POLAR BODY GENOME RECONSTRUCTED OOCYTES AND PREPARATION METHOD AND USE THEREOF

20170009254 ยท 2017-01-12

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed are polar body genome restructured oocytes, the preparation method thereof and the use thereof in preparing the materials for preventing the occurrence of mitochondrial material genetic diseases.

    Claims

    1. The polar body genome restructured oocytes, it is consisted of the genome provided by the first and/or the second polar of the patient's oocytes and germ cell, as well as cytoplasm of healthy people's oocytes, the oocytes reconstructed only contains mitochondria of the healthy people's oocytes.

    2. The polar body genome restructured oocytes as claimed in claim 1, wherein the first polar mentioned comes from the oocytes in meiosis metaphase of the female patient with mitochondria diseases.

    3. The polar body genome restructured oocytes as claimed in claim 1, wherein the second polar mentioned comes from germ cell combined the oocytes in meiosis metaphase of the female patient with mitochondria diseases and the spouse's sperm.

    4. A preparation method of the polar body genome restructured oocytes as claimed in claim 1, wherein it adopts micrurgical technique to immigrate the first and/or second polar of the patient's oocytes and germ cell to cytoplasm of the healthy people's oocytes or germ cell that the female genetic substances have been removed; the steps include: (1) reconstructing the oocytes with the first polar body genome of the female patient with mitochondria diseases and oocytes cytoplasm of the healthy female; (2) using the second polar body genome of the female patient with mitochondria diseases to replace female pronucleus of the germ cell of the healthy female and the patient spouse for reconstructing the embryo; (3) inspecting contents of the mitochondria from two sources in the embryos developed from the reconstructed oocytes/reconstructed germ cell; (4) the animal model test can be used to verify the interdicting effects of the three kinds of genetic substances contained in the embryo obtained to maternal inheritance of mitochondria diseases.

    5. The preparation method as claimed in claim 4, wherein three genetic substances mentioned are father, mother nucleus DNA and the mitochondria DNA of healthy supplier.

    6. The preparation method as claimed in claim 4, wherein content inspection of the mitochondria mentioned adopts pyrosequencing method.

    7. The polar body genome restructured oocytes and the use thereof in preparing the materials for preventing the occurrence of mitochondrial material genetic diseases.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0048] FIG. 1 is technical route of this invention shows that:

    Donor oocyte/zygote (comes from the patient with female mitochondria diseases); Recipient oocyte/zygote (comes from the healthy female); first polar body transfer; Spindle transfer; second polar body transfer; pronucleus transfer; mitochondria replacement; undetectable donor mtDNA carryover; low to medium donor mtDNA carryover; very low donor mtDNA carryover; medium to high donor mtDNA carryover.

    [0049] FIG. 2 shows mitochondria distribution around PB1, Spindle, PB2 and pronuclei, of which,

    [0050] A: The mitochondria distribution in cytoplasm of the oocytes and the first polar; B: The mitochondria distribution in cytoplasm of the germ cell and the second polar; C: The mitochondria carried around the first polar, the compound of spindle body-chromosome, the mitochondria carried around the second polar and pronucleus; D: Fluorescence intensity analysis of the mitochondria around the first polar, compound of spindle body-chromosome, the second polar, and pronucleus. MitoTrackor: Fluorescence probe of the mitochondria; Hochest: Nucleus fluorescence probe.

    [0051] FIG. 3 shows that the epigenetic characteristics of PB1 and spindlechromosome are consistent, PB1 can be used to replace spindlechromosome for treating maternal mitochondria diseases, of which,

    [0052] A, B: -tubulin dyeing shows that the form characteristics of PB1 and spindlechromosome are consistent; C, D, E: The antibody dyeing of 5-methylcystein methylation, 3-methylation of histone, and 3-phosphorylation of histone shows that epigenetic characteristic of PB1 and spindlechromosome are consistent; F: The replacement mode and entity map of the first polar; G: The replacement mode and entity map of the spindle body.

