ENHANCEMENT OF PLACENTAL STEM CELL POTENCY USING MODULATORY RNA MOLECULES
20170000828 ยท 2017-01-05
Assignee
Inventors
- Stewart Abbot (Warren, NJ)
- Kathy E. KARASIEWICZ-MENDEZ (Hillsborough, NJ, US)
- Vanessa Voskinarian-Berse (Millington, NJ)
- Xiaokui Zhang (Livingston, NJ)
Cpc classification
A61K31/7088
HUMAN NECESSITIES
C12N5/0668
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
A61K2035/122
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
C12N5/0605
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
A61K35/50
HUMAN NECESSITIES
International classification
Abstract
Provided herein are methods of producing enhanced placental stem cells by modulatory RNA molecules. Also provided herein are methods of using enhanced placental stem cells, for example, to treat individuals having a disease, disorder or condition caused by, or relating to, an unwanted or harmful immune response. Further provided herein are compositions comprising said enhanced placental stem cells.
Claims
1. A method of treating an individual having or at risk of developing a disease, disorder or condition having an inflammatory component, comprising administering to the individual a therapeutically effective amount of enhanced placental stem cells, wherein said cells comprise or have been contacted with an effective amount of modulatory RNA molecules that (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said enhanced placental stem cells; (ii) increase cyclooxygenase II (Cox-2) activity in said enhanced placental stem cells; (iii) increase an amount of PGE2 produced by said enhanced placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by enhanced placental stem cells, compared to placental stem cells not contacted with said modulatory RNA molecules, wherein the therapeutically effective amount is an amount sufficient to cause a detectable improvement in one or more symptoms of said disease, disorder or condition.
2. The method of claim 1, wherein said modulatory RNA molecules are small interfering RNAs (siRNAs), microRNA inhibitors (miR inhibitors), micro RNA mimics (miR mimics), other modulatory RNA molecules, or any combinations thereof.
3. The method of claim 1, wherein said modulatory RNA molecules suppress an amount of soluble IL-23 protein produced by PBMCs in the presence of said enhanced placental stem cells, compared to placental stem cells not contacted with said modulatory RNA molecules.
4. The method of claim 3, wherein said modulatory RNA molecules are siRNAs.
5. The method of claim 4, wherein said siRNAs modulate one or more of Twinfilin-1, vitamin D receptor tVDR), nuclear receptor subfamily 4, group A, member 3 (NR4A3), nuclear receptor subfamily 0, group B, member 2 (NR0B2), nuclear receptor subfamily 1, group 1, member 2 (NR112), nuclear receptor subfamily 1, group H, member 3 (NR1H3) and deoxynucleotidyltransferase, terminal, interacting protein 1 (DNTT1P1) in said enhanced placental stem cells.
6. The method of claim 1, wherein said modulatory RNA molecules increase an amount of PGE2 produced by said enhanced placental stem cells compared to placental stem cells not contacted with said modulatory RNA molecules.
7. The method of claim 6, wherein said modulatory RNA molecules are miR inhibitors or miRNA mimics.
8. The method of claim 7, wherein said miR inhibitors or miRNA mimics modulate one or more of cholinergic receptor, nicotinic beta 1 (muscle) (CHRNB1), chloride channel 6 (CLCN6), chloride intracellular channel 4 (CLIC4), casein kinase 1, gamma 3 (CSNK1G3), casein kinase 2, alpha prime polypeptide (CSNK2A2), dual specificity phosphatase 1 (DUSP1), potassium channel modulatory factor 1 (KCMF1), potassium voltage-gated channel, shaker-related subfamily, member 3 (KCNA3), potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), potassium channel tetramerisation domain containing 13 (KCTD13), hepatocyte growth factor hepapoietin A; scatter factor) (HGF), nuclear receptor subfamily 2, group C, member 2 (NR2C2), phosphodiesterase 1B, calmodulin-dependent (PDE1B), phosphodiesterase 7B (PDE7B), phosphatidylinositol 4-kinase type 2 beta (PI4K2B), phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), phospholipase C, eta 2 (PLCH2), protein phosphatase, Mg2.sup.+/Mn2.sup.+ dependent, 1D (PPM1D), protein phosphatase, Mg2.sup.+/Mn2.sup.+ dependent, 1G (PPM1G), protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 9 (PPP1R2P9), protein phosphatase 1, regulatory (inhibitor) subunit 3B (PPP1R3B), protein phosphatase 1, regulatory (inhibitor) subunit 9B (PPP1R9B), protein phosphatase 2, catalytic subunit, beta isozyme (PPP2CB), protein tyrosine phosphatase type IVA, member 1 (PTP4A1), protein tyrosine phosphatase, receptor type, K (PTPRK), regulator of G-protein signaling 4 (RGS4), regulator of G-protein signaling 7 binding protein (RGS7BP), regulator of G-protein signaling 8 (RGS8), solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), solute carrier family 30 (zinc transporter), member 1 (SLC30A1), solute carrier family 35, member A4 (SLC35A4), solute carrier family 38, member 7 (SLC38A7), solute carrier family 41, member 1 (SLC41A1 (includes EG:254428)), solute carrier family 45, member 3 (SLC45A3), solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (SLC7A1), ubiquitin associated protein 2 (UBAP2), ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3 (includes EG:7323)), ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3), ubiquitin-conjugating enzyme E2R 2 (UBE2R2 (includes EG:54926)), ubiquitin-conjugating enzyme E2W (putative) (UBE2W), ubiquitin-like with PHD and ring finger domains 2 (UHRF2), ubiquitin specific peptidase 9, X-linked (LUSP9X), and hypoxia inducible factor 1, alpha subunit (HIF1A) in said enhanced placental stem cells.
9. The method of claim 1, wherein said modulatory RNA molecules increase Cox-2 activity in said enhanced placental stem cells compared to placental stem cells not contacted with said modulatory RNA molecules.
10. The method of claim 1, wherein said modulatory RNA molecules reduce the level a pro-inflammatory cytokine produced by enhanced placental stem cells compared to placental stem cells not contacted with said modulatory RNA molecules.
11. The method of claim 10, wherein said pro-inflammatory cytokine is IL-6, IL-8, or a combination thereof.
12. The method of claim 1, wherein said modulatory RNA molecules are selected from a library.
13. The method of claim 12, wherein said library is a human nuclear receptor library, human phosphatase siRNA library, or an anti-miR library.
14. The method of claim 1, wherein said placental stem cell is a CD10.sup.+, CD34, CD105.sup.+, CD200.sup.+ placental stem cell.
15. The method of claim 1, wherein said placental stem cells express CD200 and do not express HLA-G, or express CD73, CD105, and CD200, or express CD200 and OCT-4, or express CD73 and CD105 and do not express HLA-G.
16. The method of claim 14, wherein said placental stem cells are additionally CD90.sup.+ and CD45.sup..
17. The method of claim 14, wherein said placental stem cells are additionally CD80.sup. and CD86.sup..
18. A pharmaceutical composition for treating an individual having or at risk of developing a disease, disorder or condition having an inflammatory component, said pharmaceutical composition comprising a therapeutically effective amount of enhanced placental stem cells, wherein said cells comprise or have been contacted with an effective amount of modulatory RNA molecules that, when compared to placental stem cells not contacted with said modulatory RNA molecules (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said enhanced placental stem cells; (ii) increase Cox-2 activity in said enhanced placental stem cells; (iii) increase an amount of PGE2 produced by said enhanced placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by enhanced placental stein cells, wherein the therapeutically effective amount is an amount sufficient to cause a detectable improvement in one or more symptoms of said disease, disorder or condition.
19. A method of modifying placental stem cells comprising contacting the placental stem cells with an effective amount of modulatory RNA molecules, such that said placental stem cells, after having been contacted with said modulatory RNA molecules (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said placental stem cells; (ii) increase cyclooxygenase II (Cox-2) activity in said placental stem cells; (iii) increase an amount of PGE2 produced by said placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by said placental stem cells, as compared to an equivalent amount of placental stem cells not contacted with said modulatory RNA molecules.
20. A composition comprising enhanced placental stem cells, wherein said enhanced placental stem cells have been modified by the method of claim 19.
21. The composition of claim 20, w herein said enhanced placental stem cells (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said enhanced placental stem cells; (ii) increase cyclooxygenase II (Cox-2) activity in said enhanced placental stem cells; (iii) increase an amount of PGE2 produced by said enhanced placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by enhanced placental stem cells, as compared to an equivalent amount of placental stem cells not contacted with said modulatory RNA molecules.
22. A composition comprising enhanced placental stem cells, wherein said enhanced placental stem cells have been modified by the method of claim 19.
23. A composition comprising enhanced placental stem cells, wherein said enhanced placental stem cells comprises one or more modulatory RNA molecules, and wherein said enhanced placental stem cells (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said enhanced placental stem cells; (ii) increase cyclooxygenase II (Cox-2) activity in said enhanced placental stem cells; (iii) increase an amount of PGE2 produced by said enhanced placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by enhanced placental stem cells, as compared to an equivalent amount of placental stem cells not contacted with said modulatory RNA molecules.
Description
4. BRIEF DESCRIPTION OF THE FIGURES
[0039]
[0040]
[0041]
[0042]
5. DETAILED DESCRIPTION
5.1 Production of Enhanced Placental Stem Cells
[0043] In one aspect, provided herein are methods of modifying placental stem cells to enhance their immunomodulatory (e.g., immunosuppressive) activity. In certain embodiments, provided herein is a method of modifying placental stein cells to enhance their immunomodulatory (e.g., immunosuppressive) activity, comprising contacting the placental stem cells with an effective amount of oligomeric or polymeric molecules, such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, as compared to placental stem cells that have not been modified, e.g., that have not been contacted with said molecules.
[0044] In another aspect, provided herein are methods for the production of enhanced placental stem cells. Such enhanced placental stem cells are placental stem cells that have been modified to have increased immunomodulatory (e.g., immunosuppressive) activity. In certain embodiments, the methods provided herein for the production of enhanced placental stem cells comprise contacting the placental stem cells with an effective amount of oligomeric or polymeric molecules, such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, as compared to placental stem cells that have not been modified, e.g., that have not been contacted with said molecules. In some embodiments, said oligomeric or polymeric molecules comprise nucleotides (e.g., DNA or RNA molecules), nucleosides, nucleotide analogs, nucleotide mimetics, polypeptides, nucleotide analogs, nucleotide mimetics, and any combinations (e.g., chimeric combinations) thereof.
[0045] In one embodiment, the nucleotide analog is an RNA analog, for example, an RNA analog that has been modified in the 2-OH group, e.g., by substitution with a group, for example OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, OCH.sub.2CH.sub.2CH.sub.2NH.sub.2, OCH.sub.2CH.sub.2CH.sub.2OH or F.
[0046] In some embodiments, the oligomeric or polymeric molecules provided herein comprise one or more modifications e.g., chemical modifications) in the sugars, bases, or internucleoside linkages. As used herein, the term internucleoside linkage group refers to a group capable of covalently coupling together two nucleotides, such as between RNA units. Examples include phosphate, phosphodiester groups and phosphorothioate groups. In one embodiment, the oligomeric or polymeric molecules provided herein comprise at least one phosphate internucleoside linkage group. In one embodiment, the oligomeric or polymeric molecules provided herein comprise at least one phosphodiester internucleoside linkage group. In another embodiment, the oligomeric or polymeric molecules provided herein comprise at least one internucleoside linkage group selected from the following: (OP(O).sub.2O) include OP(O,S)O, OP(S).sub.2O, SP(O).sub.2O, SP(O,S)O, SP(S).sub.2O, OP(O).sub.2S, OP(O,S)S, SP(O).sub.2S, OPO(R.sup.H)O, PO(OCH.sub.3)O, OPO(NR.sup.H)O, OPO(OCH.sub.2CH.sub.2SR)O, OPO(BH.sub.3)O, OPO(NHR.sup.H)O, OP(O).sub.2NR.sup.H, NR.sup.HP(O).sub.2O, NR.sup.HCOO, NR.sup.HCONR.sup.H, NR.sup.HCOCH.sub.2, OCH.sub.2CONR.sup.H, OCH.sub.2CH.sub.2NR.sup.H, CONR.sup.HCH.sub.2, CH.sub.2NR.sup.HCO, SCH.sub.2CH.sub.2S. CH.sub.2SO.sub.2CH.sub.2, CH.sub.2CONR.sup.H, OCH.sub.2CH.sub.2NR.sup.HCO, CH.sub.2NCH.sub.3OCH.sub.2, where R.sup.H is hydrogen or C.sub.1-4alkyl.
[0047] In one embodiment, the oligomeric or polymeric molecules are single-stranded oligonucleotides or polynucleotides. In another embodiment, the oligomeric or polymeric molecules are double-stranded oligonucleotides or polynucleotides. In some embodiments, the oligonucleotides or polynucleotides comprise one or more modifications (e.g., chemical modifications in the sugars, bases, or internucleoside linkages.
[0048] In a specific embodiment, said oligomeric molecules are modulatory RNA molecules. In certain embodiments, the modulator RNA molecules are small interfering RNAs tsiRNAs), microRNA inhibitors (anti-miRs), other modulatory RNA molecules such as antisense RNAs, miR mimics, small hairpin RNAs (shRNAs), microRNA-adapted shRNA (shRNAmirs), or any combination thereof.
[0049] 5.1.1 siRNAs
[0050] In certain embodiments, the methods provided herein for the production of enhanced placental stem cells or modification of placental stem cells to enhance their immunomodulatory (e.g., immunosuppressive) activity comprise contacting the placental stem cells with an effective amount of small interfering RNAs (siRNAs), such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, e.g., as compared to placental stem cells that have not been modified, e.g., that have not been contacted with siRNAs.
[0051] As used herein, the term small interfering RNA or siRNA refers to an RNA molecule that interferes with the expression of a specific gene.
[0052] In certain embodiments, a method of producing ePSCs or modifying placental stem cells to enhance their immunomodulatory (e.g., immunosuppressive) activity comprises contacting the placental stem cells with an effective amount of siRNA, such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, as described in the embodiments herein, compared to placental stem cells that have not been modified, e.g., that have not been contacted with siRNAs.
[0053] Interleukin (IL)-23 acts to promote the Th17 immune response, which is associated with unwanted or harmful immune response, such as autoimmune diseases or disorders. Thus, in certain embodiments, the enhanced placental stem cells (ePSCs), when contacted with (e.g., co-cultured with) peripheral blood mononuclear cells (PBMCs), reduce an amount of interleukin-23 (IL-23) produced by said PBMCs, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, the PBMCs are contacted with said ePSCs in vivo, e.g. within an individual to whom the ePSCs are administered. In another specific embodiment, the PBMCs are contacted with said ePSCs in vitro.
[0054] In one embodiment, said enhanced placental stem cells (ePSCs), when contacted with (e.g., co-cultured with) peripheral blood mononuclear cells (PBMCs), reduce an amount of interleukin-23 (IL-23) produced by said PBMCs, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, the PBMCs are contacted with said ePSCs in vivo, e.g. within an individual to whom the ePSCs are administered. In another specific embodiment, the PBMCs are contacted with said ePSCs in vitro. In another specific embodiment, said siRNAs target (e.g., modulate) one or more genes in said ePSCs that modulate the production of IL-23 by PBMCs such that the production of IL-23 by said PBMCs is reduced. e.g., as compared to an equivalent number of unmodified placental stem cells.
[0055] In another embodiment, said enhanced placental stem cells (ePSCs) have increased cyclooxygenase II (Cox-2) activity, e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said Cox-2 activity is induced by IL-1. In a specific embodiment, said siRNAs target (e.g., modulate) one or more genes in said ePSCs that modulate the activity of Cox-2 in said ePSCs such that the activity of said Cox-2 in said ePSCs increased, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0056] Prostaglandin E2 (PGE2), secreted by placental stem cells, acts to reduce serum tumor necrosis factor-alpha (TNF-), which in turn is implicated in a variety of diseases and disorders relating to an unwanted or harmful immune response. Thus, in certain embodiments, the enhanced placental stem cells (ePSCs) have been modified to produce an increased amount of PGE2, e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said production of PGE2 production is induced by IL-1.
[0057] In another embodiment, said enhanced placental stem cells (ePSCs) have increased production of prostaglandin E2 (PGE2), e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said production of PGE2 production is induced by IL-1. In a specific embodiment, said siRNAs target (e.g., modulate) one or more genes in said ePSCs that modulate the production of PGE2 by said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0058] In another embodiment, the enhanced placental stem cells (ePSCs) have reduced production of a pro-inflammatory cytokine (e.g., extracellular pro-inflammatory cytokine), e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said pro-inflammatory cytokine is IL-1, IL-6, IL-8, TNF-, or any combinations thereof. In a specific embodiment, said pro-inflammatory cytokine is IL-6, IL-8, or a combination thereof. In another specific embodiment, said pro-inflammatory cytokine is IL-6. In another specific embodiment, said siRNAs target (e.g., modulate) one or more genes in said ePSCs that modulate the production of said pro-inflammatory cytokine such that the production of said pro-inflammatory cytokine of is reduced, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said one or more genes comprise a gene that encodes IL-1, IL-1, IL-6, IL-8, TNF-. In another specific embodiment, said one or more genes comprise a gene that encodes IL-6.
[0059] In another embodiment, the enhanced placental stem cells (ePSCs) have suppressed response induced by interferon-gamma (IFN-), as compared to an equivalent number of unmodified placental stem cells. In one specific embodiment, said siRNAs target (e.g., modulate) one or more genes in said ePSCs that modulate IFN--induced response of said ePSCs such that the IFN--induced response is suppressed, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said one or more genes comprise one or more of protein inhibitor of activated STAT, 1 (PIAS1) and TYRO protein tyrosine kinase binding protein (TYROBP).
[0060] In certain embodiments, a method of producing ePSCs comprises contacting the placental stem cells with an effective amount of siRNAs, such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, as described in the embodiments herein, compared to placental stem cells that have not been modified, e.g., that have not been contacted with siRNAs.
[0061] The siRNAs can be single-stranded or double-stranded, and can be modified or unmodified. In one embodiment, the siRNAs have one or more 2-deoxy or 2-O-modified bases. In some embodiments, the siRNAs have one or more base substitutions and inversions (e.g., 3-4 nucleobases inversions).
[0062] In some embodiments, the siRNAs useful in producing ePSCs are double-stranded. In one embodiment, one strand of the siRNA is antisense to the target nucleic acid, while the other strand is complementary to the first strand. In certain embodiments, said siRNAs comprise a central complementary region between the first and second strands and terminal regions that are optionally complementary between said first and second strands or with the target RNA.
[0063] In certain embodiments, the siRNAs have a length of about 2 to about 50 nucleobases. In some embodiments, the siRNAs are double-stranded, and have a length of about 5 to 45, about 7 to 40, or about 10 to about 35 nucleobases. In some embodiments, the siRNAs are double-stranded, and are about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length.
[0064] In certain embodiments, one or both ends of the first and/or second strands of the siRNAs are modified by adding one or more natural or modified nucleobases to form an overhang. In certain embodiments, one or both ends of the first and/or second strands of the siRNAs are blunt. It is possible for one end of the first and/or second strands of the siRNAs to be blunt and the other to have overhanging nucleobases.
[0065] In one embodiment, said overhangs are about 1 to about 10, about 2 to about 8, about 3 to about 7, about 4 to about 6 nucleobase(s) in length. In another embodiment, said overhangs are about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleobase(s) in length. In a specific embodiment, the siRNAs are double-stranded, and have a length of about 21 nucleobases. In another specific embodiment, the siRNAs are double-stranded, and have a length of about 21 nucleobases comprising dinucleotide 3 overhangs (e.g., dinucleotide 3 DNA overhangs such as U or TT 3-overhangs) such that there is a 19 nt complementary region between the sense and antisense strands.
[0066] In a specific embodiment, said one or more genes targeted (e.g., modulated) by said siRNAs comprise one or more of Twinfilin-1, human nuclear receptor subfamily 1, group H, member 3 (NR1H3), deoxynucleotidyltransferase, terminal, interacting protein 1 (DNTTIP1), vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), nuclear receptor subfamily 4, group A, member 2 (NR4A2), nuclear receptor subfamily 4, group A, member 3 (NR4A3), nuclear receptor subfamily 0, group B, member 2 (NR0B2), or nuclear receptor subfamily 1, group I, member 2 (NR112). In another specific embodiment, said one or more gene comprise NR4A3. In another specific embodiment, said one or more gene comprise NR4A2.
[0067] In another specific embodiment, said one or more genes targeted (e.g., modulated) by said siRNAs comprise one or more of cholinergic receptor, nicotinic beta 1 (muscle) (CHRNB1), chloride channel 6 (CLCN6), chloride intracellular channel 4 (CLIC4), casein kinase 1, gamma 3 (CSNK1G3), casein kinase 2, alpha prime polypeptide (CSNK2A2), dual specificity phosphatase 1 (DUSP1), potassium channel modulatory factor 1 (KCMF1), potassium voltage-gated channel, shaker-related subfamily, member 3 (KCNA3), potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), potassium channel tetramerisation domain containing 13 (KCTD13), hepatocyte growth factor (hepapoietin A: scatter factor) (HGF), nuclear receptor subfamily 2, group C, member 2 (NR2C2), phosphodiesterase 1B, calmodulin-dependent (PDE1B), phosphodiesterase 7B (PDE7B), phosphatidylinositol 4-kinase type 2 beta (PI4K2B), phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), phospholipase C, eta 2 (PLCH2), protein phosphatase. Mg2.sup.+/Mn2.sup.+ dependent, 1D (PPM1D), protein phosphatase, Mg2.sup.+/Mn2.sup.+ dependent, 1G (PPM1G), protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 9 (PPP1R2P9), protein phosphatase 1, regulatory (inhibitor) subunit 3B (PPP1R3B), protein phosphatase 1, regulatory (inhibitor) subunit 9B (PPP1R9B), protein phosphatase 2, catalytic subunit, beta isozyme (PPP2CB), protein tyrosine phosphatase type IVA, member 1 (PTP4A1), protein tyrosine phosphatase, receptor type, K (PTPRK), regulator of G-protein signaling 4 (RGS4), regulator of G-protein signaling 7 binding protein (RGS7BP), regulator of G-protein signaling 8 (RGS8), solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), solute carrier family 30 (zinc transporter), member 1 (SLC30A1), solute carrier family 35, member A4 (SLC35A4), solute carrier family 38, member 7 (SLC38A7), solute carrier family 41, member 1 (SLC41A1 (includes EG:254428)), solute carrier family 45, member 3 (SLC45A3), solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (SLC7A1), ubiquitin associated protein 2 (UBAP2), ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3 (includes EG:7323)), ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3), ubiquitin-conjugating enzyme E2R 2 (UBE2R2 (includes EG:54926)), ubiquitin-conjugating enzyme E2W (putative) (UBE2W), ubiquitin-like with PHD and ring finger domains 2 (UHRF2), ubiquitin specific peptidase 9, X-linked (USP9X), or hypoxia inducible factor 1, alpha subunit (HIF1A). In another specific embodiment, said one or more genes comprise HIF1A. In another specific embodiment, said one or more genes comprise DUSP1. In another specific embodiment, said one or more genes comprise PDE7B. In another specific embodiment, said siRNAs decrease the mRNA level of said one or more genes in said ePSCs. In various embodiments, said decrease is a decrease of about, up to, or no more than, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%, as compared to expression of said genes in unmodified placental stem cells.
[0068] In certain embodiments, the siRNAs modulate (e.g., suppress the expression of) one or more genes listed in Table 1 (see the column designated as Full Gene Name (Human)) and Table 7.
TABLE-US-00001 TABLE1 Suppression of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of enhanced placental stem cells by siRNAs (0.25 nmoles) Sequence(Upper RefSeq Sense(S)/ casedenotesRNA- SEQ Accession Gene FullGene Gene SiRNA antisense bases,andlower ID Number Symbol (Human) ID ID (AS) coasedenotesDNA-bases NO NM_005693 NRIH3 nuclear 10062 s19568 S GGAUGCUAAUGAAACUGGUtt 1 receptor AS ACCAGUUUCAUUAGCAUCCgt 2 subfamily1, groupH, member3 NM_052951 DNTTIP1 deoxy- 116092 s41922 S GGAACAUAAUGAUAAAGCAtt 3 nucleotidyl- AS UGCUUUAUCAUUAUGUUCCaa 4 transferase, terminal, interactin protein1 NM_000376 VDR vitaminD 7421 s14779 S AGAUCACUGUAUCACCUCUtt 5 (1.25-di- AS AGAGGUGAUACAGUGAUCUga 6 hydroxy- vitaminD3) receptor NM_173198 NR4A3 nuclear 8013 s15543 S AGAUCUUGAUUAUUCCAGAtt 7 receptor AS UCUGGAAUAAUCAAGAUCUct 8 subfamily4, groupA, member3 NM_021969 NR0B2 nuclear 8431 s15998 S CGGUGCCCAGCAUACUCAAtt 9 receptor AS UUGAGUAUGCUGGGCACCCgg 10 subfamily0, groupB, member2 NM_022002 NRI12 nuclear 8856 S16911 S GGCUAUCACUUCAAUGUCAtt 11 receptor AS UGACAUUGAAGUGAUAGCCag 12 subfamily1, groupI, member2 NM_052951 DNTTIP1 deoxy- 116092 S41924 S CCUUGGAACAUAAUGAUAAtt 13 nucleotidyl- AS UUAUCAUUAUGUUCCAAGGgt 14 transferase, terminal, interactin protein1
[0069] In certain embodiments, the siRNAs target (e.g., modulate) a gene (e.g., a nucleic acid molecule) encoding human nuclear receptor subfamily 1, group H, member 3 (NR1H3) (e.g., NCBI Ref Seq Accession Number NM_005693). In one embodiment, said siRNAs are double-stranded. In a specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 1, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 2, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00002 GGAUGCUAAUGAAACUGGUttSEQIDNO:1 ||||||||||||||||||| tgCCUACGAUUACUUUGACCASEQIDNO:2
[0070] In another specific embodiment, said siRNAs target (e.g., modulate) a gene encoding NR1H3 (e.g., NCBI Ref Seq Accession Number NM_005693) such that the production of IL-23 by said PBMCs is reduced when contacted with ePSCs, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0071] In certain embodiments, the siRNAs target (e.g., modulate) a gene encoding deoxynucleotidyltransferase, terminal, interacting protein 1 (DNTT1P1) (e.g., NCBI Ref Seq Accession Number NM_052951).). In one embodiment, said siRNAs are double-stranded. In a specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 3, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 4, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00003 GGAACAUAAUGAUAAAGCAttSEQID:3 ||||||||||||||||||| aaCCUUGUAUUACUAUUUCGUSEQID:4
[0072] In another specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 13, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 14, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00004 CCUUGGAACAUAAUGAUAAttSEQID:13 ||||||||||||||||||| tgGGAACCUUGUAUUACUAUUSEQID:14
[0073] In a specific embodiment, said siRNAs target (e.g., modulate) a gene encoding DNTT1P1 (e.g., NCBI Ref Seq Accession Number NM_05295) such that the production of IL-23 by said PBMCs is reduced when contacted with ePSCs, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0074] In certain embodiments, the siRNAs target (e.g., modulate) a gene encoding vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR) (e.g., NCBI Ref Seq Accession Number NM_000376). In one embodiment, said siRNAs are double-stranded. In a specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 5, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 6, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00005 AGAUCACUGUAUCACCUCUttSEQID:5 ||||||||||||||||||| gaUCUAGUGACAUAGUGGAGASEQID:6
[0075] In a specific embodiment, said siRNAs target (e.g., modulate) a gene encoding VDR (e.g., NCBI Ref Seq Accession Number NM_000376) such that the production of IL-23 by said PBMCs is reduced when contacted with ePSCs, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0076] In certain embodiments, the siRNAs target (e.g., modulate) a gene encoding nuclear receptor subfamily 4, group A, member 3 (NR4A3) (e.g., NCBI Ref Seq Accession Number NM_173198). In one embodiment, said siRNAs are double-stranded. In a specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 7, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 8, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00006 AGAUCUUGAUUAUUCCAGAttSEQID:7 ||||||||||||||||||| tcUCUAGAACUAAUAAGGUCUSEQID:8
[0077] In a specific embodiment, said siRNAs target (e.g., modulate) a gene encoding NR4A3 (e.g., NCBI Ref Seq Accession Number NM_173198) such that the production of IL-23 by said PBMCs is reduced when contacted with ePSCs, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0078] In certain embodiments, the siRNAs target (e.g., modulate) a gene encoding nuclear receptor subfamily 0, group B, member 2 (NR0B2) (e.g., NCBI Ref Seq Accession Number NM_021969). In one embodiment, said siRNAs are double-stranded. In a specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 9, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 10, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00007 CGGUGCCCAGCAUACUCAAttSEQID:9 ||||||||||||||||||| ggGCCACGGGUCGUAUGAGUUSEQID:10
[0079] In a specific embodiment, said siRNAs target (e.g., modulate) a gene encoding NR0B2 (e.g., NCBI Ref Seq Accession Number NM_021969) such that the production of IL-23 by said PBMCs is reduced when contacted with ePSCs, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0080] In certain embodiments, the siRNAs target (e.g., modulate) a gene encoding nuclear receptor subfamily 1, group 1, member 2 (NR112) (e.g., NCBI Ref Seq Accession Number NM_022002). In one embodiment, said siRNAs are double-stranded. In a specific embodiment, one strand (e.g., sense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 11, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, one strand (e.g., antisense strand) of said double-stranded siRNAs has a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 12, wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In another embodiment, said double-stranded siRNAs form a duplex comprising a two-nucleobase overhang and the following structure:
TABLE-US-00008 GGCUAUCACUUCAAUGUCAttSEQID:11 ||||||||||||||||||| gaCCGAUAGUGAAGUUACAGUSEQID:12
[0081] In a specific embodiment, said siRNAs target (e.g., modulate) a gene encoding NR112 (e.g., NCBI Ref Seq Accession Number NM_022002) such that the production of IL-23 by said PBMCs is reduced when contacted with ePSCs, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0082] The siRNAs can be supplied by a commercial vendor (e.g., Ambion; Dharmacon), or be synthesized by, e.g., solid phase synthesis, or according to the procedures as described in. e.g., Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993). Humana Press: Scaringe, Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713).
