Modified adeno-associated virus vector compositions

09540659 ยท 2017-01-10

Assignee

Inventors

Cpc classification

International classification

Abstract

An adeno-associated virus filler component comprising a nucleic acid of between 3300 and 4200 nucleotides in length is disclosed.

Claims

1. An adeno-associated virus (AAV) filler component comprising a nucleic acid having at least 90% identity to SEQ ID NO:1 or SEQ ID NO:2, wherein the nucleic acid is between 3500 and 4000 nucleotides.

2. An adeno-associated virus (AAV) filler component consisting of a nucleic acid having at least 90% identity to SEQ ID NO:1 or SEQ ID NO:2.

3. The AAV filler component of claim 2, wherein the nucleic acid is between 3500 and 4000 nucleotides.

4. The AAV filler component of claim 1, wherein the nucleic acid is between 3700 and 3850 nucleotides.

5. A recombinant adeno-associated virus (AAV) vector comprising the filler component of claim 1 operably linked to an expression cassette, wherein the AAV vector is approximately 5 kb in length.

6. The AAV vector of claim 5, wherein the expression cassette comprises a promoter.

7. The AAV vector of claim 6, wherein the promoter is a pol III promoter.

8. The AAV vector of claim 7, wherein the promoter is a mU6 promoter.

9. The AAV vector of claim 5, further comprising a target sequence.

10. The AAV vector of claim 9, wherein the target sequence is an RNAi molecule.

11. The AAV vector of claim 5, wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8 serotype.

12. The AAV vector of claim 5, further comprising an inverted terminal repeat (ITR) of any one of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8.

13. The AAV filler component of claim 1, wherein the nucleic acid has at least 95% identity to SEQ ID NO:1 or SEQ ID NO:2.

14. The AAV filler component of claim 1, wherein the nucleic acid has at least 98% identity to SEQ ID NO:1 or SEQ ID NO:2.

15. The AAV filler component of claim 1, wherein the nucleic acid has at least 99% identity to SEQ ID NO:1 or SEQ ID NO:2.

16. The AAV filler component of claim 2, wherein the nucleic acid has at least 95% identity to SEQ ID NO:1 or SEQ ID NO:2.

17. The AAV filler component of claim 2, wherein the nucleic acid has at least 98% identity to SEQ ID NO:1 or SEQ ID NO:2.

18. The AAV filler component of claim 2, wherein the nucleic acid has at least 99% identity to SEQ ID NO:1 or SEQ ID NO:2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS AND TABLE

(1) FIG. 1 is a plasmid map of 5pFBAAVmU6miHDS1stuffer (9110 bp).

(2) FIGS. 2A-2R collectively provide the sequence of 5pFBAAVmU6miHDS1stuffer (Stuffer #1) (SEQ ID NO:3).

(3) FIGS. 3A-3C provide the sequences of the various individual components of 5pFBAAVmU6miHDS1stuffer (SEQ ID NO:1, 4-11).

(4) FIG. 4 is a graph showing relative Htt expression.

(5) FIG. 5 is a plasmid map of 5pFBAAVmU6miHDS1-stuffer.

(6) FIGS. 6A-6D collectively provide the plasmid sequence for 5pFBAAVmU6miHDS1-stuffer (SEQ ID NO:12).

(7) FIGS. 7A-7B collectively provide a stuffer sequence (Stuffer #2) (SEQ ID NO:2).

(8) FIG. 8. EM evaluation of full virions vs. empty virions. Two examples of empty virions are highlighted by the arrows. This prep had only 4% empty virions, which is quite low.

(9) FIG. 9. Silver stain to examine the capsid integrity of the purified virions. Several different miRNA-expressing constructs were engineered into the shuttle vector along with the intron I/II stuffer to generate near wild type genome size. The purified viruses show optimal VP1, VP2 and VP3 protein ratios.

(10) Table 1. % Packaging efficiencies of miR-intronI/II virions and % contaminants.

