Mitochondria targeting peptide
09540421 ยท 2017-01-10
Assignee
Inventors
Cpc classification
C12N9/0065
CHEMISTRY; METALLURGY
C12N9/1205
CHEMISTRY; METALLURGY
C07K2319/10
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a mitochondria targeting peptide, a fusion protein in which the peptide is bound to the carboxyl terminus of a protein transduction domain, a fusion protein in which the peptide is bound to the carboxyl terminus of a protein transduction domain and an antioxidant is bound to the carboxyl terminus of the peptide, an antioxidant composition and a composition for preventing or treating Parkinson's disease including the fusion protein in which the antioxidant is bound, a recombinant polynucleotide in which a polynucleotide coding a protein transduction domain, a polynucleotide coding the peptide, and a polynucleotide coding an antioxidant protein are sequentially bound, to an expression vector including the polynucleotide, and to a transformed host cell including the expression vector. The mitochondria targeting peptide according to the present invention targets mitochondria with high efficiency not only when the peptide exists alone but also when the peptide is bound to a protein transduction domain and/or to an antioxidant. Further, the peptide has a small size and is thus a very suitable targeting carrier. The peptide becomes processed when introduced into mitochondria, and thus stably delivers the drug carried by the peptide.
Claims
1. A mitochondria targeting peptide represented by the amino acid sequence of Formula 1 below:
[N-terminus-X.sup.1-LR-X.sup.2-LRK-X.sup.3-C-terminus] (SEQ ID NO: 15),[Formula 1] wherein X.sup.1 is absent, methionine, alanine, leucine, valine, or isoleucine; X.sup.2 is two identical alanines, leucines, valines, or isoleucines; and X.sup.3 is GPRLSRL (SEQ ID NO: 16), GPRLSRM (SEQ ID NO: 17), AA or AAL.
2. The peptide according to claim 1, wherein X.sup.1 is absent, methionine, alanine, or leucine (SEQ ID NO: 27).
3. The peptide according to claim 1, wherein X.sup.2 is two identical alanines or leucines (SEQ ID NO: 28).
4. The peptide according to claim 1, wherein X.sup.1 is leucine and X.sup.2 is two identical alanines (SEQ ID NO: 29).
5. The peptide according to claim 1, wherein the peptide is any one of SEQ ID NOS: 1 to 10.
6. A recombinant polynucleotide, wherein a polynucleotide encoding a protein transduction domain, a polynucleotide encoding a peptide of any one of claims 1 to 5, and a polynucleotide encoding an antioxidant protein are sequentially bound.
7. The recombinant polynucleotide according to claim 6, wherein the recombinant polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 13 or 14.
8. An expression vector comprising the polynucleotide of claim 6.
9. A host cell transformed by the expression vector of claim 8.
10. A fusion protein, wherein a peptide of any one of claims 1 to 5 is bound to the carboxyl terminus of a protein transduction domain.
11. The fusion protein according to claim 10, wherein a polyhistidine (poly-His) domain is bound to the carboxyl terminus of the fusion protein.
12. The fusion protein according to claim 10, wherein the protein transduction domain is one or more peptides selected from the group consisting of a transactivator of transcription (TAT) protein of HIV-1 virus, polyarginine, penetratin, PEP-1 peptide, and PEP-2 peptide.
13. The fusion protein according to claim 12, wherein the protein transduction domain is SEQ ID NO: 11 or 12.
14. The fusion protein according to claim 10, wherein an antioxidant is additionally bound to the carboxyl terminus of the peptide.
15. The fusion protein according to claim 14, wherein the antioxidant is superoxide dismutase 1 (SOD1), catalase, eosinophil peroxidase (EPX), glutathione peroxidase 2 (GPX), parkinson disease protein 2 (PARK2), leucine-rich repeat kinase 2 (LRRK2), or metallothionein.
16. The fusion protein according to claim 15, wherein the metallothionein is human metallothionein.
17. A pharmaceutical composition for treating Parkinson's disease comprising the fusion protein of claim 14, wherein the antioxidant is human metallothionein 1A.
18. A method for treating Parkinson's disease comprising administering a pharmaceutical composition for treating Parkinson's disease of claim 17 to a subject.
Description
DESCRIPTIONS OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
BEST MODE
(16) In an aspect of achieving the objectives, the present invention relates to a novel mitochondria targeting peptide represented by an amino acid sequence of Formula 1 below:
[N-terminus-X.sup.1-LR-X.sup.2-LRK-X.sup.3-C-terminus](SEQ ID NO: 15),[Formula 1]
(17) wherein
(18) X.sup.1 is absent or a hydrophobic amino acid;
(19) X.sup.2 is two identical hydrophobic amino acids; and
(20) X.sup.3 is GPRLSRL (SEQ ID NO: 16), GPRLSRM (SEQ ID NO: 17), AA or AAL.
(21) The amino acid sequences used in the present invention are abbreviated according to the nomenclature of IUPAC-IUB as follows:
(22) TABLE-US-00001 Alanine A Arginine R Asparagine N Aspartic acid D Cysteine C Glutamic acid E Histidine H Isoleucine I Leucine L Lysine K Methionine M Phenylalanine F Proline P Serine S Threonine T Tryptophan W Tyrosine Y Valine V Glutamine Q Glycine G
(23) As used herein, the term peptide refers to a polymer consisting of amino acids linked by amide bonds (peptide bonds).
(24) A peptide according to the present invention exhibits an effective mitochondria targeting activity by including a fragment which contains a sequence comprising a hydrophobic amino acid at the N-terminus and C-terminus. Here, a hydrophobic amino acid can be any hydrophobic amino acid, such as methionine, alanine, valine or leucine, although not limited thereto.