    [0053] FIG. 4 shows that epigenetic characteristics of PB2 and female pronucleus are consistent; PB2 can be used to replace the female pronucleus for treating maternal mitochondria diseases, of which,

    [0054] A, B: lamin B1 dyeing shows that the form characteristics of PB2 and female pronucleus are consistent; C, D, E: The antibody dyeing of 5-methylcystein methylation, 3-methylation of histone, and 3-acetylation of histone shows that epigenetic characteristics of PB2 and the female pronucleus are consistent; F: The replacement mode and entity map of the second polar; G: The replacement mode and entity map of the pronucleus replacement.

    [0055] FIG. 5 shows four kinds of mitochondria replacement mouse generated by PB1T, ST, PB2T, PNT, and the efficiency, of which,

    [0056] A, B: Efficiency of the four kinds of mitochondria replacement technologies (PB1T, ST, PB2T, and PNT), IVF is contrast of the four technologies; C: Birth weights and placenta weights of the mouse replaced with the four kinds of mitochondria (PB1T, ST, PB2T, and PNT) have no significant difference with those of IVF mouse; D: The embryo, newborn, and adult individual replaced with the four kinds of mitochondria (PB1T, ST, PB2T, and PNT).

    [0057] FIG. 6 shows the mitochondria heterogeneity of the nucleus donor and cytoplasm donor in vivo of the mouse replaced with the four kinds of mitochondria (PB1T, ST, PB2T, and PNT), of which,

    [0058] A: The detected mitochondria locus of the nucleus donor (NZW mouse) and cytoplasm donor (BDF1 mouse); B: Indicates the pyrosequencing FIG when C and T are 100%; C: The comparison of mitochondria heterogeneity of the nucleus donor and cytoplasm donor in vivo of the mouse replaced with the four kinds of mitochondria (PB1T, ST, PB2T, and PNT); D, E, F, G: Successively refer to mitochondria heterogeneity's distributions of the nucleus donor and cytoplasm donor in the important organs of brain, heart, lung, liver and kidney etc in vivo of the mouse replaced with the four kinds of mitochondria (PB1T, ST, PB2T, and PNT); H, I, J, K: Successively refer to mitochondria heterogeneity's representative atlas of the nucleus donor and cytoplasm donor in the important organs of brain, heart, lung, liver and kidney etc in vivo of the mouse replaced with the four kinds of mitochondria (PB1T, ST, PB2T, and PNT).

    [0059] FIG. 7 shows that the genetic characteristics of PB1 and spindlechromosome, germ cell PB2 and Female Pronucleus are consistent, of which,

    [0060] A: Oocytes and the first polar of human beings; B: The comparative genomics detection shows that the genetic characteristics of the oocytes's first polar and the nucleus chromosome in its cytoplasm are consistent; C: Germ cell and the second polar of human beings; D: The comparative genomics detection shows that the genetic characteristics of the germ cell's second polar and the pronucleus in its cytoplasm are consistent.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

    [0061] We will further set forth this invention combining with concrete implementation of animal model below, and compare it with existing mitochondria replacement (ST, PNT) (FIG. 1: Research diagram of this invention). And we shall understand that these implementation cases can only be used to explain this invention, not to be used for limiting the invention.

    I. Research Materials and Methods

    (I) Research Materials

    [0062] New Zealand white mouse, in this invention, it is used to simulate the patient with female mitochondria diseases. The hybrid generation mouse of BDF1 of C57BL/6 and DBA2, in this research, is used to simulate the healthy female who donates oocytes cytoplasm. While the ICR mouse is treated as surrogacy mother in this invention.

