METHOD OF PRODUCING LEAFY BIOMASS

Abstract

A method for producing leafy biomass from undifferentiated plant cells, the method comprising providing undifferentiated plant cells, contacting them with an agent that promotes differentiation of the cells into leafy tissue and growing the cells in a temporary liquid immersion culture system. This method of the invention may be used to produce polypeptides, and natural medicinal products, and can be used to capture carbon dioxide.

A method of producing a polypeptide in plant cells in vitro comprising:

providing undifferentiated plant cells containing chloroplasts that carry a transgenic nucleic acid molecule encoding the polypeptide, wherein the plant cells display homoplastomy; and propagating the cells according to the above method to produce leafy biomass containing the polypeptide.

Claims

1-16. (canceled)

17. A method for producing leafy biomass from undifferentiated plant cells, the method comprising providing undifferentiated plant cells, contacting them with an agent that promotes differentiation of the cells into leafy tissue and growing the cells in a temporary liquid immersion culture system.

18. A method according to claim 17, wherein the plant cells are cells from a monocotyledon which is corn, rye, oat, millet, sugar cane, sorghum, maize, wheat, or rice, or a dicotyledon which is tobacco, tomato, potato, bean, soybean, carrot, cassava, or Arabidopsis.

19. A method according to claim 17 wherein the plant cells are from a medicinal plant in which a main medicinal product is produced in the leaves, the plant being selected Atropa sp, Hyoscyamus sp, Datura sp, Papaver sp, Scopolia sp, Digitalis sp, Macuna sp, Taxus sp, Camptotheca sp, Cephalotaxus sp, and Catharanthus sp. or Artemisia sp.

20. A method according to claim 17 wherein the plant cells are from an energy crop which is selected from Miscanthus sp, Jatropha sp, Panicum sp, Willow, Palm tree, Maize, Cassava, or Poplar.

21. A method according to claim 17, wherein the agent that promotes differentiation of the cells into leafy tissue is a plant hormone.

22. A method according to claim 21, wherein the plant hormone is a cytokinin, the cytokinin being selected from any of a natural or artificial cytokinin belonging to the adenine-type or the phenylurea-type.

23. A method according to claim 22 wherein the cytokinin is any of adenine, kinetin, zeatin, 6-benzylaminopurine, diphenylurea, thidiazuron (TDZ) or their respective derivatives which have cytokinin activity.

24. A method according to claim 21 wherein the agent is used in combination with another plant hormone.

25. A method according to claim 17, wherein the agent is added in the culture medium at a concentration which is from 0.01 to 100 M or from 0.1 to 10 M, and the agent is added at the start or during the temporary liquid immersion culture, and wherein the immersion time varies from 1 to 30 minutes every 2 to 24 hours or from 1 to 10 minutes every 2 to 6 hours.

26. A method according to claim 17, wherein the volume of liquid in the temporary liquid immersion culture is one selected from 1 to 10,000 liters, 1 to 5,000 liters, 1 to 1,000 liters, or 1 to 500 liters, and wherein the respective size of the vessel containing the temporary liquid immersion culture system is 1 to 10,000 liters, 1 to 5,000 liters, 1 to 1,000 liters, or 1 to 500 liters.

27. A method according to claim 17 wherein the plant cells are not genetically engineered.

28. A method according to claim 17 wherein the plant cells are genetically engineered to express a polypeptide.

29. A method of producing a polypeptide in plant cells in vitro comprising: providing undifferentiated plant cells containing chloroplasts that carry a transgenic nucleic acid molecule encoding the polypeptide, wherein the plant cells display homoplastomy propagating the cells according to the method of claim 17 to produce leafy biomass containing the polypeptide, wherein the amount of light available and/or the amount of sucrose available is controlled to optimize production of the polypeptide; and obtaining the polypeptide from the leafy biomass, the polypeptide being a therapeutic polypeptide, an enzyme, a growth factor, an immunoglobulin, a hormone, a structural protein, a protein involved in stress responses of a plant, a biopharmaceutical, or a vaccine antigen.

30. A method according to claim 29, and wherein the step of providing the undifferentiated cells comprises introducing the transgenic nucleic acid molecule into a chloroplast of a plant cell, inducing the plant cell containing the transgenic nucleic acid molecule to form a callus of undifferentiated cells, and propagating the callus under conditions effective to achieve homoplastomy.

31. A method according to claim 29 wherein homoplastomy is achieved using antibiotic selection, which is selection with spectinomycin, streptomycin or kanamycin.

32. (canceled)

33. Leafy biomass obtained by the method of claim 17.

34. A method for obtaining a component present in leafy biomass, the method comprising producing leafy biomass according to the method of claim 17, and obtaining the component from the leafy biomass, wherein the component is obtained by its secretion by the leafy biomass or by extraction from the leafy biomass.

35. A method according to claim 34 wherein the component is endogenous or exogenous, the component being a medicinal product, a recombinantly expressed polypeptide, a carbohydrate, a lipid, an oil, a volatile aromatic compound, an antioxidants, a pigment, a flavor, or a flavor precursor.

36. A method according to claim 34 wherein the component is processed into a further product, which is a biofuel, food stuff or medicinal product.

37. (canceled)

38. A method of capturing carbon dioxide, the method comprising carrying out the method of claim 17.

39-43. (canceled)

Description

[0137] The present invention will now be described in more detail with reference to the following non limiting Examples and Figures.

[0138] FIG. 1. Southern blot analysis of the transplastomic GFP-6 line.