(25) Preferably in Formula 1, X.sup.1 may be absent, or methionine, alanine, or leucine, and X.sup.2 may be alanine or leucine. More preferably, X.sup.1 may be leucine and X.sup.2 may be alanine.
(26) A novel peptide of Formula 1 according to the present invention may be representatively any one of the following sequences 1 to 10:
(27) TABLE-US-00002 SEQIDNO:1: LLRAALRKAA; SEQIDNO:2: LLRAALRKAAL; SEQIDNO:3: LLRLLLRKAA; SEQIDNO:4: LLRLLLRKAAL; SEQIDNO:5: MLRAALRKGPRLSRL; SEQIDNO:6: LRAALRKGPRLSRL; SEQIDNO:7: ALRAALRKGPRLSRL; SEQIDNO:8: MLRAALRKGPRLSRM; SEQIDNO:9: LLRAALRKGPRLSRM; and SEQIDNO:10: ALRAALRKGPRLSRM.
(28) According to an exemplary embodiment of the present invention, a mitochondria targeting peptide according to the present invention has an alpha-helical structure and is amphiphilic (Example 2).
(29) The peptide of the present invention may include an additional amino acid sequence designed for a particular purpose of increasing stability of a targeting sequence, a tag, a labeled moiety, a half-life, or a peptide. Additionally, the peptide of the present invention may be linked to coupling partners such as effectors, drugs, prodrugs, toxins, peptides, carrier molecules, etc.
(30) The peptide of the present invention may be obtained by various methods well known in the art. In particular, it may be produced by genetic recombination and protein expression system, an in vitro synthesis via chemical synthesis such as peptide synthesis and cell-free protein synthesis.
(31) The peptide of the present invention may be produced in the form of a pharmaceutically acceptable salt. In particular, a salt may be formed by adding an acid. For example, a salt may be formed by adding a mineral acid (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, etc.), an organic carboxylic acid (e.g., acetic acid, haloacetic acid such as trifluoroacetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, and salicylic acid), and an organic sulfonic acid (e.g., methanesulfonic acid, and p-toluenesulfonic acid) containing sulfonic acid sugar esters such as an acidic sugar (e.g., glucuronic acid, galacturonic acid, gluconic acid, and ascorbic acid), an acidic polysaccharide (e.g., hyaluronic acid, chondroitin sulfate, and arginine acid), and chondroitin sulfate.
(32) A peptide of the present invention may be connected to an internalizing sequence, a protein transduction domain, or a cell membrane-penetrating protein so that it can effectively enter into a cell.
(33) Accordingly, in another aspect, the present invention relates to a fusion protein in which a peptide of Formula 1 is bound to the carboxyl terminus of a protein transduction domain.
(34) The protein transduction domain and the peptide of Formula 1 may be fused chemically or biologically by using techniques well known in the art without limitations.
(35) As used herein, the term, protein transduction domains refers to polypeptides, polynucleotides, carbohydrates, or organic/inorganic compounds which facilitate passing through lipid bilayers, micelles, cell membranes, organelle membranes, and vesicle membranes. The protein transduction domain includes a small portion of a protein which can pass through a cell membrane by a receptor-independent mechanism. By bonding with another molecule, a protein transduction domain can act to facilitate transporting a particular molecule from the extracellular space to the intracellular space or from the cytosol to the inside of an organelle.
(36) The protein transduction domain according to the present invention may be one or more peptides from the group comprising a transactivator of transcription (TAT) protein of HIV-1 virus, polyarginine, penetratin, a transcription regulatory protein of VP22 which is a structural protein of HSV-1, PEP-1 peptide, and PEP-2 peptide, although not limited thereto. Preferably, the protein transduction domain is a polypeptide of the following SEQ ID NO: 11 or 12:
(37) SEQ ID NO: 11: YGRKKRRQRRR
(38) SEQ ID NO: 12: YARAAARQARA.
(39) SEQ ID NO: 11 is a TAT protein transduction domain of HIV consisting of 11 amino acid sequences. Because its molecular weight is low, it is appropriate for fusion with a protein that needs to be transported to the intracellular space.
(40) A fusion protein according to the present invention exhibits targeting ability to localize inside mitochondria as well as permeating ability, and can be effectively used as a cargo molecule or a drug delivery system.
(41) Another aspect of the present invention relates to fusion protein in which a peptide of Formula 1 is bound to the carboxyl terminus of a protein transduction domain of the present invention and an antioxidant additionally is bound to the carboxyl terminus of the peptide.
(42) According to a specific embodiment of the present invention, a fusion protein consisting of a mitochondria targeting sequence and SEQ NO: 11 targeted mitochondria with a high score. Also, even when GFP and hMT1A are additionally bound, mitochondria is effectively targeted (Example 1).
(43) Further, according to a specific embodiment of the present invention, a fusion protein consisting of a mitochondria targeting sequence, SEQ NO: 11, and hTM1A are shown to be transported to mitochondria via a Western blot and immunocytochemical staining (Examples 6 and 7). Also, a long-term activity maintained in mitochondria was confirmed (
(44) In addition, according to a specific embodiment of the present invention, mitochondria targeting probability was predicted for a mitochondria targeting sequence according to the present invention which is bound not only to hMT1A, but also to intracellular antioxidant protein SOD1, catalase, EPX, GPX, and PARK2 or LRRK2 which are PD-related proteins, with TAT-MTS. Results showed that all proteins are targeted to mitochondria at almost 100% probability (Example 9).
(45) Therefore, a novel peptide fusion protein binding to a protein transduction domain according to the present invention is able to bind to compounds, drugs, antibodies, and other substances to be transported, and transport them into mitochondria. Substances which bind to the fusion protein are not limited to a certain kind, as long as they are able to bind to the fusion protein.