    (II) Research Methods

    [0063] 1. The Feasibility Analysis that PB1 and PB2 are Used for Treating Maternal Mitochondria Diseases

    [0064] (1) Comparison of the Mitochondria Carried by PB1, Spindle, PB2 and Pronuclei

    [0065] Use the mitochondria fluorescence probe of MitoTrackor (250 nM) to dye the oocytes and germ cell for 10 minutes, use Hochest33342 re-dye the nucleus for 10 minutes. Put the dyed oocytes embryo in CB operation liquid drop of 5 g/ml, use a 15 m enucleation needle to take the PB1, Spindle, PB2 and Pronuclei out, and then transfer them into the liquid drop of the culture dish cabinet specially used for the confocal microscopy, and then observe the distributions under the confocal microscopy.

    [0066] (2) Comparison of the Epigenetic Characteristics of PB1 and Spindle, PB2 and Pronulcei.

    [0067] The fresh oocytes and germ cell are fixed and conducted permeabilizing and sealing treatment with 4% of paraformaldehyde, and then, they shall be conducted epigenetic inherent immunohistochemical detection, the primary antibodies detected includes: Anti-tubulin (1/200, Sigma, T8203), anti-lamin B1 (1:50, Abcam, ab8982), anti-H3K9me3 (1/200, Abcam, ab8898), anti-H3P (1/100, Abcam, ab7031), anti-acetyl H3 (1:250, Millipore 06599), and 5 mC antibody (1:200, Abcam, ab10805).

    [0068] All primary antibodies are incubated in 4 C over the night. On the next day, use PBS to sufficiently wash the oocytes and germ cell, and then, the different primary antibodies respectively are marked with the second fluorescence antibody of DyLight 488, IgG (1:500, Jackson) or Alexa488, and IgG (1:500, Invitrogen) (incubated for 1.5 h, at 37). After the second antibody marking is over, use PI to re-dye the nucleus. Put the dye oocytes and germ cell into the liquid drop of the culture dish cabinet specially used for the confocal microscopy, and then observe the epigenetic similarities and differences under the confocal microscopy.

    [0069] 2. Prepartions of the Four Kinds of Mitochondria (PB1T, ST, PB2T, and PNT) Mice and Their Descendant Reproduction

    [0070] (1) Preparations of PB1T and ST Mice

    [0071] Inject 5IU PMSG to abdominal cavities of the 6-8 weeks of NZW, BDF1 female mice, and then, re-inject 5IU HCG to abdominal cavities of them at an interval of 48 h. 13 hours later after HCG injection, take mature oocyte wrapped with cumulus cell from expansion part of the fallopian tube, and place it into the Ggamete operation liquid containing 0.1% hyaluronidase at the temperature of 37 in the incubater where 5% CO2 is properly saturated, until the cumulus cell becomes loose (2-3 min). The oocytes after degranulation shall be placed into an incubator for recovering for 30 min.

    [0072] Place the oocytes cells of NZW and BDF1 into the Ggamete operation liquid containing CB in the microscopy room, 10 minutes later, use an oocytes-holding needle to hold a NZW oocytes (including living and saturated polar), and make the polar at the position of 12 O'clock. Use a 8 m denucleation needle controlled with Piezo pulse to absorb PB1 to simply break the plasmalemma in 7% of PVP, and then inject it to BDF1 denucleated oocytes. The final reconstructed shall be placed into HTF for sufficiently washing and transferred to HTF for in vitro fertilization.

    [0073] Use a 8 m denucleation needle controlled with Piezo pulse to slightly absorb the compound of spindle body-chromosome of NZW oocytes together with a little of cytoplasm (for short, karoplast), then use a 15 m bevel connection denucleation needle to transfer karoplast into inactivated sendai virus to treat for several seconds, and then transfer it to the transparent belt of denucleated BDF1 oocytes, so that it is closely contact with the oocytes plasmalemma of BDF1 to promote integration of the both, after integration, the reconstructed zygote is thoroughly washed with HTF liquid drop and then transferred to HTF in vitro fertilization.