[0139] (A) Physical map of wild-type Nicotiana tabacum petit Havana (Wt-pt ONA) and transformed (T-pt ONA) tobacco plastome in the targeted chloroplast region. Arrows below each map indicate the predicted ONA fragment sizes after Bglll digestion of respective genomic ONA. Vector sequence is indicated in white, whereas the tobacco plastome sequence is in stripes. (B) Southern blot analysis after digestion of the total genomic ONA with Bglll for the transgenic line GFP-6 (GFP-6) and wild-type tobacco.

[0140] Oigested genomic ONA was run on a 0.7% (w/v) agarose gel, transferred onto a nylon membrane and probed with Oig-labelled PCR fragment corresponding to the amplification of the targeted region with primers PHK40-F and rps12-out-R (black bar).

[0141] FIG. 2. GFP+ detection in transplastomic GFP-6 tobacco line.

[0142] GFP expression was (A) visualised in the GFP-6 homoplastomic line (GFP-6) under UV and visible light along with control wild-type (wt) tobacco plant. (B) Protein electrophoresis of soluble proteins from GFP-6 and wt lines. 5 g of total soluble protein extract of each plant were loaded onto a 12.5% (w/v) SOS-PAGE gel along with prestained protein marker (New England Biolabs, UK) and protein separation was visualised by silver staining. GFP was specifically detected by Western blotting using a specific anti-GFP antibody. Migration of prestained markers is also indicated.

[0143] FIG. 3. GFP+ expression in different transplastomic tobacco tissues.

[0144] Total soluble protein extracts from calli, cell suspensions and leaves from GFP-6 and wild-type tobacco were generated. For calli and cell suspensions, 5 g total soluble protein were loaded per lane onto a 12.5% (w/v) SOS-PAGE gel whereas only 1 g was loaded for leaves extracts. (A) corresponds to the silver-stained gel, whereas (B) represents the corresponding Western blot using a GFP antibody. GFP standards were purchased from Rache Life Science, UK and the Prestained Protein Marker from New England Biolabs, UK. The ladder size of the marker proteins are in kOa. Wt stands for Nicotiana tabacum Petit Havana, and E. coli corresponds to the protein extraction from 30 an E. coli KRX strain transformed with pFMGFP.

[0145] FIG. 4. Growth of GFP-6 transplastomic calli under different conditions.

[0146] Pictures of homoplastomic calli GFP-6 were taken after 4 weeks of growth at 25 C. Plates (A, B, C and D) were grown with 16/Sh light with similar intensity as for tobacco seedlings and (E, F, G and H) were grown in the dark. Only A, B, E and F contained 3% (w/v) sucrose in the media. All media contained 500 mg/L spectinomycin and 500 mg/L streptomycin. Fluorescence emission was detected at 520 nm following excitation at 490 nm using an Axiovert 200 M inverted microscope (Carl Zeiss, Goettingen, Germany) along with the Axiovision software (Version 3.0). Fluorescent exposure was 30 ms, 100 ms and 600 ms for A, D and E, H respectively. Microscope magnification was the same in A, D, E and H at 40.

[0147] FIG. 5. Detection of GFP+ in GFP-6 calli grown under different conditions.

[0148] Total soluble protein were extracted from light (L) or dark (D) grown calli as well as wild-type (Wt) grown under light and sugar. Presence of sucrose in media is indicated by (+) whereas sucrose-free media is described with (). 5 g of total soluble protein of the respective calli were loaded onto a 12.5% (w/v) SOS-PAGE gel (L, L+, D+, D, wt) and total protein content (A) was detected by silver staining. M represents the Prestained Protein Marker (New England Biolabs, UK) and corresponding sizes are indicated on the left in kDa. (B) GFP+ presence was specifically detected with an anti-GFP antibody. GFP standards (Upstate, USA) were added in the quantities indicated in nanograms.

[0149] FIG. 6. GFP+ expression in newly formed green biomass from a temporary immersion bioreactor.

[0150] After a 6-weeks incubation period, tobacco biomass of the GFP-6 line (A) was removed from the temporary immersion bioreactor. Total proteins were extracted from newly formed leaves using the acetone extraction protocol and loaded (B) onto a 10% (w/v) SOS-PAGE gel along with prestained SOS-PAGE standard low range (Bio-Rad Laboratories, UK). Proteins from wild-type (wt) and GFP-6 line (GFP-6) were visualised with Coomassie Blue staining. Different dilutions of acetonic powder were analysed by immunoblotting (C) with an anti-GFP antibody and compared to known quantity of GFP protein (Upstate, USA).

[0151] FIG. 7. GFP detection during the acetone precipitation protocol.

[0152] Western blot representing the GFP presence in several samples from different steps of the acetone extraction protocol. Pellets were resuspended directly in the loading buffer whereas washes were dried overnight in a speedvac (Savant, N.Y., USA) before addition of the loading buffer. Only 5 I of pellet (P) sample were loaded while all supernatants from washes (W) 1 to 4 were added.

[0153] FIG. 8. Dry and fresh weight of Nicotiana tabacum Petit Havana cell suspensions.

[0154] Fresh and dry weights of tobacco wild-type cells were determined every 2 days during a 18 day-growth period. Dry weight was measured after leaving fresh tobacco cells 24 h at 80 C. Measurements were done in triplicate.

EXAMPLE 1

Contained and High-Level Production of Recombinant Protein in Plant Chloroplasts Using a Temporary Immersion Bioreactor

[0155] Summary

[0156] Chloroplast transformation is a promising approach for the commercial production of recombinant proteins in plants. However, gene containment still remains an issue for the large-scale cultivation of transplastomic plants in the field. Here we have evaluated the potential of using tobacco transplastomic cell suspensions for the fully contained production of a model protein, a modified form of the green fluorescent protein (GFP+).

