IMMUNOMODULATORY COMPOUNDS
20170007692 ยท 2017-01-12
Inventors
Cpc classification
A61K38/16
HUMAN NECESSITIES
A61K39/39
HUMAN NECESSITIES
A61K2039/58
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
G01N2500/04
PHYSICS
G01N2400/00
PHYSICS
International classification
A61K39/09
HUMAN NECESSITIES
Abstract
The present invention is based on the finding that in addition to interfering with or blocking, preventing and/or inhibiting the interaction between a pathogen and, for example, a sialic acid containing cell surface receptor, certain sialic acid binding molecules have immunomodulatory properties. The invention provides methods and uses which exploit sialic acid binding molecules in the treatment and/or prevention of disease by modulation and/or priming of the host immune response.
Claims
1. A method of modulating or priming an immune response in a subject, the method comprising administering an immunomodulatory amount or quantity of a sialic acid binding molecule to a subject in need thereof.
2. The method of claim 1, wherein the sialic acid binding molecules modulate the expression, function and/or activity of one or more immunoregulatory compounds.
3. The method of claim 2, wherein the immunoregulatory compounds are chemokine(s), cytokine(s) and/or a gene/transcription factor(s) encoding and/or associated with the same.
4. The method of claim 1, wherein the immune response is a protective immune response which protects against an infection caused or contributed to by a pathogen.
5. The method of claim 4 wherein the pathogen is a viral, bacterial and/or fungal pathogen.
6. The method of claim 1, wherein the sialic acid binding molecule induces increased expression of interleukin 1- (IL1-), interleukin 8 (IL-8), interferon- (IFN-) and tumour necrosis factor- (TNF-).
7. The sialic acid binding molecule of any preceding claim, for use of any preceding method of claim 1, wherein the sialic acid binding molecule modulates the recruitment, proliferation and/or migration of immune system cells.
8. The method of claim 7, wherein the sialic acid binding molecule modulates the recruitment, proliferation and/or migration of neutrophils.
9. The method of claim 1, wherein the expression function and/or activity of one or more chemokines and/or cytokines is stimulated, enhanced or increased in the subject, and wherein the subject has or is at risk of infection by a pathogen.
10. The method of claim 1, wherein the subject is a human or animal subject.
11. The method of claim 1, wherein the subject maintains the ability to generate pathogen specific antibodies.
12. The method of claim 1, wherein during administration of the sialic acid binding molecule, there is a detectable pathogen titre.
13. The method of claim 1, wherein the sialic acid binding molecule is administered as a prophylactic treatment.
14. The method of claim 1, wherein the subject is symptomatic of an infection and the sialic acid binding molecule is administered to modulate the immune system to facilitate resolution and/or clearance of the infection.
15. The method of claim 1, wherein the sialic acid binding molecule binds N- or O-substituted neuraminic acid and synthetic, naturally occurring and/or modified forms thereof.
16. The method of claim 1, wherein the sialic acid binding molecule exhibits an affinity for -2,6-linked sialic acid and/or -2,3-linked sialic acid containing receptors.
17. The method of claim 1, wherein the sialic acid binding molecule comprises a single sialic acid binding molecule or two or more sialic acid binding molecules.
18. The method of claim 1, wherein the sialic acid binding molecule comprises one or more carbohydrate binding modules (CBM).
19. The method of claim 18, wherein the CBM comprises the sialic acid binding domain of Vibrio cholerae NanH sialidase (VcCBM) and/or the equivalent domain from Streptococcus pneumoniae NanA sialidase (SpCBM).
20. The method of claim 18, wherein the CBM comprises or consists of one or more of the sequences given as SEQ ID NOS: 1, 2, 3 or 4.
21. The method of claim 1, wherein the sialic acid binding molecule comprises: (i) one or more CBM(s); (ii) a plurality or multiple CBMs; (iii) a multivalent CBM; (iv) two or more VcCBMs; (v) two or more SpCBMs; (vi) a combination of different CBMs; or (vii) one or more VcCBMs with one or more SpCBMs.
22. The method of claim 21, wherein the immune response is protective against a bacterial, fungal and/or viral infection.
23. The method of claim 1, wherein the sialic acid binding molecule further comprises an oligomerisation domain (TD).
24. The method of claim 23, wherein the oligomerisation domain is derived from Pseudomonas aeruginosa pseudaminidase.
25. The method of claim 23, wherein the oligomerisation domain comprises a sequence given as SEQ ID NO: 5 or 6.
26. The method of claim 1, wherein the sialic acid binding molecule comprises one or more selected from the group consisting of: (i) VcCBM; (ii) Vc2CBM; (iii) Vc3CBM; (iv) VcCBMTD; (v) SpCBMTD; (vi) Vc4CBM; (vii) Vc2CBMTD; and (viii) Sp2CBMTD.
27. The method of claim 1, wherein the modulated immune response is a protective immune response and the duration of protection lasts from about 1 day to about 2, 3, 4, 5, 6, 7 or 14 days.
28. The method of claim 1, wherein the sialic acid binding molecule is prepared as a pharmaceutical formulation.
29. The method of claim 1, wherein the sialic acid binding molecule is formulated for oral, parenteral, mucosal, and/or intranasal administration.
30. The method of claim 1, wherein the sialic acid binding molecule is administered as one or more doses over a period of time.
31. The method of claim 1, wherein the sialic acid binding molecule is administered as one or more doses prior to an infection or likely infection.
32. The method of claim 1, wherein the sialic acid binding molecule is administered as one or more doses subsequent to an infection in the subject.
33. The method of claim 1, wherein the sialic acid binding molecule are administered at a dose of about 0.1, 1, 10, or 100 g of the sialic acid binding molecule/subject/day.
34. The method of claim 1, wherein the sialic acid binding molecule is administered to a mucosal tissue and/or intranasally.
35. A vaccine composition comprising one or more sialic acid binding molecules.
36. (canceled)
37. A method of treating or preventing influenza, the method comprising administering an immunomodulatory amount or quantity of a sialic acid binding molecule comprising Sp2CBMTD to a subject in need thereof.
38. (canceled)
Description
DETAILED DESCRIPTION
[0079] The present invention will now be described with reference to the following invention, which show:
[0080]
[0081]
[0082]
[0083] Survival curves are shown in top panel with corresponding weight loss curves in the bottom panel for each administration day where each value represents mean body weight s.d. for five mice.
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
EXAMPLE 1
Prevention of Influenza by Targeting Host Receptors Using Novel Engineered Proteins
[0102] Methods
[0103] Virus. For in vitro studies, the following influenza viruses were used: A/WSN/1933 (H1N1), A/Puerto Rico/8/1934 (A/PR/8/1934, H1N1), A/Udorn/1972 (H3N2), and B/Hong Kong/1973 were propagated in Madin-Darby canine kidney cells (MDCK, American Type Culture Collection, Manassas, Va.). Virus infectivity in MDCK cells was determined by plaque assay and expressed as log.sub.10PFU/ml. For in vivo studies, two strains were used: mouse-adapted A/WSN/1933 (H1N1) strain propagated in MDCK cells and mouse-adapted A/California/04/2009 (H1N1) virus.sup.30 that was grown in embryonated chicken eggs. To determine the 50% mouse lethal dose (MLD.sub.50) for A/California/04/2009 (H1N1), four female 6-week-old BALB/c mice (Jackson Laboratories, Bar Harbor, Me.) were lightly anesthetized with isofluorane and intranasally inoculated with 50 l of 10-fold serial dilutions of virus in PBS. The MLD.sub.50 value was determined after a 21-day observation period. Generation of mCBMs. Tandem-repeat multivalent protein, Vc4CBM, based on the Family 40.sup.31 sialic acid binding domain (CBM) of the nanH gene encoding the sialidase from V. cholerae, was generated using PCR-based cloning techniques as described previously.sup.8. Oligomerisation of the CBM domain from V. cholerae nanH sialidase, and from S. pneumoniae nanA sialidase, using the trimerisation domain from the pseudaminidase protein from Pseudomonas aeruginosa was engineered as follows: the DNA fragments encoding the CBM of V. cholerae sialidase residues 25-216, and that of S. pneumoniae nanA sialidase residues 121-305, respectively, were modified at the 5 and 3 termini by PCR amplification using primer pairs (Table 3) to incorporate different restriction sites to link one or two copies of the CBM unit in tandem for subsequent ligation to the gene encoding the trimerization domain from P. aeruginosa pseudaminidase residues 333-438 (PaTD). The resulting fragments were cloned either into an appropriately digested pEHISTEV vector (for VcCBM fragments) or pEGFP-HISTEV vector (for SpCBM fragments) to create constructs designated as VcCBMTD, Vc2CBMTD, SpCBMTD and Sp2CBMTD, respectively (
[0104] mCBM expression, purification and characterisation. Expression of engineered mCBMs was performed as described previously' with some modifications. Briefly, E. coli cells containing either His-tagged VcCBMs or GFP-His-tagged SpCBMs were lysed in a buffer containing PBS, 0.3M NaCl and 10 mM imidazole with DNAase (20 g/ml) and protease (minus EDTA) inhibitor tablets (Roche). Clarified lysates were applied onto a HisTrap HP column, pre-charged with nickel (GE Healthcare) before elution of histidine-tagged CBMs using PBS containing 0.3 M NaCl and 250 mM imidazole. Removal of tag, unless otherwise stated, was performed by digestion in situ with TEV protease overnight before re-applying material to the nickel column. All mCBM proteins were further purified using size exclusion chromatography with a HiPrep 16/60 Sephacryl S200HR column (GE Healthcare) in PBS before using either a Vivapure S Maxi H (VcCBMs) or Q Maxi H (SpCBMs) column (Sartorius) to remove endotoxins. GFP-tagged proteins were also subjected to affinity chromatography and size exclusion chromatography as described above. Protein yield was calculated to be between 15-70 mg/l depending on the mCBM. Proteins remained stable for several months when stored 80 C. Protein purity and size were verified by 12% SDS polyacrylamide gel electrophoresis and mass spectrometry. Purified mCBMs binding to sialic acid was verified by surface plasmon resonance (Biacore T-100, University of Edinburgh) using a streptavidin-coated biosensor chip immobilized with a multivalent, biotinylated -2,3-sialyllactose-PAA (Glycotech) (Table 1).
[0105] Glycan microarray. The glycan binding specificity of GFP-SpCBM was analyzed using Glycan slide array v4.2 (Consortium for Functional Glycomics). Preparation of GFP-SpCBM (200 g/ml) for analysis was as described previously.sup.8 but modified to allow the use of an anti-GFP antibody to enhance the fluorescence signal of binding.
[0106] Cell protection assay. For cell protection assays, confluent MDCK monolayers (in DMEM, 0.5% FCS) were incubated with mCBMs (10 mg/ml, appropriately diluted in serum-free (SF) DMEM) at 37 C. for 1 h. Monolayers were rinsed with SF-DMEM before inoculation with 100-200 PFU of influenza virus (A/WSN/1933 (H1N1), A/PR/8/1934 (H1N1), A/Udorn/1972 (H3N2), and B/Hong Kong/1973) for 1 h at 37 C. before washing. Cells were overlayed with 1.2% (w/v) Avicel (FMC Biopolymer) in 10 mM HEPES (pH 7.4) in DMEM supplemented with 2 g/ml N-acetylated trypsin. Plates were incubated at 37 C. for 2-3 days. Plaques were visualised by fixing monolayers in 4% formaldehyde and staining with 0.1% crystal violet. The EC.sub.50 values of mCBMs that protect 50% of cells from virus were calculated for each mCBM from dose-response curves.
[0107] Viral replication inhibition assay. Confluent MDCK cells (96-well format) were used to assess inhibition of influenza A virus replication by mCBMs. Cells were incubated with different mCBMs for 1 h at 37 C., before washing and adding influenza A virus (A/WSN/1933 (H1N1), A/PR/8/1934 (H1N1), A/Udorn/1972 (H3N2), MOI 0.01 PFU/cell) to monolayers for 1 h. The virus inoculum was removed and SF DMEM containing N-acetylated trypsin (2.5 g/ml) was added to cells and incubated for a further 16-24 h. Cells were fixed with 4% formaldehyde, permeabilized with PBS containing 0.5% Triton-X100 and 20 mM glycine (PBS-T) for 30 mins prior to blocking with PBS containing 1% BSA, 0.02% sodium azide (BB), for 2-3 h. Cells were rinsed before addition of goat anti-influenza A (1:500 dilution in BB, Santa Cruz) for 1-2 h at 22 C. Plates were washed before addition of donkey anti-goat IgG HRP conjugate antibody (1:500 dilution, Santa Cruz). For colour development, plates were incubated with TMB (HRP substrate, Sigma). The reaction was stopped by addition of 1M HCl. Absorbance was measured at 450 nm wavelength (620 nm as reference). EC.sub.50 values were calculated from dose-response curves to determine concentration of mCBM that inhibited 50% of viral replication compared to control wells (untreated, infected).