[0083] siRNAs useful for the production of enhanced placental stem cells can be identified by a variety of methods known in the art. In certain embodiments, such siRNAs are identified and obtained from one or more siRNA libraries, e.g., a commercially available library (e.g., Ambion. Silencer Select Human Nuclear Hormone Receptor (HNR) siRNA Library V4: Dharmacon, siRNA library Human ON-TARGETplus siRNA Nuclear Receptors Sub-library), optionally by a screening method, e.g., medium or high-throughput screening. In one embodiment, such a library can encompass a wide range of genes (e.g., human genome-wide siRNA library), or pre-defined to encompass specific target genes or gene families (e.g., human nuclear receptor siRNA library, phosphatase siRNA library, etc.)
[0084] The screening method can be carried out, for example, using automated robotics, liquid handling equipments, data processing software, and/or sensitive detectors, e.g., Precision XS Automated Pipettor System, EL406 liquid handling system, or synergy plate reader.
[0085] 5.1.2 miR Inhibitors and miR Mimics
[0086] In certain embodiments, the methods provided herein for the production of enhanced placental stem cells or modification of placental stem cells to enhance their immunomodulatory (e.g., immunosuppressive) activity comprise contacting the placental stem cells with an effective amount of microRNA inhibitors (miR inhibitors), such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, e.g., as compared to placental stem cells that have not been modified, e.g., that have not been contacted with miR inhibitors.
[0087] In certain embodiments, the methods provided herein for the production of enhanced placental stem cells or modification of placental stem cells to enhance their immunomodulatory (e.g., immunosuppressive) activity comprise contacting the placental stem cells with an effective amount of microRNA mimics (miR mimics), such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced, e.g., as compared to placental stem cells that have not been modified, e.g., that have not been contacted with miR mimics.
[0088] As used herein, the term microRNA, miRNA, or miR refers to short ribonucleic acid (RNA) molecules, including, but not limited to, mature single stranded miRNAs, precursor miRNAs (pre-miR), and variants thereof. As used herein, the term microRNA inhibitor, miRNA inhibitor, miR inhibitor or anti-miR refer to a ribonucleic acid molecule designed to inhibit miRNAs (e.g., endogenous miRNAs). In some embodiments, the miR inhibitors up-regulate a target gene by inhibition of one or more endogenous miRs. In one embodiment, the microRNAs are naturally occurring. In certain embodiments, the microRNAs are post-transcriptional regulators that bind to complementary sequences on target messenger RNA transcripts (mRNAs) and result in translational repression and gene silencing. In certain embodiments, a single precursor contains more than one mature miRNA sequence. In other embodiments, multiple precursor miRNAs contain the same mature sequence. In some embodiments, when the relative abundances clearly indicate which is the predominantly expressed miRNA, the term microRNA. miRNA, or miR refers to the predominant product, and the term microRNA*, miRNA*. or miR* refers to the opposite arm of the precursor. In one embodiment, miRNA is the guide strand that eventually enters RNA-Induced Silencing Complex (RISC), and miRNA* is the other passenger strand. In another embodiment, the level of miRNA* present in the cell at a lower level (e.g., 515%) relative to the corresponding miRNA. In some embodiments where there is a higher proportion of passenger strand present in the cell, the nomenclature miRNA-3p (i.e., miRNA derived from the 3 arm of the precursor miRNA) and miRNA-5p (i.e., miRNA-5p is the miRNA derived from the 5 arm of the precursor miRNA) is used instead of miRNA/miRNA*.
[0089] As used herein, the term microRNA mimic s) or miR mimic(s) refers to molecules that can be used to imitate or mimic the gene silencing ability of one or more miRNAs. In one embodiment, the miR mimics down-regulate a target gene by imitating one or more endogenous miRs. In certain embodiments, miRNA mimics are synthetic non-coding RNAs (i.e., the miRNA is not obtained by purification from a source of the endogenous miRNA). In certain embodiments, the miRNA mimics are capable of entering the RNAi pathway and regulating gene expression. In certain embodiments, miRNA mimics can be designed as mature molecules (e.g. single stranded) or mimic precursors (e.g., pri- or pre-miRNA,).
[0090] In some embodiments, the miR inhibitors or miRNA mimics provided herein comprise nucleic acid (modified or modified nucleic acids) including oligonucleotides comprising. e.g., RNA, DNA, modified RNA, modified DNA, locked nucleic acids, or 2-O,4-C-ethylene-bridged nucleic acids (ENA), or any combination of thereof.
[0091] The miR inhibitors or miR mimics can be single-stranded or double-stranded, and can be modified or unmodified. In certain embodiments, the miR inhibitors or miR mimics have a length of about 2 to about 30 nucleobases. In certain embodiments, the miR inhibitors or miR mimics are single-stranded, and have a length of about 15 to about 30 nucleobases. In some embodiments, the miR inhibitors are single-stranded, and are about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length.
[0092] In certain embodiments, a method of producing ePSCs comprises contacting the placental stem cells with an effective amount of miR inhibitors or miR mimics, such that the immunomodulatory (e.g., immunosuppressive) activity of the placental stem cells is enhanced compared to placental stem cells that have not been modified, e.g., that have not been contacted with miR inhibitors or miR mimics.
[0093] In one embodiment, said enhanced placental stem cells (ePSCs), when contacted with (e.g., co-cultured with) peripheral blood mononuclear cells (PBMCs), reduce an amount of interleukin-23 (IL-23) produced by said PBMCs, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, the PBMCs are contacted with said ePSCs in vivo. e.g. within an individual to whom the ePSCs are administered. In another specific embodiment, the PBMCs are contacted with said ePSCs in firm.
[0094] In another specific embodiment, said miR inhibitors target (e.g., modulate, reduce the level of, up-regulate) one or more miRs in said ePSCs that modulate the production of IL-23 by PBMCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced. e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR inhibitors target (e.g., modulate, up-regulate) one or more genes in said ePSCs that modulate the production of IL-23 by PBMCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells.
[0095] In another specific embodiment, said miR mimics imitate or mimic one or more miRs in said ePSCs that modulate the production of IL-23 by PBMCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics target one or more genes in said ePSCs that modulate the production of IL-23 by PBMCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells.
[0096] In certain embodiments, said miR inhibitors target (e.g., modulate) one or more miRs listed in Table 2 (see the column designated as Target miR). In a specific embodiment, said miR inhibitors target (e.g., modulate, reduce the level of) one or more miRs listed in Table 2 (see the column designated as Target miR) in said ePSCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR inhibitors have a sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 15-83 and 228-234, or the complement thereof.
[0097] In certain embodiments, said miR mimics imitate or mimic one or more miRs listed in Table 2 (see the column designated as Target miR). In a specific embodiment, said miR mimics imitate or mimic one or more miRs listed in Table 2 (see the column designated as Target miR) in said ePSCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 15-83 and 228-234, or the complement thereof.
[0098] In one embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-371-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 59, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-136*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 60, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-214, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 61, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-25*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 62, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-452*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 63, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-454*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90, 95%, 98% or 100% identical to SEQ ID NO. 64, or the complement thereof.
[0099] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-548b-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 65, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-10b*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% (identical to SEQ ID NO: 66, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-218, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 67, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-548m, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 68, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-520a-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 69, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1323, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 70, or the complement thereof.
[0100] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-24-2*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 71, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-613, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 72, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-26a, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 989 or 100% identical to SEQ ID NO: 73, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-193a-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 74, or the complement thereof. In another embodiment, said miR inhibitors target e.g., modulate) hsa-miR-1208, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 75, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-767-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 76, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-491-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 77, or the complement thereof.
[0101] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-626, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 78, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-216a, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 79, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-151-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 80, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1282, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 81, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-497*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 82, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-129-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 83, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 228, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-129*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 229, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-24, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 230, or the complement thereof. In another embodiment, said miR inhibitors target t e.g., modulate) hsa-miR-24-1, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 231, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-28-1*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 232, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-183, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 233, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-183*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 234, or the complement thereof.
[0102] In one embodiment, said miR mimics imitate or mimic hsa-miR-183, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 15. In another embodiment, said miR mimics imitate or mimic hsa-miR-491-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 16. In another embodiment, said miR mimics imitate or mimic hsa-miR-132*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 17. In another embodiment, said miR mimics imitate or mimic hsa-miR-129-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 18. In another embodiment, said miR mimics imitate or mimic hsa-miR-636, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 19. In another embodiment, said miR mimics imitate or mimic hsa-miR-100, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 98% or 100% identical to SEQ ID NO. 20.
[0103] In another embodiment, said miR mimics imitate or mimic hsa-miR-181a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 21. In another embodiment, said miR mimics imitate or mimic hsa-miR-519a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 22. In another embodiment, said miR mimics imitate or mimic hsa-miR-338-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98%, or 100% identical to SEQ ID NO. 23. In another embodiment, said miR mimics imitate or mimic hsa-miR-1179, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 989 or 100% identical to SEQ ID NO. 24. In another embodiment, said miR mimics imitate or mimic hsa-miR-521, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 25. In another embodiment, said miR mimics imitate or mimic hsa-miR-608, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 26. In another embodiment, said miR mimics imitate or mimic hsa-miR-1306, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 27.
[0104] In another embodiment, said miR mimics imitate or mimic hsa-miR-543, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 28. In another embodiment, said miR mimics imitate or mimic hsa-miR-542-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 29. In another embodiment, said miR mimics imitate or mimic hsa-miR-23 b, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 30. In another embodiment, said miR mimics imitate or mimic hsa-miR-299-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 31. In another embodiment, said miR mimics imitate or mimic hsa-miR-597, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 32. In another embodiment, said miR mimics imitate or mimic hsa-miR-1976, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 950%, 98% or 100% identical to SEQ ID NO. 33. In another embodiment, said miR mimics imitate or mimic hsa-miR-1252, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 34.
[0105] In another embodiment, said miR mimics imitate or mimic hsa-miR-510, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 35. In another embodiment, said miR mimics imitate or mimic hsa-miR-1207-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 36. In another embodiment, said miR mimics imitate or mimic hsa-miR-518a-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 37. In another embodiment, said miR mimics imitate or mimic hsa-miR-1250, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 38. In another embodiment, said miR mimics imitate or mimic hsa-miR-1274a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 39. In another embodiment, said miR mimics imitate or mimic hsa-miR-141*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 40. In another embodiment, said miR mimics imitate or mimic hsa-miR-9*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 41.
[0106] In another embodiment, said miR mimics imitate or mimic hsa-miR-566, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 42. In another embodiment, said miR mimics imitate or mimic hsa-miR-142-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 43. In another embodiment, said miR mimics imitate or mimic hsa-miR-23a*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 44. In another embodiment, said miR mimics imitate or mimic hsa-miR-519e*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 45. In another embodiment, said miR mimics imitate or mimic hsa-miR-1292, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 46. In another embodiment, said miR mimics imitate or mimic hsa-miR-96, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 47. In another embodiment, said miR mimics imitate or mimic hsa-miR-886-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 48. In another embodiment, said miR mimics imitate or mimic hsa-miR-216b, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 49. In another embodiment, said miR mimics imitate or mimic hsa-miR-218-2*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO 50.
[0107] In another embodiment, said miR mimics imitate or mimic hsa-miR-182, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 51. In another embodiment, said miR mimics imitate or mimic hsa-miR-545, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 52. In another embodiment, said miR mimics imitate or mimic hsa-miR-517a, wherein said miR mimics have a sequence at least about 70%, 80%, 90% 95%, 98% or 100% identical to SEQ ID NO. 53. In another embodiment, said miR mimics imitate or mimic hsa-miR-541*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 54. In another embodiment, said miR mimics imitate or mimic hsa-miR-1293, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 55. In another embodiment, said miR mimics imitate or mimic hsa-miR-339-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 56. In another embodiment, said miR mimics imitate or mimic hsa-miR-494, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 57. In another embodiment, said miR mimics imitate or mimic hsa-miR-196a*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 58. In another embodiment, said miR mimics imitate or mimic hsa-miR-1, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 228. In another embodiment, said miR mimics imitate or mimic hsa-miR-129*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 229. In another embodiment, said miR mimics imitate or mimic hsa-miR-24, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 230. In another embodiment, said miR mimics imitate or mimic hsa-miR-24-1*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 231. In another embodiment, said miR mimics imitate or mimic hsa-miR-218-1*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 232. In another embodiment, said miR mimics imitate or mimic hsa-miR-183, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 233. In another embodiment, said miR mimics imitate or mimic hsa-miR-183*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 234.
TABLE-US-00009 SequenceofmiRs SEQ Mature ID TargetmiR SequenceofTargetmiR NO. hsa-miR-183 UAUGGCACUGGUAGAAUUCACU 15 hsa-miR-491-5p UGUGGGGAACCCUUCCAUGAGG 16 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU 17 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC 18 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA 19 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG 20 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU 21 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU 22 hsa-miR-338-3P UCCAGCAUCAGUGAUUUUGUUG 23 hsa-miR-1179 AAGCAUUCUUUCAUUGGUUGG 24 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU 25 hsa-miR-621 GGCUAGCAACAGCGCUUACCU 26 hsa-miR-1306 ACGUUGGCUCUGGUGGUG 27 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU 28 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA 29 hsa-miR-23b AUCACAUUGCCAGGGAUUACC 30 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU 31 hsa-miR-597 UGUGUCACUCGAUGACCACUGU 32 hsa-miR-1976 CCUCCUGCCCUCCUUGCUGU 33 hsa-miR-1252 AGAAGGAAAUUGAAUUCAUUUA 34 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC 35 hsa-miR-1207-5p UGGCAGGGAGGCUGGGAGGGG 36 hsa-miR-518a-3p GAAAGCGCUUCCCUUUUGCUGGA 37 hsa-miR-1250 ACGGUGCUGGAUGUGGCCUUU 38 hsa-miR-1274a GUCCCUGUUCAGGCGCCA 39 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA 40 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU 41 hsa-miR-566 GGGCGCCUGUGAUCCCAAC 42 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU 43 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU 44 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC 45 hsa-miR-1292 UGGGAACGGGUUCCGGCAGACGCUG 46 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU 47 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU 48 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA 49 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG 50 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU 51 hsa-miR-545* UCAGUAAAUGUUUAUUAGAUGA 52 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU 53 hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU 54 hsa-miR-1293 UGGGUGGUCUGGAGAUUUGUGC 55 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG 56 hsa-miR-494 UGAAACAUACACGGGAAACCUC 57 hsa-miR-196a* CGGCAACAAGAAACUGCCUGAG 58 hsa-miR-371*5p ACUCAAACUGUGGGGGCACU 59 hsa-miR-136* CAUCAUCGUCUCAAAUGAGUCU 60 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU 61 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG 62 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG 63 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC 64 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC 65 hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU 66 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU 67 hsa-miR-548m CAAAGGUAUUUGUGGUUUUUG 68 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU 69 hsa-miR-1323 70 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG 71 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC 72 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU 73 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU 74 hsa-miR-1208 UCACUGUUCAGACAGGCGGA 75 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG 76 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC 77 hsa-miR-626 AGCUGUCUGAAAAUGUCUU 78 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA 79 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC 80 hsa-miR-1282 UCGUUUGCCUUUUUCUGCUU 81 hsa-miR-497* CAAACCACACUGUGGUGUUAGA 82 hsa-miR-129-2p AAGCCCUUACCCCAAAAAGCAU 83
[0108] In another embodiment, said enhanced placental stem cells (ePSCs) have increased cyclooxygenase II (Cox-2) activity, e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said Cox-2 activity is induced by IL-1. In a specific embodiment, said miR inhibitors target (e.g., modulate, reduce the level of) one or more miRs in said ePSCs that modulate the activity of said Cox-2 in said ePSCs such that the activity of said Cox-2 in said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR inhibitors target (e.g., modulate, up-regulate) one or more genes in said ePSCs that modulate the activity of said Cox-2 such that the activity of said Cox-2 in said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0109] In another specific embodiment, said miR mimics imitate or mimic one or more miRs in said ePSCs that modulate the activity of Cox-2 in said ePSCs such that the activity of said Cox-2 in said ePSCs is increased, e.g., as compared to the activity of said Cox-2 in an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics target one or more genes in said ePSCs that modulate the activity of said Cox-2 in said ePSCs such that the activity of said Cox-2 in said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0110] In another embodiment, said enhanced placental stem cells (ePSCs) have increased production of prostaglandin E2 (PGE2), e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said production of PGE2 production is induced by IL-1. In a specific embodiment, said miR inhibitors target (e.g., modulate, reduce the level of) one or more miRs in said ePSCs that modulate the production of PGE2 by said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, said miR inhibitors target (e.g., modulate, up-regulate) one or more genes in said ePSCs that modulate the production of PGE2 by said ePSCs such that the production of PGE2 by said ePSCs is increased. e.g., as compared to an equivalent number of unmodified placental stem cells.
[0111] In a specific embodiment, said miR mimics imitate or mimic one or more miRs in said ePSCs that modulate the production of PGE2 by said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, said miR mimics target one or more genes in said ePSCs that modulate the production of PGE2 by said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells.
[0112] In certain embodiments, said miR inhibitors target (e.g., modulate) one or more miRs listed in Table 3 (see the column designated as Target miR). In a specific embodiment, said miR inhibitors target (e.g., modulate, reduce the level of) one or more miRs listed in Table 3 (ee the column designated as Target miR) in said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR inhibitors have a sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to any of SEQ ID NO: 21, 27, 28, 30, 35, 39, 41, 42, 48, 52-54, 62, 72, 73, 79, 81, and 84-222, or the complement thereof.
[0113] In certain embodiments, said miR mimics imitate or mimic one or more miRs listed in Table 3 (see the column designated as Target miR). In a specific embodiment, said miR mimics imitate or mimic one or more miRs listed in Table 3 (see the column designated as Target miR) in said ePSCs such that the production of PGE2 by said ePSCs is increased. e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to any of SEQ ID NO: 21, 27, 28, 30, 35, 39, 41, 42, 48, 52-54, 62, 72, 73, 79, 81, and 84-222, or the complement thereof.
[0114] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-495, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 181, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-516a-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 182, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-938, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 183, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-936, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 184, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-373*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 185, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1184, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 186, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-122, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 187, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-208b, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 188, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-223*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 189, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1972, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 190, or the complement thereof.
[0115] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-520h. wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 191, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-330-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 192, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-149, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 193, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-7, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 194, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-29 b-2*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 195, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-520d-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 196, or the complement thereof.
[0116] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-592, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 197, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-940, wherein said miR inhibitors ha % e a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 198, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-146b-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 199, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-518e*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 200, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1255a, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 201, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-935, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 202, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-633, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 203, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-513a-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 204, or the complement thereof.
[0117] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-361-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 205, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-104, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 206, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1185, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 207, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-875-3p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 208, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-200a, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 209, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1201, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 210, or the complement thereof.
[0118] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-629, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 211, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-139-5p, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 212, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-504, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 213, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-452, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 214, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-517a, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 53, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-543, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 28, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate hsa-miR-616*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 215, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-651, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 216, or the complement thereof.
[0119] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1254, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 217, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-339-3p. % herein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 218, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-510, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 35, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-181c*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 219, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-19 b-1*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 220, or the complement thereof.
[0120] In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1274a, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 39, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1294, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 221, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1306, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 27, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-1226*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 222, or the complement thereof. In another embodiment, said miR inhibitors target (e.g., modulate) hsa-miR-541*, wherein said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 54, or the complement thereof.
[0121] In another embodiment, said miR mimics imitate or mimic hsa-miR-886-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 48. In another embodiment, said miR mimics imitate or mimic hsa-miR-371-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 84. In another embodiment, said miR mimics imitate or mimic hsa-miR-25*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 62. In another embodiment, said miR mimics imitate or mimic hsa-miR-376c, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 85. In another embodiment, said miR mimics imitate or mimic hsa-miR-888, wherein said miR mimics have a sequence at least about 70%, 80% 90%, 95%, 98% or 100% identical to SEQ ID NO. 86. In another embodiment, said miR mimics imitate or mimic hsa-miR-517b, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 87. In another embodiment, said miR mimics imitate or mimic hsa-miR-433, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 88.
[0122] In another embodiment, said miR mimics imitate or mimic hsa-miR-200a*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 89. In another embodiment, said miR mimics imitate or mimic hsa-miR-520a-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 90. In another embodiment, said miR mimics imitate or mimic hsa-miR-1286, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 91. In another embodiment, said miR mimics imitate or mimic hsa-miR-182*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 92. In another embodiment, said miR mimics imitate or mimic hsa-miR-1273, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 93. In another embodiment, said miR mimics imitate or mimic hsa-miR-1280, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 94. In another embodiment, said miR mimics imitate or mimic hsa-miR-563, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 95. In another embodiment, said miR mimics imitate or mimic hsa-miR-501-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 96. In another embodiment, said miR mimics imitate or mimic hsa-miR-448, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 97. In another embodiment, said miR mimics imitate or mimic hsa-miR-485-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 98.
[0123] In another embodiment, said miR mimics imitate or mimic hsa-miR-29c, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 99. In another embodiment, said miR mimics imitate or mimic hsa-miR-548f, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 100. In another embodiment, said miR mimics imitate or mimic hsa-miR-1248, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 101. In another embodiment, said miR mimics imitate or mimic hsa-let-7d*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 102. In another embodiment, said miR mimics imitate or mimic hsa-miR-618, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 103. In another embodiment, said miR mimics imitate or mimic hsa-miR-30c, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 104. In another embodiment, said miR mimics imitate or mimic hsa-miR-136, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 105.
[0124] In another embodiment, said miR mimics imitate or mimic hsa-miR-181a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 21. In another embodiment, said miR mimics imitate or mimic hsa-miR-26a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 73. In another embodiment, said miR mimics imitate or mimic hsa-miR-10a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 106. In another embodiment, said miR mimics imitate or mimic hsa-miR-557, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 107. In another embodiment, said miR mimics imitate or mimic hsa-miR-564, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 108. In another embodiment, said miR mimics imitate or mimic hsa-miR-520g, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 109. In another embodiment, said miR mimics imitate or mimic hsa-miR-122*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 110. In another embodiment, said miR mimics imitate or mimic hsa-miR-548k, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 111. In another embodiment, said miR mimics imitate or mimic hsa-miR-423-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100%, identical to SEQ ID NO. 112. In another embodiment, said miR mimics imitate or mimic hsa-miR-548j, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 113.
[0125] In another embodiment, said miR mimics imitate or mimic hsa-miR-340*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 114. In another embodiment, said miR mimics imitate or mimic hsa-miR-573, wherein said miR mimics have a sequence at least about 70%, 80%, 95%, 98% or 100% identical to SEQ ID NO. 115. In another embodiment, said miR mimics imitate or mimic hsa-miR-548i, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 116. In another embodiment, said miR mimics imitate or mimic hsa-miR-555, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 117, In another embodiment, said miR mimics imitate or mimic hsa-miR-144, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 118. In another embodiment, said miR mimics imitate or mimic hsa-miR-567, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 119. In another embodiment, said miR mimics imitate or mimic hsa-miR-191*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 120. In another embodiment, said miR mimics imitate or mimic hsa-miR-566, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 42.
[0126] In another embodiment, said miR mimics imitate or mimic hsa-miR-335, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 121. In another embodiment, said miR mimics imitate or mimic hsa-miR-126*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 122. In another embodiment, said miR mimics imitate or mimic hsa-miR-22*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 123. In another embodiment, said miR mimics imitate or mimic hsa-miR-572, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 124. In another embodiment, said miR mimics imitate or mimic hsa-miR-517c, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 125. In another embodiment, said miR mimics imitate or mimic hsa-miR-380*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 126. In another embodiment, said miR mimics imitate or mimic hsa-miR-106a*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 127. In another embodiment, said miR mimics imitate or mimic hsa-miR-519e, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 128. In another embodiment, said miR mimics imitate or mimic hsa-miR-520c-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 129.
[0127] In another embodiment, said miR mimics imitate or mimic hsa-miR-517*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 130. In another embodiment, said miR mimics imitate or mimic hsa-miR-432*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 131. In another embodiment, said miR mimics imitate or mimic hsa-miR-520e, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 132. In another embodiment, said miR mimics imitate or mimic hsa-miR-9*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 41. In another embodiment, said miR mimics imitate or mimic hsa-miR-551a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 133. In another embodiment, said miR mimics imitate or mimic hsa-miR-1471, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 134. In another embodiment, said miR mimics imitate or mimic hsa-miR-613, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 72. In another embodiment, said miR mimics imitate or mimic hsa-miR-562, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 135. In another embodiment, said miR mimics imitate or mimic hsa-miR-922, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 136. In another embodiment, said miR mimics imitate or mimic hsa-miR-216a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 79. In another embodiment, said miR mimics imitate or mimic hsa-miR-499-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 989 or 100% identical to SEQ ID NO. 137.
[0128] In another embodiment, said miR mimics imitate or mimic hsa-miR-25, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 138. In another embodiment, said miR mimics imitate or mimic hsa-miR-197, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 139. In another embodiment, said miR mimics imitate or mimic hsa-miR-500*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 140. In another embodiment, said miR mimics imitate or mimic hsa-miR-365*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 141. In another embodiment, said miR mimics imitate or mimic hsa-miR-1247, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 142. In another embodiment, said miR mimics imitate or mimic hsa-miR-586, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 143. In another embodiment, said miR mimics imitate or mimic hsa-miR-548d-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 144. In another embodiment, said miR mimics imitate or mimic hsa-miR-27a*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 145. In another embodiment, said miR mimics imitate or mimic hsa-miR-598, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 146.
[0129] In another embodiment, said miR mimics imitate or mimic hsa-miR-609, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 147. In another embodiment, said miR mimics imitate or mimic hsa-miR-132, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 148. In another embodiment, said miR mimics imitate or mimic hsa-miR-411*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 149. In another embodiment, said miR mimics imitate or mimic hsa-miR-135a, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 150. In another embodiment, said miR mimics imitate or mimic hsa-miR-31, wherein said miR mimics have a sequence at least about 70%, 80%, 90% 95%, 98% or 100% identical to SEQ ID NO. 151. In another embodiment, said miR mimics imitate or mimic hsa-miR-181a*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 152. In another embodiment, said miR mimics imitate or mimic hsa-miR-1245, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 153.
[0130] In another embodiment, said miR mimics imitate or mimic hsa-miR-758, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 154. In another embodiment, said miR mimics imitate or mimic hsa-miR-924, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 155. In another embodiment, said miR mimics imitate or mimic hsa-miR-1246, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 156. In another embodiment, said miR mimics imitate or mimic hsa-miR-23b, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 30. In another embodiment, said miR mimics imitate or mimic hsa-miR-631, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 157. In another embodiment, said miR mimics imitate or mimic hsa-miR-1, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 158. In another embodiment, said miR mimics imitate or mimic hsa-miR-920, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 159. In another embodiment, said miR mimics imitate or mimic hsa-miR-589*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 160.
[0131] In another embodiment, said miR mimics imitate or mimic hsa-miR-638, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 161. In another embodiment, said miR mimics imitate or mimic hsa-miR-1244, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 95%, 98% or 100% identical to SEQ ID NO. 162. In another embodiment, said miR mimics imitate or mimic hsa-miR-328, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95, 98% or 100% identical to SEQ ID NO. 163. In another embodiment, said miR mimics imitate or mimic hsa-let-7i, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 164, in another embodiment, said miR mimics imitate or mimic hsa-miR-429, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 165. In another embodiment, said miR mimics imitate or mimic hsa-miR-380, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 166. In another embodiment, said miR mimics imitate or mimic hsa-let-7b*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95% r, 98% or 100% identical to SEQ ID NO. 167. In another embodiment, said miR mimics imitate or mimic hsa-miR-614, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 168.