[0157] In transplastomic leaves GFP+ expression reached approximately 60% of total soluble protein (TSP). Expression in cell suspension cultures (and calli) was much less (1.5% of TSP) but still produced about 7.2 mg per litre of liquid culture. We further investigated the different factors influencing GFP+ production in calli and highlighted the importance of light as an input. Finally we describe the development of a novel protein production platform in which transgenic cell suspension cultures were placed in a temporary immersion bioreactor in the presence of Thidiazuron to initiate shoot formation. GFP+ yield reached an impressive 660 mg per L of bioreactor. This new production platform, combining the rapid generation of transplastomic cell suspension cultures and the use of temporary immersion bioreactors, is a promised raute for the fully-contained low-cost production of recombinant proteins.

[0158] Results

[0159] Generation of Homoplastomic Tobacco Shoots Expressing GFP+

[0160] The vector that was constructed to express GFP+ in tobacco chloroplasts is derived from pJST10, which was used to express TetC antigen in tobacco chloroplasts (Tregoning et al, 2003). Plasmid pJST10 targets the insertion of the expression and selection cassette between tobacco chloroplast genes rrn16S and rps12/7 (FIG. 1A). After bombardment, several spectinomycin-resistant shoots were produced from 10 independent bombardments and gfp+ integration was detected by PCR analysis in 4 shoots out of 6 analysed (data not shown). GFP-6 was selected for further experiments and submitted to 4 rounds of subculture on MS selective media.

[0161] To confirm that all chloroplasts of the GFP-6 line were transformed, total genomic ONA was extracted from a leaf of this plant, digested with 8glll and subjected to Southern blot analysis (FIG. 1). As expected a probe corresponding to the insertion site hybridised to a single band of 4.5 kb in the wild-type tobacco ONA. In contrast a 7.1-kb band was detected in the GFP-6 line which is consistent with insertion of the gfp+ gene and selectable marker. The lack of the 4.5 kb band in GFP-6 also indicated that GFP-6 was homoplastomic (FIG. 18).

[0162] GFP+ Expression in the GFP-6 Line

[0163] The tobacco GFP-6 line was grown on soil and expression of GFP+ tested by exposing plants to a UV/blue light source (FIG. 2A). A streng green fluorescence could be observed in GFP-6 but not in wild-type, indicating GFP+ expression in GFP-6. To confirm accumulation of GFP, total soluble proteins were extracted from the GFP-6 and wild-type lines and separated on a SOS-PAGE gel (FIG. 28). An immunoblotting analysis using a specific anti-GFP antibody confirmed the accumulation of GFP+ and the lack of significant break-down products. Analysis of a silver-stained (FIG. 28) and Coomassie-blue stained gels (data not shown) revealed that GFP+, migrating at 27 kOa, was highly expressed and the dominant protein in the soluble extract.

[0164] Comparison of Expression Levels in Leaves, Calli and Cell Suspensions of the GFP-6 Tobacco Line

[0165] The TO seeds obtained from the GFP-6 line were germinated on MS plates in vitro and the resulting young leaves were used to generate corresponding transplastomic calli and cell suspensions. GFP+ expression was evaluated in the callus state, cell suspension culture and in leaves of the parental plant GFP-6 by SOS-PAGE (FIG. 3A) and semiquantitative immunoblotting analysis (FIG. 38) using known amounts of commercially available GFP as standards.

[0166] The most striking result of this comparison was the extremely high level of GFP+ expression within tobacco leaves (FIG. 3A) compared to the calli and cell suspensions. The immunoblots indicated that GFP+ expression in leaves was about 60% of TSP, which was equivalent to about 5 mg/g fresh weight, whereas expression in callus and cell suspensions was about 1.5% of TSP (FIG. 38). After taking into account the growth of the cell suspensions (Supplementary FIG. 8), the rate of GFP+ production in transplastomic cell suspensions was estimated to be approximately 0.4 mg/L/day.

[0167] Influence of Light and Sugar on GFP Expression in Calli

[0168] In order to assess the importance of light and exogenous sucrose on GFP+ expression, transplastomic calli from the GFP-6 line were grown for one month on Callus Induction Media (CIM) either with or without light and with or without sucrose (FIG. 4), but in the presence of 500 mg/L of spectinomycin to maintain selection. As seen in FIG. 4, calli growth was significantly promoted by the addition of sucrose, independent of the light intensity. When both light and sugar were available to the transplastomic calli, a large number of small chloroplasts/plastids expressing GFP+ could be identified, which were dispersed within the cytosol (FIG. 4A). If light or sugar were not supplied to the calli, GFP fluorescence decreased and the number of chloroplasts/plastids declined and localised to the centre of the cell (FIGS. 40 and 4E). No GFP expression was detected in calli grown in the absence of light and sugar (FIG. 4H).

[0169] Immunoblotting experiments confirmed that cells grown in complete darkness expressed little or no GFP, whereas in the light, regardless of the presence or absence of sucrose, expression went up (FIG. 5).

[0170] When grown in the presence of light and sucrose (L+), the level of GFP+ expression was estimated by immunoblotting to be about 4% of TSP (FIG. 5). When normalised to the fresh and dry weights of calli, this corresponded to a GFP+ expression level of up to 48 g/g f.w. (fresh weight) or about 1 mg/g d.w. (dry weight), respectively.