[0108] Cytotoxicity assay. The influence of mCBMs on the viability of mammalian epithelial cells (MDCK) during a 24 h period was evaluated using the PrestoBlue cell viability assay as described by the manufacturer (Life Technologies, Invitrogen). mCBMs (dilution of 5 mg/ml stock concentration) were added to confluent cell monolayers and incubated for 24 h at 37 C., alongside controls (DMEM only, untreated control, and 20% (w/v) sodium azide as positive control). PrestoBlue reagent was added to cells and incubated for 1 h before measuring absorbance at 570 nm wavelength (620 nm as reference). The relative absorbance of treated cells was expressed as a percentage of untreated cells plotted against mCBM concentration. The concentration of mCBM required to reduce cell viability by 50% (CC.sub.50) was determined from dose-response curves using non-linear regression curve fit with a variable slope.
[0109] Imaging studies. MDCK and human lung carcinoma (A549) cells were diluted to 310.sup.5 cells/ml in DMEM supplemented with 10% FCS before adding 100 l to each well of a 96-well black flat bottom plate (Costar) and 1.5 ml added to WillCo-dishes (3510 mm glass bottomed, WillCo Wells B.V.). Cells were incubated overnight to 90-100% confluence. Cells were rinsed three times with warmed sterile PBS and the catalytic domain (residues 319-822) of the S. pneumoniae NanA sialidase.sup.32 was added to cells at a concentration of 150 g/ml in SF-DMEM and left to incubate for 1 h at 37 C., 5% CO.sub.2 Cells were extensively rinsed with PBS prior to addition of mCBM (Vc2CBMTD 0.05 mg/ml or Sp2CBMTD 0.1 mg/ml in SF-DMEM) and further incubated for 1 h at 37 C., 5% CO.sub.2. Cells were rinsed before rabbit polyclonal anti-mCBM antibody (Eurogentec, Belgium) was added (1:1000 in DMEM-3% FCS) and incubated for 1 h at 37 C., 5% CO.sub.2. This was followed by the addition of goat anti rabbit Alexa Fluor 488 IgG (Life Technologies) at 2 g/ml in DMEM-3% FCS and incubated for a further 1 h at 37 C., 5% CO.sub.2. DAPI was then added for 30 min before a final wash of cells with PBS. Plates were read on TECAN Infinite Pro Fluorescence plate reader (using excitation and emission wavelengths of 488 nm and 518 nm). Live cells were imaged using a DeltaVision deconvolution microscope (Applied Precision) using excitation and emission wavelengths of 485 nm and 531 nm, respectively.
[0110] Mice infection studies. In vivo studies were conducted in The Roslin Institute, Edinburgh, UK and St Jude Children's Hospital, Memphis, Tenn., USA. Female BALB/c mice were purchased either from Harlan UK Ltd (5-6 weeks old) or from Jackson Laboratories (6-8 weeks old), Bar Harbor, Me., USA. In UK, studies were conducted at the animal testing facility for influenza research at the Centre for Infectious Diseases, Edinburgh, and carried out under a UK Home Office License according to the Animals (Scientific Procedures) Act 1986. Mice were anaesthetized using halothane (Rhone Merieux Ltd, Harlow, Essex, UK) before intranasally administering varying amounts of mCBM (100-500 g in PBS) either 24 h before or on the day of lethal viral challenge with either 510.sup.3 or 410.sup.4 PFU of influenza A/WSN/33 (H1N1) virus in 40 l PBS. Mice were weighed daily and assessed for visual signs of clinical disease. Animals that had lost 25% of their original body weight were euthanized by CO.sub.2 asphyxiation. On days 4 and 7 p.i., unless otherwise indicated, lungs were removed, homogenized in PBS and clarified by centrifugation. Infectious virus titres were determined by standard plaque assays on MDCK cells.
[0111] Experiments with mouse-adapted A/California/04/2009 (H1N1) influenza virus were conducted in animal biosafety level 2+ (ABSL 2+) containment approved for use by the U.S. Department of Agriculture. All studies were conducted under applicable laws and guidelines and after approval from the St. Jude Children's Research Hospital animal care and use committee. Groups of BALB/c mice (n=5) were given 50 l of mCBMs intranasally with either a single, double or triple dose of between 0.1 to 500 g/mouse unless specified otherwise. Treatment with mCBMs protein was initiated at different time points between day-7 to day+1 of viral challenge. Animals were inoculated with A/California/04/2009 (H1N1) influenza virus at a dose of 10 MLD.sub.50 per mouse. Control (infected, untreated) mice received 50 l of sterile PBS intranasally 1 h before virus inoculation. mCBM toxicity controls (uninfected, treated) were also tested. Mice were observed daily for 21 days p.i. for clinical signs of infection and survival with weight recorded throughout infection period. Virus lung titres were determined on days 3, 6 and 9 p.i. in additional groups of mice (n=3) by a tissue culture infectious dose assay (TCID.sub.50) in MDCK cells.
[0112] Cytokine analysis. Cytokine analyses of clarified mouse lung homogenates were performed using Quantikine ELISA kits according to manufacturer's instructions (RD Biosystems, UK).
[0113] Antibody analysis. Immune sera collected from survived mice 21 days p.i. were tested for both anti-viral HA antibodies and for the presence of anti-mCBM antibodies. HI assays were performed with 0.5% packed chicken red blood cells on sera that were pre-treated with receptor-destroying enzyme (RDE II, 1:10 dilution; Denka Seiken Co., Japan) and heat-inactivated at 56 C. for 30 min. A standard ELISA was employed to measure anti-CBM antibodies from infected mouse sera samples using prepared antigens (1 g/well) immobilized on 96-well plates (Corning). Sera (diluted 1:1000 in BB) were added to wells followed by goat anti-mouse IgG, IgA or IgM HRP-conjugate antibodies (1:2500 dilution), and presence of antibodies were detected using TMB as described above. To test for pre-existing immunity of sialic acid binding CBMs in the human population, human sera samples (n=50) obtained from a mixed aged population of males and females (Seralab, UK) were used. Sera were diluted 1:1000, before applying a standard ELISA to test for anti-VcCBM and anti-SpCBM antibodies using goat anti-human IgG-conjugated HRP (1:2500).
[0114] Statistical Analysis. For survival studies, the Kaplan-Meier method was used to estimate the probability of survival of untreated and treatment groups. Data plotted with error bars are expressed as meanss.d. unless otherwise indicated. Statistical significance (p<0.05) between two groups was determined using the nonparametric Mann Whitney U test. GraphPad Prism 5.0 package (GraphPad Software Inc., La Jolla, Calif.) was used for all analysis.
[0115] Summary, Results & Discussion
[0116] The influenza virus binds to sialic acid receptors present on the respiratory tract epithelium via its surface haemagglutinin (HA) glycoprotein, an event that triggers viral endocytosis.sup.12. Human influenza viruses such as the 2009 pandemic H1N1 virus recognize -2,6-linked sialic acid receptors present in the upper respiratory tract, whereas avian influenza viruses such as H5N1 predominantly recognize -2,3-linked sialic acid receptors, although such receptors are also present in the human lower respiratory tract.sup.13,14. The recently emerged human H7N9 virus is unusual in recognizing both types of receptors and therefore has the possibility of sustained human-to-human transmission and pandemic potential.sup.15,16. We hypothesized that masking such receptors in the respiratory tract with specific proteins could provide a novel therapeutic route to prevent infection. Numerous sialic acid binding proteins are known, but most have low affinity for sialic acid, such as the HA monomer that has 2.5 mM affinity for its receptor, but gains affinity through being a trimer and by being present in high copy number on the virus surface.sup.17. Mimicking nature, we engineered multivalent forms using either the sialic acid binding domain from Vibrio cholerae NanH sialidase.sup.18 (VcCBM,
[0117] The ability of the multivalent CBMs (mCBMs) to block virus infection was first tested in vitro (Table 2). Cell protection and virus replication inhibition assays using Madin-Darby canine kidney (MDCK) cells and three different influenza A viruses [A/WSN/1933 (H1N1), A/PR/8/1934 (H1N1), A/Udorn/1972 (H3N2)] and an influenza B virus (B/Hong Kong/1973) showed that the mCBMs blocked viral attachment with EC.sub.50 values ranging from 0.39 M to 4.1 M for mCBMs with valencies between 3 and 6, compared to 300 M when using the monovalent counterpart (data not shown). The mCBMs inhibited viral replication and showed no cytotoxicity at maximum feasible concentrations (Table 2). Fluorescence-imaging of mCBMs show that they bind at the cell surface and that binding was largely abrogated after cells were pre-treated with a promiscuous sialidase to remove sialic acids (
[0118] We subsequently evaluated the biologics in BALB/c mice against a lethal challenge with mouse-adapted A/California/04/2009 (H1N1) pandemic influenza virus, exploring single intranasal doses (either 10, 50, 250 or 500 g) of Vc4CBM, Vc2CBMTD or Sp2CBMTD given on day 1, 0 or +1; day 0 being the day of viral challenge, with survival studies continuing to day +21. None of the mCBMs protected mice when given 24 h after viral challenge (
[0119] One concern with using pathogen-derived biologics is the potential of immunogenicity that may reduce the effectiveness of repeat administration. SpCBM and VcCBM were chosen from human pathogens that may have evolved immunotolerance with the host, and we found no pre-existing immunity to either of the single CBM domains in the human population (
[0120] Sialic acids are widely expressed on the surface of all cells in all vertebrates, and are involved in regulating multiple cellular functions, including development of immunity.sup.21. Intrinsic and extrinsic sialic acid-recognizing proteins, often themselves multivalent, are known to mediate and modulate cellular interactions.sup.22. The original hypothesis in the biologic design was the masking of sialic acid receptors, however the remarkable protective ability of a single low dose of Sp2CBMTD given 7 days in advance of infection raises the possibility that the biologic may additionally be priming the immune system into an antiviral state. Accordingly, we explored the induction of a limited set of inflammatory cytokines/chemokines by intranasal administration of Vc2CBMTD or Sp2CBMTD in mice and found that there is a significant difference between the two biologics, with Sp2CBMTD stimulating higher levels of IL-1 p, MIP-2 (mouse homologue of IL-8), IFN- and TNF- compared to Vc2CBMTD or PBS (
[0121] There is an urgent need for new therapeutic approaches to control influenza. Significant effort is going into developing new vaccine approaches to influenza.sup.24.sup.25, new inhibitors of viral targets.sup.26 and novel strategies targeted at host factors.sup.27.sup.28. We have demonstrated that biologics targeted to the mammalian host have certain advantages that merit further exploration. Our biologics have the capacity to bind to and mask different sialic acid receptors found in the upper and lower respiratory tract and may, therefore, protect throughout the human airway if a suitable delivery system is employed. The generation of serum anti-HA antibodies observed in all treated mice suggests that as well as affording protection, the biologics allow vaccination to occur upon exposure to virus, potentially providing protection against future exposure. There are many challenges ahead in bringing these biologics to the clinic, but we believe that this new class of therapeutics has the potential to be a powerful option for the control of influenza. The biologics have a possible broader application in blocking other respiratory pathogens that utilize sialic acid in pathogenesis, including Streptococcus pneumoniae, a leading cause of secondary bacterial infection often associated with influenza and responsible for increased morbidity and mortality.sup.29.
TABLE-US-00004 TABLE 1 Kinetic parameters for the different mCBMs interacting with multivalent -2,3-sialyllactose. T k.sub.a (10.sup.6) k.sub.d (10.sup.3) mCBM ( C.) (M.sup.1 s.sup.1) (s.sup.1) K.sub.D Vc4CBM 15 0.54 0.01 0.51 0.01 0.94 25 3.56 0.02 1.60 0.01 0.45 37 2.98 0.02 5.41 0.04 1.82 VcCBMT 15 2.55 0.02 4.20 0.02 1.65 25 7.24 0.06 12.4 0.10 1.71 37 20.7 0.54 107. 2.80 5.15 Vc2CBM 15 1.83 0.01 0.33 0.01 0.18 25 1.73 0.01 0.70 0.01 0.41 37 8.45 0.05 2.07 0.01 0.24 SpCBMT 15 0.73 0.01 0.30 0.01 0.41 25 3.49 0.02 1.37 0.01 0.39 37 1.95 0.01 0.90 0.01 0.46 Sp2CBM 15 0.03 0.00 0.56 0.04 17.2 25 2.39 0.01 1.35 0.01 0.56 37 0.70 0.01 3.65 0.04 5.21 k.sub.a represents the association (on) rate constant expressed as the mean s.d. of three replicates. k.sub.d represents the dissociation (off) rate constant expressed as the mean s.d of three replicates. K.sub.D, represents the dissociation constant for each interaction between an mCBM and -2,3-sialyllactose at three different temperatures, as determined by a global fit model (assuming Langmuir binding), derived from the ratio of k.sub.a/k.sub.d.