    [0074] The 12 weeks of male mouse died for taking-off of the cervical spine, take the sperm from the epididymis and place it into HTF to absorb energy for an hour, and then add moderate sperm to liquid drop of the reconstructed oocytes for in vitro fertilization. When the fertilization is completed for 6 hours, dual prokaryotic germ cell will be picked out and moved to G1 nutrient solution for 72 hours, to observe the embryonic development under the microscope every day, 72 hours later, it will develop to reconstructed embryo of the blastaea and transferred to in vivo of a pseudopregnancy mother mouse for farrowing. 16 days later, conduct caesarean to the pregnant mother mouse, the viable newborn mouse will be cultivated.

    [0075] (2) Preparations of PB2T and PNT Mice

    [0076] Inject 5IU PMSG to abdominal cavities of the 6-8 weeks of NZW, BDF1 (The injection PMSG time of NZW mouse shall be about 2hours earlier than BDF) female mice, and then, re-inject 5IU HCG to abdominal cavities of them at an interval of 48 h, let it copulate with a 12-week male mouse in the cage. 18 hours later after HCG injection, recycle the zygote wrapped with cumulus cell from expansion part of the fallopian tube, and place it into the Ggamete operation liquid containing 0.1% hyaluronidase at the temperature of 37 in the incubater where 5% CO2 is properly saturated, until the cumulus cell becomes loose (2-3min). The oocytes after degranulation shall be placed into an incubator for recovering for 30 min.

    [0077] Place the zygote of NZW and BDF1 into the Ggamete operation liquid containing CB in the microscopy room, 10 minutes later, use an oocytes-holding needle to hold a NZW zygote, and make the polar at the position of 12 O'clock. Use a 8 m denucleation needle controlled with Piezo pulse to absorb PB2 (pay attention to keep completeness of the plasmalemma), and then use a 15 m bevel connection denucleation needle to transfer PB2 into inactivated sendai virus to treat for several seconds, and then transfer it to the transparent belt of the BDF1 oocytes that female pronucleus has been removed, so that it is closely contact with the BDF1 oocytes plasmalemma to promote integration of the both, after integration, the reconstructed zygote is thoroughly washed with G1 liquid drop and then transferred to G1 for cultivating.

    [0078] Use an oocytes-holding needle to remove the NZW zygote of the second polar, and use a 15 m bevel connection denucleation needle to slightly absorb the male & female dual pronucleus, and transfer it into inactivated sendai virus to treat for several seconds, and then transfer it to the transparent belt of the BDF1 oocytes that male & female dual pronucleus has been removed, so that it is closely contact with the oocytes plasmalemma of BDF1 to promote integration of the both, after integration, the reconstructed zygote is thoroughly washed with G1 liquid drop and then transferred to G1 for cultivating.

    [0079] Observe the embryonic development under the microscope every day. 72 hours later, it will develop to reconstructed embryo of the blastaea and transferred to in vivo of a pseudopregnancy mother mouse in estrus synchronization for farrowing. 16 days later, conduct caesarean to the pregnant mother mouse, the viable newborn mouse will be cultivated.

    [0080] 3. Heterogeneity Comparison for the Four Mitochondria (PB1T, ST, PB2T and PNT) Replacement Mice () and Their Descendants

    [0081] Take mice tails from the four mitochondria replacement mice and their descendants, use a whole genome kit (TIANGEN, BEIJING) to extract DNA, and design the primers of 5-atggctactggattccatgg-3and 3-gctcctatgaagcttcatgg-5 to increase 920111102 series of products on the mitochondria. Compound biotin labeling marking primers of TTTGAAGCCGCAGCATGA (forward), ATTTATTTGGGGGAGTCAGAATGC (reversebiotin) to increase the second round of products for pyrosequencing. And the pyrosequencing primer is GAATAAACCCAGAAGAGAGT, operation of pyrosequencing shall be executed according to operating instructions for the instruments.