[0171] Use of Temporary Immersion Bioreactors for the Production of Transplastomic Biomass

[0172] Given that transplastomic gene expression seemed to be highest in leaf tissue we sought to develop a method for the rapid production of leaf tissue from callus/cell suspensions. In preliminary experiments, we found that addition of Thidiazuron (TDZ), which is known to promote somatic embryo growth in tobacco (Gill and Saxena, 1993), was able to induce shoot formation from GFP-6 calli grown on solid MS medium (data not shown). In order to scale up the production capacity, transplastomic cell suspensions from the tobacco GFP-6 line were loaded into a 2-L bioreactor and temporally submerged in MS media supplemented with 0.1 M TDZ. After about six weeks, a large number of shoots were produced (FIG. 6A). During the first 14 days, no growth could be detected and shoots only started to grow after this period. Possibly this lag period is related to the time needed for cells to redifferentiate from callus tissue to leafy tissue in tobacco in a similar manner to the observed switch between calli and meristematic tissues in Arabidopsis thaliana (Gordon et al, 2007).

[0173] After 40 days, the total biomass was removed from the bioreactor for analysis. Inspection of the plant material revealed the presence of mainly healthy leaves with minimal vitrification.

[0174] A total amount of about 470 g of fresh weight biomass was produced in the 2-L bioreactor. To evaluate the amount of GFP+ produced within this biomass, a protein precipitation protocol was developed based on protein precipitation in acetone. Using this method, a powder was produced, weighed and loaded onto a SOS-PAGE gel to detect produced GFP+ (FIG. 68). A clear band, absent from the wild type, and with a size of about 27 kDa was detected. To quantify the production of GFP+ within the transplastomic biomass, several amount of acetonic powder were loaded and 1 g of this powder was estimated to contain approximately 150 ng of GFP+ by immunoblotting (FIG. 6C). This indicated that the expression level reached about 2.8 mg/g fresh weight.

[0175] In the bioreactor, total GFP production reached about 660 mg/L at an approximate rate of 17 mg/L/day of GFP over the 40-day growth period. This value is approximately 42-times higher than the rate potentially achievable with cell suspensions of 0.4 mg/L/day.

DISCUSSION

[0176] Tobacco Transplastomic Cell Suspension Cultures

[0177] Most work so far in the chloroplast transformation sphere has focussed on leaves for the expression of several genes of interest. Same work has been done on expression in transplastomic potato tubers (Sidorov et al, 1999) and transplastomic tomato fruit (Ruf et al, 2001) but the expression yields were relatively poor (0.05 and 0.5% of TSP respectively). However, planting transgenic plants, even if they are transplastomic, could still be badly perceived by a large part of the public and the possible environmental issues could have a drastic impact on any future developments. In addition, there are very significant regulatory costs associated with each new transplastomic field releases. Recombinant protein production in contained transplastomic cell based cultures would overcome many of these concerns and should significantly reduce regulatory costs due to the highly contained nature of this new production system.

[0178] To compare different types of expression system, we first created a homoplastomic line of tobacco that expressed a variant of Green Fluorescent Protein (GFP+). GFP has previously been shown capable of high expression in chloroplasts in a range of different plants including tobacco (Khan and Maliga, 1999; Newell et al, 2003), potato (Sidorov et al, 1999) and lettuce (Kanamoto et al, 2006). The levels of GFP expression described here, approx 60% of TSP in leaves, is at the high end of expression and is similar to the value observed for GFP expression in lettuce where GFP at 36% of TSP was achieved (Kanamoto et al, 2006).

[0179] Our results showed clearly that levels of GFP+ expression are less in calli and cell suspension cultures compared to leaves (FIGS. 3 and 5) with levels varying between 1.5 to 4% of TSP, which is similar to the expression of GFP in transient transplastomic lettuce calli of 1% of TSP (Lelivelt et al, 2005).

[0180] Expression of GFP+ in transplastomic cell suspensions reached about 1.5% of TSP, which corresponds to 7.2 mg/L at a production rate of 0.4 mg/L/day (FIG. 5). This expression level could possibly be increased by optimisation of the culture media e.g. by the addition of polyvinyl pyrrolidone and/or gelatine, which have helped improve yields of protein expression in nuclear transformed plant cells (Kwon et al, 2003; Lee et al, 2002). We as well showed that GFP+ level could be increased to about 4% TSP when light and sugar content were better optimised (FIG. 5). If this result is extrapolated to the cell suspensions growth period, GFP+ production could potentially reach about 1 mg/L/day.

[0181] Factors Influencing the Production of GFP+ in Transplastomic Calli

[0182] The generally lower expression levels in transplastomic calli and cell suspensions might directly be explained by the choice of the chloroplast transformation vector and specifically by the respective promoter that drove the GFP+ expression. Prm, the promoter of the RNA 16S gene used in pFMGFP, is similar to the RNA 16S promoter from rice, whose activity decreased 7 fold in rice embryogenic cells in comparison to its activity in leaves (Silhavy and Maliga, 1998). The same phenomenon might have occurred here since the cell suspension plastids are less differentiated than the leaf chloroplasts. However, further work will have to assess GFP mRNA levels in both leaves and calli to be able to differentiate between a reduction in mRNA levels or a possible variation in chloroplast numbers.

[0183] Light seemed to be obviously indispensable for significant GFP+ expression (FIG. 5), whereas sucrose appeared more related to increased cell growth. However, these results might be biased, because despite a 1-month incubation period in the dark, GFP+ is very stable and the expression detected in callus grown on sucrose-supplemented media in the dark could correspond to residual GFP+ production from the tobacco cells before they had been transferred to the dark. In fact, GFP expression, driven by the same promoter, in potato microtubers reached only 0.05% TSP (Sidorov et al, 1999), which might indicate the real baseline for expression of GFP under the prrn promoter is much less than that observed here.