TABLE-US-00005 TABLE 2 In vitro cell protection, virus inhibition and cell viability of the mCBMs. Cell protection EC50 (M)* Therapeutic Index (TI) A/WSN/ A/PR8/ A/Udorn/ A/WSN/ A/PR8/ A/Udorn/ mCBM H1N1 H1N1 H3N2 B/HK/73 CC50 (M) H1N1 H1N1 H3N2 B/HK/73 Vc4CBM 1.08 0.01 1.43 0.33 0.49 0.01 1.97 0.83 >58.75 >54 >41 >119 >30 VcCBMTD 1.07 0.43 2.75 0.25 0.87 0.32 3.95 0.45 >50 >46 >18 >57 >13 Vc2CBMTD 0.39 0.02 0.90 0.03 0.47 0.05 0.62 0.08 >30.5 >79 >34 >65 >49 SpCBMTD 1.11 0.01 3.80 0.03 0.82 0.09 4.10 0.10 >50 >43 >13 >61 >12 Sp2CBMTD 3.10 0.40 1.85 0.55 0.55 0.15 2.80 0.80 >30.5 >9 >16 >55 >11 Viral replication inhibition EC50(M) mCBM A/WSN/H1N1 A/PR8/H1N1 A/Udorn/H3N2 Vc4CBM 1.10 0.03 4.80 1.68 2.60 1.60 VcCBMTD 3.20 0.50 10.75 4.75 1.70 0.02 Vc2CBMTD 0.50 0.07 1.34 0.65 0.45 0.05 SpCBMTD 4.25 0.75 44.50 0.50 5.70 1.30 Sp2CBMTD 3.35 0.65 10.00 1.20 2.05 0.95 *EC.sub.50is the concentration of mCBM that provides 50% cell protection, expressed as mean s.d. from three independent determinations, CC.sub.50 values determined by the PrestoBlue cell viability assay as described in Full Methods, with > sign representing values using maximum feasible concentration. Therapeutic index is calculated from the ratio CC.sub.50/*EC.sub.50. EC.sub.50 values determined by the concentration of mCBM that inhibits 50% viral replication expressed as mean s.d. from three independent determinations.
TABLE-US-00006 TABLE3 PrimersusedforengineeringthemCBMs. Linker Features Primers sequences VcCBMTD NcoI-VcCBM-BamHI- VcCBMNcoI(F) 5 GGCTCCATGGCACTTTTTGACTATAACGC3 GGGSG PaTD-Stop-XhoI VcCBMBamHI(R) 5 GCACGGATCCACCACCGTCGCCTTGAATTTC3 PaTDBamHI(F) 5 GGCTGGATCCGGTATGGTCCCGGATTTTGAGTCA3 PaTDXhoI(R) 5 CCGACTCGAGCTAAATCCATGCTCTGACCCG3 Vc2CBMTD NcoI-VcCBM-BamHI- VcCBMNcoI(F) 5 GGCTCCATGGCACTTTTTGACTATAACGC3 GGGSG VcCBM-HindIII- VcCBMBamHI(R) 5 GCACGGATCCACCACCGTCGCCTTGAATTTC3 and PaTD-Stop-XhoI VcCBMBamHI(F) 5 GGCTGGATCCGGTGCACTTTTTGACTATAAC3 GQALG VcCBMHindIII(R) 5 GTCCCAAAGCTTGACCGTCGCCTTGAATTTC3 PaTDHindIII(F) 5 CTGCAAGCTTTGGGAGTCCCGGATTTTGAGTCAG3 PaTDXhoI(R) 5 CCGACTCGAGCTAAATCCATGCTCTGACCCG3 SpCBMTD NcoI-SpCBM-BamHI- SpCBMNcoI(F) 5 GGCTCCATGGTGATAGAAAAAGAAGATG3 GGGSG PaTD-Stop-XhoI SpCBMBamHI(R) 5 ACCGGATCCACCACCACTACGTTTTTGTACCTC3 PaTDBamHI(F) 5 GGCTGGATCCGGTATGGTCCCGGATTTTGAGTCA3 PaTDXhoI(R) 5 CCGACTCGAGCTAAATCCATGCTCTGACCCG3 Sp2CBMTD NcoI-SpCBM-BamHI- SpCBMNcoI(F) 5 GGCTCCATGGTGATAGAAAAAGAAGATG3 GGGSG SpCBM-HindIII- SpCBMBamHI(R) 5 ACCGGATCCACCACCACTACGTTTTTGTACCTC3 and PaTD-Stop-XhoI SpCBMBamHI(F) 5 GGCTGGATCCGGTGTGATAGAAAAAGAAGATG3 GQALG SpCBMHindIII(R) 5 TCCCAAAGCTTGACCACTACGTTTTTGTGCCTC3 PaTDHindIII(F) 5 CTGCAAGCTTTGGGAGTCCCGGATTTTGAGTCAG3 PaTDXhoI(R) 5 CCGACTCGAGCTAAATCCATGCTCTGACCCG3 GFP-Sp2CBMTD* GFP-NcoI-SpCBM- AsforSp2CBMTD BamHI-SpCBM- HindIII-PaTD- Stop-XhoI *SpCBM gene fused in-frame with GFP gene using pEHISTEV-GFP vector as described in Full Methods. Restriction enzyme sites in primers are highlighted in bold.
REFERENCES FOR EXAMPLE 1
[0122] 1. Salomon, R. & Webster, R. G. The influenza virus enigma. Cell 136, 402-410 (2009).
[0123] 2. Gao, R. et al. Human infection with a novel avian-origin influenza A (H7N9) virus. N. Engl. J. Med. 368, 1888-1897 (2013).
[0124] 3. Imai, M. et al. Experimental adaptation of an influenza H5 HA confers respiratory droplet transmission to a reassortant H5 HA/H1N1 virus in ferrets. Nature 486, 420-428 (2012).
[0125] 4. Herfst, S. et al. Airborne transmission of influenza A/H5N1 virus between ferrets. Science 336, 1534-1541 (2012).
[0126] 5. Russell, C. A. et al. The potential for respiratory droplet-transmissible A/H5N1 influenza virus to evolve in a mammalian host. Science 336, 1541-1547 (2012).
[0127] 6. Hu, Y. et al. Association between adverse clinical outcome in human disease caused by novel influenza A H7N9 virus and sustained viral shedding and emergence of antiviral resistance. Lancet 381, 2273-2279 (2013).
[0128] 7. Baz, M. et al. Emergence of oseltamivir-resistant pandemic H1N1 virus during prophylaxis. N. Engl. J. Med. 361, 2296-2297 (2009).
[0129] 8. Connaris, H., Crocker, P. R. & Taylor, G. L. Enhancing the receptor affinity of the sialic acid-binding domain of Vibrio cholerae sialidase through multivalency. J. Biol. Chem. 284, 7339-7351 (2009).
[0130] 9. Suzuki, T. et al. Receptor specificities of human respiroviruses. J. Virol. 75, 4604-4613 (2001).
[0131] 10. Schwegmann-Wessels, C. & Herrler, G. Sialic acids as receptor determinants for coronaviruses. Glycoconj. J. 23, 51-58 (2006).
[0132] 11. Trappetti, C. et al. Sialic acid: a preventable signal for pneumococcal biofilm formation, colonization, and invasion of the host. J. Infect. Dis. 199, 1497-1505 (2009).
[0133] 12. Skehel, J. J. & Wiley, D. C. Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Ann. Rev. Biochem. 69, 531-569 (2000).
[0134] 13. Shinya, K. et al. Avian flu: influenza virus receptors in the human airway. Nature 440, 435-436 (2006).
[0135] 14. Walther, T. et al. Glycomic analysis of human respiratory tract tissues and correlation with influenza virus infection. PLoS pathogens 9, e1003223 (2013).
[0136] 15. Xiong, X. et al. Receptor binding by an H7N9 influenza virus from humans. Nature 499, 496-499 (2013).
[0137] 16. Zhou, J. et al. Biological features of novel avian influenza A (H7N9) virus. Nature 499, 500-503 (2013).
[0138] 17. Mammen, M., Choi, S. K. & Whitesides, G. M. Polyvalent interactions in biological systems: Implications for design and use of multivalent ligands and inhibitors. Angew. Chem. Int. Ed. 37, 2755-2794 (1998).
[0139] 18. Moustafa, I. et al. Sialic acid recognition by Vibrio cholerae neuraminidase. J. Biol. Chem. 279, 40819-40826 (2004).
[0140] 19. Xu, G., Ryan, C., Kiefel, M. J., Wilson, J. C. & Taylor, G. L. Structural studies on the Pseudomonas aeruginosa sialidase-like enzyme PA2794 suggest substrate and mechanistic variations. J. Mol. Biol. 386, 828-840 (2009).
[0141] 20. Cantor, J. R. et al. Therapeutic enzyme deimmunization by combinatorial T-cell epitope removal using neutral drift. Proc. Natl. Acad. Sci. USA 108, 1272-1277 (2011).
[0142] 21. Varki, A. & Gagneux, P. Multifarious roles of sialic acids in immunity. Ann. New York Acad. Sci. 1253, 16-36 (2012).
[0143] 22. Varki, A. Glycan-based interactions involving vertebrate sialic-acid-recognizing proteins. Nature 446, 1023-1029 (2007).
[0144] 23. Banerjee, A. et al. Activation of brain endothelium by pneumococcal neuraminidase NanA promotes bacterial internalization. Cell. Microbiol. 12, 1576-1588 (2010).
[0145] 24. Ekiert, D. C. & Wilson, I. A. Broadly neutralizing antibodies against influenza virus and prospects for universal therapies. Curr. Opin. Virology. 2, 134-141 (2012).
[0146] 25. Osterhaus, A., Fouchier, R. & Rimmelzwaan, G. Towards universal influenza vaccines? Phil. Trans. Roy. Soc. B 366, 2766-2773 (2011).
[0147] 26. Boltz, D. A., Aldridge, J. R., Jr., Webster, R. G. & Govorkova, E. A. Drugs in development for influenza. Drugs 70, 1349-1362 (2010).
[0148] 27. Ludwig, S. Disruption of virus-host cell interactions and cell signaling pathways as an anti-viral approach against influenza virus infections. Biol. Chem. 392, 837-847 (2011).
[0149] 28. Moss, R. B. et al. A phase II study of DAS181, a novel host directed antiviral for the treatment of influenza infection. J. Infect. Dis. 206, 1844-1851 (2012).
[0150] 29. Morens, D. M., Taubenberger, J. K. & Fauci, A. S. Predominant role of bacterial pneumonia as a cause of death in pandemic influenza: implications for pandemic influenza preparedness. J. Infect. Dis. 198, 962-970 (2008).
[0151] 30. Ilyushina, N. A. et al. Adaptation of pandemic H1N1 influenza viruses in mice. J. Virol. 84, 8607-8616 (2010).
[0152] 31. Cantarel, B. L. et al. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for Glycogenomics. Nuc. Acids Res. 37, D233-238 (2009).
[0153] 32. Xu, G., Li, X., Andrew, P. W. & Taylor, G. L. Structure of the catalytic domain of Streptococcus pneumoniae sialidase NanA. Acta Cryst. F64, 772-775 (2008).
EXAMPLE 2
Prophylactic Effects of Engineered Proteins Vc2CBMTD and Sp2CBMTD on Mice Infected With Murine Gammaherpesvirus 68 (MHV-68).
[0154] Introduction
[0155] Murine gammaherpesvirus 68 (MHV-68) is a naturally occurring rodent respiratory pathogen.sup.1 that is closely related to the Kaposi's Sarcoma-associated herpesvirus (KSHV) and the Epstein-Barr virus (EBV) that infect humans .sup.2. Gammaherpesviruses display a number of surface proteins, glycoprotein H (gH) and glycoprotein L (gL) and glycoprotein 150 (gp150) on their envelopes that are involved in the cell-to-cell transmission of the virus. Like EBV, MHV-68 is associated with lymphoproliferative disease.sup.3, which can occur many months after infection. However, unlike EBV and many other gammaherpesviruses, MHV-68 replicates in epithelial cells in vitro and infects laboratory strains of mice and therefore provides a good model for the study of gammaherpesviruses.sup.4. As for treatment, antiviral agents are normally suggested for the treatment of most herpesvirus infections. Intranasal administration of MHV-68 in mice results in acute productive infection of lung alveolar epithelial cells and a persistent latent infection in B lymphocytes, the spleen being a major reservoir of latent virus.sup.5,6. Infectious virus can also be recovered from the lungs of BALB/c mice for 10 to 13 days after infection.sup.s. Analysis of the inflammatory cytokine response to MHV-68 from BAL fluid after intranasal infection of C57BL/6J mice with MHV-68, show high levels of IL-6 and IFN- and lower levels of IL-2 and IL-10 with cytokine production peaking around 10 days after infection, correlating with viral clearance from the lung, although significant levels are seen as early as 3 days after administration of the virus. In contrast, negligible levels of IL-4 or IL-5 are detected. Furthermore, purified immune T cells also produce IL-6, IL-10, and IFN- following in vitro re-stimulation with MHV-68, suggesting the virus induces components of both the acquired and the innate host response.sup.1.