[0132] In another embodiment, said miR mimics imitate or mimic hsa-miR-1225-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 169. In another embodiment, said miR mimics imitate or mimic hsa-miR-545*, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 52. In another embodiment, said miR mimics imitate or mimic hsa-miR-320c, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 170. In another embodiment, said miR mimics imitate or mimic hsa-miR-579, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% c identical to SEQ ID NO. 171. In another embodiment, said miR mimics imitate or mimic hsa-miR-1282, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 81. In another embodiment, said miR mimics imitate or mimic hsa-miR-455-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 172.
[0133] In another embodiment, said miR mimics imitate or mimic hsa-miR-615-3p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 173. In another embodiment, said miR mimics imitate or mimic hsa-miR-585, wherein said miR mimics ha % e a sequence at least about 70%, 80%, 90% 95%, 5%, 98% or 100% identical to SEQ ID NO. 174. In another embodiment, said miR mimics imitate or mimic hsa-miR-559, wherein said miR mimics have a sequence at least about 70%, 80%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 175. In another embodiment, said miR mimics imitate or mimic hsa-miR-561, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 176. In another embodiment, said miR mimics imitate or mimic hsa-miR-191, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 177. In another embodiment, said miR mimics imitate or mimic hsa-miR-187, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 178. In another embodiment, said miR mimics imitate or mimic hsa-miR-29b, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 179. In another embodiment, said miR mimics imitate or mimic hsa-miR-769-5p, wherein said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 180.
TABLE-US-00010 SequenceofmiRs SEQ ID TargetmiR SequenceofInhibitor NO hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU 48 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU 84 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG 62 hsa-miR-376c AACAUAGAGGAAAUUCCACGU 85 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA 86 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU 87 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU 88 hsa-miR-200a* CAUCUUACCGGAACAGUGCUGGA 89 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU 90 hsa-miR-1286 UGCAGGACCAAGAUGAGCCCU 91 hsa-miR-182* UGGUUCUAGACUUGCCAACUA 92 hsa-miR-1273 GGGCGACAAAGCAAGACUCUUUCUU 93 hsa-miR-1280 UCCCACCGCUGCCACCC 94 hsa-miR-563 AGGUUGACAUACGUUUCCC 95 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA 96 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU 97 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU 98 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA 99 hsa-miR-548f AAAAACUGUAAUUACUUUU 100 hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUA 101 AA hsa-miR-7d* CUAUACGACCUGCUGCCUUUCU 102 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU 103 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC 104 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA 105 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU 21 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU 73 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG 106 hsa-miR-557 GUUUGCACGGUGGCCUUGUCU 107 hsa-miR-564 AGGCACGGUGUCAGCAGGC 108 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU 109 hsa-miR-122* AACGCCAUUAUCACACUAAAUA 110 hsa-miR-548k AAAAGUACUUGCGGAUUUUGCU 111 hsa-miR-423-3p AGCUCGGGUCUGAGGCCCCUCAGU 112 hsa-miR-548j AAAAGUAAUUGCGGUCUUUGGU 113 hsa-miR-340* UCCGUCUCAGUUACUUUAUAGC 114 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG 115 hsa-miR-548i AAAAGUAAUUGCGGAUUUUGCC 116 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU 117 hsa-miR-144 UACAGUAUAGAUGAUGUACU 118 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC 119 hsa-miR-191* GCUGCGCUUGGAUUUCGUCCCC 120 hsa-miR-566 GGGCGCCUGUGAUCCCAAC 42 hsa-miR-335 UCAAGAGCAAUAACGAAAAUGU 121 hsa-miR-126* CAUUAUUACUUUUGGUACGCG 122 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA 123 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA 124 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU 125 hsa-miR-380* UGGUUGACCAUAGAACAUGCGC 126 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC 127 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU 128 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU 129 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU 130 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU 131 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG 132 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU 41 hsa-miR-551a GCGACCCACUCUUGGUUUCCA 133 hsa-miR-1471 GCCCGCGUGUGGAGCCAGGUGU 134 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC 72 hsa-miR-562 AAAGUAGCUGUACCAUUUGC 135 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC 136 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA 79 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU 137 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA 138 hsa-miR-197 UUCACCACCUUCUCCACCCAGC 139 hsa-miR-500* AUGCACCUGGGCAAGGAUUCUG 140 hsa-miR-365* AGGGACUUUCAGGGGCAGCUGU 141 hsa-miR-1247 ACCCGUCCCGUUCGUCCCCGGA 142 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC 143 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC 144 hsa-miR-27A* AGGGCUUAGCUGCUUGUGAGCA 145 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA 146 hsa-miR-609 AGGGUGUUUCUCUCATCUCU 147 hsa-miR-132 UAACAGUCUACAGCCAUGGUCG 148 hsa-miR-411* UAUGUAACACGGUCCACUAACC 149 hsa-miR-135A UAUGGCUUUUUAUUCCUAUGUGA 150 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU 151 hsa-miR-181A* ACCAUCGACCGUUGAUUGUACC 152 hsa-miR-1245 AAGUGAUCUAAAGGCCUACAU 153 hsa-miR-758 UUUGUGACCUGGUCCACUAACC 154 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC 155 hsa-miR-1246 AAUGGAUUUUUGGAGCAGG 156 hsa-miR-23B AUCACAUUGCCAGGGAUUACC 30 hsa-miR-631 AGACCUGGCCCAGACCUCAGC 157 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU 158 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA 159 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA 160 hsa-miR-538 AGGGAUCGCGGGCGGGUGGCGGCCU 161 hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU 162 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU 163 hsa-miR-7i UGAGGUAGUAGUUUGUGCUGUU 164 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU 165 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU 166 hsa-miR-7b* CUAUACAACCUACUGCCUUCCC 167 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG 168 hsa-miR-1225-5p GUGGGUACGGCCCAGUGGGGGG 169 hsa-miR-545* UCAGUAAAUGUUUAUUAGAUGA 52 hsa-miR-320c AAAAGCUGGGUUGAGAGGGU 170 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU 171 hsa-miR-1282 UCGUUUGCCUUUUUCUGCUU 81 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG 172 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU 173 hsa-miR-606 AAACUACUGAAAAUCAAAGAU 174 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA 175 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG 176 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 177 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG 178 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU 179 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU 180 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU 181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU 182 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU 183 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG 184 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC 185 hsa-miR-1184 CCUGCAGCGACUUGAUGGCUUCC 186 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG 187 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU 188 hsa-miR-223* CGUGUAUUUGACAAGCUGAGUU 189 hsa-miR-1972 UCAGGCCAGGCACAGUGGCUCA 190 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU 191 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA 192 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC 193 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU 194 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG 195 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC 196 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU 197 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC 198 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG 199 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG 200 hsa-miR-1255a AGGAUGAGCAAAGAAAGUAGAUU 201 hsa-miR-935 CCAGUUACCGUUCCGCUACCGC 202 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA 203 hsa-miR-513a-5p UUCACAGGGAGGUGUCAU 204 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU 205 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA 206 hsa-miR-1185 AGAGGAUACCCUUUGUAUGUU 207 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG 208 hsa-miR-200a UAACACUGUCUGGUAACGAUGU 209 hsa-miR-1201 AGCCUGAUUAAACACAUGCUCUGA 210 hsa-miR-629 UGGGUUUACGUUGGGAGAACU 211 hsa-miR-139-5a UCUACAGUGCACGUGUCUCCAG 212 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC 213 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA 214 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU 53 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU 28 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU 215 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG 216 hsa-miR-1254 AGCCUGGAAGCUGGAGCCUGCAGU 217 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG 218 hsa-miR-510 UACUCAGGAGAGUGCAAUCAC 35 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC 219 hsa-miR-196b-1* AGUUUUGCAGGUUUGCAUCCAGC 220 hsa-miR-1274a GUCCCUGUUCAGGCGCCA 39 hsa-miR-1294 UGUGAGGUUGGCAUUGUUGUCU 221 hsa-miR-1306 ACGUUGGCUCUGGUGGUG 27 hsa-miR-1226* GUGAGGGAUGCAGGCCUGGAUGGGG 222 hsa-miR-541* AAAGGAUUCUGCUGUCGUCCCACU 54
[0134] In another embodiment, the enhanced placental stem cells (ePSCs) have reduced production of a pro-inflammatory cytokine (e.g., extracellular pro-inflammatory cytokine). e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said pro-inflammatory cytokine is IL-1, IL-6, IL-8. TNF-, or any combinations thereof. In a specific embodiment, said pro-inflammatory cytokine is IL-6, IL-8, or a combination thereof. In another specific embodiment, said pro-inflammatory cytokine is IL-6. In another specific embodiment, said miR inhibitors target (e.g., modulate, reduce the level of) one or more miRs in said ePSCs that modulate the production of said pro-inflammatory cytokine such that the production of said pro-inflammatory cytokine of is reduced, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR inhibitors target (e.g., modulate, up-regulate) one or more genes in said ePSCs that modulate the production of said pro-inflammatory cytokine such that the production of said pro-inflammatory cytokine of is reduced, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics imitate or mimic one or more miRs in said ePSCs that modulate the production of said pro-inflammatory cytokine such that the production of said pro-inflammatory cytokine of is reduced, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics target one or more genes in said ePSCs that modulate the production of said pro-inflammatory cytokine such that the production of said pro-inflammatory cytokine of is reduced, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said one or more genes comprise a gene that encodes IL-1, IL-1, IL-6, IL-8, TNF-. In another specific embodiment, said one or more genes comprise a gene that encodes IL-6.
[0135] In certain embodiments, the enhanced placental stem cells (ePSCs) have suppressed response induced by interferon-gamma (IFN-), as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, said miR inhibitors target (e.g., modulate) one or more miRs in said ePSCs that modulate IFN--induced response of said ePSCs such that the IFN--induced response is suppressed, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR inhibitors target (e.g., modulate) one or more genes in said ePSCs that modulate IFN--induced response of said ePSCs such that the IFN--induced response is suppressed, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, said miR mimics imitate or mimic one or more miRs in said ePSCs that modulate IFN--induced response of said ePSCs such that the IFN--induced response is suppressed, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said miR mimics target one or more genes in said ePSCs that modulate IFN--induced response of said ePSCs such that the IFN--induced response is suppressed, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said one or more genes comprise one or more of protein inhibitor of activated STAT, 1 (PIAS1) and TYRO protein tyrosine kinase binding protein (TYROBP).
[0136] In one embodiment, said one or more genes targeted (e.g., modulated) by said miR inhibitors or miR mimics comprise one or more of Twinfilin-1, human nuclear receptor subfamily 1, group H, member 3 (NR1H3), deoxynucleotidyltransferase, terminal, interacting protein 1 (DNTTIP1), vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), nuclear receptor subfamily 4, group A, member 3 (NR4A3), nuclear receptor subfamily 0, group B, member 2 (NR0B2), or nuclear receptor subfamily 1, group 1, member 2 (NR112). In another specific embodiment, said one or more genes comprise NR4A3. In another specific embodiment, said one or more genes comprise NR4A2. In another specific embodiment, said miR inhibitors or miR mimics target (e.g., modulate) one or more of Twinfilin-1, NR1H3. DNTTP1, VDR, NR4A3, NR0B2, or NR112 in said ePSCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In one embodiment, said miR inhibitors have a sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 15-83, or the complement thereof. In another embodiment, said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO. 15-83, or the complement thereof. In a specific embodiment, said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to any of SEQ ID NOS: 59-83. In another specific embodiment, said miR mimics have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to any of SEQ ID NOS: 19-58.
[0137] In a specific embodiment, said one or more genes targeted (e.g., modulated) by said miR inhibitors or miR mimics comprise one or more genes listed in Table 4. In another specific embodiment, said one or more gene targeted (e.g., modulated) by said miR inhibitors or miR mimics comprise one or more of cholinergic receptor, nicotinic beta 1 (muscle) (CHRNB1), chloride channel 6 (CLCN6), chloride intracellular channel 4 (CLIC4), casein kinase 1, gamma 3 (CSNK1G3), casein kinase 2, alpha prime polypeptide (CSNK2A2), dual specificity phosphatase 1 (DUSP1), potassium channel modulatory factor 1 (KCMF1), potassium voltage-gated channel, shaker-related subfamily, member 3 (KCNA3), potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), potassium channel tetramerisation domain containing 13 (KCTD13), hepatocyte growth factor (hepapoietin A: scatter factor) (HGF), nuclear receptor subfamily 2, group C, member 2 (NR2C2), phosphodiesterase 1B, calmodulin-dependent (PDE1B), phosphodiesterase 7B (PDE7B), phosphatidylinositol 4-kinase type 2 beta (PI4K2B), phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R), phospholipase C, eta 2 (PLCH2), protein phosphatase. Mg2.sup.+/Mn2.sup.+ dependent, 1D (PPM1D), protein phosphatase, Mg2.sup.+/Mn2.sup.+ dependent, 1G (PPM1G), protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 9 (PPP1R2P9), protein phosphatase 1, regulatory (inhibitor) subunit 3B (PPP1R3B), protein phosphatase 1, regulatory (inhibitor) subunit 1B (PPP1R9B), protein phosphatase 2, catalytic subunit, beta isozyme (PPP2CB), protein tyrosine phosphatase type IVA, member 1 (PTP4A1), protein tyrosine phosphatase, receptor type, K (PTPRK), regulator of G-protein signaling 4 (RGS4), regulator of (G-protein signaling 7 binding protein (RGS7BP), regulator of G-protein signaling 8 (RGS8), solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), solute carrier family 30 (zinc transporter), member 1 (SLC30A1), solute carrier family 35, member A4 (SLC35A4), solute carrier family 38, member 7 (SLC38A7), solute carrier family 41, member 1 (SLC41A1), solute carrier family 45, member 3 (SLC45A3), solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (SLC7A1), ubiquitin associated protein 2 (UBAP2), ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3), ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3), ubiquitin-conjugating enzyme E2R 2 (UBE2R2), ubiquitin-conjugating enzyme E2W (putative) (UBE2W), ubiquitin-like with PHD and ring finger domains 2 (UHRF2), ubiquitin specific peptidase 9, X-linked (USP9X), and hypoxia inducible factor 1, alpha subunit (HIF1A). In another specific embodiment, said one or more genes comprise HIF1A. In another specific embodiment, said one or more genes comprise DUSP1. In another specific embodiment, said one or more genes comprise PDE7B. In another specific embodiment, said miR inhibitors target (e.g., modulate, up-regulate) one or more of CHRNB1, CLCN6, CLIC4, CSNK1G3, CSNK2A2, DUSP1, KCMF1, KCNA3, KCNJ14, KCNS3, KCTD13, HGF, NR2C2, PDE1B, PDE7B, PI4K2B, PIK3R1, PLCH2, PPM1D, PPM1G, PPP1R2P9, PPP1R3B, PPP1R9B, PPP2CB, PTP4A1, PTPRK, RGS4, RGS7BP, RGS8, SLC16A3, SLC30A1, SLC35A4, SLC38A7, SLC41A1, SLC45A3, SLC7A1, UBAP2, UBE2D3. UBE2E3, UBE2R2, UBE2W, UHRF2, or USP9X in said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells.
TABLE-US-00011 TABLE 4 Targets of miRNAs which modulate PGE2 production Symbol Entrez Gene Name Location Family CHRNB1 cholinergic receptor, nicotinic, beta 1 Plasma Membrane transmembrane (muscle) receptor CLCN6 chloride channel 6 Plasma Membrane ion channel CLIC4 chloride intracellular channel 4 Plasma Membrane ion channel CSNK1G3 casein kinase 1, gamma 3 Cytoplasm kinase CSNK2A2 casein kinase 2, alpha prime Cytoplasm kinase polypeptide DUSP1 dual specificity phosphatase 1 Nucleus phosphatase KCMF1 potassium channel modulatory factor unknown enzyme 1 KCNA3 potassium voltage-gated channel, Plasma Membrane ion channel shaker-related subfamily, member 3 KCNJ14 potassium inwardly-rectifying Plasma Membrane ion channel channel, subfamily J, member 14 KCNS3 potassium voltage-gated channel, Plasma Membrane ion channel delayed-rectifier, subfamily S, member 3 KCTD13 potassium channel tetramerisation Nucleus ion channel domain containing 13 HGF hepatocyte growth factor (hepapoietin Extracellular Space growth factor A: scatter factor) NR2C2 nuclear receptor subfamily 2, group Nucleus ligand-dependent C, member 2 nuclear receptor PDE1B phosphodiesterase 1B, calmodulin- Cytoplasm enzyme dependent PDE7B phosphodiesterase 7B Cytoplasm enzyme PI4K2B phosphatidylinositol 4-kinase type 2 Cytoplasm kinase beta PIK3R1 phosphoinositide-3-kinase, regulatory Cytoplasm kinase subunit 1 (alpha) PLCH2 phospholipase C, eta 2 Cytoplasm enzyme PPM1D protein phosphatase, Mg2+/Mn2+ Cytoplasm phosphatase dependent, 1D PPM1G protein phosphatase, Mg2+/Mn2+ Nucleus phosphatase dependent, 1G PPP1R2P9 protein phosphatase 1, regulatory unknown other (inhibitor) subunit 2 pseudogene 9 PPP1R3B protein phosphatase 1, regulatory unknown other (inhibitor) subunit 3B PPP1R9B protein phosphatase 1, regulatory Cytoplasm other (inhibitor) subunit 9B PPP2CB protein phosphatase 2, catalytic Cytoplasm phosphatase subunit, beta isozyme PTP4A1 protein tyrosine phosphatase type Nucleus phosphatase IVA, member 1 PTPRK protein tyrosine phosphatase, receptor Plasma Membrane phosphatase type, K RGS4 regulator of G-protein signaling 4 Cytoplasm other RGS7BP regulator of G-protein signaling 7 unknown other binding protein RGS8 regulator of G-protein signaling 8 unknown other SLC16A3 solute carrier family 16, member 3 Plasma Membrane transporter (monocarboxylic acid transporter 4) SLC30A1 solute carrier family 30 (zinc Plasma Membrane transporter transporter), member 1 SLC35A4 solute carrier family 35, member A4 unknown transporter SLC38A7 solute carrier family 38, member 7 unknown transporter SLC41A1 (includes solute carrier family 41, member 1 unknown transporter EG:254428) SLC45A3 solute carrier family 45, member 3 Cytoplasm other SLC7A1 solute carrier family 7 (cationic amino Plasma Membrane transporter acid transporter, y+ system), member 1 UBAP2 ubiquitin associated protein 2 Cytoplasm other UBE2D3 (includes ubiquitin-conjugating enzyme E2D 3 Cytoplasm enzyme EG:7323) (UBC4/5 homolog, yeast) UBE2E3 ubiquitin-conjugating enzyme E2E 3 Nucleus enzyme (UBC4/5 homolog, yeast) UBE2R2 ubiquitin-conjugating enzyme E2R 2 unknown enzyme UBE2W ubiquitin-conjugating enzyme E2W unknown enzyme (putative) UHRF2 ubiquitin-like with PHD and ring Nucleus enzyme finger domains 2 USP9X ubiquitin specific peptidase 9, X- Plasma Membrane peptidase linked
[0138] In certain embodiments, provided herein is a method of modifying, e.g., genetically engineering, placental stem cells to enhance their immunosuppressive activity to produce enhanced placental stem cells, or ePSCs. In certain embodiments, the ePSCs express 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 190%, 195%, or 200%, or more, of one or more miRs listed in Tables 2-3. e.g., as compared to an equivalent number of placental stem cells that have not been enhanced.
[0139] In certain embodiments, provided herein are ePSCs expressing 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 190%, 195%, or 200%, or more, of one or more of miRs listed in Tables 2 and 3 (see the column designated as Target miR), as compared to placental stein cells that have not been enhanced.
[0140] In certain embodiments, provided herein are enhanced placental stem cells, wherein said enhanced placental stem cells (ePSCs) are isolated placental stem cells that have been genetically engineered to express one or more of miRs listed in Tables 2 and 3 (see the column designated as Target miR) that detectably enhances the immunosuppressive activity of the ePSCs as compared to placental stem cells that have not been so engineered.
[0141] The miR inhibitors or miR mimics can be supplied by a commercial vendor (e.g., Ambion: Dharmafect), or be synthesized by, e.g., solid phase synthesis, or according to the procedures as described in, e.g., Protocols for Oligonucleotides and Analogs. Ed. Agrawal (1993), Humana Press: Scaringe. Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions. Ed. Smith (1998), 1-36, Gallo et al., Tetrahedron (2001), 57, 5707-5713).
[0142] The miR inhibitors or miR mimics useful for the production of enhanced placental stem cells can be identified by a variety of methods known in the art. In certain embodiments, such miR inhibitors or miR mimics are identified and obtained from one or more miR inhibitors or miR mimics libraries, e.g., a commercially available library (e.g., Ambion, Anti-miR miRNA Precursor Library Human V13), optionally by a screening method, e.g., medium or high-throughput screening. In one embodiment, such a library can encompass a wide range of target miRs (e.g., human genome-wide siRNA library), or pre-defined to encompass specific target genes or gene families (e.g., nuclear receptor siRNA library, phosphatase siRNA library etc.)
[0143] The screening method can be carried out, for example, using automated robotics, liquid handling equipments, data processing software, and/or sensitive detectors, e.g., Precision XS Automated Pipettor System. EL406 liquid handling system, or synergy plate reader.
[0144] 5.1.3 Other Modulatory RNA Molecules
[0145] Other modulatory RNA molecules useful for the production of ePSCs or modification of placental stem cells to enhance their immunomodulatory (e.g., immunosuppressive) activity comprise antisense RNAs, shRNAs, or shRNAmirs. These RNA molecules can be used in any combination and can be used in combination with siRNAs, miR mimics and/or miR inhibitors to produce the ePSCs as described herein.
[0146] As used herein, the term antisense RNA is an antisense ribonucleic acid molecule. By illustration only without limitation, the antisense RNAs hybridize to a target nucleic acid and modulates gene expression activities such as transcription or translation.
[0147] As used herein, the term small hairpin RNA or shRNA refers to an RNA molecule comprising a stem-loop structure; the term shRNAmir refers to microRNA-adapted shRNA. In certain embodiments, said shRNA comprises a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The shRNA hairpin structure can be, for example, cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it.
[0148] In some embodiments, shRNAmirs or microRNA-adapted shRNA provided herein are shRNA constructs that mimic naturally occurring primary transcript miRNA with the addition of an miRNA loop and a miRNA flanking sequence to a shRNA. Without wishing to be bound by any theory, the shRNAmir is first cleaved to produce shRNA by Drosha, and then cleaved again by Dicer to produce siRNA. The siRNA is then incorporated into the RISC for target mRNA degradation. This allows the shRNAmir to be cleaved by Drosha thereby allowing for a greater increase in knockdown efficiency. The addition of a miR30 loop and 125 nt of miR30 flanking sequence on either side of the shRNA hairpin has been reported to result in greater than 10-fold increase in Drosha and Dicer processing of the expressed hairpins when compared with conventional shRNA constructs without microRNA.
[0149] In one embodiment, the shRNAmirs provided herein target a gene encoding vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR) (e.g., NCBI Ref Seq Accession Number NM_000376). In a specific embodiment, said shRNAmirs have a hairpin sequence encoded from a DNA sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 224.
[0150] In another specific embodiment, said shRNAmirs have a mature sense sequence encoded from a DNA sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 225.
[0151] In one embodiment, said shRNAmirs provided herein target a gene encoding nuclear receptor subfamily 4, group A, member 3 (NR4A3) (e.g., NCBI Ref Seq Accession Number NM_173198). In a specific embodiment, said shRNAmirs have a hairpin sequence encoded from a DNA sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 226.
[0152] In another specific embodiment, said shRNAmirs have a mature sense sequence encoded from a DNA sequence that is at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 227.
[0153] The shRNAmir provided herein can be delivered to the cells by any known method. In a specific embodiment, said shRNAmir is incorporated into an eukaryotic expression vector. In another specific embodiment, said shRNAmir is incorporated into a viral vector for gene expression. Such viral vectors include, but are not limited to, retroviral vectors, e.g., lentivirus, and adenoviruses. In a specific embodiment, said shRNAmir is incorporated into a lentiviral vector.
[0154] The antisense RNAs, shRNAs and shRNAmirs can be supplied by a commercial vendor (e.g., Ambion; Dharmafect), or be synthesized by, e.g., solid phase synthesis, or according to the procedures as described in, e.g., Protocols for Oligonucleotides and Analogs. Ed. Agrawal S1993), Humana Press: Scaringe. Methods (2001), 23, 206-217. Gait er al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et. al., Tetrahedron (2001), 57, 5707-5713).
[0155] Antisense RNAs, shRNAs, shRNAmirs and other modulatory RNA molecules useful for the production of enhanced placental stem cells can be identified by a variety of methods known in the art. In certain embodiments, such antisense RNAs, shRNAs, shRNAmirs and other modulatory RNA molecules are identified and obtained from one or more libraries, e.g., a commercially available library (Thermo Scientific, shRNAmir libraries), optionally by a screening method, e.g., medium or high-throughput screening. In one embodiment, such a library can encompass a wide range of genes (e.g., human genome targeted library, or pre-defined to encompass specific target genes or gene families (e.g., human nuclear receptor targeted library, phosphatase targeted library, etc.)
[0156] The screening method can be carried out, for example, using automated robotics, liquid handling equipments, data processing software, and/or sensitive detectors, e.g., Precision XS Automated Pipettor System, EL406 liquid handling system, or synergy plate reader.
[0157] In certain embodiments, the antisense RNAs, shRNAs and shRNAmirs comprise about 1 to about 100, from about 8 to about 80, 10 to 50, 13 to 80, 13 to 50, 13 to 30, 13 to 24, 18 to 22, 19 to 23, 20 to 80, 20 to 50, 20 to 30, or 20 to 24 nucleobases (nucleobases (i.e. from about 1 to about 100 linked nucleosides).
[0158] The antisense RNAs, shRNAs and shRNAmirs can be single-stranded or double-stranded, modified or unmodified. In certain embodiments, said antisense RNAs, miR mimics, shRNAs, shRNAmirs and other modulatory RNA molecules comprise about 1 to about 100, from about 8 to about 80, 10 to 50, 13 to 80, 13 to 50, 13 to 30, 13 to 24, 18 to 22, 19 to 23, 20 to 80, 20 to 50, 20 to 30, or 20 to 24 nucleobases (i.e. from about 1 to about 100 linked nucleosides). In certain embodiment, said antisense RNAs, shRNAs and shRNAmirs are single-stranded, comprising from about 12 to about 35 nucleobases (i.e. from about 12 to about 35 linked nucleosides). In one embodiment, said antisense RNAs, miR mimics, shRNAs and shRNAmirs comprise about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length.
[0159] 5.1.4 Delivery of Modulatory RNA Molecules to Placental Stem Cells
[0160] The modulatory RNA molecules can be delivered to placental stem cells by transfection (e.g., transient or stable transfection) or other means know n in the art. In certain embodiments, said transfection can be carried out, e.g., using lipids (e.g., liposomes), calcium phosphate, cyclodextrin, dendrimers, or polymers (e.g., cationic polymers); by electroporation, optical transfection, gene electrontransfer, impalefection, gene gun, or magnetofection: via viruses (e.g., viral carriers); or a combination thereof. In one embodiment, said transfection is performed using commercially available transfection reagents or kits (e.g., Ambion, siPORT Amine, siPORT NeoFX's; Dharmafect. Dharmafect 3 Transfection Reagent or Dharmafect 1; Invitrogen, Lipofectamine RNAiMAX: Integrated DNA Technologies, Transductin; Minirus Bio LLC. TransIT-siQUEST, TransIT-TKO). In some embodiments, said transfection can be set up in a medium or high-throughput manner, including, but not limited to, use of microtiter plate (e.g., 96-well plate) and microplate reader (e.g., synergy plate reader), or automation system, for example, Precision XS Automated Pipettor System. EL406 liquid handling system. In other embodiments, said transfection is set up in a large scale, including, but not limited to, the use of tissue culture dishes or culture flasks (e.g., T25, T75, or T225 flasks). Placental stem cells can be plated and cultured in tissue culture containers, e.g., dishes, flasks, multiwell plates, or the like, for a sufficient time for the placental stem cells to proliferate to about 20-80% confluence, or about 30-70% confluence at the time of transfection. For example, there can be about 2000, 2500, 3000, 3500, or 4000 placental stem cells per well in a 96-well plate at the time of transfection. In one embodiment, placental stem cells are about 50% confluence at the time of transfection. In another embodiment, there are about 3000 or 3500 placental stem cells per well in a 96-well plate at the time of direct transfection. In another embodiment, there are about 3500 placental stem cells per well in a 96-well plate at the time of reverse transfection.
[0161] The modulatory RNA molecules can be administered to the cells by transient transfection, or be stably transfected to the cell for long-term modulation e.g., suppression) of genes to which the siRNAs are targeted. In one embodiment, stable transfection of modulatory RNA molecules can be carried out, for example, by the use of plasmids or expression vectors that express functional modulatory RNA molecules. In one embodiment, such plasmids or expression vectors comprise a selectable marker (e.g., an antibiotic selection marker). In another embodiment, such plasmids or expression vectors comprise a cytomegalovirus (CMV) promoter, an RNA polymerase III (RNA pol III) promoter (e.g., U6 or H1), or an RNA polymerase II (RNA pol II) promoter. In another embodiment, such plasmids or expression vectors are commercially available (e.g., Ambion, pSilencer 4.1-CMV vector).