DETAILED DESCRIPTION

AAV Vectors and Expression Cassettes

(11) The viral vectors of the invention utilize an AAV vector. An AAV vector refers to an adeno-associated virus, and may be used to refer to the naturally occurring wild-type virus itself or derivatives thereof. The term covers all subtypes, serotypes and pseudotypes, and both naturally occurring and recombinant forms, except where required otherwise. As used herein, the term serotype refers to an AAV which is identified by and distinguished from other AAVs based on capsid protein reactivity with defined antisera, e.g., there are eight known serotypes of primate AAVs, AAV-1 to AAV-8. For example, serotype AAV-2 is used to refer to an AAV which contains capsid proteins encoded from the cap gene of AAV-2 and a genome containing 5 and 3 ITR sequences from the same AAV-2 serotype.

(12) Pseudotyped AAV refers to an AAV that contains capsid proteins from one serotype and a viral genome including 5-3 ITRs of a second serotype. Pseudotyped rAAV would be expected to have cell surface binding properties of the capsid serotype and genetic properties consistent with the ITR serotype. Pseudotyped rAAV are produced using standard techniques described in the art. As used herein, for example, rAAV1 may be used to refer an AAV having both capsid proteins and 5-3 ITRs from the same serotype or it may refer to an AAV having capsid proteins from serotype 1 and 5-3 ITRs from a different AAV serotype, e.g., AAV serotype 2.

(13) The abbreviation rAAV refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or rAAV vector). In one embodiment, the AAV expression vectors are constructed using known techniques to at least provide as operatively linked components in the direction of transcription, control elements including a transcriptional initiation region, the DNA of interest and a transcriptional termination region. The control elements are selected to be functional in a mammalian cell. The resulting construct which contains the operatively linked components is flanked (5 and 3) with functional AAV ITR sequences.

(14) By adeno-associated virus inverted terminal repeats or AAV ITRs is meant the art-recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the virus.

(15) The nucleotide sequences of AAV ITR regions are known. As used herein, an AAV ITR need not have the wild-type nucleotide sequence depicted, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. Additionally, the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV7, etc. Furthermore, 5 and 3 ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for excision and rescue of the sequence of interest from a host cell genome or vector.

(16) AAV ITRs can be excised from an AAV vector plasmid containing the same and fused 5 and 3 of a selected nucleic acid construct that is present in another vector using standard ligation techniques, such as those described in Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press Cold Spring Harbor, N.Y. (2001). For example, ligations can be accomplished in 20 mM Tris-Cl pH 7.5, 10 mM MgCl2, 10 mM DTT, 33 g/ml BSA, 10 mM-50 mM NaCl, and either 40 M ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0 C. (for sticky end ligation) or 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14 C. (for blunt end ligation). Intermolecular sticky end ligations are usually performed at 30-100 g/ml total DNA concentrations (5-100 nM total end concentration). AAV vectors which contain ITRs have been described in, e.g., U.S. Pat. No. 5,139,941. In particular, several AAV vectors are described therein which are available from the American Type Culture Collection (ATCC) under Accession Numbers 53222, 53223, 53224, 53225 and 53226.

(17) The adeno-associated virus preferentially packages a full-length genome, i.e., one that is approximately the same size as the native genome, and is not too big or too small. Many target nucleic acid sequences, or expression cassettes encoding target nucleic acid sequences, are very small. To avoid packaging of fragmented genomes, the present inventors designed and tested a nucleic acid sequence when linked to an expression cassette, resulted in a genome whose size was near-normal in length between the ITRs. The starting sequence was of mammalian origin, but was significantly modified to ensure that this filler component (also called a stuffer sequence) was devoid of enhancers, promoters, splicing regulators, noncoding RNAs or antisense sequences, among other things. In other words, the stuffer sequences are silent and confer no activity to the expression cassette.

(18) In the present invention, suitable DNA molecules for use in AAV vectors will include, for example, a stuffer sequence and an expression cassette encoding a siRNA molecule of the invention. Many expression cassettes are very small, for example, those expressing inhibitory RNAs (siRNAs and shRNAs). Thus, there is a need to add sequences to the cassette such that it makes up a full-length or near full-length AAV genome. If only the small genome was used in the AAV production, the recombinant virions would be heterogeneous and contain various size genomes. This is because the virus likes to package full length genomes so it would pick up other DNA fragments to fill that space. The stuffer cannot be too big, as AAV genomes above 105% of the wild-type genome size will generally not be packaged.

(19) In certain embodiments, the present invention provides an adeno-associated virus (AAV) filler component (also called a stuffer sequence) comprising a nucleic acid of between 3300 and 4200 nucleotides in length having at least 90% identity to SEQ ID NO:1 or SEQ ID NO:2.