[0156] Recent evidence in our laboratory using engineered sialic acid binding proteins as biologics against respiratory pathogens has shown that when these are intranasally administered in mice using a single low dose (1 g) up to 7 days in advance, complete protection is observed against lethal influenza A/California/04/2009 (H1N1) virus challenge (unpublished data). The biologics are based on carbohydrate-binding modules isolated from V. cholerae (Vc) and S. pneumoniae (Sp) sialidase enzymes and engineered as multivalent entities (mCBMs) using either a tandem repeat or an oligomerisation domain approach. As these engineered proteins have been shown to protect the host when given many days in advance at a low dose, it is thought that these proteins not only block the attachment of influenza viruses from binding to cell surface sialic acid but can also potentially prime the immune system, to allow an antiviral response against the virus via an immunomodulatory effect. Preliminary studies using mCBMs in BALB/c mice showed that when administered intranasally as a single dose in absence of an infection, an immunostimulatory effect was observed, demonstrating an ability to enhance the production of a limited set of cytokines/chemokines such as MIP-2, TNF-, IL-6, and IL-1 after 2 days (unpublished data).
[0157] Here we show preliminary data of the effect of engineered mCBMs in MHV-68 infected BALB/c mice on virus titre and cytokine levels. The reduction in virus titres and specific cytokine levels in infected mice demonstrate that mCBMs have the potential to affect the infection process by other respiratory pathogens that do not rely on sialic acid binding to initiate infection in mammals.
[0158] Methods
[0159] In vivo studies. Mouse studies were conducted at the animal testing facility for influenza research at the Centre for Infectious Diseases, Edinburgh, and carried out under a UK Home Office License according to the Animals (Scientific Procedures) Act 1986. Mice were anaesthetized using halothane (Rhone Merieux Ltd, Harlow, Essex, UK) before intranasally administering 50 g of either Vc2CBMTD or Sp2CBMTD given three times on Day 7, Day 3 and Day 1 before challenge with 410.sup.5 MHV68 in 40 l of PBS. On day 5 post infection, mice were culled and their lungs harvested post mortem for virus titre determination and cytokine analysis.
[0160] Virus titres. Infectious virus titres were determined by standard plaque assays on MDCK cells. Lung virus titres in mice determined 5 days p.i.
[0161] Cytokine analysis. Cytokine analyses of MIP-2, TNF-, IL-6, IL-1, IFN-, GM-CSF and IL-2 from clarified mouse lung homogenates were performed using Quantikine ELISA kits according to manufacturer's instructions (RD Biosystems, UK).
[0162] Statistical Analysis. Data plotted with error bars are expressed as meanss.d. unless otherwise indicated. Statistical significance (p<0.05) between two groups was determined using the nonparametric Mann Whitney U test. GraphPad Prism 5.0 package (GraphPad Software Inc., La Jolla, Calif.) was used for all analysis.
[0163] Results and Discussion
[0164] We explored the effect of hexameric mCBMs, Vc2CBMTD and Sp2CBMTD on the lung viral load and immune response in BALB/c mice when challenged with a non-sialic acid binding respiratory pathogen, MHV-68 virus. Biologics were administered intranasally as a triple dose (50 ug, Day 7, 3, 1) prior to viral challenge. All treated mice demonstrated a one-logarithm reduction in lung virus titres 5 days p.i. compared to untreated, infected mice (
REFERENCES FOR EXAMPLE 2
[0165] 1 Sarawar, S. R. et al. Cytokine production in the immune response to murine gammaherpesvirus 68. J Virol 70, 3264-3268 (1996).
[0166] 2 Efstathiou, S. et al. Murine herpesvirus 68 is genetically related to the gammaherpesviruses Epstein-Barr virus and herpesvirus saimiri. J Gen Virol 71 (Pt 6), 1365-1372 (1990).
[0167] 3 Sunil-Chandra, N. P., Arno, J., Fazakerley, J. & Nash, A. A. Lymphoproliferative disease in mice infected with murine gammaherpesvirus 68. Am J Pathol 145, 818-826 (1994).
[0168] 4 Stewart, J. P. et al. Identification and characterization of murine gammaherpesvirus 68 gp150: a virion membrane glycoprotein. J Virol 70, 3528-3535 (1996).
[0169] 5 Sunil-Chandra, N. P., Efstathiou, S. & Nash, A. A. Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J Gen Virol 73 (Pt 12), 3275-3279 (1992).
[0170] 6 Sunil-Chandra, N. P., Efstathiou, S., Arno, J. & Nash, A. A. Virological and pathological features of mice infected with murine gamma-herpesvirus 68. J Gen Virol 73 (Pt 9), 2347-2356 (1992).
EXAMPLE 3
Carbohydrate-Binding Modules Against H7N9 Influenza Virus Infection: Efficacy in Preclinical Studies. Effect of Hexameric Form of Carboxydrate-Binding Module (Sp2CBMTD) Against A/Anhui/1/2013 (H7N9) Influenza Virus Infection in BALB/c Mice
[0171] Materials and Methods
[0172] Virus. Influenza A/Anhui/1/2013 (H7N9) virus was obtained through the World Health Organization surveillance network. A/Anhui/1/2013 (H7N9) virus was isolated from a patient by culturing clinical sample in the allantoic cavity of 10-days old embryonated chicken eggs (eggs), and the stock of virus used in the experiments was prepared in eggs (passage history: E2/E2). The mouse lethal dose that killed 50% of animals (MLD.sub.50) was determined in 6-week-old female BALB/c mice after 21 days (weight, 18-20 g; Jackson Laboratories, Bar Harbor, Me.). Animals that showed severe disease and lost >25% of initial weight were euthanized.
[0173] Experiments with human H7N9 influenza virus were conducted in an animal biosafety level 3+ containment facility approved by the U.S. Department of Agriculture. All studies were conducted under applicable laws and guidelines and after approval from the St. Jude Children's Research Hospital animal care and use committee.
[0174] Compound. Hexameric form of Carbohydrate-Binding Module (Sp2CBMTD) was provided in PBS at concentration of 10.5 mg/ml by Dr. Helen Connaris (Centre for Biomolecular Sciences, University of St. Andrews, UK). The 6CBM (Sp2CBMTD) protein was stored at 80 C. until use. To assess the efficacy of the 6CBM (Sp2CBMTD) protein in a mouse animal model, the protein sample was centrifuged for 5 mins at 13K rpm, transferred into a new vial and dissolved in sterile PBS to a desired concentration.
[0175] SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Protein stability was confirmed by determination of electrophoretic mobility of Sp2CBMTD protein (10 l/channel at concentrations 5.25-0.66 g/channel dissolved in PBS) under reducing conditions in 12% SDS-PAGE (BioRad laboratories, Hercules, Calif.). The main protein band was identified at 50 kDa, and some additional minor bands (
[0176] Efficacy of Sp2CBMTD on lethal infection with A/Anhui/1/2013 (H7N9) influenza virus in mice. Female 6- to 8-week-old BALB/c mice (weight, 18 to 20 g; Jackson Laboratories, Bar Harbor, Me.) were lightly anesthetized by inhalation of isofluorane and inoculated intranasally with 50 l of infectious H7N9 virus. Overall, 32 groups of BALB/c mice (5 mice per group) were used in this experiment (Table 1a). BALB/c mice were given 50 l of Sp2CBMTD intranasally at different regimens. Single dose (0.1, 1, 10, and 100 g/mouse/day) of Sp2CBMTD protein was administered either 7 days before H7N9 virus challenge (Day 7: groups 1-4), 3 days before H7N9 virus challenge (Day 3: groups 5-8), 1 day before H7N9 virus challenge (Day 1: groups 9-12), 6 hours after H7N9 virus challenge (+6 hr: groups 13-16), 24 hours after H7N9 virus challenge (Day +1: groups 17-20). Repeated administration of Sp2CBMTD protein was conducted as two doses administered on days 3 and 1 before H7N9 virus challenge (Day 3, 1: groups 21-24) or as three doses administered on days 7, 3 and 1 before virus challenge (Day 7, 3, 1: groups 25-28). As a toxicity control Sp2CBMTD protein was administered at a dose of 100 g/mouse/day at three regimens (Toxicity: groups 29-31). Animals were inoculated with A/Anhui/1/2013 (H7N9) influenza virus at a dose of 5 MLD.sub.50 per mouse. Control (infected untreated) mice received 50 l of sterile PBS intranasally 1 hour before virus inoculation. BALB/c mice were observed daily for 21 days p.i. for clinical signs of infection and for survival. The mean day to death was calculated by using the log-hazard scale. The mice were weighed on days 0, 2, 4, 6, 8, 10, 12, 14, 19 and 21 p.i., and the loss or gain of weight was calculated for each mouse as a percentage of its weight on day 0 before virus inoculation.
[0177] Anti-HA antibody response. Serum samples were collected from survived mice 21 days p.i., treated with 1:10 diluted receptor-destroying enzyme (Denka Seiken Co., Japan) overnight at 37 C., heat-inactivated at 56 C. for 30 min, diluted 1:10 with sterile PBS, and tested by hemagglutination inhibition (HI) assay with 0.5% packed chicken red blood cells (CRBC).
[0178] Re-infection with a higher H7N9 virus dose. All animals that survived lethal infection with A/Anhui/1/2013 (H7N9) influenza virus were re-infected with 25 MLD.sub.50 of virus on day 21 p.i. The mice were observed daily for clinical signs of infection and survival and weight changes were monitored on designated days.
[0179] Results
[0180] Efficacy of Sp2CBMTD protein on survival of BALB/c mice lethally challenged with A/Anhui/1/2013 (H7N9) influenza virus. We evaluated the effect of a single or repeated administration of Sp2CBMTD protein on the survival and clinical signs of mice lethally challenged with A/Anhui/1/2013 (H7N9) influenza virus (Table 2a). Sp2CBMTD did not cause any weight changes and death of uninfected mice when administered as a single dose, 2 and 3 doses (100 gg/mouse/day). We concluded that Sp2CBMTD is nontoxic for mice at a highest dose used in these experiments.
[0181] Untreated H7N9 virus-inoculated control mice exhibited progressive weight loss with a mean day to death of 7.81.1 (Table 2a and
[0182] To assess the effect of a single Sp2CBMTD dose when administered after lethal challenge with A/Anhui/1/2013 (H7N9), we initiated treatments either 6 hours or 24 hours after virus inoculation (
[0183] To assess the efficacy of repeated dosing with Sp2CBMTD against lethal challenge of mice with A/Anhui/1/2013 (H7N9) virus, two doses of protein were administered D-3, 1, and three doses were administered on D-7,3, 1 (
[0184] Efficacy of Sp2CBMTD protein on weight changes of BALB/c mice lethally challenged with A/Anhui/1/2013 (H7N9) influenza virus. Weight changes were little or absent when the highest Sp2CBMTD dose of 100 g/mouse/day was administered to the animals. On the other hand, the dose of 0.1 g/mouse/day provided minimal effect on the weight loss and animals treated with this dose experienced the most pronounced weight loss (Table 3a). Timing of Sp2CBMTD administration is critical for providing the most beneficial effect on survival and weight loss. When treatment with Sp2CBMTD protein was initiated 24 hours after virus inoculation, the animals exhibited the most pronounced weight changes. Overall, observed weight changes correlated with survival outcome observed after H7N9 infections.
[0185] To serologically confirm infection of mice with A/Anhui/1/2013 (H7N9) influenza virus and to compare the effect of the Sp2CBMTD protein regimens on production of anti-HA antibodies, we collected serum 21 days p.i. for HI assay. Anti-HA antibodies to homologous A/Anhui/1/2013 (H7N9) influenza virus were observed in all surviving mice with reciprocal HI titers ranging between 40-80 (Table 4a).
[0186] Re-infection of survived mice with a higher dose of H7N9 virus. Animals were completely protected from re-infection with 25 MLD.sub.50 of H7N9 virus; they showed no disease signs and none died (Table 5a).
CONCLUSIONS
[0187] Repeated administration of Sp2CBMTD before lethal challenge with A/Anhui/1/2013 (H7N9) influenza virus provided the most beneficial results and resulted in 100% survival of BALB/c mice even at the lowest dose used (0.1 g/mouse/day). This indicates a possibility for the reduction in dosages used.