[0184] In our experiments, it was noticeable that the calli and cell suspensions remained green and possessed a large number of chloroplasts widely spread around the cell (FIG. 4A). GFP+ reached in these cells about 4% TSP, and such a high level might indicate that these cells are actually transient cell suspensions which are not completely dedifferentiated and in which the plastids are still similar to functional chloroplasts.

[0185] Transplastomic Biomass Production in Temporary Immersion Bioreactors

[0186] GFP+ production in leaves was vastly superior to that in undifferentiated cells (FIG. 3) and therefore attempts were made to promote shoot induction from transplastomic callus tissue. The addition of thidiazuron (TDZ) to the solid media induced the formation of shoots from calli after 6 weeks (data not shown). Interestingly, the observed growth in the magenta boxes was not linear, and no particular growth was detected within the first 2 weeks.

[0187] However, when transplastomic cell suspensions were placed under temporary immersion conditions where the cell material was subjected to being submerged in liquid occasionally, for only short periods using a temporary immersion type bioreactor, the production of leafy material was efficient and significant, with the final biomass production being extremely abundant (FIG. 6A). A similar lag phase in the biomass growth was observed for both the solid media based induction and in the temporary immersion bioreactor based induction where no growth was detected for the first 2 weeks.

[0188] The material was mainly composed of healthy small leaves and the GFP+ content was estimated to reach about 0.66 g/L (FIG. 6C). These values are slightly lower than the production observed in Chinese Hamster Ovary (CHO) cells (Wilke and Katzek, 2003) but are one of the highest attained in a plant-based system. Furthermore, the expression levels were obtained without any optimisation and future developments should improve the production and scalability of the process. For example, the exchange of glass bottles for disposable bags nearly doubled the amount of coffee somatic embryo produced using temporary immersion (Ducos et al, 2008), possibly due to a better light penetration and repartition. If a similar system was to be used with transplastomic tobacco shoots, the production yields could reach more than 1 g/L.

[0189] The system described here, properly scaled should be much less labour intensive than the production of whole plants in a green hause, and also does not require glasshouse containment facilities. It also offers a potentially faster raute to the production of target protein from transformed tissue as seeds do not need to be produced. In fact, once an homoplastomic tobacco line is identified, only one month is required to obtain a cell suspension culture suitable for the temporary immersion bioreactors, whereas, if seeds need to be produced, about 3 months are necessary (Molina et al, 2004). A combination of the temporary immersion growth of transplastomic shoots with recently described disposable bioreactors (Terrier et al, 2007; Ducos et al, 2008) is therefore a promising route for the low-cost production of biopharmaceuticals in plants.

[0190] Experimental Procedures

[0191] Tobacco Shoots, Calli and Cell Suspensions Generation

[0192] Nicotiana tabacum Petit Havana (Tobacco) seedlings, calli and cell suspensions were grown at 25 C., under a 16-hour photoperiod (about 100 mol/m2/s) at 30% humidity in a Fi-Totron 600H incubator (Sanyo, Watford, UK). Tobacco seedlings were germinated onto MS media (Murashige and Skoog, 1962) and calli were produced by placing small pieces of leaves onto Callus Induction Media (CIM), which is a MS media supplemented with 1 mg/L of 1-Napthaleneacetic acid (NAA) and 0.1 mg/L Kinetin (K). Cell suspensions were generated by incubating large amounts of calli in CIM media lacking the agar under a constant agitation of 140 rpm. All plant hormones and media were purchased from Sigma, St Louis, Mo., USA.

[0193] Construction of Chloroplast Transformation Vector

[0194] Chloroplast transformation vector pFMGFP was created by swapping TeTC gene for gfp+ gene (Scholz et al, 2000) in previously characterized tobacco chloroplast vector pJST10 (Tregoning et al, 2003) by double digestion using Nde1 and Xba1 restriction sites.

[0195] Generation of Transplastomic Tobacco Plants

[0196] Biolistic transformation of 6-weeks old wild-type tobacco leaves with tobacco chloroplast transformation vector pFMGFP was performed on RMOP media (Svab et al, 1990) with a composition based on MS medium supplemented with 1 mg/L thiamine, 100 mg/L myo-inositol, 1 mg/L N6-benzyladenosine (BAP) and 0.1 mg/L 1-Napthaleneacetic acid (NAA) using the PDS1000/He (Bio-Rad, Hercules, Calif., USA) biolistic device with rupture disks of 1100 psi. Vector pFMGFP was coated onto 550 nm gold particles (SeaShell, La Jolla, Calif., USA) according to manufacturer's recommendations. After bombardment, leaves remained in the dark for 48 hours before plant materials were cut into small pieces (5 mm5 mm) and placed onto RMOP media supplemented with 500 mg/L spectinomycin dihydrochloride. Spectinomycin resistant shoots were subcultured on the same media 4 times.

[0197] Southern Blot Analysis

[0198] Vector integration into tobacco plastome was evaluated by PCR using a primer annealing at the start of gfp+ and the other on the tobacco plastome outside the homologous regions of the vector pFMGFP (data not shown) and transplastomic GFP-6 line was chosen for all further experiments. Homoplastomy state was evaluated by Southern hybridisation of digested total genomic DNA from both wild-type and transplastomic GFP-6 lines. About 7 g of genomic DNA was digested with Bgll I and was run on a 0.7% (w/v) agarose gel. The DNA gel was transferred by capillarity onto a nylon membrane (Hybond-N, Amersham, Uppsala, Sweden) overnight in 20SSC buffer.