[0162] Other examples of mammalian expression vectors include pLOC (Open Biosystems), which contains a cytomegalovirus promoter; pCDM8 (Seed. Nature 329:840 (1987)) and pMT2PC (Kaufman et al., EMBO J. 6:187-195 (1987)). Other example expression vectors that may be used include pFN10A (ACT) FLEXI Vector (Promega), pFN11A (BIND) FLEX1 Vector (Promega), pGL4.31 [luc2P/(GAL4UAS/Hygro](Promega), pFC14K (HALOTAG 7) MCV FLEXI Vector (Promega), pFC15A (HALOTAG 7) MCV FLEXI Vector (Promega), and the like.
[0163] When used in mammalian cells, an expression vector's control functions can be provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma virus, adenovirus 2, cytomegalovirus, and simian virus 40. Other suitable expression systems for both prokaryotic and eukaryotic cells are described, e.g., in chapters 16 and 17 of Sambrook et al., eds., Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. N.Y. (1989).
[0164] Recombinant expression vectors can include one or more control sequences that can be, for example, operably linked to the nucleic acid sequence encoding the gene to be expressed. Such control sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego. Calif. (1990). In certain embodiments, the vector includes a control sequence that directs constitutive expression of the nucleotide sequence in the placental stem cells. In certain other embodiments, the control sequence directs expression of the nucleotide sequence only in cells of certain tissues in a recipient of the ePSCs, e.g., in lung, neural, muscle, skin, vascular system, or other tissues, within said recipient. In certain other embodiments, said vector comprises a control sequence that is inducible, e.g., by contact with a chemical agent, e.g., tetracycline.
[0165] The modulatory RNA molecules can be administered to the cells by any technique known to those of skill in the art, e.g., by direct transfection. For example, said direct transfection can involve the step of pre-plating the cells prior to transfection, allowing them to reattach and resume growth for a period of time (e.g., 24 hours) before exposure to transfection complexes. The modulatory RNA molecules can also be administered to the cells by reverse transfection. For example, said reverse transfection can involve the step of adding transfection complexes to the cells while they are in suspension, prior to plating.
[0166] In various embodiments, the effects of the modulatory molecules on the ePSCs, e.g., upregulation or downregulation of one or more genes in said ePSCs, effect of the ePSCs on IL-23 production by PBMCs contacted with the ePSCs, and the like) last for up to, about, or no more than, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days, or more. In various other embodiments, the ePSCs are used within no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 days of the time the ePSCs are produced. In certain embodiments, the effects of the modulatory molecules on the ePSCs are inducible. In certain other embodiments, no, or substantially no, cellular expansion (culturing of the ePSCs, proliferation, etc.) is performed between the time the placental stem cells are modified to produce the ePSCs and the time the ePSCs are administered or cryopreserved.
[0167] Assessment of the function (e.g., silencing of genes, up-regulation of genes) of modulatory RNA molecules in the enhanced placental stem cells, e.g., the level or degree of gene silencing or up-regulation, can be accomplished by any art-recognized method for detection of protein production or nucleic acid production by cells. For example, assessment can be performed by determining the mRNA or protein level of a gene of interest in a sample of ePSCs (e.g., a sample of 1010.sup.3 to 1010.sup.7 ePSCs, or 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of said ePSCs) as compared to equivalent placental stem cells that have not been transfected or transformed with such a nucleic acid sequence. Such assessment can be performed using, e.g nucleic acid-based methods, e.g., northern blot analysis, reverse transcriptase polymerase chain reaction (RT-PCR), real-time PCR, quantitative PCR, and the like. In other embodiments, expression of protein can be assessed using antibodies that bind to the protein of interest, e.g., in an ELISA, sandwich assay, or the like. In specific embodiments, said enhanced placental stem cells produce 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% less of the mRNA of a target gene as compared to unmodified placental stein cells. In specific embodiments, said enhanced placental stem cells produce 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% more of the mRNA of a target gene expressed by a target gene as compared to unmodified placental stem cells. In a specific embodiment, said enhanced placental stem cells produce 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% less of the protein of a target gene as compared to unmodified placental stein cells. In another specific embodiment, said enhanced placental stem cells produce 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% more of the protein of a target gene as compared to unmodified placental stem cells.
[0168] 5.2 Use of Enhanced Placental Stem Cells to Modulate an Immune Response
[0169] In another aspect, provided herein is a method of treating an individual having or at risk of developing a disease, disorder or condition caused by, or relating to, an unwanted or harmful immune response, for instance, a disease, disorder or condition having an inflammatory component, comprising administering to the individual a therapeutically effective amount of ePSCs. In certain embodiments, said cells comprise or have been contacted with an effective amount of modulatory RNA molecules that (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said enhanced placental stem cells: (ii) increase cyclooxygenase II (Cox-2) activity in said enhanced placental stem cells: (iii) increase an amount of PGE2 produced by said enhanced placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by enhanced placental stem cells, compared to placental stem cells not contacted with said modulatory RNA molecules, wherein the therapeutically effective amount is an amount sufficient to cause a detectable improvement in one or more symptoms of said disease, disorder or condition.
[0170] In anther aspect, provided herein are methods for the modulation, e.g., suppression, of the activity, e.g., proliferation, of an immune cell, or plurality of immune cells, by contacting the immune cell(s) with a plurality of enhanced placental stem cells. Such enhanced placental stem cells are placental stem cells that have increased immunosuppressive activity, as described in the embodiments herein, compared to an equivalent number of unmodified or untreated placental stem cells (that it, placental stem cells that are not enhanced).
[0171] In one embodiment, provided herein is a method of suppressing an immune response comprising contacting a plurality of immune cells with a plurality of enhanced placental stem cells for a time sufficient for said enhanced placental stem cells to detectably suppress an immune response, wherein said enhanced placental stem cells detectably suppress T cell proliferation in a mixed lymphocyte reaction (MLR) assay or a regression assay.
[0172] Placental stem cells used to produce enhanced placental stem cells can be derived or obtained from a single placenta or multiple placentas. Such placental stem cells used for immunosuppression can also be derived from a single species, e.g., the species of the intended recipient or the species of the immune cells the function of which is to be reduced or suppressed, or can be derived from multiple species.
[0173] An immune cell in the context of this method means any cell of the immune system, particularly T cells and NK (natural killer) cells. Thus, in various embodiments of the method, enhanced placental stem cells are contacted with a plurality of immune cells, wherein the plurality of immune cells are, or comprises, a plurality of T cells (e.g., a plurality of CD3.sup.+ T cells, CD4.sup.+ T cells and/or CD8.sup.+ T cells) and/or natural killer cells. An immune response in the context of the method can be any response by an immune cell to a stimulus normally perceived by an immune cell, e.g., a response to the presence of an antigen. In various embodiments, an immune response can be the proliferation of T cells (e.g., CD3.sup.+ T cells, CD4.sup.+ T cells and/or CD8.sup.+ T cells) in response to a foreign antigen, such as an antigen present in a transfusion or graft, or to a self-antigen, as in an autoimmune disease. The immune response can also be a proliferation of T cells contained within a graft. The immune response can also be any activity of a natural killer (NK) cell, the maturation of a dendritic cell, or the like. The immune response can also be a local, tissue- or organ-specific, or systemic effect of an activity of one or more classes of immune cells, e.g., the immune response can be graft versus host disease, inflammation, formation of inflammation-related scar tissue, an autoimmune condition (e.g., rheumatoid arthritis. Type 1 diabetes, lupus erythematosus, etc.), and the like.
[0174] Contacting in this context encompasses bringing the placental stem cells and immune cells together in a single container (e.g., culture dish, flask, vial, etc.) or in vivo, for example, in the same individual (e.g., mammal, for example, human). In a preferred embodiment, the contacting is for a time sufficient, and with a sufficient number of placental stem cells and immune cells, that a change in an immune function of the immune cells is detectable. More preferably, in various embodiments, said contacting is sufficient to suppress immune function (e.g., T cell proliferation in response to an antigen) by at least 50%, 60%, 70%, 80%, 90% or 95%, compared to the immune function in the absence of the placental stem cells. Such suppression in an in vivo context can be determined in an in vitro assay (see below); that is, the degree of suppression in the in vitro assay can be extrapolated, for a particular number of enhanced placental stem cells and a number of immune cells in a recipient individual, to a degree of suppression in the individual.
[0175] In certain embodiments, provided herein are methods of using enhanced placental stem cells to modulate an immune response, or the activity of a plurality of one or more types of immune cells, in vitro. Contacting the enhanced placental stem cells and plurality of immune cells can comprise combining the enhanced placental stem cells and immune cells in the same physical space such that at least a portion of the plurality of enhanced placental stem cells interacts with at least a portion of the plurality of immune cells: maintaining the enhanced placental stem cells and immune cells in separate physical spaces with common medium: or can comprise contacting medium from one or a culture of enhanced placental stem cells or immune cells with the other type of cell (for example, obtaining culture medium from a culture of enhanced placental stem cells and resuspending isolated immune cells in the medium). In a specific example, the contacting is performed in a Mixed Lymphocyte Reaction (MLR). In another specific example, the contacting is performed in a regression assay. In another specific example, the contacting is performed in a Bead T-lymphocyte reaction (BTR) assay.
[0176] Such contacting can, for example, take place in an experimental setting designed to determine the extent to which a particular plurality of enhanced placental stem cells is immunomodulatory, e.g., immunosuppressive. Such an experimental setting can be, for example, a mixed lymphocyte reaction (MLR) or regression assay. Procedures for performing the MLR and regression assays are well-known in the art. See. e.g. Schwarz. The Mixed Lymphocyte Reaction: An In Vitro Test for Tolerance. J. Exp. Med. 127(5):879-890 (1968): Laccrda et al., Human Epstein-Barr Virus (EBV)-Specific Cytotoxic T Lymphocytes Home Preferentially to and Induce Selective Regressions of Autologous EBV-Induced B Lymphoproliferations in Xenografted C,B-17 Scid/Scid Mice. J. Exp. Med. 183:1215-1228 (1996). In a preferred embodiment, an MLR is performed in which pluralities of placental stem cells are contacted with a plurality of immune cells (e.g., lymphocytes, for example, CD3.sup.+, CD4.sup.+ and/or CD8.sup.+ T lymphocytes).
[0177] For example, a plurality of enhanced placental stem cells can be tested in an MLR comprising combining CD4.sup.+ or CD8.sup.+ T cells, dendritic cells (DC) and enhanced placental stem cells in a ratio of about 10:1:2, wherein the T cells are stained with a dye such as, e.g., CFSE that partitions into daughter cells, and wherein the T cells are allowed to proliferate for about 6 days. The plurality of enhanced placental stem cells is immunosuppressive if the T cell proliferation at 6 days in the presence of enhanced placental stem cells is detectably reduced compared to T cell proliferation in the presence of DC and absence of placental stem cells. Additionally, a control using unmodified or untreated (i.e., non-enhanced) placental stein cells can be run in parallel to demonstrate that the enhanced placental stem cells are more immunosuppressive than unmodified or untreated placental stem cells. In such an MLR, for example, enhanced placental stem cells can be either thawed or harvested from culture. About 20,000 enhanced placental stem cells are resuspended in 100 l of medium (RPMI 1640, 1 mM HEPES buffer, antibiotics, and 5% pooled human serum), and allowed to attach to the bottom of a well for 2 hours. CD4.sup.+ and/or CD8.sup.+ T cells are isolated from whole peripheral blood mononuclear cells Miltenyi magnetic beads. The cells are CFSE stained, and a total of 100.000 T cells (CD4.sup.+ T cells alone. CD8.sup.+ T cells alone, or equal amounts of CD4.sup.+ and CD8.sup.+ T cells) are added per well. The volume in the well is brought to 200 l, and the MLR is allowed to proceed.
[0178] In one embodiment, therefore, provided herein is a method of suppressing an immune response comprising contacting a plurality of immune cells with a plurality of enhanced placental stein cells for a time sufficient for said enhanced placental stem cells to detectably suppress T cell proliferation in a mixed lymphocyte reaction (MLR) assay or in a regression assay. In one embodiment, said enhanced placental stem cells used in the MLR represent a sample or aliquot of placental stem cells from a larger population of placental stem cells.
[0179] Populations of placental stem cells obtained from different placentas, or different tissues within the same placenta, and thus enhanced placental stein cells produced therefrom, can differ in their ability to modulate an activity of an immune cell, e.g., can differ in their ability to suppress T cell activity or proliferation, macrophage activity. DC activity, or NK cell activity. It is also possible that different preparations of enhanced placental stem cells may vary in their ability to modulate an activity of an immune cell, e.g., can differ in their ability to suppress T cell activity or proliferation, macrophage activity. DC activity, or NK cell activity. It is thus desirable to determine, prior to use, the immunosuppressive activity of a particular population of placental stem cells or enhanced placental stein cells for immunosuppression. Such a activity can be determined, for example, by testing a sample of the placental stem cells or enhanced placental stem cells in, e.g., an MLR or regression assay. In one embodiment, an MLR is performed with the sample, and a degree of immunosuppression in the assay attributable to the placental stem cells or enhanced placental stem cells is determined. This degree of immunosuppression can then be attributed to the placental stem cell population or enhanced placental stem cell population that was sampled. Thus, the MLR can be used as a method of determining the absolute and relative ability of a particular population of placental stem cells or enhanced placental stem cells to suppress immune function. The parameters of the MLR can be varied to provide more data or to best determine the capacity of a sample of placental stem cells or enhanced placental stem cells to immunosuppress. For example, because immunosuppression by placental stem cells or enhanced placental stem cells appears to increase roughly in proportion to the number of placental stem cells or enhanced placental stem cells present in the assay, the MLR can be performed with, in one embodiment, two or more numbers of placental stem cells or enhanced placental stem cells, e.g., 110.sup.3, 310.sup.3, 110.sup.4 and/or 310.sup.4 placental stem cells or enhanced placental stem cells per reaction. The number of placental stem cells or enhanced placental stem cells relative to the number of T cells in the assay can also be varied. For example, placental stem cells or enhanced placental stem cells, and T cells, in the assay can be present in any ratio of, e.g. about 10:1 to about 1:10, preferably about 1:5, though a relatively greater number of placental stem cells or enhanced placental stem cells, or T cells, can be used.
[0180] The regression assay or BTR assay can be used in similar fashion.
[0181] Enhanced placental stem cells can be administered to an individual in a ratio, with respect to a known or expected number of immune cells, e.g., T cells, in the individual, of from about 10:1 to about 1:10, preferably about 1:5. However, enhanced placental stem cells can be administered to an individual in a ratio of, in non-limiting examples, about 10,000:1, about 1,000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1.000 or about 1:10,000. Generally, about 110.sup.5 to about 110.sup.8 enhanced placental stem cells per recipient kilogram, preferably about 110.sup.6 to about 110.sup.7 enhanced placental stem per recipient kilogram can be administered to effect immunosuppression. In various embodiments, a plurality of enhanced placental stem cells administered to an individual or subject comprises at least, about, or no more than, 110.sup.5, 310.sup.5, 110.sup.6, 310.sup.6, 110.sup.7, 310.sup.7, 110.sup.8, 310.sup.8, 110.sup.9, 310.sup.9 enhanced placental stem cells, or more.
[0182] The enhanced placental stem cells can also be administered with one or more second types of stem cells, e.g., mesenchymal stem cells from bone marrow. Such second stem cells can be administered to an individual with said enhanced placental stem cells in a ratio of, e.g., about 1:10 to about 10:1.
[0183] To facilitate contacting, or proximity of, enhanced placental stem cells and immune cells in vivo, the enhanced placental stem cells can be administered to an individual by any route sufficient to bring the enhanced placental stem cells and immune cells into contact with each other. For example, the enhanced placental stem cells can be administered to the individual. e.g., intravenously, intramuscularly, intraperitoneally, intraocularly, parenterally, intrathecally, or directly into an organ, e.g., pancreas. For in vivo administration, the enhanced placental stem cells can be formulated as a pharmaceutical composition, as described below.
[0184] The method of immunosuppression can additionally comprise the addition of one or more immunosuppressive agents, particularly in the in vivo, context. In one embodiment, the enhanced placental stem cells are contacted with the immune cells in vivo in an individual, and a composition comprising an immunosuppressive agent is administered to the individual.
[0185] Immunosuppressive agents are well-known in the art and include, e.g., anti-T cell receptor antibodies (monoclonal or polyclonal, or antibody fragments or derivatives thereof), anti-IL-2 receptor antibodies (e.g., Basiliximab (SIMULECT) or daclizumab (ZENAPAX)), anti T cell receptor antibodies (e.g., Muromonab-CD3), azathioprine, corticosteroids, cyclosporine, tacrolimus, mycophenolate mofetil, sirolimus, calcineurin inhibitors, and the like. In a specific embodiment, the immunosuppressive agent is a neutralizing antibody to macrophage inflammatory protein (MIP)-1 or MIP-1. Preferably, the anti-MIP-1 or MIP-1 antibody is administered in an amount sufficient to cause a detectable reduction in the amount of MIP-1 and/or MIP-1 in said individual.
[0186] Placental stem cells, in addition to suppression of proliferation of T cells, have other anti-inflammatory effects on cells of the immune system which can be beneficial in the treatment of a CNS injury, e.g., a spinal cord injury or traumatic brain injury. For example, placental stem cells, e.g., in vitro or in vivo, as when administered to an individual, reduce an immune response mediated by a Th1 and/or a Th17 T cell subset. In another aspect, provided herein is a method of inhibiting a pro-inflammatory response, e.g., a Th1 response or a Th17 response, either in vivo or in vitro, comprising contacting T cells (e.g., CD4.sup.+ T lymphocytes or leukocytes) with enhanced placental stem cells, e.g., the enhanced placental stem cells described herein. In a specific embodiment, said contacting detectably reduces Th1 cell maturation. In a specific embodiment of the method, said contacting detectably reduces the production of one or more of lymphotoxin-1 (LT-1), interleukin-1 (IL-1), IL-12, IL-17, IL-21, IL-23, tumor necrosis factor alpha (TNF) and/or interferon gamma (IFN) by said T cells or by an antigen-producing cell. In another specific embodiment of the method, said contacting potentiates or upregulates a regulatory T cell (Treg) phenotype, and/or reduces expression in a dendritic cell (DC) and/or macrophage of biomolecules that promote a Th1 and/or Th17 response (e.g., CD80, CD83, CD86, ICAM-1, HLA-11).
[0187] In another embodiment, provided herein is a method of reducing the production of pro-inflammatory cytokines from macrophages, comprising contacting the macrophages with an effective amount of enhanced placental stem cells. In another embodiment, provided herein is a method of increasing a number of tolerogenic cells, promoting tolerogenic functions of immune cells, and/or upregulating tolerogenic cytokines, e.g., from macrophages, comprising contacting immune system cells with an effective amount of enhanced placental stem cells. In a specific embodiment, said contacting causes activated macrophages to produce detectably more IL-10 than activated macrophages not contacted with said enhanced placental stem cells. In another embodiment, provided herein is a method of upregulating, or increasing the number of, anti-inflammatory T cells, comprising contacting immune system cells with an effective amount of enhanced placental stein cells.
[0188] In one embodiment, provided herein is a method of inhibiting a Th1 response in an individual comprising administering to the individual an effective amount of placental stem cells, wherein said effective amount is an amount that results in a detectable decrease in a Th1 response in the individual. In another embodiment, provided herein is a method of inhibiting a Th17 response in an individual comprising administering to the individual an effective amount of placental stem cells, wherein said effective amount is an amount that results in a detectable decrease in a Th17 response in the individual. In specific embodiments of these methods, said administering detectably reduces the production, by T cells or antigen presenting cells in said individual, of one or more of IL-1, IL-12, IL-17, IL-21, IL-23, TNF and/or IFN.
[0189] In another specific embodiment of the method, said contacting potentiates or upregulates a regulatory T cell (Treg) phenotype, or modulates production in a dendritic cell t DC(and/or macrophage in said individual of markers the promote a Th1 or Th17 response. In another specific embodiment, the method comprises additionally administering IL-10 to said individual. In another specific embodiment, the individual has graft-versus-host disease. In another specific embodiment, the individual has rheumatoid arthritis, multiple sclerosis, psoriasis, inflammatory bowel disease (e.g., Crohn's disease), diabetes (e.g., diabetes mellitus), lupus (e.g., lupus erythematosus), scleroderma, or mycosis fungoides.
[0190] In another aspect, provided herein are enhanced placental stem cells, as described herein, that have been additionally genetically engineered to express one or more anti-inflammatory cytokines. In a specific embodiment, said anti-inflammatory cytokines comprise IL-10.
[0191] 5.3 Placental Stem Cells and Placental Stem Cell Populations
[0192] The methods provided herein use enhanced placental stem cells, or ePSCs. In another aspect, provided herein are placental stem cells that have been treated or modified, according to methods of modifying placental stem cells provided herein, to enhance their immunomodulatory (e.g., immunosuppressive) activity over that of untreated or unmodified placental stem cells.
[0193] Enhanced placental stem cells are produced from placental stem cells, which are stem cells obtainable from a placenta or part thereof, that (1) adhere to a tissue culture substrate; (2) have the capacity to differentiate into non-placental cell types: and (3) have, in sufficient numbers, the capacity to detectably suppress an immune function, e.g., proliferation of CD4.sup.+ and/or CD8.sup.+ T cells in a mixed lymphocyte reaction assay or regression assay. Enhancement of such placental stem cells by oligomeric or polymeric molecules (e.g., modulatory RNA molecules such as antisense RNAs, siRNAs, miR inhibitors, shRNAs, or a combination thereof) provided herein improves upon the native immunosuppressive capacity of such placental stem cells.
[0194] In certain embodiments, the enhanced placental stem cells (ePSCs), when contacted with (e.g., co-cultured with) peripheral blood mononuclear cells (PBMCs), reduce an amount of interleukin-23 (IL-23) produced by said PBMCs, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, the PBMCs are contacted with said ePSCs in vivo, e.g. within an individual to whom the ePSCs are administered. In another specific embodiment, the PBMCs are contacted with said ePSCs in vitro.
[0195] In certain embodiments, said modulatory RNA molecules target one or more genes in said ePSCs that modulate the production of IL-23 by PBMCs such that the production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In a specific embodiment, said one or more genes comprise one or more of Twinfilin-1, human nuclear receptor subfamily 1, group H, member 3 (NR1H3), deoxynucleotidyltransferase, terminal, interacting protein 1 (DNTT1P1), vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), nuclear receptor subfamily 4, group A, member 3 (NR4A3), nuclear receptor subfamily 4, group A, member 2 (NR4A2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), and nuclear receptor subfamily 1, group I, member 2 (NR112). In another specific embodiment, said one or more genes comprise NR4A2. In another specific embodiment, said one or more genes comprise NR4A3.
[0196] In one embodiment, said modulatory RNA molecules are small interfering RNAs (siRNAs). In a specific embodiment, said siRNAs are double-stranded, wherein one strand of said siRNAs have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 1, 3, 5, 7, 9, 11 or 13, e.g., wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs. In a specific embodiment, said siRNAs are double-stranded, wherein one strand of said siRNAs have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to SEQ ID NO: 2, 4, 6, 8, 10, 12 or 14, e.g., wherein said ePSCs contacted with said siRNAs suppress IL-23 production in PBMCs contacted with said ePSCs.
[0197] In certain embodiments, said modulatory RNA molecules target one or more miRNAs in said ePSCs that modulate the production of IL-23 by PBMCs such that production of IL-23 by said PBMCs contacted with said ePSCs is reduced, e.g., as compared to PBMCs contacted with an equivalent number of unmodified placental stem cells. In a specific embodiment, said one or more miRNAs comprise hsa-miR-183, hsa-miR-491-5p, hsa-miR-132*, hsa-miR-129-5p, hsa-miR-636, hsa-miR-100, hsa-miR-181a, hsa-miR-519a, hsa-miR-338-3p, hsa-miR-1179, hsa-miR-521, hsa-miR-608, hsa-miR-1306, ha-miR-543, hsa-miR-542-3p, hsa-miR-23b, hsa-miR-299-3p, hsa-miR-597, hsa-miR-1976, hsa-miR-1252, hsa-miR-510, hsa-miR-1207-5p, hsa-miR-518a-3p, hsa-miR-1250, hsa-miR-1274a, hsa-miR-141*, hsa-miR-9*, hsa-miR-566, hsa-miR-142-5p, hsa-miR-23a*, hsa-miR-519e*, hsa-miR-1292, hsa-miR-96, hsa-miR-886-3p, hsa-miR-216b, hsa-miR-218-2*, hsa-miR-182, hsa-miR-545*, hsa-miR-517a, hsa-miR-541*, hsa-miR-1293, hsa-miR-339-5p, hsa-miR-494, hsa-miR-196a, hsa-miR-371-5p, hsa-miR-136*, hsa-miR-214, hsa-miR-25*, hsa-miR-452*, hsa-miR-454*, hsa-miR-548b-5p, hsa-miR-10b*, hsa-miR-218, hsa-miR-548m, hsa-miR-520a-3p, hsa-miR-1323, hsa-miR-24-2*, hsa-miR-613, hsa-miR-26a, hsa-miR-193a-3p, hsa-miR-1208, hsa-miR-767-5p, hsa-miR-491-3p, hsa-miR-626, hsa-miR-216a, hsa-miR-151-5p, hsa-miR-1282, hsa-miR-497*, hsa-miR-129-3p, hsa-miR-1, hsa-miR-129*, hsa-miR-24, hsa-miR-24-1*, hsa-miR-218-1*, hsa-miR-183, and/or hsa-miR-183*.
[0198] In one embodiment, said modulatory RNA molecules are miR inhibitors. In a specific embodiment, said miR inhibitors have a sequence of at least about 70%, 80%, 90%, 95%, 98% or 100% identical to any of SEQ ID NO: 59-83, e.g., wherein said ePSCs contacted with said miR inhibitors suppress IL-23 produced by said PBMCs contacted with said ePSCs.
[0199] In certain embodiments, the enhanced placental stem cells (ePSCs) have increased cyclooxygenase II (Cox-2) activity, e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said Cox-2 activity is induced by IL-1.
[0200] In certain embodiments, the enhanced placental stem cells (ePSCs) have increased production of prostaglandin E2 (PGE2), e.g., as compared to an equivalent number of unmodified placental stem cells. In one embodiment, said production of PGE2 production is induced by IL-1.
[0201] In certain embodiments, said modulatory RNA molecules target one or more genes in said ePSCs that modulate the production of PGE2 by said ePSCs such that the production of PGE2 by said ePSCs is increased, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, said one or more genes comprise one or more of cholinergic receptor, nicotinic beta 1 (muscle) (CHRNB1), chloride channel 6 (CLCN6), chloride intracellular channel 4 (CLIC4), casein kinase 1, gamma 3 (CSNK1G3), casein kinase 2, alpha prime polypeptide (CSNK2A2), dual specificity phosphatase 1 (DUSP1), potassium channel modulatory factor 1 (KCMF1), potassium voltage-gated channel, shaker-related subfamily, member 3 (KCNA3), potassium inwardly-rectifying channel, subfamily J, member 14 (KCNJ14), potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), potassium channel tetramerisation domain containing 13 (KCTD13), hepatocyte growth factor (hepapoietin A: scatter factor) (HGF), nuclear receptor subfamily 2, group C, member 2 (NR2C2), phosphodiesterase 1B, calmnodulin-dependent (PDE1B), phosphodiesterase 7B (PDL7B), phosphatidylinositol 4-kinase type 2 beta (PI4K2B), phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), phospholipase C, eta 2 (PLCH2), protein phosphatase. Mg2.sup.+/Mn2.sup.+ dependent, 1D (PPM1D), protein phosphatase, Mg2.sup.+/Mn2.sup.+ dependent, 1G (PPM1G), protein phosphatase 1 regulatory (inhibitor) subunit 2 pseudogene 9 (PPP1R2P9), protein phosphatase 1, regulatory (inhibitor) subunit 3B (PPP1R3B), protein phosphatase 1, regulatory (inhibitor) subunit 9B (PPP1R9B), protein phosphatase 2, catalytic subunit, beta isozyme (PPP2CB), protein tyrosine phosphatase type IVA, member 1 (PTP4A1), protein tyrosine phosphatase, receptor type, K (PTPRK), regulator of G-protein signaling 4 (RGS4), regulator of G-protein signaling 7 binding protein (RGS7BP), regulator of G-protein signaling 8 (RG8S) solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), solute carrier family 30 (zinc transporter), member 1 (SLC30A1), solute carrier family 35, member A4 (SLC35A4), solute carrier family 38, member 7 (SLC38A7), solute carrier family 41, member 1 (SLC4A1 (includes EG:254428)), solute carrier family 45, member 3 (SLC45A3), solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (SLC7A), ubiquitin associated protein 2 (LUBAP2), ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3 (includes EG:7323)), ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3), ubiquitin-conjugating enzyme E2R 2 (UBE2R2), ubiquitin-conjugating enzyme E2W (putative) (UBE2W), ubiquitin-like with PHD and ring finger domains 2 (UHRF2), ubiquitin specific peptidase 9, X-linked (IUSP9X), and hypoxia inducible factor 1, alpha subunit (HIF1A). In another specific embodiment, said one or more genes comprise HIF1A. In another specific embodiment, said one or more genes comprise DUSP1. In another specific embodiment, said one or more genes comprise PDE7B.