[0188] Time of administration is associated with the efficacy of Sp2CBMTD protein treatment in a lethal mouse model: complete protection (100% survival rates) was achieved when protein was administered before A/Anhui/1/2013 (H7N9) influenza virus inoculation.
[0189] The Sp2CBMTD dose-dependent effect was observed in a H7N9 lethal mouse model, thus indicating the specificity of this protein against influenza virus.
[0190] Administration of Sp2CBMTD did not affect development of anti-HA antibodies, and the level of immune response was sufficient to protect against H7N9 virus re-infection.
TABLE-US-00007 TABLE 1a Design of the studies to assess the effect of Sp2CBMTD against A/Anhui/1/2013 (H7N9) influenza virus infection in BALB/c mice. Dosage of Sp2CBMTD (g/mouse/ Schedule of drug Initiation of Group day) administration treatments 1 0.1 Single administration 7 days before virus (intranasaly) 7 Day p.i. inoculation 2 1 Single administration 7 days before virus (intranasaly) 7 Day p.i. inoculation 3 10 Single administration 7 days before virus (intranasaly) 7 Day p.i. inoculation 4 100 Single administration 7 days before virus (intranasaly) 7 Day p.i. inoculation 5 0.1 Single administration 3 days before virus (intranasaly) 3 Day p.i. inoculation 6 1 Single administration 3 days before virus (intranasaly) 3 Day p.i. inoculation 7 10 Single administration 3 days before virus (intranasaly) 3 Day p.i. inoculation 8 100 Single administration 3 days before virus (intranasaly) 3 Day p.i. inoculation 9 0.1 Single administration 1 day before virus (intranasaly) 1 Day p.i. inoculation 10 1 Single administration 1 day before virus (intranasaly) 1 Day p.i. inoculation 11 10 Single administration 1 day before virus (intranasaly) 1 Day p.i. inoculation 12 100 Single administration 1 day before virus (intranasaly) 1 Day p.i. inoculation 13 0.1 Single administration 6 hrs after virus (intranasaly) +6 hr p.i.. inoculation 14 1 Single administration 6 hrs after virus (intranasaly) +6 hr p.i.. inoculation 15 10 Single administration 6 hrs after virus (intranasaly) +6 hr p.i.. inoculation 16 100 Single administration 6 hrs after virus (intranasaly) +6 hr p.i.. inoculation 17 0.1 Single administration 24 hrs after virus (intranasaly) +24 hr p.i. inoculation 18 1 Single administration 24 hrs after virus (intranasaly) +24 hr p.i. inoculation 19 10 Single administration 24 hrs after virus (intranasaly) +24 hr p.i. inoculation 20 100 Single administration 24 hrs after virus (intranasaly) +24 hr p.i. inoculation 21 0.1 x2 administration 3 and 1 days before (intranasaly) 3 virus inoculation and 1 Days p.i. 22 1 x2 administration 3 and 1 days before (intranasaly) 3 virus inoculation and 1 Days p.i. 23 10 x2 administration 3 and 1 days before (intranasaly) 3 virus inoculation and 1 Days p.i. 24 100 x2 administration 3 and 1 days before (intranasaly) 3 virus inoculation and 1 Days p.i. 25 0.1 x3 administration 7, 3 and 1 days (intranasaly) 7, 3 before virus and 1 Days p.i. inoculation 26 1 x3 administration 7, 3 and 1 days (intranasaly) 7, 3 before virus and 1 Days p.i. inoculation 27 10 x3 administration 7, 3 and 1 days (intranasaly) 7, 3 before virus and 1 Days p.i. inoculation 28 100 x3 administration 7, 3 and 1 days (intranasaly) 7, 3 before virus and 1 Days p.i. inoculation 29 100 (Tox- Single administration Toxicity control icity) (intranasaly) 7 Day p.i. 30 100 (Tox- x2 administration Toxicity control icity) (intranasaly) 7 and 1 Days p.i. 31 100 (Tox- x3 administration Toxicity control icity) (intranasaly) 7, 3 and 1 Days p.i. 32 Control (PBS) Day 0 p.i.
TABLE-US-00008 TABLE 2a Efficacy of Sp2CBMTD protein on survival of BALB/c mice lethally challenged with A/Anhui/1/2013 (H7N9) influenza virus. Dosage of Schedule of drug No. of Sp2CBMTD administration survivors/ Mean (g/mouse/ (intranasal total no. day to Group day) administration) of mice (%) death 1 0.1 Day 7 1/5 (20) 10.4 5.5 2 1 Day 7 1/5 (20) 11.2 4.9 3 10 Day 7 4/5 (80) 17.8 4.9 4 100 Day 7 5/5 (100) >21 5 0.1 Day 3 1/5 (20) 11.2 4.9 6 1 Day 3 5/5 (100) >21 7 10 Day 3 5/5 (100) >21 8 100 Day 3 5/5 (100) >21 9 0.1 Day 1 1/5 (20) 11.2 4.9 10 1 Day 1 2/5 (40) 13.4 6.0 11 10 Day 1 5/5 (100) >21 12 100 Day 1 5/5 (100) >21 13 0.1 +6 hr p.i. 0/5 (0) 7.8 1.1 14 1 +6 hr p.i. 4/5 (80) 17.4 5.5 15 10 +6 hr p.i. 5/5 (100) >21 16 100 +6 hr p.i. 5/5 (100) >21 17 0.1 Day +1 0/5 (0) 7.0 0.0 18 1 Day +1 0/5 (0) 7.0 0.0 19 10 Day +1 1/5 (20) 9.6 5.8 20 100 Day +1 2/5 (40) 12.2 7.1 21 0.1 2x (Day 3, 1) 5/5 (100) >21 22 1 2x (Day 3, 1) 5/5 (100) >21 23 10 2x (Day 3, 1) 5/5 (100) >21 24 100 2x (Day 3, 1) 5/5 (100) >21 25 0.1 3x (Day 7, 3, 1) 5/5 (100) >21 26 1 3x (Day 7, 3, 1) 5/5 (100) >21 27 10 3x (Day 7, 3, 1) 5/5 (100) >21 28 100 3x (Day 7, 3, 1) 5/5 (100) >21 29 100 (Tox- Day 7 5/5 (100) >21 icity) 30 100 (Tox- 2x (Day 3, 1) 5/5 (100) >21 icity) 31 100 (Tox- 3x (Day 7, 3, 1) 5/5 (100) >21 icity) 32 Control Control 0/5 (0) 7.8 1.1
TABLE-US-00009 TABLE 3a Efficacy of Sp2CBMTD protein on weight changes of BALB/c mice lethally challenged with A/Anhui/1/2013 (H7N9) influenza virus. Schedule of drug Dosage of administration Mean weight change Sp2CBMTD (intranasal (%) on day post virus inoculation.sup.a Group (g/mouse/d) administration) 2 p.i. 4 p.i. 6 p.i. 8 p.i. 10 p.i. 12 p.i. 1 0.1 Day 7 1.6 7.9 13.0 20.7 17.0 0.8 2 1 Day 7 0.7 6.6 10.0 22.0 24.6 8.6 3 10 Day 7 0.02 3.3 8.4 16.5 12.2 3.6 4 100 Day 7 0.5 1.2 3.5 6.6 1.2 1.8 5 0.1 Day 3 1.5 4.1 7.6 17.1 21.2 7.1 6 1 Day 3 0.6 2.7 6.0 12.3 7.1 2.9 7 10 Day 3 1.2 0.1 1.6 5.6 0.1 0.5 8 100 Day 3 1.4 0.7 2.0 0.7 3.4 4.4 9 0.1 Day 1 3.4 6.6 13.0 19.6 24.9 0.4 10 1 Day 1 2.4 4.6 11.1 22.1 21.5 1.7 11 10 Day 1 0.3 0.5 5.8 7.8 1.8 0.1 12 100 Day 1 2.8 4.6 3.0 5.3 8.12 7.5 13 0.1 +6 hr p.i. 0.1 6.1 12.0 25.4 27.0 N/A 14 1 +6 hr p.i. 1.0 3.3 10.1 18.4 8.6 3.4 15 10 +6 hr p.i. 0.7 2.1 5.6 10.0 4.4 0.8 16 100 +6 hr p.i. 5.1 3.4 2.7 3.1 2.4 2.4 17 0.1 Day +1 0.7 15.4 23.6 31.6 N/A N/A 18 1 Day +1 1.2 16.4 25.0 32.6 N/A N/A 19 10 Day +1 2.5 13.0 19.4 26.6 17.2 11.2 20 100 Day +1 4.8 14.1 18.2 23.9 13.3 10.3 21 0.1 2x (Day3, 1) 1.5 3.3 6.6 17.0 12.9 7.4 22 1 2x (Day3, 1) 1.6 0 2.6 8.1 1.5 3.8 23 10 2x (Day3, 1) 2.0 1.1 0.4 1.5 3.0 4.7 24 100 2x (Day3, 1) 2.3 5.0 3.6 4.5 7.1 7.9 25 0.1 3x (Day7, 3, 1) 0 2.7 5.8 15.2 7.8 1.6 26 1 3x (Day7, 3, 1) 0.9 3.0 5.5 10.3 3.0 1.4 27 10 3x (Day7, 3, 1) 1.1 1.1 2.0 0.4 3.8 4.3 28 100 3x (Day7, 3, 1) 3.8 6.0 5.1 5.5 10.0 10.7 29 100 (Toxicity) Day 7 2.7 8.5 10.0 9.6 10.5 12.1 30 100 (Toxicity) 2x (Day3, 1) 3.2 7.2 9.2 8.6 9.7 12.3 31 100 (Toxicity) 3x (Day7, 3, 1) 5.5 8.9 11.2 10.2 11.3 13.4 32 Control Control 0.5 6.8 11.9 24.7 35.7 N/A .sup.aLoss or gain of weight was calculated for each mouse as a percentage of weight on day 0 before A/Anhui/1/2013 (H7N9) influenza virus inoculation. N/A - data is not available due to deceased mice.
TABLE-US-00010 TABLE 4a Serum antibody responses in BALB/c mice lethally challenged with A/Anhui/1/2013 (H7N9) influenza virus and treated with Sp2CBMTD protein. Dosage of Schedule of drug Anti-HA antibody titers Sp2CBMTD administration in mouse sera .sup.a (g/mouse/ (intranasal Geometric Group day) administration) Range mean 1 0.1 Day 7 80-80 80 2 1 Day 7 40-80 50 3 10 Day 7 40-80 57 4 100 Day 7 40-40 40 5 0.1 Day 3 40-40 40 6 1 Day 3 40-40 40 7 10 Day 3 40-80 46 8 100 Day 3 40-40 40 9 0.1 Day 1 80-80 80 10 1 Day 1 40-80 50 11 10 Day 1 40-40 40 12 100 Day 1 40-40 40 13 0.10 +6 hr p.i. N/A N/A 14 1 +6 hr p.i. 40-80 53 15 10 +6 hr p.i. 40-40 40 16 100 +6 hr p.i. 40-80 53 17 0.1 Day +1 N/A N/A 18 1 Day +1 N/A N/A 19 10 Day +1 40-40 40 20 100 Day +1 40-80 50 21 0.1 2x (Day 3, 1) 40-80 46 22 1 2x (Day 3, 1) 40-40 40 23 10 2x (Day 3, 1) 40-40 40 24 100 2x (Day 3, 1) 40-80 46 25 0.1 3x (Day 7, 3, 1) 40-80 53 26 1 3x (Day 7, 3, 1) 40-40 40 27 10 3x (Day 7, 3, 1) 40-40 40 28 100 3x (Day 7, 3, 1) 40-40 40 31 Control Control N/A N/A .sup.a Sera samples were collected from all survived animal 21 day p.i. The titers are determined against homologous A/Anhui/1/2013 (H7N9) influenza virus with 0.5% CRBC and expressed as the reciprocal value (e.g., 640 vs. 1:640). N/Adata is not available due to deceased mice.