(46) Another aspect of the present invention relates to an antioxidant composition which includes a fusion protein consisting of a novel mitochondria targeting peptide, a protein transduction domain, and an oxidant.
(47) Since ROS is mostly produced in mitochondria, when a fusion protein according to the present invention, to which an antioxidant is bound, is transported into mitochondria, there is an advantage of maximizing effects of the antioxidant.
(48) The antioxidant according to the present invention may be, for example, SOD1, catalase, EPX, GPX, PARK2, LRRK2, or metallothionein. Preferably, the antioxidant according to the present invention is metallothionein. More preferably, the metallothionein is human metallothionein.
(49) As used herein, the term metallothionein (MT) refers to a cysteine-rich low molecule (3.514 kDa) consisting of 61 amino acids in a structure repeating cysteine-X-cysteine, cysteine-XX-cysteine, and cysteine-cysteine. Metallothionein refers to a protein which includes 20 cysteine residues that bind to a divalent metal ion. Metallothionein is overexpressed in stressful conditions such as heavy metals, starvation, heat, or infections. Metallothionein has been considered as an important biophylaxic means and is known to act in defense mechanism against oxidative stress. Commonly, biological defense against oxidative damage by ROS consists of proteins eliminating ROS, molecules isolating metal ions, and enzymes restoring damaged cellular components.
(50) In addition, it has been recently reported that metallothionein can protect cells and tissues from diabetes and diabetic complications in vitro and in vivo because of its anti-apoptotic and antioxidant capacities (K. G. Danielson et al., Proc Natl Acad Sci USA. 79 (1982) 2301-04). It has been reported that when metallothionein is overexpressed in MT null diabetic mice, diabetic cardiomyopathy is reduced, and impaired ischemic heart contraction is alleviated (A. Liang et al., Diabetes. 51 (2002) 174-181). Zinc also induces expression of metallothionein and protects mice from diabetic damages caused by hyperglycemia and progressive damages in beta cells of type 2 diabetes. It is also known that zinc-metallothionein is capable of blocking hydroxyl radicals in vitro and in vivo (C. G. Taylor et al., Biometals. 18 (2005) 305-312).
(51) According to an exemplary embodiment of the present invention, when a fusion protein including metallothionein of the present invention was administered to cells, cell viability was maintained, ATP production was increased, and tyrosine hydroxylase activity was recovered (Example 10). Additionally, when a fusion protein including human metallothionein was administered to Parkinson's cell models, mitochondrial activity was recovered (Example 11,
(52) In addition, according to an exemplary embodiment of the present invention, when a fusion protein including an antioxidant of the present invention is administered to mice, target-transport to mitochondria in liver cells (Example 12), and effects of eliminating ROS (Example 13) were confirmed.
(53) In addition, according to a specific embodiment of the present invention, when a fusion protein including an antioxidant according to the present invention is administered to mice of MPTP-derived Parkinson's animal models, mice recovered to the normal level in behavioral perspectives. Also, brain tissue analysis showed that dopaminergic neurons were recovered, thus confirming possible applications in treating Parkinson's disease by restoring cell damages, as well as preventing Parkinson's disease by preventing cell damages (
(54) Therefore, a fusion protein including an antioxidant according to the present invention may be used as an agent preventing or treating any disorders or diseases induced by oxidative stress. Especially, it may be used effectively for brain disorders such as Parkinson's disease and diabetic diseases described above.
(55) In another aspect, the present invention relates to a method for preventing or treating diseases induced by stress (e.g., brain disorders such as Parkinson's disease, diabetic diseases, etc.) by administering a pharmaceutical composition including a fusion protein including the antioxidant for preventing or treating diseases induced by oxidative stress to humans or mammals in need.
(56) As used herein, the term subject refers to mammals which include mice, cattle, humans, etc., although not limited thereto.
(57) In addition, a pharmaceutical composition of the present invention may be administered via various routes. Administration according to the present invention refers to introducing a prescribed substance into a patient via any appropriate method, and a route of administration of the conjugate may be any common methods as long as a drug reaches a target tissue. Particularly, the pharmaceutical composition may be administered via intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, and intrarectal administration, but is not limited thereto. However, because a peptide is digested when administered orally, it is preferred that a composition for oral administration is formulated to coat an active substance or to be protected against degradation in stomach. Preferably, it may be administered in the form of injections. Additionally, a pharmaceutical composition may be administered by any device which can transport active substances to target cells.
(58) Although a preferred dosage of a fusion protein including the antioxidant according to the present invention differs depending on conditions and weight of mammals including humans, severity of a disease, drug type, administration route, and duration, it may be appropriately selected by one of ordinary skill in the art. Further, any method of administration may be predicted. For example, it may be administered via oral, rectal, intravenous, subcutaneous, intrauterine epidural, or cerebrovascular injections, although not limited thereto.
(59) A fusion protein with or without an antioxidant according to the present invention may have a poly-His domain bound to the carboxyl terminus.
(60) A fusion protein including an antioxidant of the present invention has a feature of stably delivering drugs after transportation into mitochondria and processing.
(61) According to an exemplary embodiment of the present invention, the fusion protein according to the present invention was observed as a mature form of 7.6 kDa inside mitochondria after being processed by a matrix metalprotease, a mitochondrial matrix signal peptide processing enzyme. After being processed, the present invention was observed to become hMT1A, which includes His-tag and amino acid residues (AAGKL) (SEQ ID NO: 18) (Example 8).