[0202] In certain embodiments, said modulatory RNA molecules target one or more miRNAs in said ePSCs that modulate the production of PGE2 by ePSCs such that production of IL-23 by said ePSCs is reduced, e.g., as compared to an equivalent number of unmodified placental stem cells. In a specific embodiment, said one or more miRNAs comprise one or more of hsa-miR-886-3p, hsa-miR-371-3p, hsa-miR-25*, hsa-miR-376c, hsa-miR-888, hsa-miR-517b, hsa-miR-433, hsa-miR-200a*, hsa-miR-520a-5p, hsa-miR-1286, hsa-miR-182*, hsa-miR-1273, hsa-miR-1280, hsa-miR-563, hsa-miR-501-5p, hsa-miR-448, hsa-miR-485-3p, hsa-miR-29c, hsa-miR-548f, hsa-miR-1248, hsa-let-7d*, hsa-miR-618, hsa-miR-30c, hsa-miR-136, hsa-miR-181a, hsa-miR-26a, hsa-miR-10a, hsa-miR-557, hsa-miR-564, hsa-miR-520g, hsa-miR-122*, hsa-miR-548k, hsa-miR-423-3p, hsa-miR-548j, hsa-miR-340*, hsa-miR-573, hsa-miR-548i, hsa-miR-555, hsa-miR-144, hsa-miR-567, hsa-miR-191*, hsa-miR-566, hsa-miR-335, hsa-miR-126*, hsa-miR-22*, hsa-miR-572, hsa-miR-517c, hsa-miR-380*, hsa-miR-106a*, hsa-miR-519e, hsa-miR-520c-3p, hsa-miR-517*, hsa-miR-432*, hsa-miR-520e, hsa-miR-9*, hsa-miR-551a, hsa-miR-1471, hsa-miR-613, hsa-miR-562, hsa-miR-922, hsa-miR-216a, hsa-miR-499-5p, hsa-miR-25, hsa-miR-197, hsa-miR-500*, hsa-miR-365*, hsa-miR-1247, hsa-miR-586, hsa-miR-548d-3p, hsa-miR-27a*, hsa-miR-598, hsa-miR-609, hsa-miR-132, hsa-miR-411*, hsa-miR-135a, hsa-miR-31, hsa-miR-181a*, hsa-miR-1245, hsa-miR-758, hsa-miR-924, hsa-miR-1246, hsa-miR-23b, hsa-miR-631, hsa-miR-1, hsa-miR-920, hsa-miR-589*, hsa-miR-638, hsa-miR-1244, hsa-miR-328, hsa-let-7i, hsa-miR-429, hsa-miR-380, hsa-let-7b*, hsa-miR-614, hsa-miR-1225-5p, hsa-miR-545*, hsa-miR-320c, hsa-miR-579, hsa-miR-1282, hsa-miR-455-5p, hsa-miR-615-3p, hsa-miR-585, hsa-miR-559, hsa-miR-561, hsa-miR-191, hsa-miR-187, hsa-miR-29b, hsa-miR-769-5p, hsa-miR-495, hsa-miR-516a-3p, hsa-miR-938, hsa-miR-936, hsa-miR-373*, hsa-miR-1184, hsa-miR-122, hsa-miR-208b, hsa-miR-223*, hsa-miR-1972, hsa-miR-520h, hsa-miR-330-3p, hsa-miR-149, hsa-miR-7, hsa-miR-29b-2*, hsa-miR-520d-5p, hsa-miR-592, hsa-miR-940, hsa-miR-146b-3p, hsa-miR-518e*, hsa-miR-1255a, hsa-miR-935, hsa-miR-633, hsa-miR-513a-5p, hsa-miR-361-3p, hsa-miR-194, hsa-miR-1185, hsa-miR-875-3p, hsa-miR-200a, hsa-miR-1201, hsa-miR-629, hsa-miR-139-5p, hsa-miR-504, hsa-miR-452, hsa-miR-517a, hsa-miR-543, hsa-miR-616*, hsa-miR-651, hsa-miR-1254, hsa-miR-339-3p, hsa-miR-510, hsa-miR-181c*, hsa-miR-19b-1*, hsa-miR-1274a, hsa-miR-1294, hsa-miR-1306, hsa-miR-1226*, and hsa-miR-541* in said enhanced placental stem. In one embodiment, said modulatory RNA molecules are miR inhibitors. In a specific embodiment, said miR inhibitors have a sequence at least about 70%, 80%, 90%, 95%, 98% or 100% identical to any of SEQ ID NO: 27, 28, 35, 39, 53-54, and 181-222.
[0203] In certain embodiments, the enhanced placental stem cells (ePSCs) have reduced production of a pro-inflammatory cytokine (e.g., extracellular pro-inflammatory cytokine), e.g., as compared to an equivalent number of unmodified placental stem cells. In certain embodiments, said pro-inflammatory cytokine is IL-1, IL-6, IL-8, TNF-, or any combinations thereof. In a specific embodiment, said pro-inflammatory cytokine is IL-6, IL-8, or a combination thereof. In another specific embodiment, said pro-inflammatory cytokine is IL-6.
[0204] In another embodiment, the enhanced placental stem cells (ePSCs) have suppressed response induced by interferon-gamma (IFN-), as compared to an equivalent number of unmodified placental stem cells. In one specific embodiment, said modulatory RNA molecules target (e.g., modulate) one or more genes in said ePSCs that modulate IFN--induced response of said ePSCs such that the IFN--induced response is suppressed, e.g., as compared to an equivalent number of unmodified placental stem cells. In another specific embodiment, said one or more genes comprise one or more of protein inhibitor of activated STAT, 1 (PIAS1) and TYRO protein tyrosine kinase binding protein (TYROBP).
[0205] Placental stem cells from which enhanced placental stem cells are produced are not derived from blood, e.g., placental blood or umbilical cord blood. The placental stem cells used to produce the enhanced placental stem cells used in the methods and compositions provided herein have the capacity, and can be selected for their capacity, to suppress the immune system of an individual.
[0206] Placental stem cells can be either fetal or maternal in origin (that is, can have the genotype of either the mother or fetus). Populations of placental stem cells, or populations of cells comprising placental stem cells, can comprise placental stem cells that are solely fetal or maternal in origin, or can comprise a mixed population of placental stem cells of both fetal and maternal origin. The placental stem cells, and populations of cells comprising the placental stem cells, can be identified and selected by the morphological, marker, and culture characteristics discussed below.
[0207] 5.3.1 Physical and Morphological Characteristics
[0208] The placental stem cells used as described herein, when cultured in primary cultures or in cell culture, adhere to the tissue culture substrate, e.g., tissue culture container surface (e.g., tissue culture plastic). Placental stem cells in culture assume a generally fibroblastoid, stellate appearance, with a number of cyotplasmic processes extending from the central cell body. The placental stem cells are, however, morphologically differentiable from fibroblasts cultured under the same conditions, as the placental stem cells exhibit a greater number of such processes than do fibroblasts. Morphologically, placental stem cells are also differentiable from hematopoietic stem cells, which generally assume a more rounded, or cobblestone, morphology in culture.
[0209] 5.3.2 Cell Surface, Molecular and Genetic Markers
[0210] The isolated placental stem cells, e.g., isolated multipotent placental stem cells or isolated placental stem cells, and populations of such isolated placental stem cells, useful in the methods disclosed herein, e.g., the methods of treatment of a CNS injury, are tissue culture plastic-adherent human placental stem cells that have characteristics of multipotent cells or stem cells, and express a plurality of markers that can be used to identify and/or isolate the cells, or populations of cells that comprise the stem cells. In certain embodiments, the placental stem cells are angiogenic, e.g., in vitro or in vivo. The isolated placental stem cells, and placental cell populations described herein (that is, two or more isolated placental stem cells) include placental stem cells and placental cell-containing cell populations obtained directly from the placenta, or any part thereof (e.g., chorion, placental cotyledons, or the like). Isolated placental cell populations also include populations of (that is, two or more) isolated placental stein cells in culture, and a population in a container, e.g., a bag. The isolated placental stem cells described herein are not bone marrow-derived mesenchymal cells, adipose-derived mesenchymal stem cells, or mesenchymal cells obtained from umbilical cord blood, placental blood, or peripheral blood. Placental cells, e.g., placental multipotent cells and placental stem cells, useful in the methods and compositions described herein are described herein and, e.g., in U.S. Pat. Nos. 7,311,904; 7,311,905; 7,468,276 and 8,057,788, the disclosures of which are hereby incorporated by reference in their entireties.
[0211] In certain embodiments, the isolated placental stem cells are CD34, CD10.sup.+ and CD105.sup.+ as detected by flow cytometry. In another specific embodiment, the isolated CD34, CD10.sup.+ CD105.sup.+ placental stem cells have the potential to differentiate into cells of a neural phenotype, cells of an osteogenic phenotype, and/or cells of a chondrogenic phenotype. In another specific embodiment, the isolated CD34, CD10.sup.+, CD105.sup.+ placental stem cells are additionally CD200.sup.+, In another specific embodiment, the isolated CD34, CD10.sup.+, CD105.sup.+ placental stem cells are additionally CD45 or CD90.sup.+. In another specific embodiment, the isolated CD34, CD10.sup.+, CD105.sup.+ placental stem cells are additionally CD45 and CD90.sup.+, as detected by flow cytometry. In another specific embodiment, the isolated CD34, CD10.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells are additionally CD90.sup.+ or CD45, as detected by flow cytometry. In another specific embodiment, the isolated CD34, CD10.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells are additionally CD90.sup.+ and CD45, as detected by flow cytometry, i.e., the cells are CD34, CD10.sup.+, CD45, CD90.sup.+, CD105.sup. and CD200.sup.+. In another specific embodiment, said CD34, CD10.sup.+, CD45, CD90.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells are additionally CD80.sup. and CD86.sup..
[0212] In certain embodiments, said placental stem cells are CD34.sup., CD10.sup.+, CD105.sup.+ and CD200.sup.+, and one or more of CD38, CD45, CD80.sup.+, CD86.sup.+, CD133.sup.+, HLA-DR,DP,DQ.sup.+, SSEA3.sup.+, SSEA4.sup.+, CD29.sup.+, CD44.sup.+, CD73.sup.+, CD90.sup.+, CD105.sup.+, HLA-A,B,C.sup.+, PDL1.sup.+, ABC-p.sup.+, and/or OCT-4.sup.+, as detected by flow cytometry. In other embodiments, any of the CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells described above are additionally one or more of CD29.sup.+, CD38, CD44.sup.+, CD54.sup.+, SH3.sup.+ or SH4.sup.+. In another specific embodiment, the placental stem cells are additionally CD44.sup.+. In another specific embodiment of any of the isolated CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stein cells above, the cells are additionally one or more of CD117, CD133, KDR (VEGFR2), HLA-A,B,C.sup.+, HLA-DP,DQ,DR, or Programmed Death-1 Ligand (PDL1).sup.+, or any combination thereof.
[0213] In another embodiment, the CD34, CD10.sup.+, CD105.sup.+ placental stem cells are additionally one or more of CD13.sup.+, CD29.sup.+, CD33.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD62E.sup.+, CD62L.sup.+, CD62P.sup.+, SH3.sup.+ (CD73.sup.+), SH4.sup.+ (CD73.sup.+), CD80.sup.+, CD86.sup.+, CD90.sup.+, SH2.sup.+ (CD105.sup.+), CD106/VCAM.sup.+, CD117.sup.+, CD144/VE-cadherin.sup.low, CD184/CXCR4.sup.+, CD200.sup.+. CD133.sup.+, OCT-4.sup.4, SSEA3.sup.+, SSE4.sup.+, ABC-p.sup.+, KDR (VEGFR2), HLA-A,B,C.sup.+, HLA-DP,DQ,DR, HLA-G, or Programmed Death-1 Ligand (PDL1).sup.+, or any combination thereof. In another embodiment, the CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells are additionally CD13.sup.+, CD29.sup.+, CD33.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54/ICAM.sup.+, CD62E.sup.+, CD62L.sup.+, CD62P.sup.+, SH3.sup.+ (CD73.sup.+), SH4.sup.+ (CD73.sup.+), CD80.sup.+, CD86.sup.+, CD90.sup.+, SH2.sup.+ (CD105.sup.+), CD106/VCAM.sup.+, CD117, CD144/VE-cadherin.sup.low, CD184/CXCR4.sup.+, CD200.sup.+, CD133.sup.+, OCT-4.sup.+. SSEA3.sup.+, SSEA4.sup.+, ABC-p.sup.+, KDR.sup.+ (VEGFR2.sup.+), HLA-A,B,C.sup.+, HLA-DP,DQ,DR, HLA-G.sup.+, and Programmed Death-1 Ligand (PDL1).sup.+.
[0214] In another specific embodiment, any of the placental stem cells described herein are additionally ABC-p.sup.+, as detected by flow cytometry, or OCT-4.sup.+ (POU5F1.sup.+), as determined by reverse-transcriptase polymerase chain reaction (RT-PCR), wherein ABC-p is a placenta-specific ABC transporter protein (also known as breast cancer resistance protein (BCRP) or as mitoxantrone resistance protein (MXR)), and OCT-4 is the Octamer-4 protein (POU5F1). In another specific embodiment, any of the placental stem cells described herein are additionally SSEA3.sup.+ or SSEA4, as determined by flow cytometry, wherein SSEA3 is Stage Specific Embryonic Antigen 3, and SSEA4 is Stage Specific Embryonic Antigen 4. In another specific embodiment, any of the placental stem cells described herein are additionally SSEA3 and SSLA4.
[0215] In another specific embodiment, any of the placental stem cells described herein are, or are additionally, one or more of MHC-1.sup.+ (e.g., HLA-A,B,C.sup.+), MHC-11.sup.+ (e.g., HLA-DP,DQ,DR.sup.+) or HLA-G.sup.+. In another specific embodiment, any of the placental stem cells described herein are additionally MHC-1.sup.+ (e.g., HLA-A,B,C). MHC-II.sup.+ (e.g., HLA-DP,DQ,DR) and HLA-G.sup.+.
[0216] Also provided herein are populations of the isolated placental stem cells, or populations of cells, e.g., populations of placental cells, comprising, e.g., that are enriched for, the isolated placental stem cells, that are useful in the methods and compositions disclosed herein. Preferred populations of cells are those comprising the isolated placental stem cells, wherein the populations of cells comprise, e.g., at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% isolated CD10.sup.+, CD105.sup.+ and CD34.sup.+ placental stem cells; that is, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% of cells in said population are isolated CD10.sup.+, CD105.sup.+ and CD34.sup.+ placental stem cells. In a specific embodiment, the isolated CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells are additionally CD200.sup.+. In another specific embodiment, the isolated CD34.sup.+, CD10.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells are additionally CD90.sup.+ or CD45.sup.+, as detected by flow cytometry. In another specific embodiment, the isolated CD34.sup.+, CD10.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells are additionally CD90.sup.+ and CD45.sup.+, as detected by flow cytometry. In another specific embodiment, any of the isolated CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells described above are additionally one or more of CD29.sup.+, CD38.sup.+, CD44.sup.+, CD54.sup.+, SH3.sup.+ or SH4.sup.+. In another specific embodiment, the isolated CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells, or isolated CD34.sup.+, CD10.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells, are additionally CD44.sup.+. In a specific embodiment of any of the populations of cells comprising isolated CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells above, the isolated placental stem cells are additionally one or more of CD13.sup.+, CD29.sup.+, CD33.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD62E.sup.+, CD62L.sup.+, CD62P.sup.+, SH3.sup.+ (CD73.sup.+), SH4.sup.+ (CD73.sup.+), CD80.sup.+, CD86.sup.+, CD90.sup.+, SH2.sup.+ (CD105.sup.+), CD106/VCAM.sup.+, CD117.sup.+, CD144/VE-cadherin.sup.low, CD184/CXCR4.sup.+, CD200.sup.+, CD133.sup.+, OCT-4.sup.+, SSEA3.sup.+, SSEA4.sup.+, ABC-p.sup.+, KDR (VEGFR2). HLA-A,B,C.sup.+, HLA-DP,DQ,DR.sup.+, HLA-G.sup.+, or Programmed Death-1 Ligand (PDL1).sup.+, or any combination thereof. In another specific embodiment, the CD34.sup.+, CD10.sup.+, CD105.sup.+ placental stem cells are additionally CD13.sup.+, CD29.sup.+, CD33.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54/ICAM.sup.+, CD62E.sup.+, CD62L.sup.+, CD62P.sup.+, SH3.sup.+ (CD73.sup.+), SH4.sup.+ (CD73.sup.+), CD80.sup.+, CD86.sup.+, CD90.sup.+, SH2.sup.+ (CD105.sup.+), CD106/VCAM.sup.+, CD117.sup.+, CD144/VE-cadherin.sup.low, CD184/CXCR4.sup.+, CD200.sup.+, CD133.sup.+, OCT-4.sup.+, SSEA3.sup.+, SSEA4.sup.+, ABC-p.sup.+, KDR (VEGFR2.sup.+), HLA-A,B,C.sup.+, HLA-DP,DQ,DR.sup.+, HLA-G.sup.+, and Programmed Death-1 Ligand (PDL1).sup.+.
[0217] In certain embodiments, the isolated placental stem cells in said population of cells are one or more, or all, of CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH2.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+, SSEA4.sup.+, OCT-4.sup.+, and ABC-p.sup.+, wherein said isolated placental stem cells are obtained by physical and/or enzymatic disruption of placental tissue. In a specific embodiment, the isolated placental stem cells are OCT-4.sup.+ and ABC-p.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+ and CD34.sup.+, wherein said isolated placental stem cells have at least one of the following characteristics: CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+, and SSEA4.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+, CD34.sup.+, CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+, and SSEA4.sup.+. In another embodiment, the isolated placental stem cells are OCT-4.sup.+, CD34.sup.+, SSEA3.sup.+, and SSEA4.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+ and CD34.sup.+, and is either SH2.sup.+ or SH3.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+, CD34.sup.+, SH2.sup.+, and SH3.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+, CD34.sup.+, SSEA3.sup.+, and SSEA4.sup.+, and are either SH2.sup.+ or SH3.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+ and CD34.sup.+, and either SH2.sup.+ or SH3.sup.+, and is at least one of CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SSEA3.sup.+, or SSEA4.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+, CD34.sup.+, CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SSEA3.sup.+, and SSEA4.sup.+, and either SH2.sup.+ or SH3.sup.+.
[0218] In another embodiment, the isolated placental stem cells are SH2.sup.+, SH3.sup.+, SH4.sup.+ and OCT-4.sup.+. In another specific embodiment, the isolated placental stem cells are CD10.sup.+, CD29.sup.+, CD44.sup.+, CD54.sup.+, CD90.sup.+, CD34.sup.+, CD45.sup.+, SSEA3.sup.+, or SSEA4.sup.+. In another embodiment, the isolated placental stem cells are SH2.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+ and SSEA4.sup.+. In another specific embodiment, the isolated placental stem cells are SH2.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+ and SSEA4.sup.+, CD10.sup.+, CD29.sup.+, CD44.sup.+, CD54.sup.+, CD90.sup.+, OCT-4.sup.+, CD34.sup.+ or CD45.sup.+.
[0219] In another embodiment, the isolated placental stem cells useful in the methods and compositions disclosed herein are CD10.sup.+, CD29.sup.+, CD34.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH2.sup.+, SH3.sup.+, and SH4.sup.+; wherein said isolated placental stem cells are additionally one or more of OCT-4.sup.+, SSEA3.sup.+ or SSEA4.sup.+.
[0220] In certain embodiments, isolated placental stem cells are CD200.sup.+ or HLA-G.sup.+. In a specific embodiment, the isolated placental stem cells are CD200.sup.+ and HLA-G.sup.+. In another specific embodiment, the isolated placental stem cells are additionally CD73.sup.+ and CD105.sup.+. In another specific embodiment, the isolated placental stem cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, the isolated placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said placental stem cells are CD34.sup.+, CD38.sup.+, CD45.sup.+, CD73.sup.+ and CD105.sup.+. In another specific embodiment, said isolated CD200.sup.+ or HLA-G.sup.+ placental stem cells facilitate the formation of embryoid-like bodies in a population of placental cells comprising the isolated placental stem cells, under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, the isolated placental stem cells are isolated away from placental cells that are not said placental stem cells. In another specific embodiment, said isolated placental stem cells are isolated away from placental cells that do not display this combination of markers.
[0221] In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., that is enriched for, CD200.sup.+. HLA-G.sup.+ placental stem cells. In a specific embodiment, said population is a population of placental cells. In various embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or at least about 60% of cells in said cell population are isolated CD200.sup.+. HLA-G.sup.+ placental stem cells. Preferably, at least about 70% of cells in said cell population are isolated CD200.sup.+. HLA-G.sup.+ placental stem cells. More preferably, at least about 90%, 95%, or 99% of said cells are isolated CD200.sup.+. HLA-G.sup.+ placental stem cells. In a specific embodiment of the cell populations, said isolated CD200.sup.+. HLA-G.sup.+ placental stem cells are also CD73.sup.+ and CD105.sup.+. In another specific embodiment, said isolated CD200.sup.+. HLA-G.sup.+ placental stem cells are also CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said isolated CD200.sup.+. HLA-G.sup.+ placental stem cells are also CD34.sup.+, CD38.sup.+, CD45.sup.+, CD73.sup.+ and CD105.sup.+. In another embodiment, said cell population produces one or more embryoid-like bodies when cultured under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, said cell population is isolated away from placental cells that are not placental stem cells. In another specific embodiment, said isolated CD200.sup.+. HLA-G.sup.+ placental stem cells are isolated away from placental cells that do not display these markers.
[0222] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are CD73.sup.+, CD105.sup.+, and CD200.sup.+. In another specific embodiment, the isolated placental stem cells are HLA-G.sup.+. In another specific embodiment, the isolated placental stem cells are CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, the isolated placental stem cells are CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, the isolated placental stem cells are CD34.sup.+, CD38.sup.+, CD45.sup.+, and HLA-G.sup.+. In another specific embodiment, the isolated CD73.sup.+, CD105.sup.+, and CD200.sup.+ placental stem cells facilitate the formation of one or more embryoid-like bodies in a population of placental cells comprising the isolated placental stem cells, when the population is cultured under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, the isolated placental stem cells are isolated away from placental cells that are not the isolated placental stem cells. In another specific embodiment, the isolated placental stem cells are isolated away from placental cells that do not display these markers.
[0223] In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., that is enriched for, isolated CD73.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells. In various embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or at least about 60% of cells in said cell population are isolated CD73.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells. In another embodiment, at least about 70% of said cells in said population of cells are isolated CD73.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells. In another embodiment, at least about 90%, 95% or 99% of cells in said population of cells are isolated CD73.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells. In a specific embodiment of said populations, the isolated placental stem cells are HLA-G.sup.+. In another specific embodiment, the isolated placental stem cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, the isolated placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, the isolated placental stem cells are additionally CD34.sup.+, CD38.sup.+, CD45.sup.+, and HLA-G.sup.+. In another specific embodiment, said population of cells produces one or more embryoid-like bodies when cultured under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, said population of placental stem cells is isolated away from placental cells that are not placental stem cells. In another specific embodiment, said population of placental stem cells is isolated away from placental cells that do not display these characteristics.
[0224] In certain other embodiments, the isolated placental stem cells are one or more of CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH2.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+, SSEA4.sup.+, OCT-4.sup.+, HLA-G.sup.+ or ABC-p.sup.+. In a specific embodiment, the isolated placental stem cells are CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH2.sup.+, SH3.sup.+, SH4.sup.+, SSEA3+. SSEA4.sup.+, and OCT-4.sup.+. In another specific embodiment, the isolated placental stem cells are CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD45.sup.+, CD54.sup.+, SH2.sup.+, SH3.sup.+, and SH4.sup.+. In another specific embodiment, the isolated placental stem cells CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD45.sup.+, CD54.sup.+, SH2.sup.+, SH3.sup.+, SH4.sup.+ and OCT-4.sup.+. In another specific embodiment, the isolated placental stem cells are CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, HLA-G.sup.+, SH2.sup.+, SH3.sup.+, SH4.sup.+. In another specific embodiment, the isolated placental stem cells are OCT-4.sup.+ and ABC-p.sup.+. In another specific embodiment, the isolated placental stem cells are SH2.sup.+, SH3.sup.+, SH4.sup.+ and OCT-4.sup.+. In another embodiment, the isolated placental stem cells are OCT-4.sup.+, CD34.sup.+, SSEA3.sup.+, and SSEA4.sup.+. In a specific embodiment, said isolated OCT-4.sup.+, CD34.sup.+, SSEA3.sup.+, and SSEA4.sup.+ placental stem cells are additionally CD10.sup.+, CD29.sup.+, CD34.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, SH2.sup.+, SH3.sup.+, and SH4.sup.+. In another embodiment, the isolated placental stem cells are OCT-4.sup.+ and CD34.sup.+, and either SH3.sup.+ or SH4.sup.+. In another embodiment, the isolated placental stem cells are CD34.sup.+ and either CD10.sup.+, CD29.sup.+, CD44.sup.+, CD54.sup.+, CD90.sup.+, or OCT-4.sup.+.
[0225] In another embodiment, isolated placental stem cells are CD200.sup.+ and OCT-4.sup.+. In a specific embodiment, the isolated placental stem cells are CD73.sup.+ and CD105.sup.+. In another specific embodiment, said isolated placental stem cells are HLA-G.sup.+. In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stem cells are CD34.sup.+, CD38.sup.+ or CD45.sup.+.
[0226] In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stem cells are CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stem cells are CD34.sup.+, CD38.sup.+, CD45.sup.+, CD73.sup.+, CD105.sup.+ and HLA-G.sup.+. In another specific embodiment, the isolated CD200.sup.+, OCT-4.sup.+ placental stem cells facilitate the production of one or more embryoid-like bodies by a population of placental cells that comprises the placental stein cells, when the population is cultured under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stein cells are isolated away from placental cells that are not said placental stem cells. In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stem cells are isolated away from placental cells that do not display these characteristics.
[0227] In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., that is enriched for, CD200.sup.+, OCT-4.sup.+ placental stem cells. In various embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or at least about 60% of cells in said cell population are isolated (CD200.sup.+). OCT-4.sup.+ placental stem cells. In another embodiment, at least about 70% of said cells are said isolated CD200.sup.+, OCT-4.sup.+ placental stem cells. In another embodiment, at least about 80%, 90%, 95%, or 99% of cells in said cell population are said isolated CD200.sup.+, OCT-4.sup.+ placental stein cells. In a specific embodiment of the isolated populations, said isolated CD200.sup.+. OCT-4.sup.+ placental stem cells are additionally CD73.sup.+ and CD105.sup.+. In another specific embodiment, said isolated CD200.sup.+. OCT-4.sup.+ placental stem cells are additionally HLA-G.sup.+. In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated CD200.sup.+, OCT-4.sup.+ placental stein cells are additionally CD34.sup.+, CD38.sup.+, CD45.sup.+, CD73.sup.+. CD105.sup.+ and HLA-G.sup.+. In another specific embodiment, the cell population produces one or more embryoid-like bodies when cultured under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, said cell population is isolated away from placental cells that are not isolated CD200.sup.+, OCT-4.sup.+ placental cells. In another specific embodiment, said cell population is isolated away from placental cells that do not display these markers.
[0228] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are CD73.sup.+, CD105.sup.+ and HLA-G.sup.+. In another specific embodiment, the isolated CD73.sup.+. CD105.sup.+ and HLA-G.sup.+ placental stein cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, the isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, the isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally OCT-4.sup.+. In another specific embodiment, the isolated CD73.sup.+, CD105.sup.+. HLA-G.sup.+ placental stem cells are additionally CD200.sup.+. In another specific embodiment, the isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+, CD45.sup.+, OCT-4 and CD200.sup.+. In another specific embodiment, the isolated CD73.sup.+, CD105.sup.+. HLA-G.sup.+ placental stem cells facilitate the formation of embryoid-like bodies in a population of placental cells comprising said placental stem cells, when the population is cultured under conditions that allow the formation of embryoid-like bodies. In another specific embodiment, said the isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are isolated away from placental cells that are not the isolated CD73.sup.+, CD105.sup.+. HLA-G.sup.+ placental stem cells. In another specific embodiment, said the isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are isolated away from placental cells that do not display these markers.