TABLE-US-00011 TABLE 5a Efficacy of Sp2CBMTD protein on survival of BALB/c mice re-infected with 25 MLD.sub.50 of A/Anhui/1/2013 (H7N9) influenza virus. Dosage of Schedule of drug No. of Sp2CBMTD administration survivors/ (g/mouse/ (intranasal total no. Mean day Group day) administration) of mice to death 1 0.1 Day 7 1/1 >21 2 1 Day 7 1/1 >21 3 10 Day 7 4/4 >21 4 100 Day 7 5/5 >21 5 0.1 Day 3 1/1 >21 6 1 Day 3 5/5 >21 7 10 Day 3 5/5 >21 8 100 Day 3 5/5 >21 9 0.1 Day 1 1/1 >21 10 1 Day 1 2/2 >21 11 10 Day 1 5/5 >21 12 100 Day 1 5/5 >21 13 0.1 +6 hr p.i. N/A N/A 14 1 +6 hr p.i. 4/4 >21 15 10 +6 hr p.i. 5/5 >21 16 100 +6 hr p.i. 5/5 >21 17 0.1 Day +1 N/A N/A 18 1 Day +1 N/A N/A 19 10 Day +1 1/1 >21 20 100 Day +1 2/2 >21 21 0.1 2x (Day 3, 1) 5/5 >21 22 1 2x (Day 3, 1) 5/5 >21 23 10 2x (Day 3, 1) 5/5 >21 24 100 2x (Day 3, 1) 5/5 >21 25 0.1 3x (Day 7, 3, 1) 5/5 >21 26 1 3x (Day 7, 3, 1) 5/5 >21 27 10 3x (Day 7, 3, 1) 5/5 >21 28 100 3x (Day 7, 3, 1) 5/5 >21 29 100 (Tox- Day 7 0/5 (0) 8.0 0.0 icity) 30 100 (Tox- 2x (Day 3, 1) 0/5 (0) 8.0 0.0 icity) 31 100 (Tox- 3x (Day 7, 3, 1) 0/5 (0) 8.0 0.0 icity) 32 Control Control N/A N/A Note: Toxicity groups were infected with 5 MLD.sub.50 of A/Anhui/1/2013 (H7N9) influenza virus. Toxicity groups received SP2CBMTD ~27 days before lethal challenge with H7N9 virus did not survive infection. This was primary infection for toxicity group. All other groups were re-infected with 25 MLD.sub.50 of A/Anhui/1/2013 (H7N9) influenza virus but previously they were infected with 5 MLD.sub.50 of A/Anhui/1/2013 (H7N9) influenza virus.
TABLE-US-00012 TABLE 6a Serum antibody responses in BALB/c mice re-infected with 25 MLD.sub.50 of A/Anhui/1/2013 (H7N9) influenza virus. Dosage of Schedule of drug Anti-HA antibody titers Sp2CBMTD administration in mouse sera .sup.a (g/mouse/ (intranasal Geometric Group day) administration) Range mean 1 0.1 Day 7 80-80 80 2 1 Day 7 80-80 80 3 10 Day 7 80-160 101 4 100 Day 7 80-160 101 5 0.1 Day 3 80-80 80 6 1 Day 3 80-80 80 7 10 Day 3 80-80 80 8 100 Day 3 80-80 80 9 0.1 Day 1 160-160 160 10 1 Day 1 160-160 160 11 10 Day 1 80-80 80 12 100 Day 1 80-80 80 13 0.1 +6 hr p.i. N/A N/A 14 1 +6 hr p.i. 80-160 127 15 10 +6 hr p.i. 80-160 101 16 100 +6 hr p.i. 80-80 80 17 0.1 Day +1 N/A N/A 18 1 Day +1 N/A N/A 19 10 Day +1 80-80 80 20 100 Day +1 80-160 113 21 0.1 2x (Day 3, 1) 80-160 101 22 1 2x (Day 3, 1) 80-160 101 23 10 2x (Day 3, 1) 80-80 80 24 100 2x (Day 3, 1) 80-80 80 25 0.1 3x (Day 7, 3, 1) 80-160 101 26 1 3x (Day 7, 3, 1) 80-160 101 27 10 3x (Day 7, 3, 1) 80-80 80 28 100 3x (Day 7, 3, 1) 80-80 80 32 Control Control N/A N/A .sup.a Sera samples were collected from all survived animal 42 days after initial infection or 21 day after re-infection with A/Anhui/1/2013 (H7N9) virus. The titers are determined against homologous A/Anhui/1/2013 (H7N9) influenza virus with 0.5% CRBC and expressed as the reciprocal value (e.g., 640 vs. 1:640). N/Adata is not available due to deceased mice.
EXAMPLE 4
Further Studies Regarding Sialic AcidBinding Protein Sp2CBMTD Protects Mice Against Lethal Challenge With the Emerging A(H7N9) Influenza Virus
[0191] Summary
[0192] As shown by the data presented in Example 3, compounds that target the cellular factors essential for influenza virus replication represent an attractive approach to antiviral therapy. Sp2CBMTD is a genetically engineered multivalent protein that masks sialic acid-containing cellular receptors on the respiratory epithelium which are recognized by influenza viruses. The antiviral potential of Sp2CBMTD against lethal infection of mice with an emerging human A/Anhui/1/2013(H7N9) influenza virus was investigated as was the mechanistic basis of its activity in vivo. Sp2CBMTD was administered to mice intranasally as a single or repeated dose (0.1, 1, 10, or 100 g) before (day 7, 3, or 1) or after (6 or 24 h) H7N9 virus inoculation. A single Sp2CBMTD dose (10 or 100 g) protected 80% to 100% of mice when administered 7 days before the H7N9 lethal challenge. Repeated Sp2CBMTD administration conferred the highest protection, resulting in 100% survival of mice even at the lowest dose tested (0.1 g). Administration of Sp2CBMTD induced pulmonary expression of proinflammatory mediators (IL-6, RANTES, MCP-1, II-1, TNF, MIP-1, IP-10) and recruited neutrophils to the respiratory tract before H7N9 virus infection, which resulted in less pronounced inflammation and rapid virus clearance from mouse lungs. Sp2CBMTD administration did not affect the virus-specific adaptive immune response, which was sufficient to protect against reinfection with a higher dose of homologous H7N9 virus or heterologous H5N1 virus. Thus, Sp2CBMTD was effective in preventing H7N9 infections in a lethal mouse model and holds promise as a prophylaxis option against zoonotic influenza viruses.
[0193] Materials and Methods
[0194] Viruses, Cells, and Biologic.
[0195] Influenza A/Anhui/1/2013(H7N9) and A/Turkey/15/2006(H5N1) viruses were obtained through the World Health Organization network and propagated in embryonated chicken eggs for 48 h at 35 C. Madin-Darby canine kidney (MDCK) cells were obtained from the American Type Culture Collection and maintained as described previously (22). Sp2CBMTD was generated by PCR-based cloning techniques, using genes encoding the carbohydrate-binding module 40 (CBM40) domain from Streptococcus pneumoniae NanA sialidase and the trimerization domain from Pseudomonas aeruginosa pseudaminidase (21). Experiments with H7N9 and H5N1 influenza viruses were conducted in an animal biosafety level 3+ containment facility approved by the US Department of Agriculture.
[0196] Efficacy of Sp2CBMTD in Mice.
[0197] Six-week-old female BALB/c mice (weight, 18-20 g; Jackson Laboratories, Bar Harbor, Me.) were lightly anesthetized by isoflurane inhalation and inoculated intranasally with five 50% mouse lethal doses (MLD50) of A/Anhui/1/2013(H7N9) influenza virus in 50 L of PBS. For the first study, 5 BALB/c mice per group were given a single dose of Sp2CBMTD (0.1, 1, 10, or 100 g/mouse) intranasally on day 7, 3, or 1 before inoculation, or 6 or 24 h after H7N9 virus inoculation. Repeated dosing with Sp2CBMTD was given either as double (days 3 and 1) or triple (days 7, 3, and 1) doses before the H7N9 inoculation. Survival of mice was monitored daily for 21 days post-infection (p.i.); animals that showed signs of severe disease and a 25% weight loss were sacrificed. Control mice received sterile PBS on day 7, 3, and 1.
[0198] For the second study, the 10 g dose of Sp2CBMTD was evaluated. Ten BALB/c mice per group were given single (day 7 or 3), double (days 3 and 1), or triple (days 7, 3, and 1) dose(s) of Sp2CBMTD before A/Anhui/1/2013(H7N9) influenza virus inoculation. The loss or gain of weight was calculated for each mouse as a percentage of its weight before inoculation. On days 3, 6, and 9 p.i., 3 mice from each group were sacrificed for the determination of virus lung titers and level of cytokine/chemokine responses in the lung homogenates. Additional 3 mice from each group were sacrificed for histopathological examination of the lungs. The lungs were removed, thoroughly rinsed with sterile PBS, homogenized, and suspended in 1 mL of ice cold PBS. Cellular debris was removed by centrifugation at 2000 g for 10 min, after which the supernatants were used for 50% tissue culture infectious dose (TCID50) assays in MDCK cells. Survival of mice was monitored daily for 21 days p.i. All studies were conducted under applicable laws and guidelines and approved by the St. Jude Children's Research Hospital Animal Care and Use Committee.
[0199] Reinfection With H7N9 and H5N1 Viruses.
[0200] Three weeks after inoculation with A/Anhui/1/2013(H7N9) influenza virus, surviving mice were reinfected with 25 MLD50 of homologous virus. Other mice that survived an initial treatment with Sp2CBMTD and H7N9 virus inoculation received a second administration of Sp2CBMTD after 3 weeks and were then infected with 20 MLD50 of A/Turkey/15/2006(H5N1) virus.
[0201] Lung Cytokine and Chemokine Analysis.
[0202] Concentrations of the 4 cytokines [gamma interferon (IFN-), interleukin-6 (IL-6), regulated upon activation, normal T cell expressed and secreted (RANTES), monocyte chemotactic protein-1 (MCP-1)], and 4 chemokines [interleukin-1 (II -1), tumor necrosis factor alpha (TNF-), macrophage inflammatory protein-1 (MIP-1), inducible protein (IP-10)] were measured using a mouse MYCTOMAG-70K-PMX MILLIPLEX premixed kit (Millipore) according to the manufacturer's instructions. For each cytokine, the standard curve ranged from 3.2 to 10,000 g/mL. Cytokines were measured in 25 L of lung homogenate samples at 0, 3, 6, and 9 days p.i. Multiplex plates were read on the Luminex 100/200 analyzer, using the xPonent data acquisition and analysis software.
[0203] Histopathology and Immunohistochemistry.
[0204] Lungs of mice in each experimental group (n=3) of the second study were collected after whole-body perfusion with 10% neutral buffered formalin (NBF). Mouse lungs underwent inflation via tracheal infusion and were kept in 10% NBF for at least 7 days before embedding, sectioning, and staining for conventional histopathology with hematoxylin and eosin or with immunohistochemical (IHC) staining for influenza A virus [nucleoprotein (NP); US Biological], and neutrophils [myeloperoxidase (MPO); Thermo Shandon). Influenza A virus NP- and MPO-stained sections were blinded for pathology evaluation. The presence of antigens was quantified by capturing digital images of whole-lung sections, using an Aperio ScanScope XT Slide Scanner (Aperio Technologies) and then manually outlining entire fields together with areas of noticeably decreased or absent NP and MPO staining. The percentage of lung field with reduced staining coverage was calculated by using the Aperio's ImageScope software.
[0205] Serology.
[0206] Serum samples were obtained 21 days after H7N9 or H5N1 virus infection, treated with receptor-destroying enzyme (Denka Seiken Co.), heat inactivated at 56 C. for 1 h, and tested for the presence of anti-hemagglutinin (HA) antibodies by the HA inhibition assay with 0.5% turkey red blood cells (Rockland Immunochemicals). The presence of anti-SpCBM antibodies in sera samples was measured in an ELISA, using purified protein (1 g/well) immobilized on 96-well plates (Corning) (21).
[0207] Statistical Analysis.
[0208] Virus lung titers, concentrations of cytokines and chemokines, and anti-SpCBM antibody titers were analyzed by the unpaired Student t test. The number of NP- and MPO-stained lung cells were compared by analysis of variance (ANOVA), using the GraphPad Prism 5.0 software. Cumulative survival was calculated by the Kaplan-Meier log-rank test.
[0209] Results
[0210] Efficacy of Sp2CBMTD on survival of mice lethally challenged with H7N9 influenza virus. To determine whether Sp2CBMTD improved the survival of mice lethally challenged with A/Anhui/1/2013(H7N9) influenza virus, the biologic was administered once at a dose of 0.1, 1, 10, or 100 g on day 7, 3, or 1 before virus challenge. Virus-inoculated, PBS treated control animals exhibited progressive weight loss and all died between days 8 and 10 p.i. (
[0211] Next, the effect of early post exposure treatment with Sp2CBMTD on the survival of mice was assessed. Sp2CBMTD given 6 h after the H7N9 virus challenge protected 100% of mice at doses of 10 and 100 g and 40% of mice at 1 g (
[0212] Repeated administration of Sp2CBMTD given as a double or triple regimen before lethal challenge of mice infected with A/Anhui/1/2013(H7N9) influenza virus provided complete protection at all doses of the biologic tested (
[0213] Effect of Sp2CBMTD on H7N9 influenza virus replication in mouse lungs. In a second experiment, the mechanistic basis of the antiviral activity of Sp2CBMTD was examined at a 10 g dose, at which protection was conferred in the first experiment. The kinetics of H7N9 virus load was determined in the lungs of infected mice. Virus titers in the lungs of mice treated with all biologic regimens tested did not differ from those of controls on day 3 or 6 p.i. (Table 1 b). Notably, on day 9 p.i., double and triple administration of Sp2CBMTD significantly reduced virus load in the lungs of infected mice (P<0.005), but both single dose regimens tested did not reduce virus titers (Table 1b).