(20) TABLE-US-00001 (SEQIDNO:1) GAATTCGGGCTATCCCAGGTTGCCTTGGTTCATGGCAAATGGGACGTTAAGAGGGCAGAGAGAAT ATGAACAGAAACTGTTCTAATATTGGTCATTTAATGTGTAAGTATTGTTCTTTTTTAAACCTCCTTC ATTTTTTTTCCAGGAATTGCTGGACACAGTGGCTTGGTGTGTGTCTGAGGACTGTAGGCCATGGCC CTAGGTTGTGGTTTTAGGTCTCAGGTGCTCTTCCTGGCTGTCTCCTTGCTTCTTTCCCATGTCCTCTT CTTTGTTTCCAGCCATTTCTCCCTTATGCTTAAGTTTGGTGCAGCAGGGTTTGGCTGCTCTCAGATT CCTGCTTCCTCAGATGCTGTAGTTGTCAGGCCCAGCGGGCTGGCAGCGGGATCAGGATCTGGCTAG GTTTGCTCTCACTGTGGCAGAGTAGGGGGAGGCGTGGGAGAGCACGTGTGACCCCAGGCCAGCTG TAGGGAGCATAGGCATGGTCACGTAGCCTTCAGGTCCTAGACTTTGTCTTCTCATGAGTATGGCTG TGTGTGTATGGTGAAAACTAGGTTCTACTTAGCCCAAGAAAATGGGCACATTTTGCATGTGGTTTC TGTAGAGAAATGCACTGGGTATCTGACATAGCCTGGCAGCATGCCTCCCTCAGGTAGGTTAGTCTC AGGCGGTGAAGCACGTGTGTCCAGCAAGAACTTCATATGTGGCATAAAGTCTCCGTTCTGTGAGGT GCTGGCAAATCACCACCACCGTCAAGAGGCTGAAGTGATTTTTGTCTAGGGAGGCAGGAAAGGCT TCCTGGAGTCAGCAGCCAGTAGGTGAAAGAGTAGATTGGAGACCTTCTTAATCATCACCGCCTCTT GTCTCAAGGGGTGCCAGGAAGCTGTGGAGGCTGAACCCATCTTATGCTGCCAGAGAGTGGGACAC CATGAGGGTCAGGTCAAGGGGTTGTACCTTGTTTGGTAGAGAATTAGGGGCTCTTGAAGACTTTGG ATGTGGTCAGGGGAGTGTATCATTTAGGAAGAGTGACCCGGTGAGGACGTGGGGTAGAGGAGGAC AGGTGGGAGGGAGTCCAGGTGGGAGTGAGTAGACCCAGCAGGAGTGCAGGGCCTCGAGCCAGGA TGGTGGCAGGGCTGTGAGGAGAGGCAGCCACCTGTGTGTCTGCGGAAGCAGGGGCAAGAGGGAA GAGGCCAGCAGCGTGCTGCCATCACCCAGCGACTGGCGTAGATTGTGAGAGACCATTCCCTGCTCT TAGGAGGGGCTGAGTTTTAGTTTTCTCTTGTTATACAATAAGCTTGGTATTTGTTTACAAAACATTT GTAAAGCTAAATCAAGGTTTGATAAGGCTTCTAGTTTTATTTAAGAAGTAATGTTGAAATAAATGT TTGTCCAATTCGCTTTGCTCATTTAAGGACTTTCAGTACAAACTGCAACAACAGGATTAGGATTTA AACGTTTCTGAGATGTTTTTACTCCTCAGAATTTCCCAGAATGTGATCTGGTTTTGATTTTCAAGCT TGCTGACCCAATAGGTTAACCCACAAGTTTTACGAAGACCATCTCAGTCCACTTACATCAACTGCC CATGCCACGGTTAAAGAGATCATCGACTGATGTTTGGCACAGCTTCCTCCCTCTTGGGTGGGCAAG CATTTGGAAGAGAAGGCTCCTATGGGTGAGAGTGGGGCACCAAAGTCTTCCCTGTCCCATCCCCTA GCTTGAGAAGCCCTTCTCTAATGTGGACTTTGTGCCGTTAGCATCGTTACTAGCTTGAAGTTGACCA TCTGGACGTACTTTCTGGTTTAGCCTCACAAGTGAGCAAGGAGGGTTGAGAGATGTGCTGTGAGGA