(62) In another aspect, the present invention relates to a recombinant polynucleotide in which a polynucleotide encoding a protein transduction domain, a polynucleotide encoding the mitochondria targeting peptide, and a polynucleotide encoding an antioxidant protein are sequentially bound. The recombinant polynucleotide may be produced by conventional methods using known sequences encoding a novel polynucleotide encoding a protein transduction domain, a mitochondria targeting peptide, and an antioxidant protein. Especially, a recombinant polynucleotide of the present invention may include sequences of nucleic acids of SEQ ID NO: 13 or 14.
(63) In another aspect, the present invention relates to an expression vector including the polynucleotide.
(64) As used herein, the term expression vector refers to a recombinant vector capable of expressing a target peptide in an appropriate host cell and to a genetic construct which includes essential regulatory factors coupled to express genetic inserts. An expression vector of the present invention includes expression regulatory factors such as a promoter, an operator, and a start codon, which are generally included in expression vectors. A start codon and a stop codon are considered to be parts of nucleotide sequences encoding polypeptides, and are required to show activities when genetic constructs are introduced and be in frame with a coding sequence. A promoter of a vector may be constitutive or inductive.
(65) In addition, in order to facilitate separation of a protein from a cell culture, a signal sequence for emitting fusion polypeptide may be included. Specific initiation signals may also be required for effective translation of inserted nucleic acid sequences. These signals include ATG start codon and adjacent sequences. In some cases, external translation regulatory signals capable of including ATG start codon should be provided. The external translation regulatory signals and start codons may come from various natural or synthetic sources. Expression efficiency may be increased by introducing appropriate transcription or translation enhancers.
(66) As expression vectors, any conventional expression vectors may be used. For example, plasmid DNA, phage DNA, etc., may be used. Specific examples of plasmid DNA include commercial plasmids such as pUC18 and pIDTSAMART-AMP. Other examples of plasmids, which may be used in the present invention are, E. coli-derived plasmids (pYG601BR322, pBR325, pUC118 and pUC119), Bacillus subtilis-derived plasmids (pUB110 and pTP5), and yeast-derived plasmids (YEp13, YEp24, and YCp50). Specific examples of phage DNA are -phage (Charon4A, Charon21A, EMBL3, EMBL4, gt10, gt11, and ZAP). Further, animal viruses such as retrovirus, adenovirus, or vaccinia virus, or insect viruses such as baculovirus may be used. Since such expression vectors exhibit different protein expression amounts, formula, etc., depending on host cells, appropriate host cells should be selected.
(67) In another aspect, the present invention relates to a host cell transformed by the expression vector.
(68) As used herein, the term transformation refers to a stable genetic alteration in which the polynucleotide fragment is moved into the genome of a host cell for expressing targeted peptides.
(69) A fusion protein including an antioxidant according to the present invention may be prepared by methods including: (1) a step of transforming a host cell by a recombinant expression vector including a recombinant polynucleotide in which a polynucleotide encoding a protein transduction domain represented by an amino acid sequence of SEQ ID NO: 11 or 12 is bound to the 5 terminus of a polynucleotide encoding a mitochondria targeting sequence represented by an amino acid sequence selected from the group consisting of SEQ ID. NOS: 1 to 10, and a polynucleotide encoding an antioxidant protein is bound to the 3 terminus of a polynucleotide encoding a mitochondria targeting sequence represented by the amino acid selected from the group consisting of SEQ ID NOS: 1 to 10; (2) a step of expressing an antioxidant fusion protein by culturing the transformed host cell; and (3) a step of purifying an expressed antioxidant fusion protein.
(70) The transformation of the present invention may be performed by any transformation methods and may be easily performed according to conventional methods in the art. Generally, transformation methods include CaCl.sub.2 precipitation, Hananhan method of which efficiency is increased by using a reducing agent, dimethyl sulfoxide (DMSO) in CaCl.sub.2 method, electroporation, calcium phosphate precipitation, protoplast fusion, agitation using silicon carbide fiber, agrobacteria-mediated transformation, transformation using PEG, dextran sulfate, lipofectamine, drying/inhibition-mediated transformation, etc.
(71) The host cell is not limited to a certain kind, as long as it expresses a peptide of the present invention, and preferably may be a microorganism. Specific examples of a microorganism that may be used in the present invention are bacteria belonging to the genus Escherichia such as E. coli, bacteria belonging to the genus Bacillus such as Bacillus subtilis, bacteria belonging to the genus Pseudomonas such as Pseudomonas putida, and yeasts such as Schizosaccharomyces pombe and Saccharomyces cerevisiae, animal cells and insect cells.
(72) In another aspect, the present invention relates to the use of a fusion protein to which the antioxidant is bound in producing a pharmaceutical drug for preventing or treating Parkinson's disease.
MODE FOR INVENTION
(73) Hereinafter, the present invention will be described in more detail with reference to Examples, However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.
Example 1
Production of a Novel Mitochondria Targeting Sequence (MTS)
(74) In order to test mitochondria targeting probabilities, (TAT which is a protein transduction domain with cell membrane permeability), (TAT+mitochondria targeting sequence), and (TAT+mitochondria targeting sequence+protein to be targeted) are grouped and produced respectively. Hereinafter, a mitochondria targeting sequence is abbreviated as MTS.
(75) MTS according to the present invention is artificially produced, and the respective mitochondria targeting probabilities thereof are virtually predicted using a program MitoProt II. Specifically, as a mitochondria sequence according to the present invention, aMTS consisting of SEQ ID NO: 2 (LLRAALRKAAL) is used. As a comparison, sequences derived from malate dehydrogenase (mMDH), succinate dehydrogenase subunit alpha (SDHA), and mitochondria aldehyde dehydrogenase (ALDH2) were used. By binding TAT to each of the sequences, virtual TAT-MTS was produced, and mitochondria targeting probabilities were calculated and shown in Table 1B.