[0229] In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., that is enriched for, isolated CD73.sup.+, CD105.sup.+ and HLA-G.sup.+ placental stem cells. In various embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or at least about 60% of cells in said population of cells are isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells. In another embodiment, at least about 70% of cells in said population of cells are isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells. In another embodiment, at least about 90%, 95% or 99% of cells in said population of cells are isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stein cells. In a specific embodiment of the above populations, said isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+, HLA-G placental stem cells are additionally OCT-4.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally CD200.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+, CD45.sup.+, OCT-4.sup.+ and CD200.sup.+. In another specific embodiment, said cell population is isolated away from placental cells that are not CD73.sup.+, CD105.sup.+, HLA-G.sup.+ placental stem cells. In another specific embodiment, said cell population is isolated away from placental cells that do not display these markers.
[0230] In another embodiment, the isolated placental stem cells are CD73.sup.+ and CD105.sup.+ and facilitate the formation of one or more embryoid-like bodies in a population of isolated placental cells comprising said CD73.sup.+, CD105.sup.+ cells when said population is cultured under conditions that allow formation of embryoid-like bodies. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stein cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally OCT-4.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally OCT-4.sup.+, CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are isolated away from placental cells that are not said cells. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are isolated away from placental cells that do not display these characteristics.
[0231] In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., that is enriched for, isolated placental stem cells that are CD73.sup.+, CD105.sup.+ and facilitate the formation of one or more embryoid-like bodies in a population of isolated placental cells comprising said cells when said population is cultured under conditions that allow formation of embryoid-like bodies. In various embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or at least about 60%, of cells in said population of cells are said isolated CD73.sup.+, CD105.sup.+ placental stem cells. In another embodiment, at least about 70% of cells in said population of cells are said isolated CD73.sup.+, CD105.sup.+ placental stem cells. In another embodiment, at least about 90%, 95% or 99% of cells in said population of cells are said isolated CD73.sup.+, CD105.sup.+ placental stem cells. In a specific embodiment of the above populations, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally OCT-4.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally CD200.sup.+. In another specific embodiment, said isolated CD73.sup.+, CD105.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+, CD45.sup.+, OCT-4.sup.+ and CD200.sup.+. In another specific embodiment, said cell population is isolated away from placental cells that are not said isolated CD73.sup.+, CD105.sup.+ placental stem cells. In another specific embodiment, said cell population is isolated away from placental cells that do not display these markers.
[0232] In another embodiment, the isolated placental stein cells are OCT-4.sup.+ and facilitate formation of one or more embryoid-like bodies in a population of isolated placental cells comprising said placental stem cells when said population of cells is cultured under conditions that allow formation of embryoid-like bodies. In a specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD73.sup.+ and CD105.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+, or CD45.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD200.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD73.sup.+, CD105.sup.+, CD200.sup.+, CD34.sup.+, CD38.sup.+, and CD45.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are isolated away from placental cells that are not OCT-4.sup.+ placental cells. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are isolated away from placental cells that do not display these characteristics.
[0233] In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., that is enriched for, isolated placental stem cells that are OCT-4.sup.+ and facilitate the formation of one or more embryoid-like bodies in a population of isolated placental cells comprising said cells when said population is cultured under conditions that allow formation of embryoid-like bodies. In various embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or at least about 60% of cells in said population of cells are said isolated OCT-4.sup.+ placental stem cells.
[0234] In another embodiment, at least about 70% of cells in said population of cells are said isolated OCT-4.sup.+ placental stem cells. In another embodiment, at least about 80%, 90%, 95% or 99% of cells in said population of cells are said isolated OCT-4.sup.+ placental stem cells. In a specific embodiment of the above populations, said isolated OCT-4.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD73.sup.+ and CD105.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD200.sup.+. In another specific embodiment, said isolated OCT-4.sup.+ placental stem cells are additionally CD73.sup.+, CD105.sup.+, CD200.sup.+, CD34.sup.+, CD38.sup.+, and CD45.sup.+. In another specific embodiment, said cell population is isolated away from placental cells that are not said placental stem cells. In another specific embodiment, said cell population is isolated away from placental cells that do not display these markers.
[0235] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are isolated HLA-A,B,C.sup.+, CD45.sup.+, CD133.sup.+ and CD34.sup.+ placental stem cells. In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising isolated placental stem cells, wherein at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 99% of cells in said population of cells are isolated HLA-A,B,C.sup.+, CD45.sup.+, CD133.sup.+ and CD34.sup.+ placental stem cells. In a specific embodiment, said isolated placental cell or population of isolated placental cells is isolated away from placental cells that are not HLA-A,B,C.sup.+, CD45.sup.+, CD133.sup.+ and CD34.sup.+ placental stem cells. In another specific embodiment, said isolated placental stem cells are non-maternal in origin. In another specific embodiment, said population of isolated placental stem cells are substantially free of maternal components, e.g., at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 90%, 85%, 90%, 95%, 98% or 99% of said cells in said population of isolated placental stein cells are non-maternal in origin.
[0236] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are isolated CD10.sup.+, CD13.sup.+, CD33.sup.+, CD45.sup.+, CD117.sup.+ and CD133.sup.+ placental stem cells. In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising isolated placental stem cells, wherein at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 99% of cells in said population of cells are isolated CD10.sup.+, CD13.sup.+, CD33.sup.+, CD45.sup.+, CD117.sup.+ and CD133.sup.+ placental stein cells. In a specific embodiment, said isolated placental stem cells or population of isolated placental stem cells is isolated away from placental cells that are not said isolated placental stem cells. In another specific embodiment, said isolated CD10.sup.+, CD13.sup.+, CD33.sup.+, CD45.sup.+, CD117.sup.+ and CD133.sup.+ placental stem cells are non-maternal in origin, i.e., have the fetal genotype. In another specific embodiment, at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 90%, 85%, 90%, 95%, 98% or 99% of said cells in said population of isolated placental stem cells, are non-maternal in origin. In another specific embodiment, said isolated placental stem cells or population of isolated placental stem cells are isolated away from placental cells that do not display these characteristics.
[0237] In another embodiment, the isolated placental stein cells are isolated CD10.sup.+, CD33.sup.+, CD44.sup.+, CD45.sup.+, and CD117.sup.+ placental cells. In another embodiment, a cell population useful for the in the methods and compositions described herein is a population of cells comprising. e.g., enriched for, isolated placental cells, wherein at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 99% of cells in said population of cells are isolated CD10.sup.+, CD33.sup.+, CD44.sup.+, CD45.sup.+, and CD117.sup.+ placental cells. In a specific embodiment, said isolated placental cell or population of isolated placental cells is isolated away from placental cells that are not said cells. In another specific embodiment, said isolated placental cells are non-maternal in origin. In another specific embodiment, at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 90%, 85%, 90%, 95%, 98% or 99% of said placental stem cells in said cell population are non-maternal in origin. In another specific embodiment, said isolated placental stem cells or population of isolated placental stem cells is isolated away from placental cells that do not display these markers.
[0238] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are isolated CD10.sup.+, CD13.sup.+, CD33.sup.+, CD45.sup.+, and CD117.sup.+ placental stem cells. In another embodiment, a cell population useful in the methods and compositions described herein is a population of cells comprising, e.g., enriched for, isolated CD10.sup.+, CD13.sup.+, CD33.sup.+, CD45.sup.+, and CD117.sup.+ placental stem cells, wherein at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 99% of cells in said population are CD10.sup.+, CD13.sup.+, CD33.sup.+, CD45.sup.+, and CD117.sup.+ placental stem cells. In a specific embodiment, said isolated placental stem cells or population of isolated placental stem cells are isolated away from placental cells that are not said placental stem cells. In another specific embodiment, said isolated placental cells are non-maternal in origin. In another specific embodiment, at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 90%, 85%, 90%, 95%, 98% or 99% of said cells in said cell population are non-maternal in origin. In another specific embodiment, said isolated placental stem cells or population of isolated placental stem cells is isolated away from placental cells that do not display these characteristics.
[0239] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are HLA A,B,C.sup.+, CD45.sup.+, CD34.sup.+, and CD133.sup.+, and an: additionally CD10.sup.+, CD13.sup.+, CD38.sup.+, CD44.sup.+, CD90.sup.+, CD105.sup.+, CD200.sup.+ and/or HLA-G.sup.+, and/or negative for CD117.sup.+. In another embodiment, a cell population useful in the methods described herein is a population of cells comprising isolated placental stem cells, wherein at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about 99% of the cells in said population are isolated placental stem cells that are HLA A,B,C.sup.+, CD45.sup.+, CD34.sup.+, CD133.sup.+, and that are additionally positive for CD10, CD13, CD38, CD44, CD90, CD90, CD105, CD200, and/or negative for CD117 and/or HLA-G. In a specific embodiment, said isolated placental stem cells or population of isolated placental stemin cells are isolated away from placental cells that are not said placental stem cells. In another specific embodiment, said isolated placental stem cells are non-maternal in origin. In another specific embodiment, at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 90%, 85%, 90%, 95%, 98% or 99% of said placental stem cells in said cell population are non-maternal in origin. In another specific embodiment, said isolated placental stem cells or population of isolated placental stem cells are isolated away from placental cells that do not display these characteristics.
[0240] In another embodiment, the isolated placental stem cells are isolated placental stem cells that are CD200.sup.+ and CD10.sup.+, as determined by antibody binding, and CD117.sup.+, as determined by both antibody binding and RT-PCR. In another embodiment, the isolated placental stem cells are isolated placental stem cells that are CD10.sup.+, CD29.sup.+, CD54.sup.+, CD200.sup.+, HLA-G.sup.+, MHC class 1.sup.+ and -2-microglobulin.sup.+. In another embodiment, isolated placental stem cells useful in the methods and compositions described herein are placental stem cells wherein the expression of at least one cellular marker is at least two-fold higher than in an equivalent number of mesenchymal stem cells, e.g., bone marrow-derived mesenchymal stem cells. In another specific embodiment, said isolated placental stem cells are non-maternal in origin. In another specific embodiment, at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 90%, 85%, 90%, 95%, 98% or 99% of said cells in said cell population are non-maternal in origin.
[0241] In another embodiment, the isolated placental stem cells are isolated placental stem cells that are one or more of CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54/ICAM.sup.+, CD62E.sup.+, CD62L.sup.+, CD62P.sup.+, CD80.sup.+, CD86.sup.+, CD103.sup.+, CD104.sup.+, CD105, CD106/VCAM.sup.+, CD144/VE-cadherin.sup.low, CD184/CXCR4, 2-microglobulin.sup.low, MHC-1.sup.low, MHC-II.sup.+, HLA-G.sup.low, and/or PDL1.sup.low. In a specific embodiment, the isolated placental stem cells are at least CD29.sup.+ and CD54.sup.+. In another specific embodiment, the isolated placental stem cells are at least CD4.sup.+ and CD106.sup.+. In another specific embodiment, the isolated placental stem cells are at least CD29.sup.+.
[0242] In another embodiment, a cell population useful in the methods and compositions described herein comprises isolated placental stem cells, and at least 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% of the cells in said cell population are isolated placental stein cells that are one or more of CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54/ICAM.sup.+, CD62-E.sup.+, CD62-L.sup.+, CD62-P.sup.+, CD80.sup.+, CD86.sup.+, CD103.sup.+, CD104.sup.+, CD105.sup.+, CD106/VCAM.sup.+, CD144/VE-cadherin.sup.dim, CD184/CXCR4, 2-microglobulin.sup.dim, HLA-I.sup.dim, HLA-II.sup.+, HLA-G.sup.dim, and/or PDL1.sup.dim placental stem cells. In another specific embodiment, at least 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% of cells in said cell population are CD10.sup.+, CD29.sup.+, CD44.sup.+, CD45.sup.+, CD54/ICAM.sup.+, CD62-E.sup.+, CD62-L.sup.+, CD62-P.sup.+, CD80.sup.+, CD86.sup.+, CD103.sup.+, CD104.sup.+, CD105.sup.+, CD106/VCAM.sup.+, CD144/VE-cadherin.sup.dim, CD184/CXCR4.sup.+, 2-microglobulin.sup.dim, MHC-I.sup.dim, MHC-II.sup.+, HLA-G.sup.dim, and PDLI.sup.dim placental stem cells. In certain embodiments, the placental stem cells express HLA-II markers when induced by interferon gamma (IFN-).
[0243] In another embodiment, the isolated placental stem cells useful in the methods and compositions described herein are isolated placental stem cells that are one or more, or all, of CD10.sup.+, CD29.sup.+, CD34.sup.+, CD38.sup.+, CD44.sup.+, CD45.sup.+, CD54.sup.+, CD90.sup.+, SH2.sup.+, SH3.sup.+, SH4.sup.+, SSEA3.sup.+, SSEA4.sup.+, OCT-4.sup.+, and ABC-p.sup.+, where ABC-p is a placenta-specific ABC transporter protein (also known as breast cancer resistance protein (BCRP) or as mitoxantrone resistance protein (MXR)), wherein said isolated placental stem cells are obtained by perfusion of a mammalian, e.g., human, placenta that has been drained of cord blood and perfused to remove residual blood.
[0244] In another specific embodiment of any of the above embodiments, expression of the recited cellular marker(s) (e.g., cluster of differentiation or immunogenic marker(s)) is determined by flow cytometry. In another specific embodiment, expression of the marker(s) is determined by RT-PCR.
[0245] Gene profiling confirms that isolated placental stem cells, and populations of isolated placental stem cells, are distinguishable from other cells, e.g., mesenchymal stein cells, e.g., bone marrow-derived mesenchymal stein cells. The isolated placental stem cells described herein can be distinguished from, e.g., bone marrow-derived mesenchymal stem cells on the basis of the expression of one or more genes, the expression of which is significantly higher in the isolated placental stem cells in comparison to bone marrow-derived mesenchymal stem cells. In particular, the isolated placental stem cells, useful in the methods of treatment provided herein, can be distinguished from bone marrow-derived mesenchymal stem cells on the basis of the expression of one or more genes, the expression of which is significantly higher (that is, at least twofold higher) in the isolated placental stem cells than in an equivalent number of bone marrow-derived mesenchymal stem cells, wherein the one or more gene comprise ACTG2, ADARB1, AMIGO2, ARTS-1, B4GALT6, BCHE, C1 lorf9, CD200. COL4A1, COL4A2, CPA4, DMD, DSC3, DSG2, ELOVL2, F2RL1, FLJ10781, GATA6, GPR126, GPRC5B, ICAM1, IER3, IGFBP7, IL1A, IL6, IL18, KRT18, KRT8, LIPG, LRAP, MATN2, MEST. NFE2L3, NUAK1, PCDH7, PDLIM3, PKP2, RTN1, SERPINB9, ST3GAL6, ST6GALNAC5, SLC12A8, TCF21, TGFB2, VTN, ZC3H12A, or a combination of any of the foregoing, when the cells are grown under equivalent conditions. See, e.g., U.S. Patent Application Publication No. 2007/0275362, the disclosure of which is incorporated herein by reference in its entirety. In certain specific embodiments, said expression of said one or more genes is determined, e.g., by RT-PCR or microarray analysis. e.g. using a U133-A microarravy Affymetrix).
[0246] In another specific embodiment, said isolated placental stem cells express said one or more genes when cultured for a number of population doublings, e.g., anywhere from about 3 to about 35 population doublings, in a medium comprising DMEM-LG (e.g., from Gibco); 2% fetal calf serum (e.g., from Hyclone Labs.): 1 insulin-transferrin-selenium (ITS): 1 linoleic acid-bovine serum albumin (LA-BSA); 10.sup.9 M dexamethasone (e.g., from Sigma); 10.sup.4 M ascorbic acid 2-phosphate (e.g., from Sigma); epidermal growth factor 10 ng/mL (e.g., from R&D Systems); and platelet-derived growth factor (PDGF-BB) 10 ng/mL (e.g., from R&D Systems). In another specific embodiment, the isolated placental cell-specific gene is CD200.
[0247] Specific sequences for these genes can be found in GenBank at accession nos. NM_001615 (ACTG2), BC065545 (ADARB1), (NM_181847 (AMIGO2), AY358590 (ARTS-1), BC074884 (B4GALT6), BC008396 (BCHE), BC020196 (C1 lorf9), BC031103 (CD200), NM_001845 (COL4A1), NM_001846 (COL4A2). BC052289 (CPA4), BC094758 (DMD), AF293359 (DSC3), NM_001943 (DSG2), AF338241 (ELOVL2), AY336105 (F2RL1). NM_018215 (FLJ10781), AY416799 (GATA6), BC075798 (GPR126), NM_016235 (GPRC5B), AF340038 (ICAM1), BC000844 (IER3), BC066339 (IGFBP7), BC013142 (IL1A). BT019749 (IL6), BC007461 (IL18), (BC072017) KRT18, BC075839 (KRT8), BC060825 (LIPG). BC065240 (LRAP). BC010444 (MATN2). BC011908 (MEST), BC068455 (NFE2L3). NM_014840 (NUAK1), AB006755 (PCDH7). NM_014476 (PDLIM3), BC126199 (PKP-2). BC090862 (RTN1), BC002538 (SERPINB9), BC023312 (ST3GAL6). BC001201 (ST6GALNAC5), BC126160 or BC065328 (SLC12A8). BC025697 (TCF21), BC096235 (TGFB2). BC005046 (VTN), and BC005001 (ZC3H12A) as of March 2008.
[0248] In certain specific embodiments, said isolated placental stem cells express each of ACTG2, ADARB1, AMIGO2, ARTS-1, B4GALT6, BCHE, C1 lorf9, CD200, COL4A1, COL4A2, CPA4, DMD, DSC3, DSG2, ELOVL2, F2RL1, FLJ10781, GATA6, GPR126, GPRC5B, ICAM1, IER3, IGFBP7, IL1A, IL6, IL18, KRT18, KRT8, LIPG, LRAP, MATN2, MEST, NFE2L3, NUAK1, PCDH7, PDLIM3, PKP2, RTN1, SERPINB9, ST3GAL6, ST6GALNAC5, SLC12A8, TCF21, TGFB2, VTN, and ZC3H12A at a detectably higher level than an equivalent number of bone marrow-derived mesenchymal stem cells, when the cells are grown under equivalent conditions.
[0249] In specific embodiments, the placental stein cells express CD200 and ARTS1 (aminopeptidase regulator of type 1 tumor necrosis factor); ARTS-1 and LRAP (leukocyte-derived arginine aminopeptidase); IL6 (interleukin-6) and TGFB2 (transforming growth factor, beta 2); IL6 and KRT18 (keratin 18); IER3 (immediate early response 3), MEST (mesoderm specific transcript homolog) and TGFB2; CD200 and IER3; CD200 and IL6; CD200 and KRT18; CD200 and LRAP; CD200 and MEST; CD200 and NFE2L3 (nuclear factor (erythroid-derived 2)-like 3); or CD200 and TGFB2 at a detectably higher level than an equivalent number of bone marrow-derived mesenchymal stem cells wherein said bone marrow-derived mesenchymal stem cells have undergone a number of passages in culture equivalent to the number of passages said isolated placental stem cells have undergone. In other specific embodiments, the placental stem cells express ARTS-1, CD200, IL6 and LRAP; ARTS-1, IL6, TGFB2, IER3, KRT18 and MEST; CD200, IER3, IL6, KRT18, LRAP, MEST, NFE2L3, and TGFB2; ARTS-1, CD200, IER3, IL6, KRT18, LRAP, MEST, NFE2L3, and TGFB2; or IER3. MEST and TGFB2 at a detectably higher level than an equivalent number of bone marrow-derived mesenchymal stem cells, wherein said bone marrow-derived mesenchymal stem cells have undergone a number of passages in culture equivalent to the number of passages said isolated placental stem cells have undergone.
[0250] Expression of the above-referenced genes can be assessed by standard techniques. For example, probes based on the sequence of the gene(s) can be individually selected and constructed by conventional techniques. Expression of the genes can be assessed, e.g., on a microarray comprising probes to one or more of the genes, e.g., an Affymetrix GENECHIP Human Genome U133A 2.0 array, or an Affymetrix GENECHIP Human Genome U133 Plus 2.0 (Santa Clara, Calif.). Expression of these genes can be assessed even if the sequence for a particular GenBank accession number is amended because probes specific for the amended sequence can readily be generated using well-known standard techniques.
[0251] The level of expression of these genes can be used to confirm the identity of a population of isolated placental stem cells, to identify a population of cells as comprising at least a plurality of isolated placental stem cells, or the like. Populations of isolated placental stem cells, the identity of which is confirmed, can be clonal, e.g., populations of isolated placental stem cells expanded from a single isolated placental stem cells, or a mixed population of placental stem cells, e.g., a population of cells comprising isolated placental stem cells that are expanded from multiple isolated placental stem cells, or a population of cells comprising isolated placental stem cells, as described herein, and at least one other type of cell.
[0252] The level of expression of these genes can be used to select populations of isolated placental stem cells. For example, a population of cells, e.g., clonally-expanded placental stem cells, may be selected if the expression of one or more of the genes listed above is significantly higher in a sample from the population of cells than in an equivalent population of bone marrow-derived mesenchymal stem cells. Such selecting can be of a population from a plurality of isolated placental stein cells populations, from a plurality of cell populations, the identity of which is not known, etc.
[0253] Isolated placental stem cells can be selected on the basis of the level of expression of one or more such genes as compared to the level of expression in said one or more genes in, e.g., a hone marrow-derived mesenchymal stem cell control. In one embodiment, the level of expression of said one or more genes in a sample comprising an equivalent number of bone marrow-derived mesenchymal stem cells is used as a control. In another embodiment, the control, for isolated placental stem cells tested under certain conditions, is a numeric value representing the level of expression of said one or more genes in bone marrow-derived mesenchymal stein cells under said conditions.
[0254] The isolated placental stem cells described herein display the above characteristics (e.g., combinations of cell surface markers and/or gene expression profiles) in primary culture, or during proliferation in medium comprising, e.g., DMEM-LG (Gibco), 2% fetal calf serum (FCS) (Hyclone Laboratories), 1 insulin-transferrin-selenium (ITS), 1 linoleic-acid-bovine-serum-albumin (LA-BSA), 10.sup.9 M dexamethasone (Sigma), 10.sup.4 M ascorbic acid 2-phosphate (Sigma), epidermal growth factor (EGF) 10 ng/ml (R&D Systems), platelet derived-growth factor (PDGF-BB) 10 ng/ml (R&D Systems), and 100 U penicillin/1000 U streptomycin.
[0255] In certain embodiments of any of the placental stem cells disclosed herein, the cells are human. In certain embodiments of any of the placental cells disclosed herein, the cellular marker characteristics or gene expression characteristics are human markers or human genes.
[0256] In another specific embodiment of the isolated placental stem cells or populations of cells comprising the isolated placental stem cells, said cells or population have been expanded, for example, passaged at least, about, or no more than, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times, or proliferated for at least, about, or no more than, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 or 40 population doublings. In another specific embodiment of said isolated placental stem cells or populations of cells comprising the isolated placental stein cells, said cells or population are primary isolates. In another specific embodiment of the isolated placental stem cells, or populations of cells comprising isolated placental stem cells, that are disclosed herein, said isolated placental stem cells are fetal in origin that is, have the fetal genotype).
[0257] In certain embodiments, said isolated placental stem cells do not differentiate during culturing in growth medium, i.e., medium formulated to promote proliferation, e.g., during proliferation in growth medium. In another specific embodiment, said isolated placental stem cells do not require a feeder layer in order to proliferate. In another specific embodiment, said isolated placental stem cells do not differentiate in culture in the absence of a feeder layer, solely because of the lack of a feeder cell layer.
[0258] In another embodiment, the isolated placental cells are positive for aldehyde dehydrogenase (ALDH), as assessed by an aldehyde dehydrogenase activity assay. Such assays are known in the art (see, e.g., Bostian and Betts, Biochem. J., 173, 787, (1978)). In a specific embodiment, said ALDH assay uses ALDEFLUOR (Aldagen, Inc., Ashland, Oreg.) as a marker of aldehyde dehydrogenase activity. In a specific embodiment, between about 3% and about 25% of placental stem cells are positive for ALDH. In another embodiment, said isolated placental stem cells show at least three-fold, or at least five-fold, higher ALDH activity than a population of bone marrow-derived mesenchymal stem cells having about the same number of cells and cultured under the same conditions.
[0259] In certain embodiments of any of the populations of cells comprising the isolated placental stein cells described herein, the placental stem cells in said populations of cells are substantially free of cells having a maternal genotype: e.g., at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% of the placental stem cells in said population have a fetal genotype. In certain other embodiments of any of the populations of cells comprising the isolated placental stem cells described herein, the populations of cells comprising said placental stem cells are substantially free of cells having a maternal genotype; e.g., at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% of the cells in said population have a fetal genotype.
[0260] In a specific embodiment of any of the above isolated placental stem cells or cell populations comprising isolated placental stem cells, the karyotype of the cells, e.g., all of the cells, or at least about 95% or about 99% of the cells in said population, is normal. In another specific embodiment of any of the above placental stem cells or populations or placental stem cells, the placental stem cells are non-maternal in origin.
[0261] In a specific embodiment of any of the embodiments of placental cells disclosed herein, the placental cells are genetically stable, displaying a normal diploid chromosome count and a normal karyotype.
[0262] Isolated placental stem cells, or populations of isolated placental stem cells, bearing any of the above combinations of markers, can be combined in any ratio. Any two or more of the above isolated placental stem cells populations can be combined to form an isolated placental stem cell population. For example, a population of isolated placental stem cells can comprise a first population of isolated placental stein cells defined by one of the marker combinations described above, and a second population of isolated placental stem cells defined by another of the marker combinations described above, wherein said first and second populations are combined in a ratio of about 1:99, 2:98, 3:97, 4:96, 5:95, 10:90, 20:80, 30:70, 40:60, 50:50, 60:40, 70:30, 80:20, 90:10, 95:5, 96:4, 97:3, 98:2, or about 99:1. In like fashion, any three, four, five or more of the above-described isolated placental stem cells or isolated placental stem cell populations can be combined.
[0263] Isolated placental stem cells useful in the methods and compositions described herein can be obtained, e.g., by disruption of placental tissue, with or without enzymatic digestion or perfusion. For example, populations of isolated placental stem cells can be produced according to a method comprising perfusing a mammalian placenta that has been drained of cord blood and perfused to remove residual blood; perfusing said placenta with a perfusion solution; and collecting said perfusion solution, wherein said perfusion solution after perfusion comprises a population of placental cells that comprises isolated placental stem cells; and isolating said placental stem cells from said population of cells. In a specific embodiment, the perfusion solution is passed through both the umbilical vein and umbilical arteries and collected after it exudes from the placenta. In another specific embodiment, the perfusion solution is passed through the umbilical vein and collected from the umbilical arteries, or passed through the umbilical arteries and collected from the umbilical vein.
[0264] In various embodiments, the isolated placental stem cells, contained within a population of cells obtained from perfusion of a placenta, are at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or at least 99.5% of said population of placental stem cells. In another specific embodiment, the isolated placental stem cells collected by perfusion comprise fetal and maternal cells. In another specific embodiment, the isolated placental stem cells collected by perfusion are at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or at least 99.5% fetal cells.
[0265] In another specific embodiment, provided herein is a composition comprising a population of the isolated placental stem cells, as described herein, collected (isolated) by perfusion, wherein said composition comprises at least a portion of the perfusion solution used to isolate the placental stem cells.
[0266] Populations of the isolated placental stem cells described herein can be produced by digesting placental tissue with a tissue-disrupting enzyme to obtain a population of placental cells comprising the placental stem cells, and isolating, or substantially isolating, a plurality of the placental stem cells from the remainder of said placental cells. The whole, or any part of, the placenta can be digested to obtain the isolated placental stem cells described herein. In specific embodiments, for example, said placental tissue can be a whole placenta (e.g., including an umbilical cord), an amniotic membrane, chorion, a combination of amnion and chorion, or a combination of any of the foregoing. In other specific embodiments, the tissue-disrupting enzyme is trypsin or collagenase. In various embodiments, the isolated placental stem cells, contained within a population of cells obtained from digesting a placenta, are at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or at least 99.5% of said population of placental cells.
[0267] The populations of isolated placental stem cells described above, and populations of isolated placental stem cells generally, can comprise about, at least, or no more than, 110.sup.5, 510.sup.5, 110.sup.6, 510.sup.6, 110.sup.7, 510.sup.7, 110.sup.8, 510.sup.8, 110.sup.9, 510.sup.9, 110.sup.10, 510.sup.10, 110.sup.11 or more of the isolated placental stem cells. Populations of isolated placental stem cells useful in the methods of treatment described herein comprise at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 90%, 95%, 98%, or 99% viable isolated placental stem cells, e.g., as determined by, e.g., trypan blue exclusion.
[0268] For any of the above placental stem cells, or populations of placental stem cells, the cells or population of placental stem cells are, or can comprise, cells that have been passaged at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, or 20 times, or more, or expanded for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 28, 30, 32, 34, 36, 38 or 40 population doublings, or more.
[0269] In a specific embodiment of any of the above placental stem cells or placental stem cells populations, the karyotype of the cells, or at least about 95% or about 99% of the cells in said population, is normal. In another specific embodiment of any of the above placental stem cells or placental stem cells populations, the cells, or cells in the population of cells, are non-maternal in origin.