ATGTGGGGCCCCAGCTGGCAGCAGGCTCTGGGTCAGGGGGGCAGGGACCACGGGCATACCTGACA GTGAGGAGGGTCTAGTAGGGGATCAGTTCCCCTGTTGTTCTTTAGAATTTTCTGGATATTCTTCTTT ATTGATTTTGGGATGTGAACAATAGAATCAACTTCTACTTGTAGATTGATTTAGGGAGAACTTATA CCTCAGATGTTAAGTCACCCTGTCCAGAATGTGGGATGCTTTCCTATTTGTTCAGAACTTTTTAAAT TACCTCAGAAGCACATGAAATTTAAAGGATTTTAAAAAAAACTTAAAGATTATTTCACATAGCTCT TGCACATTTCTTGATAAATGAATCCTCAGGTATTCCTCTGTTTTTGTTACTAATAGTTACTTCTTATG GGTTTTTTTTCCCCTGAAAATCATTTATCAAACGTATGTGGCTTATTTTCTGAAGGATGTTTGATAA TTTTGGAAGATATGAAAGTCTTCATATTTTACAAGGTTTGAGGTCTCTTTAAGCTGCATGGTTCTCA TGTCAGCTCCCAAAGCAGAAGACGGCATGTTGAAAAATGCCGTAGAGAAGATACTTCTTTTCCACC TGTTTTCAACTCATATCATCTTGAATTTCAGGGCACCITTCCATGCTCCTAGTGCTTGCTATCTGTTT ATTATTTTCCTTCCTGAATACCCTGAACTCCAGCATGTTCTGCTGTAATTCTGGCCTCCCTGGCATC TTGGACTCCTGTTTCCTTTGCTCTGTCATCCCCGCGGTCAGCTCCTGCTGCGCAGCTTCTCAGCTGA AGTGCGTTTGGAGTGCCTGGCGTGTCTTGCTGGATCTTTGAGTATTGCCTCTGGTTTCCTTGGTTCC TTCTGCTGAGTTGCTCAGCGTCTCCACTCCCCATTTCTTGTGTGGCCCTTCCTGCACTCCTCTGATTC CTTTTGTCTTCCCTGGTTTCTTGCTTTGGTTTCGAGTCTCCACAGAACTTTTGCAGCTCTTCTGAAGA CCTGGAAGCTTTTTCATCTTAATTCTCATCTCATGACCTCTTTTCCCTTCTTTGAGAGCTAGAACTTC CCATGGTGAACTTCTCTTTCCAGAATTCCATGCCTTCTTTTCCCTCCCACTTACCTGTTGTCCAGGA GAGGTCAGATTGCTGTGCATATTGGAGGAGAACCCTTTCTTCCCTGGGCTCTTCATCTCACATGAC ATCACCACATCACCTCGTTCCTTGGACCCTCAGTGGTGTCACTGCTGGATTTTTCTTTCCTTTGGCT GGCCTTAGGGCACACCCAGGTTGACTAGCGTAGTCATGGTATTTAGATCCACTCACATTTTCAGTT TCTGTGTCTGTCTCTTGCCTGCTTCTGACTTCGCCCAGAGAAAGCTTCTCTTTCACAAGGGTTCTTA GATTTATGTTCACTGAGCACCTTCTTTTCTGAGGCAGTGTTTTACCAATATTTATTTTCCTAGTCAGT CTCGCCTTACCTTTCTTGTTATGCATGTCTTTGGTCCTGACCCATTCTCTGAGTCTGTAAAATAGAA TTGCTGTATAATTTAATTACATGAAATCCTTTAGAATCTTAACACATCTTACACCTGATTTAATATT TTATTGTATCCAAATTGAACCAACCCTATGTGAATTTGACAGTGATTTCTCCCAGGGATCCTAGTGT ATAAGGAATAGGACTTAGTATTTTCTATTTTTTGATATACCACATACCAGATACTGATTATGATGG ACATTTAACCCTTTTTTCTCATTATGAAAGAAAGTTAGGAATTATTTCTTCCAGTAGCGCCAGTGTA ACCTGAAAGCCTTTGAAAGAGTAGTTTTTGTATAGCTATCTGAAAGGAATTTCTTTCCAAAATATTT TTCCAGTGCTGACAACAAACACGCAGACACACCCTGCAAGGTGAGTGTACGGCG (SEQIDNO:2) GGGCTATCCCAGGTTGCCTTGGTTCATGGCAAATGGGACGTTAAGAGGGCAGAGAGAATATGAAC AGAAACTGTTCTAATATTGGTCATTTAATGTGTAAGTATTGTTCTTTTTTAAACCTCCTTCATTTTTT TTCCAGGAATTGCTGGACACAGTGGCTTGGTGTGTGTCTGAGGACTGTAGGCCATGGCCCTAGGTT GTGGTTTTAGGTCTCAGGTGCTCTTCCTGGCTGTCTCCTTGCTTCTTTCCCATGTCCTCTTCTTTGTTT CCAGCCATTTCTCCCTTATGCTTAAGTTTGGTGCAGCAGGGTTTGGCTGCTCTCAGATTCCTGCTTC CTCAGATGCTGTAGTTGTCAGGCCCAGCGGGCTGGCAGCGGGATCAGGATCTGGCTAGGTTTGCTC TCACTGTGGCAGAGTAGGGGGAGGCGTGGGAGAGCACGTGTGACCCCAGGCCAGCTGTAGGGAG CATAGGCATGGTCACGTAGCCTTCAGGTCCTAGACTTTGTCTTCTCATGAGTATGGCTGTGTGTGTA TGGTGAAAACTAGGTTCTACTTAGCCCAAGAAAATGGGCACATTTTGCATGTGGTTTCTGTAGAGA AATGCACTGGGTATCTGACATAGCCTGGCAGCATGCCTCCCTCAGGTAGGTTAGTCTCAGGCGGTG AAGCACGTGTGTCCAGCAAGAACTTCATATGTGGCATAAAGTCTCCGTTCTGTGAGGTGCTGGCAA ATCACCACCACCGTCAAGAGGCTGAAGTGATTTTTGTCTAGGGAGGCAGGAAAGGCTTCCTGGAG TCAGCAGCCAGTAGGTGAAAGAGTAGATTGGAGACCTTCTTAATCATCACCGCCTCTTGTCTCAAG GGGTGCCAGGAAGCTGTGGAGGCTGAACCCATCTTATGCTGCCAGAGAGTGGGACACCATGAGGG TCAGGTCAAGGGGTTGTACCTTGTTTGGTAGAGAATTAGGGGCTCTTGAAGACTTTGGATGTGGTC AGGGGAGTGTATCATTTAGGAAGAGTGACCCGGTGAGGACGTGGGGTAGAGGAGGACAGGTGGG AGGGAGTCCAGGTGGGAGTGAGTAGACCCAGCAGGAGTGCAGGGCCTCGAGCCAGGATGGTGGC AGGGCTGTGAGGAGAGGCAGCCACCTGTGTGTCTGCGGAAGCAGGGGCAAGAGGGAAGAGGCCA GCAGCGTGCTGCCATCACCCAGCGACTGGCGTAGATTGTGAGAGACCATTCCCTGCTCTTAGGAGG GGCTGAGTTTTAGTTTTCTCTTGTTATACAATAAGCTTGGTATTTGTTTACAAAACATTTGTAAAGC TAAATCAAGGTTTGATAAGGCTTCTAGTTTTATTTAAGAAGTAATGTTGAAATAAATGTTTGTCCA ATTCGCTTTGCTCATTTAAGGACTTTCAGTACAAACTGCAACAACAGGATTAGGATTTAAACGTTT CTGAGATGTTTTTACTCCTCAGAATTTCCCAGAATGTGATCTGGTTTTGATTTTCAAGCTTGCTGAC CCAATAGGTTAACCCACAAGTTTTACGAAGACCATCTCAGTCCACTTACATCAACTGCCCATGCCA CGGTTAAAGAGATCATCGACTGATGTTTGGCACAGCTTCCTCCCTCTTGGGTGGGCAAGCATTTGG AAGAGAAGGCTCCTATGGGTGAGAGTGGGGCACCAAAGTCTTCCCTGTCCCATCCCCTAGCTTGAG AAGCCCTTCTCTAATGTGGACTITGTGCCGTTAGCATCGTTACTAGCTTGAAGTTGACCATCTGGAC GTACTTTCTGGTTTAGCCTCACAAGTGAGCAAGGAGGGTTGAGAGATGTGCTGTGAGGAATGTGG