(76) In addition, in order to verify whether mitochondria targeting ability remains intact not only with TAT-MTS, but also with a protein bound, green fluorescence proteins (GFP) and human metallothionein 1A (hMT1A) proteins were additionally bound to the produced sequences. The binding structure was produced corresponding to the structure of TAT-MTS-hMT1A as shown in
(77) As shown in Table 1B, TAT-mMDH, TAT-SDHA, TAT-ALDH2, and TAT-aMTS to which a protein was not bound targeted mitochondria at a probability close to 100%. When GFP was bound, the mitochondria targeting probability of TAT was substantially decreased to 56.8%, but when TAT-ALDH and MTS were bound together, TAT was expected to target mitochondria over 98%. When hMT1A was bound, the mitochondria targeting probability was 67.7% for TAT-mMDH-hMT1A. 77.1% for TAT-SDHA-hMT1A, and 87.6% for TAT-ALDH2-hMT1A, thus confirming a decreased mitochondria activity. On the other hand, TAT-aMTS-hMT1A showed 100% mitochondria targeting probability, thus confirming an effective mitochondria targeting activity even when a transduction protein was bound instead of GFP.
(78) A comparison of the sequences and sizes of TAT, TAT-mMDH, TAT-SDHA, and TAT-ALDH2 are shown in
Example 2
Prediction on Mitochondria Targeting Sequence (MTS) Structure
(79) In order to verify if TAT-MTS is transported to mitochondria, a secondary structure of a TAT-MTS peptide was predicted and represented in
(80) Results from a COOT program showed that the TAT-MTS peptide exhibits an alpha-helical structure (
Example 3
Cell Culture
(81) SK-Hep1 cells (human hepatocellular carcinoma cells) were cultured in high glucose (4.5 g/L) Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics (100 g/mL of penicillin/streptomycin mixture) in a humidified atmosphere of 5% CO.sub.2 and 37 C. SH-SY5Y cells (human neuroblastoma cells) were cultured in DMEM/F12 supplemented with 10% FBs and antibiotics at 5% CO.sub.2 and 37 C.
Example 4
Transduction
(82) Hereinafter, the term TAT-MTS-hMT1A is abbreviated as TMhM.
(83) A synthetic gene of HindIII-TMhM-6His-BamHI (Bioneer, Korea) (6His disclosed as SEQ ID NO: 19) was cloned using pcDNA 3.1 (Progmega). A synthetic gene sequence is as follows (SEQ ID NO: 13):
(84) TABLE-US-00003 AAGCTTATGGGCTATGGCAGGAAGAAGCGGAGACAGCGA CGACGATTGTTGCGCGCTGCCCTGCGCAAGGCTGCCCTG ATGGACCCCAACTGCTCCTGCGCCACTGGTGGCTCCTGC ACCTGCACTGGCTCCTGCAAATGCAAAGAGTGCAAATGC ACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCCATG AGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGG GCATCAGAGAAGTGCAGCTGCTGTGCCCATCATCATCAT CATCATTAGGGATCC
(85) pcDNA3-TMhM plasmids were transduced into SK-Hep cells as 70% confluents on 6-well plates containing Superfect transduction reagents (QIAGEN, Valencia, Calif.). For 2 weeks, stable cells were selected using G418 (1000 g/mL). Plasmid pcDNA3.1-transduced cells were used as controls. Transduced cells were analyzed via an immunochemical method or Western blot.
Example 5
Production of Zn-TMhM Protein
(86) A synthetic gene of Nco I-TAT-aMTS-HindIII-hMT1A-XhoI (Bioneer, Korea) was cloned using pET28a(+) (Clontech, CA, USA). The synthetic gene sequence is as follows (SEQ ID NO: 14):
(87) TABLE-US-00004 CCATGGGCTATGGCAGGAAGAAGCGGAGACAGCGACGA CGATTGTTGCGCGCTGCCCTGCGCAAGGCTGCCCTGGGC AAGCTTATGGACCCCAACTGCTCCTGCGCCACTGGTGGC TCCTGCACCTGCACTGGCTCCTGCAAATGCAAAGAGTGC AAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGC CCCATGAGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGC AAAGGGGCATCAGAGAAGTGCAGCTGCTGTGCCCTCGAG
(88) For cloning other carrier proteins HindII was inserted between aMTS and hMT1A. pET28a-TMhM plasmid was transformed into an E. coli BL21 (DE) pLysS (Novagen, Madison, Wis.), and cultured for 4 hours at 37 C. with 50 g/mL of ampicillin in an LB medium until OD.sub.600 nm reached 0.40.6. In order to induce a protein expression, isopropyl-beta-D-thio-galactoside (IPTG, 1 mM) was added to the medium, and cells were cultured overnight at 26 C. In order to increase the stability of MT1A, 1 mM ZnSO.sub.4 (Sigma, St Louis, Mo.) was added during the culture. Cell pellets were collected by centrifugation, and dispersed in a lysis buffer in the presence of 100 mM of phenylmethylsulfonyl fluoride (PMSF). Subsequently, it was sonicated for 30 seconds for 8 times. The supernatant was filtered through a 0.45 m filter, and purified via immobilized metal affinity chromatography using Ni-NTA resin columns together with FPLC (Bio-Rad, Hercules, Calif.). Zn-TMhM proteins were prepared by removing salts from purified proteins via dialysis using a membrane (Spectrum Laboratories, CA) with a cutoff value of 3,500 mw with respect to phosphate buffered saline of pH 7.4 containing 20% glycerol and 1 mM PMSF. Prior to storing at 4 C., a protease inhibitor cocktail (Roche, Switzerland) was added in the protein preparation.