[0199] The probe was DIG-labelled overnight at 37 C. using DIG High Prime DNA Labelling and Detection Starter Kit II (Rache Applied Science, UK). A 3 kb probe homologous to the targeted region was obtained by PCR using primers pJST10-F 5 AATTCACCGCCGTATGGCTGACCGGCGA 3 (SEQ ID N0:1) and Rps12-OUT-R 5 TTCATGTTCCAATTGAACACTGTCCATT 3 (SEQ ID N0:2) and tobacco genomic DNA as template. Probe labelling and hybridisation were performed according to manufacturer's recommendations with a final probe concentration of 25 ng/ml. Specific signal detection with provided CSPD was detected by X-ray film (Amersham, Uppsala, Sweden) according to the manufacturer's guidelines. After homoplastomy confirmation by Southern blot analysis, GFP-6 plantlet was transferred to soil and allowed to produce seeds. This T.sub.0 seeds were germinated onto MS media supplemented with 500 mg/L spectinomycin and young Ta leaves were used for calli and cell suspensions generation.

[0200] Protein Extractions

[0201] First, total soluble protein extraction was performed according to (Kanamoto et al, 2006). Plant materials (leaves, calli, cell suspensions) were grounded into a fine powder with liquid nitrogen and mixed with total soluble extraction buffer (50 mM HEPES pH 7.6, 1 mM DTT, 1 mM EDTA, 2% (w/v) polyvinyl pyrrolidone and one tablet of complete protease inhibitors EDTA-free cocktail (Rache Products Ltd, Welwyn Garden City, UK). Plant mixtures were vortexed during 1 min and spun down at 13,000 rpm for 30 min at 4 C. Supernatants were aliquoted and stored at 20 C. until further use.

[0202] The second method was based on a total protein extraction protocol based acetone precipitation. Plant material was grounded to a fine powder in liquid nitrogen. 30 ml of extraction buffer (80% (v/v) acetone, 5 mM ascorbate) were added to 2 g of plant powder or leaf equivalent and the mixture was homogenised with an Ultra-Turrax (IKA, Heidelberg, Germany) for 15 s on ice. Proteins were pelleted by a centrifugation at 5,000 g for 5 min at 4 C. The supernatant was discarded and the pellet was washed 4 times using the same extraction buffer and same centrifugation conditions. Then the pellet was resuspended in pure acetone and homogenised again. Proteins were spun down once more at 10,000 g for 5 min at 4 C. The supernatant was discarded and the pellet was washed 3 more times in pure acetone. During the last wash, the buffer was aliquoted and dried using a Speed-Vac (Savant, Holbrook, N.Y., USA) and the residual powder was termed acetonic powder. The presence of GFP in the pellet and the different washes was detected by Western blot analysis (Supplementary FIG. 7).

[0203] Electrophoresis and Western Blot Analysis

[0204] Proteins from transplastomic and wild-type samples were resolved in 12.5% (w/v) SDSPAGE gels along with protein markers and commercially available recombinant GFP (Upstate, Waltham, Mass., USA) for quantification purposes. Protein gels were directly stained with Coomassie Blue or with silver staining.

[0205] Following electrophoresis, proteins were transferred onto a 0.2 m nitrocellulose membrane (Bio-Rad, Hercules, Calif., USA) either using the mini Trans-Blot system (BioRad, Hercules, Calif., USA) or by using the iBlot dry transfer system according to manufacturer's recommendation (Invitrogen, UK). After the transfer, GFP specific detection was performed with primary rabbit polyclonal anti-GFP antibody (provided by Prof Nixon, Imperial College London, UK) diluted 1:20,000 whereas the secondary antibody (Horseradish Peroxidase-conjugated goat anti-rabbit immunoglobulin G, Amersham, Uppsala, Sweden) was diluted 1:10,000. Biochemical detection was performed with the ECL SuperSignal West Pico Chemiluminescence Substrate kit (Pierce Biotechnology Inc., UK).

[0206] Temporary Immersion Bioreactors

[0207] Tobacco biomass was generated by placing about 7 grams of Nicotiana tabacum Petit Havana cell suspensions in a 2-L temporary immersion bioreactor (Ducos et al, 2007). Immersions were performed over a 40-day period with 1-L MS media supplemented with 0.1 M Thidiazuron (TDZ, Sigma, UK) every three hours for 5 min. Additionally, the media contained 100 mg/L of spectinomycin to prevent contamination and to select for transplastomic cells. The TDZ (Thidiazuron) concentration in MS media was estimated to be optimal at 0.1 M by researchers in Nestle, based on calli solid induction in Petri dishes (data not shown). The medium was pushed by an air pump into the 2-L vessel for 3 min and allowed to return to the original bettle by gravity for 2 more minutes. Light conditions and temperature were similar to the calli and cell suspensions growth experiments.

[0208] Fluorescence Microscopy

[0209] Transplastomic tobacco calli and cell suspensions expressing GFP and originating from the GFP-6 line were observed using an Axiovert 200 M inverted microscope (Carl Zeiss, Goettingen, Germany) and the Axiovision software (version 3.0). Excitation and emission wavelength were set up at 491 nm and 512 nm respectively, optimal for GFP+ detection (Scholz et al, 2000). Exposures and magnifications varied depending on the experiment and are indicated in each figure.

[0210] Table S1. Ratios Between Fresh, Dry Weights and Acetonic Powder.

[0211] These ratios were calculated for the determination of a robust quantification of GFP. Values represented an average of at least 4 repetitions for fresh weight (f.w.), dry weight (d.w.) and acetonic powder (powder). Calli and cell suspensions (Cells) were harvested at the end of their respective growth phases and leaves measurement was performed on young 2-3 weeks old plantlets (with about 4 leaves per plant, similar to the biomass produced in the temporary immersion bioreactor).