GGCCCCAGCTGGCAGCAGGCTCTGGGTCAGGGGGGCAGGGACCACGGGCATACCTGACAGTGAG GAGGGGTCTAGTAGGGGATCAGTTCCCCTGTTGTTCTTTAGAATTTTCTGGATATTCTTCTTTATTG ATTTTGGGATGTGAACAATAGAATCAACTTCTACTTGTAGATTGATTTAGGGAGAACTTATACCTC AGATGTTAAGTCACCCTGTCCAGAATGTGGGATGCTTTCCTATTTGTTCAGAACTTTTTAAATTACC TCAGAAGCACATGAAATTTAAAGGATTTTAAAAAAAACTTAAAGATTATTTCACATAGCTCTTGCA CATTTCTTGATAAATGAATCCTCAGGTATTCCTCTGTTTTTGTTACTAATAGTTACTTCTTATGGGTT TTTTTTCCCCTGAAAATCATTTATCAAACGTATGTGGCTTATTTTCTGAAGGATGTTTGATAATTTT GGAAGATATGAAAGTCTTCATATTTTACAAGGTTTGGGGTCTCTTTAAGCTGCATGGTTCTCATGTC AGCTCCCAAAGCAGAAGACGGCATGTTGAAAAATGCCGTAGAGAAGATACTTCTTTTCCACCTGTT TTCAACTCATATCATCTTGAATTTCAGGGCACCTTTCCATGCTCCTAGTGCTTGCTATCTGTTTATTA TTTTCCTTCCTGAATACCCTGAACTCCAGCATGTTCTGCTGTAATTCTGGCCTCCCTGGCATCTTGG ACTCCTGTTTCCTTTGCTCTGTCATCCCCGCGGTCAGCTCCTGCTGCGCAGCTTCTCAGCTGAAGTG CGTTTGGAGTGCCTGGCGTGTCTTGCTGGATCTTTGAGTATTGCCTCTGGTTTCCTTGGTTCCTTCTG CTGAGTTGCTCAGCGTCTCCACTCCCCATTTCTTGTGTGGCCCTTCCTGCACTCCTCTGATTCCTTTT GTCTTCCCTGGTTTCTTGCTTTGGTTTCGAGTCTCCACAGAACTTTTGCAGCTCTTCTGAAGACCTG GAAGCTTTTTCATCTTAATTCTCATCTCATGACCTCTTTTCCCTTCTTTGAGAGCTAGAACTTCCCAT GGTGAACTTCTCTTICCAGAATTCCATGCCTTCTTTTCCCTCCCACTTACCTGTTGTCCAGGAGAGG TCAGATTGCTGTGCATATTGGAGGAGAACCCTTTCTTCCCTGGGCTCTTCATCTCACATGACATCAC CACATCACCTCGTTCCTTGGACCCTCAGTGGTGTCACTGCTGGATTTTTCTTTCCTTTGGCTGGCCTT AGGGCACACCCAGGTTGACTAGCGTAGTCATGGTATTTAGATCCACTCACATTTTCAGTTICTGTGT CTGTCTCTTGCCTGCTTCTGACTTCGCCCAGAGAAAGCTTCTCTTTCACAAGGGTTCTTAGATTTAT GTTCACTGAGCACCTTCTTTTCTGAGGCAGTGTTTTACCAATATTTATTTTCCTAGTCAGTCTCGCCT TACCTTTCTTGTTATGCATGTCTTTGGTCCTGACCCATTCTCTGAGTCTGTAAAATAGAATTGCTGT ATAATTTAATTACATGAAATCCTTTAGAATCTTAACACATCTTACACCTGATTTAATATTTTATTGT ATCCAAATTGAACCAACCCTATGTGAATTTGACAGTGATTTCTCCCAGGGATCCTAGTGTATAAGG AATAGGACTTAGTATTTTCTATTTTTTGATATACCACATACCAGATACTGATTATGATGGACATTTA ACCCTTTTTTCTCATTATGAAAGAAAGTTAGGAATTATTTCTTCCAGTAGCGCCAGTGTAACCTGAA AGCCTTTGAAAGAGTAGTTTTTGTATAGCTATCTGAAAGGAATTTCTTTCCAAAATATTTTTCCAGT GCTGACAACAAACACGCAGACACACCCTGCAAGGTGAGTGTACGGCG