(89) Zn-TMhM proteins used in the present invention were confirmed as human MT1A via Maldi-TOF/Ms/Ms (
Example 6
Confirmation of Localization to Mitochondria
(90) In order to test whether TAT-MTS transports hMT1A to mitochondria, His-tag TMhM transduced with plasmids was overexpressed in SK-Hep1 cells. In particular, cells grown on glass cover slips of 6-well plates were treated with 2 M Zn-TMhM for an hour, and results were analyzed via a Western blot and a confocal laser scanning microscopy.
(91) Isolation of Mitochondria
(92) Mitochondria of SK-Hep1 cells were prepared via differential centrifugation. In particular, cells were obtained and homogenized in 1 mL of a mitochondrial isolation buffer solution (MIB, 0.25M sucrose, 0.025 M Tris, and 1 mM EDTA, pH 7.4). Cell homogenates were centrifuged at 3,000 rpm for 10 minutes, and supernatants were centrifuged at 9,500 rpm for 10 minutes. Mitochondrial pellets were redispersed using MIB, and the protein concentration was analyzed by a BCA method (Pierce, Rockford, Ill.).
(93) Western Blot Analysis
(94) Total cell lysates (30 g) or mitochondria lysates (10 g) were isolated by 15% SDS-PAGE, analyzed by a Western blot and enhanced using an electrochemiluminescence system (ECL, Amersham Bioscience, NJ). The primary antibody to 6His (SEQ ID NO: 19) (1:1000, Cell Signaling Technology, Beverly, Mass.) and the primary antibody to Hsp60 (1:1000, Santa Cruz) were obtained commercially. The HRP-conjugated secondary antibody was purchased at Cell Signaling Technology (Beverly, Mass.). Equivalent protein loading was confirmed by an anti-beta-actin antibody (Sigma Co., St. Louis, Mo.), and results are shown in
(95) As shown in
(96) Confocal Laser Scanning Microscopy
(97) Cells treated with 2 M Zn-TMhM for an hour were washed with DPBS and stained with MitoTracker Orange (Molecular Proves, Eugene, Oreg.) in a complete medium containing 10% FBS for 20 minutes until the final concentration reached 300 nM. Cells were fixed for 10 minutes using 4% ice-cold paraformalehyde and permeated using 0.1% Triton X-100. Cells were covered with 5% BSA in Tris-buffered saline for an hour and cultured with rabbit polyclonal 6His antibodies (6His disclosed as SEQ ID NO: 19) (Cell signaling Technology, Beverly, Mass., USA; 1:500). After washing, cells were detected using secondary antibodies conjugated to Alexa Fluor 488 (1:1000, Molecular Probes). The nucleus was stained with Hoechst (2 g/mL Molecular Probes, Eugene, Oreg.) in PBS for 5 minutes at room temperature. Then, slides were washed twice with PBS and enhanced in DAKO fluorescence mounting medium (DAKO corporation, Carpinteria, Calif.). Specimens were observed via a confocal laser scanning microscope (Carl Zeiss, Germany) at 405 nm, 488 nm and 555 nm for Hoechst, 6His (SEQ ID NO: 19), and MitoTracker, respectively, and results are shown
(98) As shown in
Example 7
Verification of Zn-TMhM Expressed and Purified in E. coli
(99) Expression and Purification of Zn-TMhM in E. coli
(100) In order to verify its potential as a prodrug of TMhM proteins, Zn-TMhM was expressed in E. coli and purified via affinity chromatography. In particular, TMhM proteins were expressed in E. coli in the presence of ZnSO.sub.4 and purified via Ni-NTA affinity columns. The purity of Zn-TMhM proteins were verified via Coomassie blue staining and a Western blot, and results are shown in
(101) As shown in
(102) Verification of Zn-TMhM Localization
(103) Next, Sk-Hep1 cells were cultured with recombinant Zn-TMhM (2 M) for an hour, and localization of Zn-TMhM was analyzed. Results are shown in
(104) As shown in
(105) In addition, to verify whether purified proteins maintain localization in mitochondria in two other kinds of cells (SK-Hep1 and SH-SY5Y), immunocytochemical staining of His-tag Zn-TMhM proteins was performed after Mitotracker staining, and results were observed via a confocal laser scanning microscope (400, Scale bar=10 m).
(106) As shown in
(107) Maintaining TAT-MTS Activity in Mitochondria
(108) Sk-Hep1 cells transfected with dsRed2-mito plasmids (dsRed2-mito-SK-Hep1) were prepared as stable cells. These cells allow observation of mitochondria without other treatments. dsRed2-mito-SK-Hep1 cells cultured on cover glass in a 35 mm plate were treated with Tat-aMTS-GFP (TM-GFP) proteins (final concentration of 2 M) for the times indicated in
(109) As shown in
Example 8
Verification of Intracellular Processing
(110) Since most MTS are removed from their precursor proteins after being transported to mitochondria, there are high possibilities that TAT-MTS may be processed by TMhM inside mitochondria, as predicted in
(111) As shown in
Example 9
Verification of Mitochondria Targeting of Various Proteins
(112) In order to verify if TAT-MTS exhibits cell permeability and mitochondria localization even when it is bound to other proteins, in silico analysis was performed. SOD1 which is an intracellular antioxidant protein, catalase, EPX, GPX, PARK2, LRRK2, and PARK2 or LRRK2 which are PD-related proteins were virtually conjugated with TAT-MTS as candidate protein drugs. Mitochondria targeting scores were calculated using MitoProtII.