    [0082] 4. Comparison of the Genetic Characteristics of PB1 and Spindle, Germ Cell PB2 and Pronulcei

    [0083] Place the fresh oocytes and germ cell into the operation liquid drop containing 5 g/ml CB, then use a 15 m denucleation needle to take PB1, Spindle, PB2 and Pronuclei out, and transfer them into a PCR tube, use a use a whole genome kit to conduct single-cell increase, and then conduct comparative genomics chip detection (cGH) to the increased products, and compare whether the genetic characteristics of PB1 and spindle, PB2 and Pronulcei are consistent.

    The results show that:

    [0084] 1. PB1 and PB2 Have the Basis and Advantage (Relative to ST and PNT) That Can be Used for Treating Maternal Mitochondria Diseases.

    [0085] (1) Relative to Spindle and Pronuclei, PB1 and PB2 Carry Few Mitochondria

    [0086] Use a MitoTrackor fluorescence probe to mark the dyeing (FIG. 2), the results show that PB1 and PB2 carry little mitochondria, especially, and almost no mitochondria can be detected in PB1; while the corresponding partSpindle is surrounded with plenty of mitochondria, because movement of Spindle needs a lot of energy; the corresponding part of PB2Pronuclei is surrounded with more mitochondria, because of that after the oocytes being fertilized, the mitochondria will be sharply increased, at the same time, the female and male pronucleuses continuously close to prepare splitting, this process needs a lot of mitochondria to provide energy. Therefore, use PB1 to replace ST; use PB2 to replace PNT, the quantity of disease mitochondria carried to the reconstructed oocytes/embryo will be significantly reduced.

    [0087] (2) Epigenetic Inheritance of PB1 and SpindleChromosome, PB2 and Female Pronucleus is Consistent

    [0088] The immumohistochemical staining dyeing analysis results show that the epigenetic inheritance characteristics of PB1 and spindlechromosome are consistent, expressions of the epigenetic biomarkers of H3K9me3, H3P and 5mC antibody can be detected in PB1 and spindlechromosome (FIG. 3); the genetic characteristics of PB2 and Female Pronucleus are consistent, expressions of H3K9me3, acetyl H3, and 5mC can be detected in PB2 and Female Pronucleus (FIG. 4 ).

    [0089] 2. The Efficiency That PB1 and PB2 Provide Genomes to Birth Mitochondria Replacement Descendants Hasn't Significant Difference With That of ST, PNT and IVF Embryo

    [0090] In this invention, we have used mitochondria replacement research with a mouse as the model, and got reconstructed mice of PB1 and PB2, comparing with existing mitochondria replacement technology ST, PNT and conventional IVF, the acquisition efficiency hasn't significant difference, and comparing with ST, PNT and conventional IVF, the descendant's body weight and placenta weight also haven't significant difference (see FIG. 5).

    [0091] 3. PB1T Mitochondria Replacement Mouse Only Contains the Mitochondria of Cytoplasm Donor, that is, the Healthy Oocytes Cytoplasm Donor

    [0092] The pyrosequencing results show that PB1T mitochondria replacement mouse only contains the mitochondria of cytoplasm donor, without the mitochondria of genome donor, that is, heterogeneity of the mouse is 0%, and it is significantly less than heterogeneity of the ST mitochondria replacement mouse (5%); PB2T mitochondria replacement mouse contains few genome donor, that is, the mitochondria comes from the patient (1%), the value is significantly lower than heterogeneity of PNT mitochondria replacement mouse (25%).

    [0093] 4. The Genetic Characteristics of PB1 and SpindleChromosome, as Well as PB2 and Female Pronucleus are Consistent

    [0094] Using comparative genomics chip to detect oocytes/germ cell of human beings, the result show that the genetic characteristics of PB1 and spindlechromosome, PB2 and Female Pronucleus are consistent, with 23 chromosomes, no DNA breakage or increase (FIG. 7), which indicates the feasibility that the polar body genome restructured oocytes in this invention can be used for mitochondria replacement to treat maternal mitochondria genetic diseases.