(21) In certain embodiments, the present invention provides an adeno-associated virus (AAV) filler component consisting of a nucleic acid of between 3300 and 4200 nucleotides in length having at least 90% identity to SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the filler component consists of at least 90% identity with SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the filler component has 95% identity, 98% identity, 99% identity, or even 100% identity with SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the filler component has a length of about 3500-4000 nucleotides, or of about 3700-3850 nucleotides. In the present invention, the filler component is silent in terms of biological activity, in that it is devoid of enhancers, promoters, splicing regulators, noncoding RNAs, antisense sequences, or coding sequences.

(22) The term nucleic acid refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base that is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues. A nucleic acid fragment is a portion of a given nucleic acid molecule.

(23) A nucleotide sequence is a polymer of DNA or RNA that can be single-stranded or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. The terms nucleic acid, nucleic acid molecule, nucleic acid fragment, nucleic acid sequence or segment, or polynucleotide are used interchangeably and may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.

(24) The invention encompasses isolated or substantially purified nucleic acid compositions. In the context of the present invention, an isolated or purified DNA molecule or RNA molecule is a DNA molecule or RNA molecule that exists apart from its native environment and is therefore not a product of nature. An isolated DNA molecule or RNA molecule may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell. For example, an isolated or purified nucleic acid molecule or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In one embodiment, an isolated nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5 and 3 ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Fragments and variants of the disclosed nucleotide sequences are also encompassed by the present invention. By fragment or portion is meant a full length or less than full length of the nucleotide sequence.

(25) Naturally occurring, native, or wild-type is used to describe an object that can be found in nature as distinct from being artificially produced. For example, a protein or nucleotide sequence present in an organism (including a virus), which can be isolated from a source in nature and that has not been intentionally modified by a person in the laboratory, is naturally occurring.

(26) Genome refers to the complete genetic material of an organism.

(27) A vector is defined to include, inter alia, any viral vector, as well as any plasmid, cosmid, phage or binary vector in double or single stranded linear or circular form that may or may not be self transmissible or mobilizable, and that can transform prokaryotic or eukaryotic host.

(28) AAV ITRs

(29) An AAV virus or AAV viral particle refers to a viral particle composed of at least one AAV capsid protein (preferably by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide. If the particle comprises heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as rAAV.

(30) In one embodiment, the AAV expression vectors are constructed using known techniques to at least provide as operatively linked components in the direction of transcription, control elements including a transcriptional initiation region, the DNA of interest and a transcriptional termination region. The control elements are selected to be functional in a mammalian cell. The resulting construct which contains the operatively linked components is flanked (5 and 3) with functional AAV ITR sequences.

(31) By adeno-associated virus inverted terminal repeats or AAV ITRs is meant the art-recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the virus. AAV ITRs, together with the AAV rep coding region, provide for the efficient excision from plasmids expressing them.

(32) The nucleotide sequences of AAV ITR regions are known. As used herein, an AAV ITR need not have the wild-type nucleotide sequence depicted, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. Additionally, the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, etc. Furthermore, 5 and 3 ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for excision and rescue of the sequence of interest from a vector, and to package the desired genome into the AAV virion.

(33) In one embodiment, AAV ITRs can be derived from any of several AAV serotypes, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, etc. Furthermore, 5 and 3 ITRs which flank a selected nucleotide sequence in an AAV expression vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for excision and rescue of the sequence of interest from a vector, and to allow packaging of the desired genome into the AAV virion.

(34) In certain embodiments, the present invention provides an adeno-associated virus (AAV) vector comprising the filler component as described above operably linked to an expression cassette. In certain embodiments, the expression cassette comprises a promoter. In certain embodiments, the promoter is a pol III promoter. In certain embodiments, the promoter is a mU6 promoter. In certain embodiments, the AAV vector further comprising a target sequence. In certain embodiments, the target sequence is an RNAi molecule.

(35) Expression cassette as used herein means a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, which may include a promoter operably linked to the nucleotide sequence of interest that may be operably linked to termination signals. The coding region usually codes for a functional RNA of interest, for example an RNAi molecule. The expression cassette including the nucleotide sequence of interest may be chimeric. The expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.