(113) TABLE-US-00005 TABLE 1 TAT-aMTS Name Size (kDa) Probability Size (kDa) Probability MT1A 6.12 0.0028 8.97 0.9709 SOD1 15.94 0.0101 18.79 0.9993 Catalase 66.5 0.0616 69.35 0.9989 EPX 81.5 0.0269 83.9 0.9979 GPX 21.94 0.4122 24.79 0.9986 PARK2 51.65 0.0071 54.5 0.9995 LRRK2 286.15 0.0652 289 0.9996
(114) As shown in Table 1, all candidates exhibited almost 100% mitochondria targeting probabilities. Thus, it was observed that a mitochondria targeting sequence according to the present invention exhibits excellent mitochondria targeting activity, independent of substances conjugated (or bounded) thereto, and may be effectively used in drug delivery.
Example 10
Verification of Cell Viability and Effects on Tyrosine Hydroxylase
(115) Cell Viability Assessment (MTT Assay)
(116) MTT analysis is a method for measuring activity of mitochondria dehydrogenase in cells. SH-SY5Y cells on 96-well plates containing DMEM-F12 which consists of 0.5% FBS (110.sup.5 cells/well) were treated with 1 mM 1-methyl-4-phenyl-2,3-dihydropyridinium ion (MPP.sup.+) for 24 hours. Thereafter, cells were cultured with purified TMhM for 24 hours, and cultured with 0.2 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT, Sigma Co., St. Louis, Mo.) in PBS solution for 4 hours. MTT formazan precipitates formed by living cells were dissolved in 100 L of 0.04N HCL/isopropanol. The absorbance was measured at 540 nm using an ELISA microplate reader (Molecular Devices, Sunnyvale, Calif.).
(117) As shown in
(118) Intracellular ATP Measurement
(119) Using an ATP bioluminescent somatic cell assay kit (bioluminescent somatic cell assay kit, Sigma Co., St. Louis, Mo.), the intracellular ATP concentration was measured via a luciferin-luciferase reaction. In particular, 100 L of cell lysates were mixed with 100 L of a luciferin-luciferase reaction buffer solution and cultured for 10 minutes at 20 C. Fluorescent signals were measured by a LB 9501 Lumat luminometer (Berthold, Badwildbad, Germany). Signals were calculated after excluding background florescence values of control group wells containing a cell-free medium, and the amount of ATP was normalized to a protein concentration. All data were expressed in % control.
(120) As shown in
(121) Verification of Tyrosine Hydroxylase (TB) Expressions
(122) Expressions of tyrosine hydroxylase (TH) which is a restriction enzyme of dopamine synthesis as well as a survival marker for dopminergic neurons was verified by a Western blot. As a control group (CTL), a DPBS-treated group was used.
(123) As shown in 6D, 6His (SEQ ID NO: 19) and -actin demonstrated presence of Zn-TMhM and the loading control group, thus confirming that tyrosine hydroxylase expressions were not altered by Zn-TNhM.
Example 11
Verification of Recovery of Mitochondria Activity in Parkinson's Cell Models
(124) Therapeutic effects of Zn-TMhM were investigated using MPP.sup.+-induced SH-SY5Y cells. MPP.sup.+ is useful in inducing mitochondria damages in dopaminergic neurons to imitate Parkinson's disease. 24 hours before treating Zn-TmhM, MPP.sup.+ was treated, and recovery from MPP.sup.+-mediated damages was monitored.
(125) As shown in
Example 12
Verification of Mitochondria Targeting Effects in Mice
(126) Whether Zn-TMhM proteins are distributed and targeted to mitochondria when administered to mice was investigated. In particular, Zn-TMhM at a concentration of 2 mg/kg was administered to 57/BL6 mice via an intraperitoneal (IP) injection. Following sacrifice after 24 hours, mitochondria were isolated from liver tissues via differential centrifugation. Liver lysates and mitochondria fractions (liver mito) were investigated via SDS-PAGE and a Western blot. The used antibody was His-Tag (6His) (SEQ ID NO: 19). -actin and TOM20 served as the loading control groups for liver lysates and mitochondria fractions, respectively.
(127) As shown in
Example 13
Verification of ROS Effects of Mitochondria Targeting Sequences
(128) In order to verify whether Zn-TMhM proteins restore mitochondria functions, experiments were performed by over-expressing miR-24 on neurons with reduced mitochondria functions. The neurons were treated with Zn-TMhM (0 M, 0.1 M, and 2 M) for 24 hours and stained using 1 M DCF-DA and 0.5 M Hoechst 33342 at 37 C. for an hour. Florescence intensity was measured at 485 nm/535 nm for DCF-DA and 355 nm/460 nm for Hoechst 33342. Then, ROS amounts were quantified as a ratio of DCF-DA/Hoechst.
(129) As shown in
Comparative Example 1
(130) As Comparative Example, a mitochondria targeting sequence was produced using TAT, mouse metallothione (MT1), and MTS (ITMVSAL) (SEQ ID NO: 20). A schematic diagram of the sequence is shown in
(131) Metallothionein (MT), TAT-metallothionein (TMT), and TAT-MTS-metallothionein (TMM) each produced in E. coli were treated on ds-Red2-mito-transfected cells for 4 hours (
(132) As shown in
Example 14
Verification of Therapeutic Effects in Parkinson's Disease Animal Models
(133) Mice Breeding
(134) 8-week-old C57BL/6 male mice (19 g-22 g) were obtained, bred to adapt in laboratory animal breeding facilities in the College of Pharmacy at Kyung Hee University for more than a week, and used. Water and food were provided to be freely consumed, and breeding conditions maintained consistent temperature (222 C.) and humidity (533%). Meanwhile, a light-dark cycle (12 hours) was automatically controlled.