[0214] To compare A/Anhui/1/2013(H7N9) influenza virus replication in the lower respiratory tract of infected mice given either PBS (control) or different regimens of the biologic, virus positive cells were quantified in lung sections on days 3, 6, and 9 p.i. (
[0215] These findings indicated that Sp2CBMTD administration controlled H7N9 virus replication in the lungs of infected mice. The observed difference in the infectious virus titers and the number of virus-positive cells in the lungs of infected mice can be because the lung section assay can detect only intracellular virus but the TCID50 assay can detect both intracellular and extracellular viruses.
[0216] Effect of Sp2CBMTD on histologic changes of lung tissues. To determine the extent of changes in the lungs, tissues obtained from different Sp2CBMTD regimen groups on days 3, 6, and 9 p.i. were histologically examined (
[0217] Effect of Sp2CBMTD on production of pulmonary cytokines and chemokines. To determine the inflammatory and innate immune responses associated with Sp2CBMTD administration, the effect of Sp2CBMTD on pulmonary expression of cytokines and chemokines was studied. Sp2CBMTD stimulated a proinflammatory response before H7N9 virus inoculation and the levels of specific proinflammatory mediators such as cytokines (IL-6, RANTES, MCP-1) and chemokines (II-1, TNF, MIP-1, IP-10) increased, and the significant differences (P<0.01 or P<0.05) were observed between Sp2CBMTD-treated and control animals on day 0 p.i. especially with repeat dosing (
[0218] Effect of Sp2CBMTD on neutrophil recruitment. To confirm that the elevated levels of cytokines determined before virus inoculation were associated with an increase in immune cell population in the lungs, the number of neutrophils was determined (
[0219] Reinfection of mice with H7N9 influenza virus. To examine whether Sp2CBMTD treatment interferes with the induction of adaptive immunity, titers of serum anti-HA antibodies against A/Anhui/1/2013(H7N9) influenza virus were determined. All surviving mice had moderate titers of anti-HA antibodies (1:40 to 1:160), regardless of the regimen used (Table 2b). Anti-HA antibody titers were sufficient to protect 100% of surviving animals against a 25 MLD50 dose of homologous H7N9 virus reinfection (data not shown). Induction of anti-SpCBM antibodies after repeated administration and reinfection with H5N1 influenza virus. Development of anti-biologic antibodies could potentially abrogate protection when the biologic is used repeatedly. We assessed the levels of anti-SpCBM antibodies in mouse sera after two uses of the biologic (Table 2b). Compared to nave mice, the most prominent increase after the first use of Sp2CBMTD was observed for IgM, which presents the pool of acute antibodies, and the least increase was shown for IgA. After the second use of Sp2CBMTD, the levels of IgG and IgM increased 1.3-1.7 and 1.4-4.4-fold in all treatment groups, respectively (Table 2b). To address the question whether repeated Sp2CBMTD use can affect protection against influenza virus infection, we re-infected mice with highly pathogenic H5N1 virus. Importantly, animals in the groups that received the biologic twice were completely protected from lethal challenge with H5N1 virus (data not shown).
[0220] Discussion. In a previously developed lethal mouse model of influenza H7N9 virus-induced acute respiratory distress syndrome (23), we demonstrated high potency of the novel host-targeted biologic Sp2CBMTD in preventing lethal infection with the newly emerging human pathogen. The highest efficacy and 100% protection of mice were achieved by repeated administration of Sp2CBMTD before the H7N9 viral challenge, although 20%-100% of animals were protected with a single dose of Sp2CBMTD after the viral challenge, depending on the timing and dose. Repeated administration of Sp2CBMTD induced some key proinflammatory cytokines and recruited immune cells to the lung epithelia before H7N9 virus infection, which resulted in less pronounced inflammation and rapid virus clearance from mouse lungs.
[0221] Human infection caused by avian influenza viruses raises concerns about optimal therapeutics to control zoonotic infections and highlights the need to develop novel anti influenza drugs. The targets for novel drugs have broadened in recent years, focusing on not only influenza virus-specific proteins but also host factors essential for virus replication. The major advantages of host-targeted drugs are their broad spectrum of activity and efficacy against different influenza virus subtypes and the low risk of emergence of drug-resistant variants (24). An attractive strategy for drug development is to inhibit influenza virus entry into the host cell. Therefore, Sp2CBMTD, which was designed to mask SA-containing host cell receptors, is a promising candidate. Unlike the investigational antiviral biologic DAS181, Sp2CBMTD does not remove cellular receptors but masks them and prevents viral attachment (21). Glycan array screening shows that SpCBM recognizes glycans containing terminal 2,3- or 2,6-linked SA (20), emphasizing the feasibility of a biologic that can bind to receptors in the upper and lower respiratory tract of humans. The high affinity of Sp2CBMTD, which was achieved through multivalency, allows it to mask SA receptors for an extended time period. Sp2CBMTD has been detected in mouse lungs up to 8 days after a single administration (21), which allows its administration in advance of virus infection, thus making it a valuable component of preventive measures. In contrast, recent studies on the antiviral activity of DAS181 in H7N9-infected mice show that daily dosing is required at the start of infection to reduce weight loss and completely protect mice from lethality (25). Despite the target (cell surface sialoglyconjugates) being identical for both drugs, the regimens are different.
[0222] Our data suggest that the mechanism of antiviral action of Sp2CBMTD is complex and is driven by 2 major factors: 1) preventing virus binding to the SA-containing cellular receptors (21) and 2) modulating host immune response. The multifunctional role of Sp2CBMTD in protecting against influenza virus infection is demonstrated by stimulation of an innate immune response and recruitment of immune cells to the site of influenza virus infection, thus reducing the severity of immunopathology induced by the H7N9 virus. It is possible that Sp2CBMTD binds to a yet-unknown receptor(s) in addition to SA, and thus acquired the ability to modulate the immune response.
[0223] Importantly, sera collected from Sp2CBMTD-treated mice that survived H7N9 virus infection were positive for specific anti-HA antibodies and thereby the development of an adaptive immune response has occurred. The level of immune response was sufficient to protect against H7N9 virus reinfection with a higher dose of the homologous virus.
[0224] A major concern about the long-term use of this novel therapeutic is the development of specific antibodies against it. Our results demonstrated that although serum levels of IgG, IgM, and IgA anti-SpCBM antibodies increased after a second administration of Sp2CBMTD three weeks after the first one, the protection was not affected and all animals survived the heterologous challenge with the highly pathogenic H5N1 influenza virus. All the internal gene segments of newly emerging H7N9 influenza viruses and highly pathogenic H5N1 are similar and closely related to those from avian H9N2 viruses (16, 26). Therefore, cross-reactive CD4+ T and CD8+ cytotoxic T lymphocyte immune responses established by the initial H7N9 virus infection may have contributed to protection against H5N1 reinfection. Further studies are required to determine the efficacy of Sp2CBMTD against different HA clades of highly pathogenic H5N1 influenza viruses. Our results confirm that repeated use of Sp2CBMTD is possible even within a short time period. If the time period between Sp2CBMTD administrations is longer, the anti-SpCBM antibodies could be eliminated and their possible effect on the level of protection may decrease. To reduce the possible concern of immunogenicity, humanization of the biologic is possible.
[0225] Sp2CBMTD represents a new host-directed class of therapeutics for influenza infections that shows promise for the prophylaxis of disease caused by potentially pandemic strains of influenza. Previous studies suggest that this biologic is effective against pandemic H1N1pdm09 viruses (21). Taken together, these data support the notion that Sp2CBMTD is a promising prophylaxis option against emerging influenza viruses. Other respiratory pathogens such as parainfluenza viruses, some coronaviruses, and S. pneumoniae also use SA receptors for pathogenesis, which may implement a broader application of the Sp2CBMTD in the future. Our findings in mice confirmed that a regimen of repeated low doses resulted in highest survival rates and minimized tissue damage in mouse lungs. The immunomodulatory properties of Sp2CBMTD require further investigation, but the findings of this study advocate an even broader applicability of this approach in preventing respiratory disease caused by pathogens that do not use SA receptors.
TABLE-US-00013 TABLE 1b Efficacy of Sp2CBMTD against lethal A/Anhui/1/2013 (H7N9) influenza virus infection in BALB/c mice No. Mean lung virus titer survived/ Mean Average weight (log.sub.10TCID.sub.50/mL SD) Sp2CBMTD total no. survival loss (% SD) on day p.i..sup.b on day p.i..sup.c administration.sup.a (%) day SD 4 6 8 12 3 6 9 Single (day 7).sup.d 6/10 (60) 15.4 5.9 10.5 2.6 17.8 3.7 24.9 5.7 18.3 8.3 6.8 0.5 6.2 0.0 5.5 0.2 Single (day 3) 8/10 (80) 17.8 4.6 6.0 4.0 13.4 4.3 20.0 8.1 7.4 6.1 6.7 0.3 5.6 0.4 5.1 0.3 Double (days 3 and 1) 10/10 (100) 20.0 0.0 6.2 1.9 10.3 2.4 13.3 5.1 2.8 4.5 6.8 0.5 6.0 0.3 2.9 0.6* Triple (days 7, 3, 10/10 (100) 20.0 0.0 4.0 2.8 10.1 3.7 12.9 6.8 0.9 7.3 6.3 0.1 5.8 0.5 3.3 0.0* and 1) Control 0/10 (0) 8.0 1.0 13.2 2.5 20.2 4.5 26.6 4.9 N/A 7.0 0.0 6.0 0.3 5.4 0.3 Abbreviations: SD, standard deviation; p.i., post infection; N/A, not applicable (all mice in the group died). .sup.aGroups of 6- to 8-week-old BALB/c mice (n = 10) were given 50 L of Sp2CBMTD intranasally as a single, double, or triple dose of 10 g/ mouse. Treatment with Sp2CBMTD was initiated at different time points between days 7 to 1 before inoculation with 5 MLD50 of A/Anhui/1/2013(H7N9) influenza virus. .sup.bLoss of weight was calculated for each mouse as a percentage of its weight on day 0. .sup.cData from 3 animals per group. The lower limit of virus detection was 0.75 log10TCID50/mL. .sup.dDays before A/Anhui/1/2013(H7N9) influenza virus inoculation. *P26 <0.005, by unpaired Student t test as compared with control animals.
TABLE-US-00014 TABLE 2b Titres of anti-HA and anti-SpCBM antibodies in mouse sera Range of HI titers after Mean concentration (mg/mL SD) of anti-SpCBM antibodies after infection with influenza virus Sp2CBMTD administration A/Anhui/1/ A/Turkey/15/ First administration.sup.d Second administration.sup.e Sp2CBMTD administration.sup.a 2013 (H7N9).sup.b 2006 (HSN1).sup.c IgG IgM IgA IgG IgM IgA Single (day 7).sup.f 80 40-80 174.7 7.0 5.3 3.0 4.5 3.3 257.7 0.2* 17.7 0.2** 30.2 6.1** (26.5) (132.5) (1.4) (1.5) (3.3) (6.7) Single (day 3) 80-160 20-40 143.1 7.4 3.8 1.2 5.1 4.6 238.6 2.9** 16.6 1.1** 42.7 9.1** (21.7) (95.0) (1.5) (1.7) (4.4) (8.4) Double (days 3 and 1) 40-80 40-80 214.9 9.0 11.2 1.9 3.9 2.8 273.8 1.4** 19.2 0.7** 59.4 2.6** (32.6) (280.0) (1.2) (1.3) (1.7) (15.2) Triple (days 7, 3, and 1) 80-160 40-80 211.6 16.1 12.7 2.2 7.9 5.5 269.9 1.6** 18.0 0.4* 85.1 13.5** (32.1) (317.5) (2.4) (1.3) (1.4) (10.8) Nave mice N/A N/A 6.6 3.0 0.04 0.1 3.3 1.8 5.6 0.4 0.1 0.0 3.1 1.8 Abbreviations: SD, standard deviation; HI, hemagglutination inhibition; N/A, not applicable [nave mice did not possess anti-HA antibodies against A/Anhui/1/2013 (H7N9) and A/Turkey/15/2006(H5N1) influenza viruses]. .sup.aSp2CBMTD (10 g/mouse) was administered as described in the legend to Table 1b. Three weeks after initial H7N9 virus inoculation and the first use of Sp2CBMTD, the biologic was used the second time and administered to the animals at the same regimens as during the first use. The animals were reinfected with 20 MLD50 of highly pathogenic A/Turkey/15/2006(H5N1) influenza virus (28 days p.i. with the H7N9 virus). Nave mice did not receive Sp2CBMTD and were not infected with the influenza virus. .sup.bHI titers against A/Anhui/1/2013(H7N9) influenza virus were determined 3 weeks after initial H7N9 virus inoculation (expressed as reciprocal values, e.g., 40 versus 1:40) using 0.5% turkey red blood cells. .sup.cHI titers against A/Turkey/15/2006(H5N1) influenza virus were determined 3 weeks after initial H5N1 virus inoculation (or 48 days after H7N9 virus inoculation). .sup.dValues are means SD from 4 mice per group. The fold change in the levels of anti-SpCBM antibodies relative to the mean concentrations of naive animals is shown in parenthesis. .sup.eValues are means SD from 4 mice per group. The fold change in the levels of anti-SpCBM antibodies relative to the mean concentrations after the first administration is shown in parenthesis. .sup.fDays before A/Anhui/1/2013(H7N9) influenza virus inoculation. *P <0.05, **P <0.005, by unpaired Student t test as compared to the concentration after the first administration of Sp2CBM
REFERENCES FOR EXAMPLE 4
[0226] 1. World Health Organization. Number of confirmed human cases of avian influenza A(H7N9) reported to WHO. http://www.who.int/influenza/human_animal_interface/influenza_h7n9/18_reportweb7n9number_201 40714.pdf?ua=1. Accessed 25 Sep. 2014.