TABLE-US-00001 Tissue d.w./f.w. (%) Powder/d.w. (%) Leaves 6.6 0.9 28.3 1.1 Cells 4.4 0.3 14.1 1.4 Calli 3.6 0.4 12.4 1.3

REFERENCES

[0212] Azhagiri A K and Maliga P (2007) Exceptional paternal inheritance of plastids in Arabidopsis suggests that low-frequency leakage of plastids via pollen may be universal in plants. Plant J 52: 817-823. [0213] Birch R G (1997) PLANT TRANSFORMATION: Problems and Strategies for Practical Application. Annu Rev Plant Physiol Plant Mol Biol. 48:297-326. [0214] Brinkmann N and Tebbe C C (2007) Leaf-feeding larvae of Manduca sexta (Insecta, Lepidoptera) drastically reduce copy numbers of aadA antibiotic resistance genes from transplastomic tobacco but maintain intact aadA genes in their feces. Environmental biosafety research 6: 121-133. [0215] Daniell H, Lee S B, Panchal T and Wiebe P O (2001) Expression of the native cholera toxin B subunit gene and assembly as functional oligomers in transgenic tobacco chloroplasts. Journal of molecular biology 311: 1001-1009. [0216] Doran P M (2000) Foreign protein production in plant tissue cultures. Current opinion in biotechnology 11: 199-204. [0217] Ducos J, Labbe G, Lambot C and Petiard V (2007) Pilot scale process for the production of pre-germinated somatic embryos of selected robusta (Coffea canephora) clones. In vitro Cellular & Developmental BiologyPlant 43: 652-659. [0218] Ducos J, Terrier B, Courtois D and Petiard V (2008) Improvement of plastic-based disposable bioreactors for plant science needs. Phytochemistry Reviews 7: 607-613. [0219] Farran 1, Rio-Manterola F, Iniguez M, Garate S, Prieto J and Mingo-Castel A M (2008) High-density seedling expression system for the production of bioactive human cardiotrophin-1, a potential therapeutic cytokine, in transgenic tobacco chloroplasts. Plant biotechnology journal 6: 516-527. [0220] Fischer R, Emans N, Schuster F, Hellwig S and Drossard J (1999) Towards molecular farming in the future: using plant-cell-suspension cultures as bioreactors. Biotechnology and applied biochemistry 30 (Pt 2): 109-112. [0221] Fischer R, Stoger E, Schillberg S, Christau P and Twyman R M (2004) Plant-based production of biopharmaceuticals. Current opinion in plant biology 7: 152-158. [0222] Fox J L (2003) Puzzling industry response to ProdiGene fiasco. Nature biotechnology 21: 3-4. [0223] Gill R and Saxena P K (1993) Somatic embryogenesis in Nicotiana tabacum L.: induction by thidiazuron of direct embryo differentiation from cultured leaf discs. Plant Cell Reports 12: 154-159. [0224] Gleba Y, Klimyuk V and Marillonet S (2007) Viral vectors for the expression of proteins in plants. Curr Opin Biotechnol. 18: 134-41. [0225] Gordon S P, Heisler M G, Reddy G V, Ohno C, Das P and Meyerowitz E M (2007) Pattern formation during de novo assembly of the Arabidopsis shoot meristem. Development (Cambridge, England) 134: 3539-3548. [0226] Hagemann R (2004) The Sexual Inheritance of Plant Organelles, in Molecular Biology and Biotechnology of Plant Organelles pp 93-113. [0227] Halioua E (2006) Status of biomanufacturing in the world. Eurobio conference 2006. www.eurobio2006.com/DocBD/press/pdf/41.pdf (accessed Mar. 3, 2009) [0228] Hellwig S, Drossard J, Twyman R M and Fischer R (2004) Plant cell cultures for the production of recombinant proteins. Nature biotechnology 22: 1415-1422. [0229] Huang C Y, Ayliffe M A and Timmis J N (2003) Direct measurement of the transfer rate of chloroplast DNA into the nucleus. Nature 422: 72-76. [0230] Huang J, Sutliff T D, Wu L, Nandi S, Benge K, Terashima M, Ralston A H, Drohan W, Huang N and Rodriguez R L (2001) Expression and purification of functional human alpha-1-Antitrypsin from cultured plant cells. Biotechnology progress 17: 126-133. [0231] Kanamoto H, Yamashita A, Asao H, Okumura S, Takase H, Hattori M, Yokota A and Tomizawa K (2006) Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids. Transgenic research 15: 205-217. [0232] Kang T J, Loc N H, Jang M O, Jang Y S, Kim Y S, Seo J E and Yang M S (2003) Expression of the B subunit of E. coli heat-labile enterotoxin in the chloroplasts of plants and its characterization. Transgenic research 12: 683-691. [0233] Khan M S and Maliga P (1999) Fluorescent antibiotic resistance marker for tracking plastid transformation in higher plants. Nature biotechnology 17: 910-915. [0234] Kwon T H, Seo J E, Kim J, Lee J H, Jang Y S and Yang M S (2003) Expression and secretion of the heterodimeric protein interleukin-12 in plant cell suspension culture. Biotechnology and bioengineering 81: 870-875. [0235] Langbecker C L, Ye G N, Broyles D L, Duggan L L, Xu C W, Hajdukiewicz P T, Armstrong C L and Staub J M (2004) High-frequency transformation of undeveloped plastids in tobacco suspension cells. Plant physiology 135: 39-46. [0236] Lee J H, Kim N S, Kwon T H, Jang Y S and Yang M S (2002) Increased production of human granulocyte-macrophage colony