(135) Recovery of Dopaminergic Neurons in MPTP-Induced Parkinson's Disease Animal Models
(136) Whether symptoms of Parkinson's disease are recovered by isolated and purified Zn-TMhM proteins is verified by applying MPTP-induced Parkinson's disease animal models. In particular, PD mouse models (acute model, 20 mg/kg/injection, 4 times of intraperitoneal injections at 2-hour intervals) were prepared by injecting MPTP into the abdominal cavity of mice (8 weeks old, n=6). A week after injections, 3 g of Zn-TMhM was administered to right substantia nigra (SN) via a stereotaxic injection. 3 days after Zn-TMhM administration, a behavioral experiment (rotarod test) was conducted, and an experiment involving removing brain tissues was conducted. In particular, a behavioral experiment and a brain-tissue-related experiment were performed as described below.
(137) Therapeutic Effects of Zn-TMhM in MPTP-Induced Parkinson's Disease Animal Models
(138) Mice were divided into three groups: Group 1 (control group), Group 2 (MPTP-control group), and Group 3 (MPTP-Zn-TMhM administered group). 6 mice were assigned to each experimental group. 2 days before experiments began, pre-training for a rotarod test was conducted. On the experiment day (7D, Day 7), Group 1 was administered with 10 L of PBS, and Group 2 and 3 were administered with MPTP (20 mg/kg/injection) via intraperitoneal injections 4 times with 2-hour intervals. A week after injections, Zn-TMhM (3 g/2 L PBS) was administered in right substantia nigra via a stereotaxic injection. After 3 days, a rotarod test was conducted again. Treatment conditions, etc., of experimental animals are as shown in Table 2, and conditions in a time series order is as shown in
(139) TABLE-US-00006 TABLE 2 Mouse C57BL/6, male, 8 weeks, n = 18 in total (n = 6/group) Model Acute MPTP-included model Groups 1 PBS (~10 L), i.p. Control Stereotaxic (~2 L, PBS) (N = 6) 2 MPTP in PBS MPTP + PBS Stereotaxic (~2 L, PBS) 3 20 mg/kg/injection MPTP + Zn-TMhM Stereotaxic (Zn-TMhM 3 g/2 L) i.p. 4 times at 2 h intervals in a day
(140) Animals were treated as indicated in Table 2, and behavioral data were obtained via an experiment of
(141) Behavioral Experiment on Parkinson's Disease Animal Models
(142) Sensorimotor coordination was measured in Parkinson's disease animal models and a rotarod test was conducted to monitor hypokinesia.
(143) A rotating apparatus consists of a rotating rod (diameter of 7.3 cm) and 5 sections which allows respectively testing 5 mice at once. Mice were trained on a rotating apparatus twice a day for 2 days (rotating speed during training: 5 rpm on Day 1 and 20 rpm on Day 2). For the actual experiment on Day 3, the rotating speed was increased to 25 rpm. Time that mice endured on a rotating rod was measured, and each mouse was tested 3 times with 3-minute intervals. The maximum measurement time was set to 300 seconds.
(144) Preparation of Brain Tissue Samples and Immunocytochemical Analysis
(145) After conducting a rotarod test, an experiment was performed by anesthetizing mice via an intramuscular injection of Zoletil and removing brain tissues.
(146) Striatum (ST) and SN were dissected from brain tissues removed from 3 mice, and protein lysates were prepared. Tyrosine hydroxylase (TH) expressions were verified via a Western blot.
(147) Furthermore, remaining 3 mice were sacrificed for staining by transcardially administering 4% paraformaldehyde (PBS) and removing brain tissues. Brain tissues were fixed again with 4% paraformaldehyde and immersed in a 30% sucrose solution at 4 C. until they settled on the bottom. Frozen brain tissues were segmented as 30 m coronal segments using cryostat microtome (CM3000: Leica, Wetzlar, Germany). Segmented tissues were stored after immersing in storage media (glycerin, ethylene glycol, and PBS) at 4 C. for immunocytochemical analysis. Brain segments were put on cover slips, washed with PBS, and treated with 1% H.sub.20.sub.2 (PBS) for 15 minutes to eliminate any existing peroxidase activity. Dehydrated brain segments were reacted with the primary antibody, anti-tyrosine hydroxylase (anti-TH, millipore, Rabbit 1:2000), overnight, and reacted with the secondary antibody, biotinated anti-rabbit IgG, for 90 minutes. Next, the segments were reacted with an avidin-biotin complex solution (Vectastain ABCkit; Vector Laboratories, Burlingame, Calif.) for an hour, and stained using diaminobenzidine. Cytoprotective effects on dopaminergic neurons were verified and quantified by measuring optical density in striatum (ST) and counting TH-positive cells in substantia nigra (SN).
(148) Meanwhile, brains of a few mice in each group were not segmented, but isolated into cortex, cerebellum, striatum (ST) and substantia nigra (SN) respectively and conserved for a Western blot.
(149) Verification of Therapeutic Effects in Parkinson's Disease Animal Models
(150) The experimental results showed that Zn-TMhM injections restored motor abilities which were lost by MPTP intraperitoneal injections, to a level almost over the normal level (p<0.01), and that TH expressions which were reduced by MPTP was also recovered to a level close to the normal level when TH expressions in SN and ST tissues were analyzed by a Western blot (
(151) Results from a Western blot and immunostaining of brain tissues showed that the number of TH-positive neurons which was reduced by MPTP in SN and ST, was recovered by Zn-TMhM injections by over 90%. This confirms the effects of recovering damaged dopaminergic neurons, as well as protection of neurons by pre-treatment of Zn-TMhM (
(152) From the foregoing, one of ordinary skill in the art to which the present invention pertains could understand that the present invention may be embodied in other specific forms without changing technical concepts or essential features of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting in all respects. The scope of the present invention shall be construed to include not only the exemplary embodiments but also various alternatives, modifications, equivalent and other embodiments that may be included within the sprit and scope of the present invention as defined by the appended claims.