[0270] Isolated placental stem cells, or populations of isolated placental stem cells, bearing any of the above combinations of markers, can be combined in any ratio. Any two or more of the above placental stem cells populations can be isolated, or enriched, to form a placental stem cells population. For example, an population of isolated placental stem cells comprising a first population of placental stem cells defined by one of the marker combinations described above can be combined with a second population of placental stem cells defined by another of the marker combinations described above, wherein said first and second populations are combined in a ratio of about 1:99, 2:98, 3:97, 4:96, 5:95, 10:90, 20:80, 30:70, 40:60, 50:50, 60:40, 70:30, 80:20, 90:10, 95:5, 96:4, 97:3, 98:2, or about 99:1. In like fashion, any three, tour, five or more of the above-described placental stem cells or placental stem cells populations can be combined.
[0271] In a specific embodiment of the above-mentioned placental stem cells, the placental stem cells constitutively secrete IL-6, IL-8 and monocyte chemoattractant protein (MCP-1).
[0272] The immunosuppressive pluralities of placental cells described above can comprise about, at least, or no more than, 110.sup.5, 510.sup.5, 110.sup.6, 510.sup.6, 110.sup.7, 510.sup.7, 110.sup.8, 510.sup.8, 110.sup.9, 510.sup.9, 110.sup.10, 510.sup.10, 110.sup.11 or more placental stem cells.
[0273] In certain embodiments, the placental stem cells useful in the methods provided herein, do not express CD34, as detected by immunolocalization, after exposure to 1 to 100 ng/ml. VEGF for 4 to 21 days. In a specific embodiment, said placental stem cells are adherent to tissue culture plastic. In another specific embodiment, said placental stem cells induce endothelial cells to form sprouts or tube-like structures, e.g., when cultured in the presence of an angiogenic factor such as vascular endothelial growth factor (VEGF), epithelial growth factor (EGF), platelet derived growth factor (PDGF) or basic fibroblast growth factor (bFGF), e.g., on a substrate such as MATRIGEL.
[0274] In another aspect, the placental stem cells provided herein, or a population of cells, e.g., a population of placental stem cells, or a population of cells wherein at least about 50%, 60%, 70%, 80%, 90%, 95% or 98% of cells in said population of cells are placental stem cells, secrete one or more, or all, of VEGF, HGF, IL-8, MCP-3, FGF2, follistatin, G-CSF, EGF, ENA-78. GRO, IL-6, MCP-1, PDGF-BB, TIMP-2, uPAR, or galectin-1, e.g., into culture medium in which the cell, or cells, are grown. In another embodiment, the placental stem cells express increased levels of CD202b, IL-8 and/or VEGF under hypoxic conditions (e.g., less than about 5% O.sub.2) compared to normoxic conditions (e.g., about 20% or about 21% O.sub.2).
[0275] In another embodiment, any of the placental stem cells or populations of cells comprising placental stem cells described herein can cause the formation of sprouts or tube-like structures in a population of endothelial cells in contact with said placental stem cells. In a specific embodiment, the placental stem cells are co-cultured with human endothelial cells, which form sprouts or tube-like structures, or support the formation of endothelial cell sprouts, e.g., when cultured in the presence of extracellular matrix proteins such as collagen type I and IV, and/or angiogenic factors such as vascular endothelial growth factor (VEGF), epithelial growth factor (EGF), platelet derived growth factor (PDGF) or basic fibroblast growth factor (bFGF). e.g., in or on a substrate such as placental collagen or MATRIGEL for at least 4 days. In another embodiment, any of the populations of cells comprising placental stem cells, described herein, secrete angiogenic factors such as vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet derived growth factor (PDGF), basic fibroblast growth factor (bFGF), or Interleukin-8 (IL-8) and thereby can induce human endothelial cells to form sprouts or tube-like structures when cultured in the presence of extracellular matrix proteins such as collagen type I and IV e.g., in or on a substrate such as placental collagen or MATRIGEL.
[0276] In another embodiment, any of the above populations of cells comprising placental stem cells secretes angiogenic factors. In specific embodiments, the population of cells secretes vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet derived growth factor (PDGF), basic fibroblast growth factor (btGF), and/or interleukin-8 (IL-8). In other specific embodiments, the population of cells comprising placental stem cells secretes one or more angiogenic factors and thereby induces human endothelial cells to migrate in an in vitro wound healing assay. In other specific embodiments, the population of cells comprising placental stem cells induces maturation, differentiation or proliferation of human endothelial cells, endothelial progenitors, myocytes or myoblasts.
[0277] 5.3.3 Selecting and Producing Placental Cell Populations
[0278] In certain embodiments, populations of placental stem cells can be selected, wherein the population is immunosuppressive. In one embodiment, for example, immunosuppressive placental stem cells can be selected from a plurality of placental cells, comprising selecting a population of placental cells wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said cells are CD10.sup.+, CD34.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells, and wherein said placental stem cells detectably suppresses T cell proliferation in a mixed lymphocyte reaction (MLR) assay. In a specific embodiment, said selecting comprises selecting placental stem cells that are also CD45.sup.+ and CD90.sup.+.
[0279] In another embodiment, provided herein is a method of selecting a plurality of immunosuppressive placental stem cells from a plurality of placental cells, comprising selecting a population of placental stem cells wherein at least 10%, at least 20%, at least 30%, at least 409, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said cells are CD200.sup.+, HLA-G.sup.+ placental stem cells, and wherein said placental stem cells detectably suppresses T cell proliferation in a mixed lymphocyte reaction (MLR) assay. In a specific embodiment, said selecting comprises selecting placental stem cells that are also CD73.sup.+ and CD105.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+, CD45.sup.+, CD73.sup.+ and CD105.sup.+. In another specific embodiment, said selecting also comprises selecting a plurality of placental cells, e.g., the placental stem cells described above, that forms one or more embryoid-like bodies when cultured under conditions that allow the formation of embryoid-like bodies.
[0280] In another embodiment, provided herein is a method of selecting a plurality of immunosuppressive placental stem cells from a plurality of placental cells, comprising selecting a plurality of placental cells wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said cells are CD73.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells, and wherein said placental cells detectably suppresses T cell proliferation in a mixed lymphocyte reaction (MLR) assay. In a specific embodiment, said selecting comprises selecting placental stem cells that are also HLA-G.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+, CD45.sup.+, and HLA-G.sup.+. In another specific embodiment, said selecting additionally comprises selecting a population of placental stem cells that produces one or more embryoid-like bodies when the population is cultured under conditions that allow the formation of embryoid-like bodies.
[0281] In another embodiment, also provided herein is a method of selecting a plurality of immunosuppressive placental stem cells from a plurality of placental cells, comprising selecting a plurality of placental cells wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said cells are CD200.sup.+, OCT-4.sup.+ placental stem cells, and wherein said placental cells detectably suppresses T cell proliferation in a mixed lymphocyte reaction (MLR) assay. In a specific embodiment, said selecting comprises selecting placental stem cells that are also CD73.sup.+ and CD105.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also HLA-G.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+, CD15.sup.+, CD73.sup.+, CD105.sup.+ and HLA-G.sup.+.
[0282] In another embodiment, provided herein is a method of selecting a plurality of immunosuppressive placental stem cells from a plurality of placental cells, comprising selecting a plurality of placental cells wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said cells are CD73.sup.+, CD105.sup.+ and HLA-G.sup.+ placental stem cells, and wherein said placental cells detectably suppresses T cell proliferation in a mixed lymphocyte reaction (MLR) assay. In a specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD200.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+, CD45.sup.+, OCT-4.sup.+ and CD200.sup.+.
[0283] In another embodiment, also provided herein is provides a method of selecting a plurality of immunosuppressive placental stem cells from a plurality of placental cells, comprising selecting a plurality of placental cells wherein at least 10%, at least 20%, at least 30%, at least 10%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said cells are CD73.sup.+, CD105.sup.+ placental stem cells, and wherein said plurality forms one or more embryoid-like bodies under conditions that allow formation of embryoid-like bodies. In a specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ or CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+ and CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also OCT-4.sup.+. In a more specific embodiment, said selecting comprises selecting placental stem cells that are also OCT-4.sup.+, CD34.sup.+, CD38.sup.+ and CD45.sup.+.
[0284] In another embodiment, provided herein is a method of selecting a plurality of immunosuppressive placental stem cells from a plurality of placental cells, comprising selecting a plurality of placental stem cells wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50% at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of said isolated placental cells are OCT4.sup.+ placental stem cells, and wherein said plurality forms one or more embryoid-like bodies under conditions that allow formation of embryoid-like bodies. In a specific embodiment, said selecting comprises selecting placental stem cells that are also CD73.sup.+ and CD105.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD34.sup.+, CD38.sup.+, or CD45.sup.+. In another specific embodiment, said selecting comprises selecting placental stem cells that are also CD200.sup.+. In a more specific embodiment, said selecting comprises selecting placental stem cells that are also CD73.sup.+, CD105.sup.+, CD200.sup.+, CD34.sup.+, CD38.sup.+, and CD45.sup.+.
[0285] Immunosuppressive populations, or pluralities, of placental cells can be produced according to the methods provided herein. For example, provided herein is method of producing a cell population, comprising selecting any of the pluralities of placental stem cells described above, and isolating the plurality of placental cells from other cells, e.g., other placental cells. In a specific embodiment, provided herein is a method of producing a cell population comprising selecting placental stem cells, wherein said placental stem cells (a) adhere to a substrate, (b) express CD200 and do not express HLA-G; or express CD73, CD105, and CD200; or express CD200 and OCT-4; or express CD73, CD105, and do not express HLA-G; or express CD73 and CD105 and facilitate the formation of one or more embryoid-like bodies in a population of placental cells that comprise the placental stem cells, when said population is cultured under conditions that allow formation of embryoid-like bodies; or express OCT-4 and facilitate the formation of one or more embryoid-like bodies in a population of placental cells that comprise the placental stem cells, when said population is cultured under conditions that allow formation of embryoid-like bodies; and (c) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR (mixed lymphocyte reaction) or regression assay; and selecting said placental stem cells, or isolating said placental stem cells from other cells to form a cell population.
[0286] In a more specific embodiment, immunosuppressive placental stem cells populations can be produced by a method comprising selecting placental stem cells that (a) adhere to a substrate, (b) express CD200 and do not express HLA-G, and (c) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR (mixed lymphocyte reaction); and isolating said placental stem cells from other cells to form a cell population. In another specific embodiment, the method comprises selecting placental stem cells that (a) adhere to a substrate, (b) express CD73, CD105, and CD200, and (c) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR; and isolating said placental stein cells from other cells to form a cell population. In another specific embodiment, provided herein is a method of producing a cell population comprising selecting placental stem cells that (a) adhere to a substrate, (h) express CD200 and OCT-4, and (c) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR; and isolating said placental stem cells from other cells to form a cell population. In another specific embodiment, provided herein is a method of producing a cell population comprising selecting placental stem cells that (a) adhere to a substrate, th) express CD73 and CD105, (c) form embryoid-like bodies when cultured under conditions allowing the formation of embryoid-like bodies, and (d) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR; and isolating said placental stem cells from other cells to form a cell population. In another specific embodiment, the method comprises selecting placental stem cells that (a) adhere to a substrate, (b) express CD73 and CD105, and do not express HLA-G, and (c) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR; and isolating said placental stem cells from other cells to form a cell population. In another specific embodiment, the method comprises selecting placental stem cells that (a) adhere to a substrate, (b) express OCT-4, (c) form embryoid-like bodies when cultured under conditions allowing the formation of embryoid-like bodies, and (d) detectably suppress CD4.sup.+ or CD8.sup.+ T cell proliferation in an MLR; and isolating said placental cells from other cells to form a cell population.
[0287] In a specific embodiment of the methods of producing an immunosuppressive placental stem cells population, said T cells and said placental stem cells are present in said MLR at a ratio of about 5:1. The placental stem cells used in the method can be derived from the whole placenta, or primarily from amnion, or amnion and chorion. In another specific embodiment, the placental stem cells suppress CD4.sup.+ or CD8.sup.+ T cell proliferation by at least 50%, at least 75%, at least 90%, or at least 95% in said MLR compared to an amount of T cell proliferation in said MLR in the absence of said placental stem cells. The method can additionally comprise the selection and/or production of a placental stem cells population capable of immunomodulation. e.g., suppression of the activity of, other immune cells, e.g., an activity of a natural killer (NK) cell.
[0288] 5.3.4 Growth in Culture
[0289] The growth of the placental cells, e.g., the placental stem cells (PDACs) described herein, as for any mammalian cell, depends in part upon the particular medium selected for growth. Under optimum conditions, placental stem cells typically double in number in 3-5 days. During culture, the placental stem cells provided herein adhere to a substrate in culture. e.g. the surface of a tissue culture container (e.g., tissue culture dish plastic, fibronectin-coated plastic, and the like) and form a monolayer.
[0290] Populations of isolated placental cells that comprise the placental stem cells provided herein, when cultured under appropriate conditions, can form embryoid-like bodies, that is three-dimensional clusters of cells grow atop the adherent stem cell layer. Cells within the embryoid-like bodies express markers associated with very early stem cells, e.g., OCT-4. Nanog. SSEA3 and SSEA4. Cells within the embryoid-like bodies are typically not adherent to the culture substrate, as are the placental stem cells described herein, but remain attached to the adherent cells during culture. Embryoid-like body cells are dependent upon the adherent placental stem cells for viability, as embryoid-like bodies do not form in the absence of the adherent stem cells. The adherent placental cells thus facilitate the growth of one or more embryoid-like bodies in a population of placental cells that comprise the adherent placental cells. Mesenchymal stem cells, e.g., bone marrow-derived mesenchymal stem cells, do not develop embryoid-like bodies in culture.
[0291] 5.3.5 Differentiation
[0292] The placental cells, useful in the methods of treating a CNS injury, e.g., a spinal cord injury or traumatic brain injury, provided herein, in certain embodiments are differentiable into different committed cell lineages. For example, in certain embodiments, the placental cells can be differentiated into cells of an adipogenic, chondrogenic, neurogenic, or osteogenic lineage. Such differentiation can be accomplished, e.g., by any method known in the art for differentiating, e.g., bone marrow-derived mesenchymal stem cells into similar cell lineages, or by methods described elsewhere herein. Specific methods of differentiating placental cells into particular cell lineages are disclosed in, e.g., U.S. Pat. No. 7,311,905, and in U.S. Patent Application Publication No. 2007/0275362, the disclosures of which are hereby incorporated by reference in their entireties.
[0293] The placental stem cells provided herein can exhibit the capacity to differentiate into a particular cell lineage in vitro, in vivo, or in vitro and in vivo. In a specific embodiment, the placental stem cells provided herein can be differentiated in vitro when placed in conditions that cause or promote differentiation into a particular cell lineage, but do not detectably differentiate in vivo. e.g., in a NOD-SCID mouse model.
[0294] 5.4 Methods of Obtaining Placental Stem Cells
[0295] 5.4.1 Stem (Cell Collection Composition
[0296] Placental stem cells can be collected and isolated according to the methods provided herein. Generally, placental stem cells are obtained from a mammalian placenta using a physiologically-acceptable solution, e.g., a stem cell collection composition. A stein cell collection composition is described in detail in related U.S. Patent Application Publication No. 20070190042.
[0297] The stem cell collection composition can comprise any physiologically-acceptable solution suitable for the collection and/or culture of stem cells, for example, a saline solution (e.g., phosphate-buffered saline. Kreb's solution, modified Kreb's solution. Eagle's solution, 0.9% NaCl, etc.), a culture medium (e.g., DMEM, HDMEM, etc.), and the like.
[0298] The stem cell collection composition can comprise one or more components that tend to preserve placental stem cells, that is, prevent the placental stem cells from dying, or delay the death of the placental stem cells, reduce the number of placental stem cells in a population of cells that die, or the like, from the time of collection to the time of culturing. Such components can be, e.g., an apoptosis inhibitor (e.g., a caspase inhibitor or JNK inhibitor); a vasodilator (e.g., magnesium sulfate, an antihypertensive drug, atrial natriuretic peptide (ANP), adrenocorticotropin, corticotropin-releasing hormone, sodium nitroprusside, hydralazine, adenosine triphosphate, adenosine, indomethacin or magnesium sulfate, a phosphodiesterase inhibitor, etc.); a necrosis inhibitor (e.g., 2-(1H-Indol-3-yl)-3-pentylamino-maleimide, pyrrolidine dithiocarbamate, or clonazepam); a TNF- inhibitor; and/or an oxygen-carrying perfluorocarbon (e.g., perfluorooctyl bromide, perfluorodecyl bromide, etc.).
[0299] The stem cell collection composition can comprise one or more tissue-degrading enzymes, e.g., a metalloprotease, a serine protease, a neutral protease, an RNase, or a DNase, or the like. Such enzymes include, but are not limited to, collagenases (e.g., collagenase I, II, III or IV, a collagenase from Clostridium histolyticum, etc.); dispase, thermolysin, elastase, trypsin, LIBERASE, hyaluronidase, and the like.
[0300] The stem cell collection composition can comprise a bacteriocidally or bacteriostatically effective amount of an antibiotic. In certain non-limiting embodiments, the antibiotic is a macrolide (e.g., tobramycin), a cephalosporin (e.g., cephalexin, cephradine, cefuroxime, cefprozil, cefaclor, cefixime or cefadroxil), a clarithromycin, an erythromycin, a penicillin (e.g., penicillin V) or a quinolone (e.g., ofloxacin, ciprofloxacin or norfloxacin), a tetracycline, a streptomycin, etc. In a particular embodiment, the antibiotic is active against Gram(+) and/or Gram() bacteria. e.g., Pseudomonas aeruginosa, Staphylococcus aureus, and the like.
[0301] The stem cell collection composition can also comprise one or more of the following compounds: adenosine (about 1 mM to about 50 mM); D-glucose (about 20 mM to about 100 mM); magnesium ions (about 1 mM to about 50 mM); a macromolecule of molecular weight greater than 20,000 daltons, in one embodiment, present in an amount sufficient to maintain endothelial integrity and cellular viability (e.g., a synthetic or naturally occurring colloid, a polysaccharide such as dextran or a polyethylene glycol present at about 25 g/l to about 100 g/l, or about 40 g/l to about 60 g/l); an antioxidant (e.g., butylated hydroxyanisole, butylated hydroxytoluene, glutathione, vitamin C or vitamin E present at about 25 M to about 100 M); a reducing agent (e.g., N-acetylcysteine present at about 0.1 mM to about 5 mM); an agent that prevents calcium entry into cells (e.g., verapamil present at about 2 M to about 25 M); nitroglycerin (e.g., about 0.05 g/L to about 0.2 g/L); an anticoagulant, in one embodiment, present in an amount sufficient to help prevent clotting of residual blood (e.g., heparin or hirudin present at a concentration of about 1000 units/l to about 100,000 units/l); or an amiloride containing compound (e.g., amiloride, ethyl isopropyl amiloride, hexamethylene amiloride, dimethyl amiloride or isobutyl amiloride present at about 1.0 M to about 5 M).
[0302] 5.4.2 Collection and Handling of Placenta
[0303] Generally, a human placenta is recovered shortly after its expulsion after birth. In a preferred embodiment, the placenta is recovered from a patient after informed consent and after a complete medical history of the patient is taken and is associated with the placenta. Preferably, the medical history continues after delivery. Such a medical history can be used to coordinate subsequent use of the placenta or the stem cells harvested therefrom. For example, human placental cells can be used, in light of the medical history, for personalized medicine for the infant associated with the placenta, or for parents, siblings or other relatives of the infant.
[0304] Prior to recovery of placental stem cells, the umbilical cord blood and placental blood are removed. In certain embodiments, after delivery, the cord blood in the placenta is recovered. The placenta can be subjected to a conventional cord blood recovery process. Typically a needle or cannula is used, with the aid of gravity, to exsanguinate the placenta (see, e.g., Anderson. U.S. Pat. No. 5,372,581; Hessel et al., U.S. Pat. No. 5,415,665). The needle or cannula is usually placed in the umbilical vein and the placenta can be gently massaged to aid in draining cord blood from the placenta. Such cord blood recovery may be performed commercially. e.g., LifeBank Inc., Cedar Knolls. N.J., ViaCord. Cord Blood Registry and Cryocell. Preferably, the placenta is gravity drained without further manipulation so as to minimize tissue disruption during cord blood recovery.
[0305] Typically, a placenta is transported from the delivery or birthing room to another location, e.g., a laboratory, for recovery of cord blood and collection of stem cells by, e.g., perfusion or tissue dissociation. The placenta is preferably transported in a sterile, thermally insulated transport device (maintaining the temperature of the placenta between 20-28C), for example, by placing the placenta, with clamped proximal umbilical cord, in a sterile zip-lock plastic bag, which is then placed in an insulated container. In another embodiment, the placenta is transported in a cord blood collection kit substantially as described in pending United States patent application Ser. No. 11/230,760, filed Sep. 19, 2005. Preferably, the placenta is delivered to the laboratory four to twenty-four hours following delivery. In certain embodiments, the proximal umbilical cord is clamped, preferably within 4-5 cm (centimeter) of the insertion into the placental disc prior to cord blood recovery. In other embodiments, the proximal umbilical cord is clamped after cord blood recovery but prior to further processing of the placenta.
[0306] The placenta, prior to placental stem cell collection, can be stored under sterile conditions and at either room temperature or at a temperature of 5 to 25 C. (centigrade). The placenta may be stored for a period of longer than forty eight hours, and preferably for a period of four to twenty-four hours prior to perfusing the placenta to remove any residual cord blood. The placenta is preferably stored in an anticoagulant solution at a temperature of 5 to 25 C. (centigrade). Suitable anticoagulant solutions are well known in the art. For example, a solution of heparin or warfarin sodium can be used. In a preferred embodiment, the anticoagulant solution comprises a solution of heparin (e.g., 1% w/w in 1:1000 solution). The exsanguinated placenta is preferably stored for no more than 36 hours before placental cells are collected.
[0307] The mammalian placenta or a part thereof, once collected and prepared generally as above, can be treated in any art-known manner. e.g., can be perfused or disrupted, e.g., digested with one or more tissue-disrupting enzymes, to obtain stein cells.
[0308] 5.4.3 Physical Disruption and Enzymatic Digestion of Placental Tissue
[0309] In one embodiment, placental stem cells are collected from a mammalian placenta by physical disruption, e.g., enzymatic digestion, of the organ, e.g., using the stem cell collection composition described above. For example, the placenta, or a portion thereof, may be, e.g., crushed, sheared, minced, diced, chopped, macerated or the like, while in contact with, e.g., a buffer, medium or a stem cell collection composition, and the tissue subsequently digested with one or more enzymes. The placenta, or a portion thereof, may also be physically disrupted and digested with one or more enzymes, and the resulting material then immersed in, or mixed into, a buffer, medium or a stem cell collection composition. Any method of physical disruption can be used, provided that the method of disruption leaves a plurality, more preferably a majority, and more preferably at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% of the cells in said organ viable, as determined by, e.g., trypan blue exclusion.
[0310] Typically, placental cells can be obtained by disruption of a small block of placental tissue. e.g., a block of placental tissue that is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or about 1000 cubic millimeters in volume.
[0311] Enzymatic digestion can be performed using single enzymes or combinations of enzymes. In one embodiment, enzymatic digestion of placental tissue uses a combination of a matrix metalloprotease, a neutral protease, and a mucolytic enzyme for digestion of hyaluronic acid, such as a combination of collagenase, dispase, and hyaluronidase or a combination of LIBERASE t Boehringer Mannheim Corp., Indianapolis, Ind.) and hyaluronidase. Other enzymes that can be used to disrupt placenta tissue include papain, deoxyribonucleases, serine proteases, such as trypsin, chymotrypsin, or elastase. Serine proteases may be inhibited by alpha 2 microglobulin in serum and therefore the medium used for digestion is usually serum-free. EDTA and DNase are commonly used in enzyme digestion procedures to increase the efficiency of cell recovery. The digestate is preferably diluted so as to avoid trapping stem cells within the viscous digest.
[0312] Typical concentrations for tissue digestion enzymes include, e.g., 50-200 U/mL for collagenase I and collagenase IV, I-10 U/mL for dispase, and 10-100 U/mL for elastase. Proteases can be used in combination, that is, two or more proteases in the same digestion reaction, or can be used sequentially in order to liberate placental cells. For example, in one embodiment, a placenta, or part thereof, is digested first with an appropriate amount of collagenase 1 at 2 mg/ml for 30 minutes, followed by digestion with trypsin, 0.25%, for 10 minutes, at 37 C. Serine proteases are preferably used consecutively following use of other
[0313] In another embodiment, the tissue can further be disrupted by the addition of a chelator. e.g., ethylene glycol bis(2-aminoethyl ether)-N,N,NN-tetraacetic acid (EGTA) or ethylenediaminetetraacetic acid (EDTA) to the stem cell collection composition comprising the stem cells, or to a solution in which the tissue is disrupted and/or digested prior to isolation of the placental stem cells with the stem cell collection composition.
[0314] It will be appreciated that where an entire placenta, or portion of a placenta comprising both fetal and maternal cells (for example, where the portion of the placenta comprises the chorion or cotyledons) is digested to obtain placental stem cells, the placental cells collected will comprise a mix of placental cells derived from both fetal and maternal sources. Where a portion of the placenta that comprises no, or a negligible number of, maternal cells (for example, amnion) is used to obtain placental stem cells, the placental stem cells collected will comprise almost exclusively fetal placental stem cells.
[0315] 5.4.4 Placental Perfusion
[0316] Placental stem cells can also be obtained by perfusion of the mammalian placenta. Methods of perfusing mammalian placenta to obtain stem cells are disclosed, e.g., in Hariri. U.S. Application Publication No. 2002/0123141, and in related U.S. Provisional Application No. 60/754,969, entitled Improved Composition for Collecting and Preserving Placental Cells and Methods of Using the Composition filed on Dec. 29, 2005.
[0317] Placental stem cells can be collected by perfusion, e.g., through the placental vasculature, using, e.g., a stem cell collection composition as a perfusion solution. In one embodiment, a mammalian placenta is perfused by passage of perfusion solution through either or both of the umbilical artery and umbilical vein. The flow of perfusion solution through the placenta may be accomplished using, e.g., gravity flow into the placenta. Preferably, the perfusion solution is forced through the placenta using a pump. e.g., a peristaltic pump. The umbilical vein can be, e.g., cannulated with a cannula, e.g., a TIEFLON or plastic cannula, that is connected to a sterile connection apparatus, such as sterile tubing. The sterile connection apparatus is connected to a perfusion manifold.
[0318] In preparation for perfusion, the placenta is preferably oriented (e.g., suspended) in such a manner that the umbilical artery and umbilical vein are located at the highest point of the placenta. The placenta can be perfused by passage of a perfusion fluid, e.g., the stem cell collection composition provided herein, through the placental vasculature, or through the placental vasculature and surrounding tissue. In one embodiment, the umbilical artery and the umbilical vein are connected simultaneously to a pipette that is connected via a flexible connector to a reservoir of the perfusion solution. The perfusion solution is passed into the umbilical vein and artery. The perfusion solution exudes from and/or passes through the walls of the blood vessels into the surrounding tissues of the placenta, and is collected in a suitable open vessel from the surface of the placenta that was attached to the uterus of the mother during gestation. The perfusion solution may also be introduced through the umbilical cord opening and allowed to flow or percolate out of openings in the wall of the placenta which interfaced with the maternal uterine wall. In another embodiment, the perfusion solution is passed through the umbilical veins and collected from the umbilical artery, or is passed through the umbilical artery and collected from the umbilical veins.
[0319] In one embodiment, the proximal umbilical cord is clamped during perfusion, and more preferably, is clamped within 4-5 cm (centimeter) of the cord's insertion into the placental disc.
[0320] The first collection of perfusion fluid from a mammalian placenta during the exsanguination process is generally colored with residual red blood cells of the cord blood and/or placental blood; this portion of the perfusion can be discarded. The perfusion fluid becomes more colorless as perfusion proceeds and the residual cord blood cells are washed out of the placenta.
[0321] The volume of perfusion liquid used to collect placental stem cells may vary depending upon the number of placental stem cells to be collected, the size of the placenta, the number of collections to be made from a single placenta, etc. In various embodiments, the volume of perfusion liquid may be from 50 mL to 5000 mL, 50 mL to 4000 mL, 50 mL to 3000 mL, 100 mL to 2000 mL, 250 mL to 2000 mL, 500 mL to 2000 mL, or 750 mL to 2000 mL. Typically, the placenta is perfused with 700-800 mL of perfusion liquid following exsanguination.