stimulating factor (hGM-CSF) by the addition of stabilizing polymer in plant suspension cultures. Journal of biotechnology 96: 205-211. [0237] Lelivelt C L, McCabe M S, Newell C A, Desnoo C B, van Dun K M, Birch-Machin 1, Gray J C, Mills K H and Nugent J M (2005) Stable plastid transformation in lettuce (Lactuca sativa L.). Plant molecular biology 58: 763-774. [0238] Ma J K, Drake P M and Christau P (2003) The production of recombinant pharmaceutical proteins in plants. Nature reviews 4: 794-805. [0239] Maliga P (2004) Plastid transformation in higher plants. Annu Rev Plant Biol. 55:289-313. Molina A, Hervas-Stubbs S, Daniell H, Mingo-Castel A M and Veramendi J (2004) High-yield expression of a viral peptide animal vaccine in transgenic tobacco chloroplasts. Plant biotechnology journal 2: 141-153. [0240] Manier J M, Bernillon D, Kay E, Faugier A, Rybalka 0, Dessaux Y, Simonet P and Vogel T M (2007) Detection of potential transgenic plant DNA recipients among soil bacteria. Environmental biosafety research 6: 71-83. [0241] Murashige K and Skoog F (1962) A revised medium for rapid growth and bio assays with Tobacco tissue cultures. Physiologia Plantarum 15: 473:497. [0242] Newell C A, Birch-Machin 1, Hibberd J M and Gray J C (2003) Expression of green fluorescent protein from bacterial and plastid promoters in tobacco chloroplasts. Transgenic research 12: 631-634. [0243] Ruf S, Hermann M, Berger I J, Carrer H and Bock R (2001) Stable genetic transformation of tomato plastids and expression of a foreign protein in fruit. Nature biotechnology 19: 870-875. [0244] Ruf S, Karcher D and Bock R (2007) Determining the transgene containment level provided by chloroplast transformation. Proceedings of the National Academy of Sciences of the United States of America 104: 6998-7002. [0245] Saxby S (1999) Commercial production of monoclonal antibodies. In: Proceedings of the Production of Monoclonal antibodies Workshop (Eds. McArdle J E and Lund C J). Scholz O, Thiel A, Hillen W and Niederweis M (2000) Quantitative analysis of gene expression with an improved green fluorescent protein. p6. European journal of biochemistry/FEBS 267: 1565-1570. [0246] Scott S E and Wilkinson M J (1999) Low probability of chloroplast movement from oilseed rape (Brassica napus) into wild Brassica rapa. Nature biotechnology 17: 390-392. [0247] Sheppard A E, Ayliffe M A, Blatch L, Day A, Delaney S K, Khairul-Fahmy N, Li Y, Madesis P, Pryor A J and Timmis J N (2008) Transfer of plastid DNA to the nucleus is elevated during male gametogenesis in tobacco. Plant physiology 148: 328-336. [0248] Sidorov V A, Kasten D, Pang S Z, Hajdukiewicz P T, Staub J M and Nehra N S (1999) Technical Advance: Stable chloroplast transformation in potato: use of green fluorescent protein as a plastid marker. Plant J 19: 209-216. [0249] Silhavy D and Maliga P (1998) Plastid promoter utilization in a rice embryogenic cell culture. Current genetics 34: 67-70. [0250] Svab Z, Hajdukiewicz P and Maliga P (1990) Stable transformation of plastids in higher plants. Proceedings of the National Academy of Sciences of the United States of America 87: 8526-8530. [0251] Svab Z and Maliga P (2007) Exceptional transmission of plastids and mitochondria from the transplastomic pollen parent and its impact on transgene containment. Proceedings of the National Academy of Sciences of the United States of America 104: 7003-7008. [0252] Terrier B, Courtois D, Henault N, Cuvier A, Bastin M, Aknin A, Dubreuil J and Petiard V (2007) Two new disposable bioreactors for plant cell culture: The wave and undertow bioreactor and the slug bubble bioreactor. Biotechnology and bioengineering 96: 914-923. [0253] Tregoning J S, Nixon P, Kurada H, Svab Z, Glare S, Bowe F, Fairweather N, Ytterberg J, van Wijk K J, Dougan G and Maliga P (2003) Expression of tetanus toxin Fragment C in tobacco chloroplasts. Nucleic acids research 31: 1174-1179. [0254] Twyman R M, Stoger E, Schillberg S, Christau P and Fischer R (2003) Molecular farming in plants: hast systems and expression technology. Trends in biotechnology 21: 570-578. [0255] Verma D and Daniell H (2007) Chloroplast vector systems for biotechnology applications. Plant Physiology 145: 1129-1143. [0256] Wang T, Li Y, Shi Y, Reboud X, Darmency H and Gressel J (2004) Low frequency transmission of a plastid-encoded trait in Setaria italica. Theoretical and applied genetics 108: 315-320. [0257] Wilke D and Katzek J (2003) Primary production of biopharmaceuticals in plantsAn economically attractive choice? In: European Biopharmaceutical Review (Autumn). www.biomitteldeutschland.de/files/pdf/Biopharmaceuticalsinplants.pdf (accessed Mar. 2, 2009) [0258] Zhang Q, Liu Y and Sodmergen (2003) Examination of the Cytoplasmic DNA in Male Reproductive Cells to Determine the Potential for Cytoplasmic Inheritance in 295 Angiosperm Species, in Plant Cell Physiology 44: 941-951.