(36) Double-stranded RNA (dsRNA) can induce sequence-specific posttranscriptional gene silencing in many organisms by a process known as RNA interference (RNAi). RNA fragments are the sequence-specific mediators of RNAi. Interference of gene expression by these RNA interference (RNAi) molecules is now recognized as a naturally occurring strategy for silencing genes in the cells of many organisms.

(37) Certain embodiments of the present invention provide a vector that encodes an isolated RNAi molecule. As used herein the term encoded by is used in a broad sense, similar to the term comprising in patent terminology. RNAi molecules include siRNAs, shRNAs and other small RNAs that can or are capable of modulating the expression of a target gene, for example via RNA interference. Such small RNAs include without limitation, shRNAs and miroRNAs (miRNAs).

(38) Operably-linked refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one of the sequences is affected by another. For example, a regulatory DNA sequence is said to be operably linked to or associated with a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.

(39) Operably linked nucleic acids are nucleic acids placed in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, operably linked DNA sequences are DNA sequences that are linked are contiguous. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.

(40) The invention will now be illustrated by the following non-limiting Examples.

Example 1

(41) A plasmid FBAAVmU6miHDS1 stuffer was generated that included AAV2 ITRs, mU6 promoter, miHDS1 target sequence, filler component stuffer, and an AAV backbone (FIG. 1). The sequence for 5pFBAAVmU6miHDS1 AAVstuffer is provided in FIG. 2, and the sequences for the individual components of the plasmid are provided in FIG. 3. The full-length filler component (stuffer sequence) consisted of 3776 nucleotides.

Example 2

(42) The in vivo silencing efficiency of a vectors expressing miHDS1 was compared. Four vectors were constructed: (1) a vector expressing a control sequence (miSAFE) and containing a control sequence (eGFP), (2) a vector expressing the target sequence (miHDS1) and containing a control sequence (eGFP), (3) a vector expressing a control sequence (miSAFE) and containing the stuffer sequence described in Example 1, and (4) a vector expressing the target sequence (miHDS1) and containing the stuffer sequence described in Example 1.

(43) (1) AAV2/1 mU6miSAFE-eGFP (4.81E12 g/ml)

(44) (2) AAV2/1 mU6miHDS1-eGFP (4.81E12 g/ml)

(45) (3) AAV2/1 mU6miSAFE-stuffer (4.81E12 g/ml)

(46) (4) AAV2/1 mU6miHDS1-stuffer (4.81E12 g/ml)

(47) The sequences for miSAFE and miHDS1 have been previously discussed (see, PCT/US2012/024904, which is hereby incorporated by reference herein in its entirety). Wild type mice were injected in the striatum with the four vectors. Mice were sacrificed one month later and Htt expression was determined relative to Actb expression levels by QPCR. FIG. 4 shows that there was a 20% decrease in expression between the misafe/eGFP and the miHDS1/eGFP expression cassettes, whereas there was a 60% decrease in expression between the misafe/stuffer and the miHDS1/stuffer expression cassettes, i.e., a 60% decrease in expression when the stuffer was used.

Example 3

(48) A plasmid 5pFBAAVmU6miHDS1stuffer was generated that included AAV2 ITRs, mU6 promoter, miHDS1 target sequence, filler component stuffer, and an AAV backbone (FIG. 5). The sequence for the plasmid 5pFBAAVmU6miHDS1AAV-stuffer is provided in FIG. 6. The sequence for the stuffer (Stuffer #2) is provided in FIG. 7.

Example 4

(49) One of the considerations with AAV packaging is maintaining optimal genome size. When this occurs, the ratio of virions that form which are lacking genomes are minimized. Experiments were performed testing the packaging efficiency of the new stuffer sequences and found high efficiency packaging. For example, see Table 1 Average empty and FIG. 8). It was also measured if genetic material that was packaged contained non-miRNA:intron stuffer sequences. It was found that the incorporation of unintended genomic material used in virus production was extremely low (Cap/rAAV, Amp/rAAV, Gent/rAAV). Finally, the quality of the viruses were analyzed by Silver Stain after polyacrylamide gel electrophoresis and found to contain the appropriate proportions of the various capsid proteins (VP1, VP2, and VP3; FIG. 9). In summary, the intron I/II stuff sequence allows optimal packaging of desired transgenes into AAV capsids.

(50) All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

(51) The use of the terms a and an and the and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

(52) Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.