[0227] 2. Qi X, Qian Y H, Bao C J, Guo X L, Cui L B, Tang F Y, Ji H, Huang Y, Cai P Q, Lu B, Xu K, Shi C, Zhu F C, Zhou M H, Wang H. 2013. Probable person to person transmission of novel avian influenza A (H7N9) virus in Eastern China, 2013: epidemiological investigation. BMJ 347:f4752. doi: 10.1136/bmj.f4752.
[0228] 3. Liu T, Bi Z, Wang X, Li Z, Ding S, Bi Z, Wang L, Pei Y, Song S, Zhang S, Wang J, Sun D, Pang B, Sun L, Jiang X, Lei J, Yuan Q, Kou Z, Yang B, Shu Y, Yang L, Li X, Lu K, Liu J, Zhang T, Xu A. 2014. One family cluster of avian influenza A(H7N9) virus infection in Shandong, China. BMC Infect. Dis. 14:98. doi: 10.1186/1471-2334-14-98.
[0229] 4. Xiao X C, Li K B, Chen Z Q, Di B, Yang Z C, Yuan J, Luo H B, Ye S L, Liu H, Lu J Y, Nie Z, Tang X P, Wang M, Zheng B J. 2014. Transmission of avian influenza A(H7N9) virus from father to child: a report of limited person-to-person transmission, Guangzhou, China, January 2014. Euro Surveill. 19(25):pii=20837.
[0230] 5. Hu J, Zhu Y, Zhao B, Li J, Liu L, Gu K, Zhang W, Su H, Teng Z, Tang S, Yuan Z, Feng Z, Wu F. 2014. Limited human-to-human transmission of avian influenza A(H7N9) virus, Shanghai, China, March to April 2013. Euro Surveill. 19(25): pii: 20838.
[0231] 6. van Riel D, Leijten L M, Verdijk R M, GeurtsvanKessel C, van der Vries E, van Rossum A M, Osterhaus A D, Kuiken T. 2013. Novel avian-origin influenza A (H7N9) virus attaches to epithelium in both upper and lower respiratory tract of humans. Am. J. Pathol. 183:1137-1143. doi: 10.1016/j.ajpath.2013.06.011.
[0232] 7. Zhou J, Wang D, Gao R, Zhao B, Song J, Qi X, Zhang Y, Shi Y, Yang L, Zhu W, Bai T, Qin K, Lan Y, Zou S, Guo J, Dong J, Dong L, Zhang Y, Wei H, Li X, Lu J, Liu L, Zhao X, Li X, Huang W, Wen L, Bo H, Xin L, Chen Y, Xu C, Pei Y, Yang Y, Zhang X, Wang S, Feng Z, Han J, Yang W, Gao G F, Wu G, Li D, Wang Y, Shu Y. 2013. Biological features of novel avian influenza A (H7N9) virus. Nature 499(7459):500-503. doi: 10.1038/nature12379.
[0233] 8. Chan M C, Chan R W, Chan L L, Mok C K, Hui K P, Fong J H, Tao K P, Poon L L, Nicholls J M, Guan Y, Peiris J S. 2013. Tropism and innate host responses of a novel avian influenza A H7N9 virus: an analysis of ex-vivo and in-vitro cultures of the human respiratory tract. Lancet Respir. Med. 1(7):534-542. doi: 10.1016/S2213-2600(13)70138-3.
[0234] 9. Belser J A, Gustin K M, Pearce M B, Maines T R, Zeng H, Pappas C, Sun X, Carney P J, 458 Villanueva J M, Stevens J, Katz J M, Tumpey T M. 2013. Pathogenesis and transmission of avian influenza A (H7N9) virus in ferrets and mice. Nature 501(7468):556-559. doi: 10.1038/nature12391.
[0235] 10. Watanabe T, Kiso M, Fukuyama S, Nakajima N, Imai M, Yamada S, Murakami S, Yamayoshi S, Iwatsuki-Horimoto K, Sakoda Y, Takashita E, McBride R, Noda T, Hatta M, Imai H, Zhao D, Kishida N, Shirakura M, de Vries R P, Shichinohe S, Okamatsu M, Tamura T, Tomita Y, Fujimoto N, Goto K, Katsura H, Kawakami E, Ishikawa I, Watanabe S, Ito M, Sakai-Tagawa Y, Sugita Y, Uraki R, Yamaji R, Eisfeld A J, Zhong G, Fan S, Ping J, Maher E A, Hanson A, Uchida Y, Saito T, Ozawa M, Neumann G, Kida H, Odagiri T, Paulson J C, Hasegawa H, Tashiro M, Kawaoka Y. 2013. Characterization of H7N9 influenza A viruses isolated from humans. Nature 501(7468):551-555. doi: 10.1038/nature12392.
[0236] 11. Xu L, Bao L, Deng W, Dong L, Zhu H, Chen T, Lv Q, Li F, Yuan J, Xiang Z, Gao K, Xu Y, Huang L, Li Y, Liu J, Yao Y, Yu P, Li X, Huang W, Zhao X, Lan Y, Guo J, Yong W, Wei Q, Chen H, Zhang L, Qin C. 2014. Novel avian-origin human influenza A(H7N9) can be transmitted between ferrets via respiratory droplets. J. Infect. Dis. 209:551-556. doi: 10.1093/infdis/jit474.
[0237] 12. Zhang Q, Shi J, Deng G, Guo J, Zeng X, He X, Kong H, Gu C, Li X, Liu J, Wang G, Chen Y, Liu L, Liang L, Li Y, Fan J, Wang J, Li W, Guan L, Li Q, Yang H, Chen P, Jiang L, Guan Y, Xin X, Jiang Y, Tian G, Wang X, Qiao C, Li C, Bu Z, Chen H. 2013. H7N9 influenza viruses are transmissible in ferrets by respiratory droplet. Science 341(6144):410-414. doi: 10.1126/science. [0238] 13. Osterholm M T, Ballering K S, Kelley N S. 2013. Major challenges in providing an effective and timely pandemic vaccine for influenza A(H7N9). JAMA 309:2557-2558. doi: 10.1001/jama.2013.6589.
[0239] 14. De Groot A S, Ardito M, Terry F, Levitz L, Ross T, Moise L, Martin W. 2013. Low immunogenicity predicted for emerging avian-origin H7N9: implication for influenza vaccine design. Hum. Vaccin. Immunother. 9:950-956. doi: 10.4161 /hv.24939.
[0240] 15. Li Q, Zhou L, Zhou M, Chen Z, Li F, Wu H, Xiang N, Chen E, Tang F, Wang D, Meng L, Hong Z, Tu W, Cao Y, Li L, Ding F, Liu B, Wang M, Xie R, Gao R, Li X, Bai T, Zou S, He J, Hu J, Xu Y, Chai C, Wang S, Gao Y, Jin L, Zhang Y, Luo H, Yu H, He J, Li Q, Wang X, Gao L, Pang X, Liu G, Yan Y, Yuan H, Shu Y, Yang W, Wang Y, Wu F, Uyeki T M, Feng Z. 2014. Epidemiology of human infections with avian influenza A(H7N9) virus in China. N. Engl. J. Med. 370(6):520-532. doi: 10.1056/NEJMoa1304617.
[0241] 16. Gao R, Cao B, Hu Y, Feng Z, Wang D, Hu W, Chen J, Jie Z, Qiu H, Xu K, Xu X, Lu H, Zhu W, Gao Z, Xiang N, Shen Y, He Z, Gu Y, Zhang Z, Yang Y, Zhao X, Zhou L, Li X, Zou S, Zhang Y, Li X, Yang L, Guo J, Dong J, Li Q, Dong L, Zhu Y, Bai T, Wang S, Hao P, Yang W, Zhang Y, Han J, Yu H, Li D, Gao GF, Wu G, Wang Y, Yuan Z, Shu Y. 2013. Human infection with a novel avian-origin influenza A (H7N9) virus. N. Engl. J. Med. 368 (20):1888-1897. doi: 10.1056/NEJMoa1304459.
[0242] 17. Hu Y, Lu S, Song Z, Wang W, Hao P, Li J, Zhang X, Yen HL, Shi B, Li T, Guan W, Xu L, Liu Y, Wang S, Zhang X, Tian D, Zhu Z, He J, Huang K, Chen H, Zheng L, Li X, Ping J, Kang B, Xi X, Zha L, Li Y, Zhang Z, Peiris M, Yuan Z. 2013. Association between adverse clinical outcome in human disease caused by novel influenza A H7N9 virus and sustained viral shedding and emergence of antiviral resistance. Lancet 381(9885):2273-2279. doi: 10.1016/S0140-6736(13)61125-3.
[0243] 18. ClinicalTrials.gov. 2014. htttp://www.clinicaltrials.gov/ct2/show/NCT00527865?term=Fludase&rank=2. Accessed 25 Sep. 2014.
[0244] 19. Malakhov M P, Aschenbrenner L M, Smee D F, Wandersee M K, Sidwell R W, Gubareva L V, Mishin V P, Hayden F G, Kim D H, Ing A, Campbell E R, Yu M, Fang F. 2006. Sialidase fusion protein as a novel broad-spectrum inhibitor of influenza virus infection. Antimicrob. Agents Chemother. 50:1470-1479.
[0245] 20. Connaris H, Crocker P R, and Taylor G L. 2009. Enhancing the receptor affinity of the sialic acid-binding domain of Vibrio cholerae sialidase through multivalency. J. Biol. Chem. 284(11):7339-7351. doi: 10.1074/jbc.M807398200.
[0246] 21. Connaris H, Govorkova E A, Ligertwood Y, Dutia B M, Yang L, Tauber S, Taylor M A, Alias N, Hagan R, Nash A A, Webster R G, Taylor G L. 2014. Prevention of influenza by targeting host receptors using engineered proteins. Proc. Natl. Acad. Sci. U.S.A. 111(17):6401-6406. doi: 10.1073/pnas.1404205111.
[0247] 22. Ilyushina N A, Bovin N V, Webster R G, Govorkova E A. 2006. Combination chemotherapy, a potential strategy for reducing the emergence of drug-resistant influenza A variants. Antiviral. Res.70:121-131.
[0248] 23. Baranovich T, Burnham A J, Marathe B M, Armstrong J, Guan Y, Shu Y, Peiris J M, Webby R J, Webster R G, Govorkova E A. 2014. The neuraminidase inhibitor oseltamivir is effective against A/Anhui/1/2013 (H7N9) influenza virus in a mouse model of acute respiratory distress syndrome. J. Infect. Dis. 209:1343-1353. doi: 10.1093/infdis/jit554.
[0249] 24. Webster R G and Govorkova E A. 2014. Continuing challenges in influenza. Ann. N.Y. Acad. Sci. 1323(1):115-139. doi: 10.1111/nyas.12462.
[0250] 25. Marjuki H, Mishin V P, Chesnokov A P, De La Cruz J A, Fry A M, Villanueva J, Gubareva L V. 2014. An investigational antiviral drug, DAS181, effectively inhibits replication of zoonotic influenza A virus subtype H7N9 and protects mice from lethality. J. Infect. Dis. 210:435-440. doi: 10.1093/infdis/jiu105.
[0251] 26. Guan Y, Shortridge K F, Krauss S, Webster R G. 1999. Molecular characterization of H9N2 influenza viruses: were they the donors of the internal genes of H5N1 viruses in Hong Kong? Proc. Natl. Acad. Sci. U.S.A. 96:9363-9367.