[0322] The placenta can be perfused a plurality of times over the course of several hours or several days. Where the placenta is to be perfused a plurality of times, it may be maintained or cultured under aseptic conditions in a container or other suitable vessel, and perfused with the stem cell collection composition, or a standard perfusion solution (e.g., a normal saline solution such as phosphate buffered saline (PBS)) with or without an anticoagulant (e.g., heparin, warfarin sodium, coumarin, bishydroxycoumarin), and/or with or without an antimicrobial agent (e.g., -mercaptoethanol (0.1 mM); antibiotics such as streptomycin (e.g., at 40-100 g/ml), penicillin (e.g., at 40 U/ml), amphotericin B (e.g., at 0.5 g/ml). In one embodiment, an isolated placenta is maintained or cultured for a period of time without collecting the perfusate, such that the placenta is maintained or cultured for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or 2 or 3 or more days before perfusion and collection of perfusate. The perfused placenta can be maintained for one or more additional time(s), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more hours, and perfused a second time with, e.g., 700-800 mL perfusion fluid. The placenta can be perfused 1, 2, 3, 4, 5 or more times, for example, once every 1, 2, 3, 4, 5 or 6 hours. In a preferred embodiment, perfusion of the placenta and collection of perfusion solution, e.g., stem cell collection composition, is repeated until the number of recovered nucleated cells falls below 100 cells/ml. The perfusates at different time points can be further processed individually to recover time-dependent populations of placental stem cells. Perfusates from different time points can also be pooled.
[0323] Without wishing to be bound by any theory, after exsanguination and a sufficient time of perfusion of the placenta, placental stem cells are believed to migrate into the exsanguinated and perfused microcirculation of the placenta where they are collectable, preferably by washing into a collecting vessel by perfusion. Perfusing the isolated placenta not only serves to remove residual cord blood but also provide the placenta with the appropriate nutrients, including oxygen. The placenta may be cultivated and perfused with a similar solution which was used to remove the residual cord blood cells, preferably, without the addition of anticoagulant agents.
[0324] Stem cells can be isolated from placenta by perfusion with a solution comprising one or more proteases or other tissue-disruptive enzymes. In a specific embodiment, a placenta or portion thereof is brought to 25-37 C. and is incubated with one or more tissue-disruptive enzymes in 200 mL of a culture medium for 30 minutes. Cells from the perfusate are collected, brought to 4 C. and washed with a cold inhibitor mix comprising 5 mM EDTA, 2 mM dithiothreitol and 2 mM beta-mercaptoethanol. The placental stem cells are washed after several minutes with a cold (e.g., 4 C.) stem cell collection composition described elsewhere herein.
[0325] Perfusion using the pan method, that is, whereby perfusate is collected after it has exuded from the maternal side of the placenta, results in a mix of fetal and maternal cells. As a result, the cells collected by this method comprise a mixed population of placental stem cells of both fetal and maternal origin. In contrast, perfusion solely through the placental vasculature, whereby perfusion fluid is passed through one or two placental vessels and is collected solely through the remaining vessel(s), results in the collection of a population of placental stem cells almost exclusively of fetal origin.
[0326] 5.4.5 Isolation, Sorting, and Characterization of Placental Cells
[0327] Stem cells from mammalian placenta, whether obtained by perfusion or enyzmatic digestion, can initially be purified from (i.e., be isolated from) other cells by Ficoll gradient centrifugation. Such centrifugation can follow any standard protocol for centrifugation speed, etc. In one embodiment, for example, cells collected from the placenta are recovered from perfusate by centrifugation at 5000g for 15 minutes at room temperature, which separates cells from, e.g., contaminating debris and platelets. In another embodiment, placental perfusate is concentrated to about 200 ml, gently layered over Ficoll, and centrifuged at about 1100g for 20 minutes at 22 C. and the low-density interface layer of cells is collected for further processing.
[0328] Cell pellets can be resuspended in fresh stem cell collection composition, or a medium suitable for stem cell maintenance, e.g., IMDM serum-free medium containing 2 U/ml heparin and 2 mM EDTA (GibcoBRL, N.Y.). The total mononuclear cell fraction can be isolated. e.g., using Lymphoprep (Nycomed Pharma. Oslo. Norway) according to the manufacturer's recommended procedure.
[0329] As used herein. isolating placental stem cells means removing at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the cells with which the placental stem cells are normally associated in the intact mammalian placenta.
[0330] Placental stem cells obtained by perfusion or digestion can, for example, be further, or initially, isolated by differential trypsinization using, e.g., a solution of 0.05% trypsin with 0.2% EDTA (Sigma. St. Louis Mo.). Differential trypsinization is possible because placental stem cells typically detach from plastic surfaces within about five minutes whereas other adherent populations typically require more than 20-30 minutes incubation. The detached placental stem cells can be harvested following trypsinization and trypsin neutralization, using, e.g., Trypsin Neutralizing Solution (TNS, Cambrex).
[0331] In one embodiment of isolation of placental stem cells, aliquots of, for example, about 5-1010.sup.6 placental cells are placed in each of several T-75 flasks, preferably fibronectin-coated T75 flasks. In such an embodiment, the cells can be cultured with commercially available Mesenchymal Stem Cell Growth Medium (MSCGM) (Cambrex), and placed in a tissue culture incubator (37 C., 5% CO.sub.2). After 10 to 15 days, non-adherent cells are removed from the flasks by washing with PBS. The PBS is then replaced by MSCGM. Flasks are preferably examined daily for the presence of various adherent cell types and in particular, for identification and expansion of clusters of fibroblastoid cells.
[0332] The number and type of cells collected from a mammalian placenta can be monitored, for example, by measuring changes in morphology and cell surface markers using standard cell detection techniques such as flow cytometry, cell sorting, immunocytochemistry (e.g., staining with tissue specific or cell-marker specific antibodies) fluorescence activated cell sorting (FACS), magnetic activated cell sorting (MACS), by examination of the morphology of cells using light or confocal microscopy, and/or by measuring changes in gene expression using techniques well known in the art, such as PCR and gene expression profiling. These techniques can be used, too, to identify cells that are positive for one or more particular markers. For example, using antibodies to CD34, one can determine, using the techniques above, whether a cell comprises a detectable amount of CD34 as compared to, for example, an isotype control; if so, the cell is CD34. Likewise, if a cell produces enough OCT-4 RNA to be detectable by RT-PCR, or significantly more OCT-4 RNA than a terminally-differentiated cell, the cell is OCT-4.sup.+. Antibodies to cell surface markers (e.g., CD markers such as CD34) and the sequence of stem cell-specific genes, such as OCT-4, are well-known in the art.
[0333] Placental cells, particularly cells that have been isolated by Ficoll separation, differential adherence, or a combination of both, may be sorted, e.g., further isolated, using a fluorescence activated cell sorter (FACS). Fluorescence activated cell sorting (FACS) is a well-known method for separating particles, including cells, based on the fluorescent properties of the particles (Kamarch, 1987. Methods Enzymol. 151:150-165. Laser excitation of fluorescent moieties in the individual particles results in a small electrical charge allowing electromagnetic separation of positive and negative particles from a mixture. In one embodiment, cell surface marker-specific antibodies or ligands are labeled with distinct fluorescent labels. Cells are processed through the cell sorter, allowing separation of cells based on their ability to bind to the antibodies used. FACS sorted particles may be directly deposited into individual wells of 96-well or 384-well plates to facilitate separation and cloning.
[0334] In one sorting scheme, placental stem cells can be sorted on the basis of expression of the markers CD34, CD38, CD44, CD45. CD73, CD105. OCT-4 and/or HLA-G, or any of the other markers listed elsewhere herein. This can be accomplished in connection with procedures to select stem cells on the basis of their adherence properties in culture. For example, adherence selection of placental stem cells can be accomplished before or after sorting on the basis of marker expression. In one embodiment, for example, placental stein cells can be sorted first on the basis of their expression of CD34; CD34.sup.+ cells are retained, and cells that are CD200.sup.+ or HLA-G.sup.+, are separated from all other CD34 cells. In another embodiment, placental stem cells can be sorted based on their expression of CD200 and/or HLA-G, or lack thereof; for example, cells displaying either of these markers can be isolated for further use. Cells that express, e.g., CD200 and/or HLA-G can, in a specific embodiment, be further sorted based on their expression of CD73 and/or CD105, or epitopes recognized by antibodies SH2, SH3 or SH4, or lack of expression of CD34, CD38 or CD45. For example, in one embodiment, placental stem cells are sorted by expression, or lack thereof, of CD200, HLA-G, CD73, CD105, CD34, CD38 and CD45, and placental stem cells that are CD200.sup.+, HLA-G.sup.+, CD73.sup.+, CD105.sup.+, CD34, CD38 and CD45 are isolated from other placental cells for further use.
[0335] In another embodiment, magnetic beads can be used to separate cells, e.g., separate placental stem cells from other placental cells. The cells may be sorted using a magnetic activated cell sorting (MACS) technique, a method for separating particles based on their ability to bind magnetic beads (0.5-100 m diameter). A variety of useful modifications can be performed on the magnetic microspheres, including covalent addition of antibody that specifically recognizes a particular cell surface molecule or hapten. The beads are then mixed with the cells to allow binding. Cells are then passed through a magnetic field to separate out cells having the specific cell surface marker. In one embodiment, these cells can then isolated and re-mixed with magnetic beads coupled to an antibody against additional cell surface markers. The cells are again passed through a magnetic field, isolating cells that bound both the antibodies. Such cells can then be diluted into separate dishes, such as microtiter dishes for clonal isolation.
[0336] Placental stem cells can also be characterized and/or sorted based on cell morphology and growth characteristics. For example, placental stem cells can be characterized as having, and/or selected on the basis of, e.g., a fibroblastoid appearance in culture. Placental stem cells can also be characterized as having, and/or be selected, on the basis of their ability to form embryoid-like bodies. In one embodiment, for example, placental cells that are fibroblastoid in shape, express CD73 and CD105, and produce one or more embryoid-like bodies in culture can be isolated from other placental cells. In another embodiment. OCT-4.sup.+ placental cells that produce one or more embryoid-like bodies in culture are isolated from other placental cells.
[0337] In another embodiment, placental stem cells can be identified and characterized by a colony forming unit assay. Colony forming unit assays are commonly known in the art, such as Mesen Cult medium (Stem Cell Technologies. Inc., Vancouver British Columbia).
[0338] Placental stem cells can be assessed for viability, proliferation potential, and longevity using standard techniques known in the art, such as trypan blue exclusion assay, fluorescein diacetate uptake assay, propidium iodide uptake assay (to assess viability); and thymidine uptake assay. MTT cell proliferation assay (to assess proliferation). Longevity may be determined by methods well known in the art, such as by determining the maximum number of population doubling in an extended culture.
[0339] Placental stem cells can also be separated from other placental cells using other techniques known in the at, e.g., selective growth of desired cells (positive selection), selective destruction of unwanted cells (negative selection); separation based upon differential cell agglutinability in the mixed population as, for example, with soybean agglutinin; freeze-thaw procedures; filtration; conventional and zonal centrifugation; centrifugal elutriation counter-streaming centrifugation); unit gravity separation; countercurrent distribution; electrophoresis; and the like.
[0340] 5.5 Culture of Placental Stem Cells
[0341] 5.5.1 Culture Media
[0342] Isolated placental stem cells, or placental cell populations, or cells or placental tissue from which placental cells grow out, can be used to initiate, or seed, cell cultures. Cells are generally transferred to sterile tissue culture vessels either uncoated or coated with extracellular matrix or ligands such as laminin, collagen (e.g., native or denatured), gelatin, fibronectin, ornithine, vitronectin, and extracellular membrane protein (e.g., MATRIGEL (BD Discovery Labware. Bedford, Mass.)).
[0343] Placental stem cells can be cultured in any medium, and under any conditions, recognized in the art as acceptable for the culture of stem cells. Preferably, the culture medium comprises serum. Placental stem cells can be cultured in, for example, DMEM-LG (Dulbecco's Modified Essential Medium, low glucose)/MCDB 201 (chick fibroblast basal medium) containing ITS (insulin-transferrin-selenium). LA+BSA (linoleic acid-bovine serum albumin), dextrose, L-ascorbic acid. PDGF. EGF. IGF-1, and penicillin/streptomycin; DMEM-HG (high glucose) comprising 10% fetal bovine serum (FBS); DMEM-HG comprising 15% FBS; IMDM (Iscove's modified Dulbecco's medium) comprising 10% FBS, 10% horse serum, and hydrocortisone; M199 comprising 10% FBS, EGF, and heparin; -MEM (minimal essential medium) comprising 10% FBS. GlutaMAX and gentamicin; DMEM comprising 10% FBS. GlutaMAX and gentamicin, etc. A preferred medium is DMEM-LG/MCDB-201 comprising 2% FBS, ITS, LA+BSA, dextrose, L-ascorbic acid, PDGF, EGF, and penicillin/streptomycin.
[0344] Other media in that can be used to culture placental stem cells include DMEM (high or low glucose), Eagle's basal medium, Ham's F10 medium (F10), Ham's F-12 medium (F12). Iscove's modified Dulbecco's medium, Mesenchymal Stem Cell Growth Medium (MSCGM). Liebovitz's L-15 medium. MCDB, DMIEM/F12. RPMI 1640, advanced DMEM (Gibco), DMEM/MCDB201 (Sigma), and CELL-GRO FREE.
[0345] The culture medium can be supplemented with one or more components including, for example, serum (e.g., fetal bovine serum (FBS), preferably about 2-15% (v/v); equine (horse) scerum (ES); human serum (HS)); beta-mercaptoethanol (BME), preferably about 0.001% (v/v): one or more growth factors, for example, platelet-derived growth factor (PDGF), epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), insulin-like growth factor-1 (IGF-1), leukemia inhibitory factor (LIF), vascular endothelial growth factor (VEGF), and erythropoietin (EPO); amino acids, including L-valine; and one or more antibiotic and/or antimycotic agents to control microbial contamination, such as, for example, penicillin G, streptomycin sulfate, amphotericin B, gentamicin, and nystatin, either alone or in combination.
[0346] Any of the culture methods and media disclosed herein can be used to culture and propagate enhanced placental stem cells, as well.
[0347] 5.5.2 Expansion and Proliferation of Placental Stem Cells
[0348] Once placental stem cells are isolated (e.g., separated from at least 50% of the placental cells with which the stem cell or population of stem cells is normally associated in vivo)), the stem cell or population of stem cells can be proliferated and expanded in vitro. Similarly, once enhanced placental stem cells are produced, such cells can also be proliferated and expanded in vitro. For example, placental stem cells can be cultured in tissue culture containers, e.g., dishes, flasks, multiwell plates, or the like, for a sufficient time for the placental stem cells to proliferate to 70-90% confluence, that is, until the placental stem cells and their progeny occupy 70-90% of the culturing surface area of the tissue culture container.
[0349] Placental stem cells can be seeded in culture vessels at a density that allows cell growth. For example, the placental stem cells may be seeded at low density (e.g., about 1.000 to about 5.000 cells/cm.sup.2) to high density (e.g., about 50.000 or more cells/cm). In a preferred embodiment, the placental stem cells are cultured at about 0 to about 5 percent by volume CO.sub.2 in air. In some preferred embodiments, the placental stem cells are cultured at about 2 to about 25 percent O.sub.2 in air, preferably about 5 to about 20 percent O.sub.2 in air. The placental stem cells preferably are cultured at about 25 C. to about 40 C. preferably 37 C. The placental stem cells are preferably cultured in an incubator. The culture medium can be static or agitated, for example, using a bioreactor. Placental stein cells are preferably are grown under low oxidative stress (e.g., with addition of glutathione, ascorbic acid, catalase, tocopherol. N-acetylcysteine, or the like).
[0350] Once 70%-90% confluence is obtained, the placental stem cells may be passaged. For example, the cells can be enzymatically treated, e.g., trypsinized, using techniques well-known in the art, to separate them from the tissue culture surface. After removing the placental stem cells by pipetting and counting the cells, about 20,000-100,000 stem cells, preferably about 50,000 placental stem cells, are passaged to a new culture container containing fresh culture medium.
[0351] Typically, the new medium is the same type of medium from which the stem cells were removed. Provided herein are populations of placental stein cells that have been passaged at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, or 20 times, or more, and combinations of the same.
[0352] 5.6 Preservation of Enhanced Placental Cells
[0353] Enhanced placental stem cells can be preserved, that is, placed under conditions that allow for long-term storage, or conditions that inhibit cell death by, e.g., apoptosis or necrosis.
[0354] Enhanced placental stem cells can be preserved using, e.g., a composition comprising an apoptosis inhibitor, necrosis inhibitor and/or an oxygen-carrying perfluorocarbon, as described in related U.S. Provisional Application No. 60/754,969, entitled Improved Composition for Collecting and Preserving Placental Cells and Methods of Using the Composition filed on Dec. 25, 2005.
[0355] In one embodiment, provided herein is a method of preserving enhanced placental stem cells comprising contacting said enhanced placental stem cells with a stem cell collection composition comprising an inhibitor of apoptosis and an oxygen-carrying perfluorocarbon, wherein said inhibitor of apoptosis is present in an amount and for a time sufficient to reduce or prevent apoptosis in the population of enhanced placental stem cells, as compared to a population of enhanced placental stem cells not contacted with the inhibitor of apoptosis. In a specific embodiment, said inhibitor of apoptosis is a caspase inhibitor. In another specific embodiment, said inhibitor of apoptosis is a JNK inhibitor. In a more specific embodiment, said JNK inhibitor does not modulate differentiation or proliferation of said enhanced placental stem cells. In another embodiment, said stem cell collection composition comprises said inhibitor of apoptosis and said oxygen-carrying perfluorocarbon in separate phases. In another embodiment, said stem cell collection composition comprises said inhibitor of apoptosis and said oxygen-carrying perfluorocarbon in an emulsion. In another embodiment, the stem cell collection composition additionally comprises an emulsifier, e.g., lecithin. In another embodiment, said apoptosis inhibitor and said perfluorocarbon are between about 0 C. and about 25 C. at the time of contacting the stem cells. In another more specific embodiment, said apoptosis inhibitor and said perfluorocarbon are between about 2C and 10 C. or between about 2 C. and about 5 C. at the time of contacting the stem cells. In another more specific embodiment, said contacting is performed during transport of said enhanced placental stem cells. In another more specific embodiment, said contacting is performed during freezing and thawing of said population of stem cells.
[0356] In another embodiment, enhanced placental stem cells can be preserved by a method comprising contacting said enhanced placental stem cells with an inhibitor of apoptosis and an organ-preserving compound, wherein said inhibitor of apoptosis is present in an amount and for a time sufficient to reduce or prevent apoptosis of the enhanced placental stem cells, as compared to enhanced placental stem cells not contacted with the inhibitor of apoptosis. In a specific embodiment, the organ-preserving compound is UW solution (described in U.S. Pat. No. 4,798,824; also known as ViaSpan; see also Southard et al., Transplantation 49(2):251-257 (1990)) or a solution described in Stern et al., U.S. Pat. No. 5,552,267. In another embodiment, said organ-preserving compound is hydroxyethyl starch, lactobionic acid, raffinose, or a combination thereof.
[0357] In another embodiment, placental stem cells, to be used to produce enhanced placental stem cells, are contacted with a stein cell collection composition comprising an apoptosis inhibitor and oxygen-carrying perfluorocarbon, organ-preserving compound, or combination thereof, during perfusion. In another embodiment, said placental stem cells, to be used to produce enhanced placental stem cells, are contacted during a process of tissue disruption. e.g., enzymatic digestion. In another embodiment, placental cells are contacted with said stem cell collection compound after collection by perfusion, or after collection by tissue disruption, e.g., enzymatic digestion.
[0358] Typically, during placental stem cell collection, enrichment and isolation, it is preferable to minimize or eliminate cell stress due to hypoxia and mechanical stress. In another embodiment of the method, therefore, placental stem cells, to be used to produce enhanced placental stem cells, are exposed to a hypoxic condition during collection, enrichment or isolation for less than six hours during said preservation, wherein a hypoxic condition is a concentration of oxygen that is less than normal blood oxygen concentration. In a more specific embodiment, said placental stem cells are exposed to said hypoxic condition for less than two hours during said preservation. In another more specific embodiment, said placental stem cells are exposed to said hypoxic condition for less than one hour, or less than thirty minutes, or is not exposed to a hypoxic condition, during collection, enrichment or isolation. In another specltic embodiment, said placental stem cells are not exposed to shear stress during collection, enrichment or isolation.
[0359] The enhanced placental stem cells, as well as the placental stem cells to be used to produce enhanced placental stem cells, described herein can be cryopreserved, e.g., in cryopreservation medium in small containers, e.g., ampoules. Suitable cryopreservation medium includes, but is not limited to, culture medium including, e.g., growth medium, or cell freezing medium, for example commercially available cell freezing medium, e.g., C2695. C2639 or C6039 (Sigma). Cryopreservation medium preferably comprises DMSO (dimethylsulfoxide), at a concentration of, e.g., about 10% (v/v). Cryopreservation medium may comprise additional agents, for example, Plasmalyte, methylcellulose with or without glycerol. The stem cells are preferably cooled at about 1 C./min during cryopreservation. A preferred cryopreservation temperature is about 80 C. to about 180 C. preferably about 125 C. to about 140 C.
[0360] Cryopreserved cells can be transferred to liquid nitrogen prior to thawing for use. In some embodiments, for example, once the ampoules have reached about 9 C. they are transferred to a liquid nitrogen storage area. Cryopreserved cells preferably are thawed at a temperature of about 25 C. to about 40 C., preferably to a temperature of about 37 C. In certain embodiments, enhanced placental stem cells provided herein are cryopreserved about 12, 24, 36, 48, 60 or 72 hours after being contacted with modulatory RNA molecules (e.g., transfection). In one embodiment, enhanced placental stem cells provided herein are cryopreserved about 24 hours after being contacted with modulatory RNA molecules (e.g., transfection).
[0361] 5.7 Other Uses of Enhanced Placental Cells
[0362] 5.7.1 Compositions Comprising Placental Cells
[0363] The methods provided herein can use compositions comprising the enhanced placental stem cells, or biomolecules therefrom. In the same manner, the populations of enhanced placental stem cells provided herein can be combined with any physiologically-acceptable or medically-acceptable compound, composition or device for use in, e.g., research or therapeutics.
[0364] 5.7.1.1 Cryopreserved Placental Cells
[0365] The immunosuppressive enhanced placental cells described herein can be preserved, for example, cryopreserved for later use. Methods for cryopreservation of cells, such as stem cells, are well known in the art. Enhanced placental cells can be prepared in a form that is easily administrable to an individual. For example, enhanced placental cells described herein can be contained within a container that is suitable for medical use. Such a container can be, for example, a sterile plastic bag, flask, jar, vial, or other container from which the placental cell population can be easily dispensed. For example, the container can be a blood bag or other plastic, medically-acceptable bag suitable for the intravenous administration of a liquid to a recipient. The container is preferably one that allows for cryopreservation of the enhanced placental cells.
[0366] Cryopreserved immunosuppressive enhanced placental cell populations can comprise placental stem cells derived from a single donor, or from multiple donors. The enhanced placental cells can be completely HLA-matched to an intended recipient, or partially or completely HLA-mismatched.
[0367] Thus, in one embodiment, provided herein is a composition comprising enhanced placental cells in a container. In a specific embodiment, the enhanced placental cells cryopreserved. In another specific embodiment, the container is a bag, flask, vial or jar. In more specific embodiment, said bag is a sterile plastic bag. In a more specific embodiment, said bag is suitable for, allows or facilitates intravenous administration of said enhanced placental cells. The bag can comprise multiple lumens or compartments that are interconnected to allow mixing of the enhanced placental cells and one or more other solutions, e.g., a drug, prior to, or during, administration. In another specific embodiment, the composition comprises one or more compounds that facilitate cryopreservation of the combined stem cell population. In another specific embodiment, said enhanced placental cells are contained within a physiologically-acceptable aqueous solution. In a more specific embodiment, said physiologically-acceptable aqueous solution is a 0.9% NaCl solution. In another specific embodiment, said enhanced placental cells are HLA-matched to a recipient of said enhanced placental cells. In another specific embodiment, said enhanced placental cells are at least partially HLA-mismatched to a recipient of said enhanced placental cells. In another specific embodiment, said enhanced placental cells are derived from placental stem cells from a plurality of donors.
[0368] 5.7.1.2 Pharmaceutical Compositions
[0369] In another aspect, provided herein is a pharmaceutical composition for treating an individual having or at risk of developing a disease, disorder or condition having an inflammatory component, said pharmaceutical composition comprising a therapeutically effective amount of enhanced placental stem cells. In certain embodiments, said cells comprise or have been contacted with an effective amount of modulatory RNA molecules that, when compared to placental stem cells not contacted with said modulatory RNA molecules (i) suppress an amount of soluble IL-23 protein produced by peripheral blood mononuclear cells (PBMCs) in the presence of said enhanced placental stem cells; (ii) increase Cox-2 activity in said enhanced placental stem cells; (iii) increase an amount of PGE2 produced by said enhanced placental stem cells; or (iv) reduce the level a pro-inflammatory cytokine produced by enhanced placental stem cells, wherein the therapeutically effective amount is an amount sufficient to cause a detectable improvement in one or more symptoms of said disease, disorder or condition.
[0370] In another aspect, provided herein are enhanced placental stem cells that have been modified by the methods or modulatory RNA molecules provided herein.
[0371] Immunosuppressive enhanced placental cells can be formulated into pharmaceutical compositions for use in vivo. Such pharmaceutical compositions can comprise enhanced placental cells in a pharmaceutically-acceptable carrier, e.g., a saline solution or other accepted physiologically-acceptable solution for in vitro administration. Pharmaceutical compositions provided herein can comprise any of the enhanced placental cells described elsewhere herein.
[0372] The pharmaceutical compositions can comprise fetal, maternal, or both fetal and maternal enhanced placental cells. The pharmaceutical compositions provided herein can further comprise enhanced placental cells produced from placental stem cells obtained from a single individual or placenta, or from a plurality of individuals or placentae.
[0373] The pharmaceutical compositions provided herein can comprise any immunosuppressive number of enhanced placental cells. For example, a single unit dose of enhanced placental cells can comprise, in various embodiments, about, at least, or no more than 110.sup.5, 510.sup.5, 110.sup.6, 510.sup.6, 110.sup.7, 510.sup.7, 110.sup.8, 510.sup.8, 110.sup.9, 510.sup.9, 110.sup.10, 510.sup.10, 110.sup.11 or more enhanced placental cells.
[0374] The pharmaceutical compositions provided herein can comprise populations of enhanced placental cells that comprise 50% viable enhanced placental cells or more (that is, at least 50% of the cells in the population are functional or living). Preferably, at least 60% of the cells in the population are viable. More preferably, at least 70%, 80%, 90%, 95%, or 99% of the enhanced placental cells in the population in the pharmaceutical composition are viable.
[0375] The pharmaceutical compositions provided herein can comprise one or more compounds that, e.g., facilitate engraftment (e.g., anti-T-cell receptor antibodies, an immunosuppressant, or the like); stabilizers such as albumin. dextran 40, gelatin, hydroxyethyl starch, and the like.
[0376] 5.7.1.3 Matrices Comprising Enhanced Placental Cells
[0377] Further provided herein are matrices, hydrogels, scaffolds, and the like that comprise immunosuppressive enhanced placental cells. Enhanced placental cells provided herein can be seeded onto a natural matrix, e.g., a placental biomaterial such as an amniotic membrane material. Such an amniotic membrane material can be, e.g., amniotic membrane dissected directly from a mammalian placenta; fixed or heat-treated amniotic membrane, substantially dry (i.e., <20% H.sub.2O) amniotic membrane, chorionic membrane, substantially dry chorionic membrane, substantially dry amniotic and chorionic membrane, and the like. Preferred placental biomaterials on which enhanced placental cells can be seeded are described in Hariri, U.S. Application Publication No. 2004/0048796.
[0378] Placental cells provided herein can be suspended in a hydrogel solution suitable for, e.g., injection. Suitable hydrogels for such compositions include self-assembling peptides, such as RAD16. Enhanced placental stem cells can also be combined with, e.g., alginate or platelet-rich plasma, or other fibrin-containing matrices, for local injection. In one embodiment, a hydrogel solution comprising enhanced placental cells can be allowed to harden, for instance in a mold, to form a matrix having the cells dispersed therein for implantation. Enhanced placental cells in such a matrix can also be cultured so that the cells are mitotically expanded prior to implantation. The hydrogel can be, e.g., an organic polymer (natural or synthetic) that is cross-linked via covalent, ionic, or hydrogen bonds to create a three-dimensional open-lattice structure that entraps water molecules to form a gel. Hydrogel-forming materials include polysaccharides such as alginate and salts thereof, peptides, polyphosphazines, and polyacrylates, which are crosslinked ionically, or block polymers such as polyethylene oxide-polypropylene glycol block copolymers which are crosslinked by temperature or pH, respectively. In some embodiments, the hydrogel or matrix is biodegradable.
[0379] In some embodiments, the matrix comprises an in situ polymerizable gel (see, e.g., U.S. Patent Application Publication 2002/0022676; Anseth et al., J. Control Release. 78(1-3):199-209 (2002); Wang et al., Biomaterials, 241 (22):3969-80 (2003).
[0380] In some embodiments, the polymers are at least partially soluble in aqueous solutions, such as water, buffered salt solutions, or aqueous alcohol solutions, that have charged side groups, or a monovalent ionic salt thereof. Examples of polymers having acidic side groups that can be reacted with cations are poly(phosphazenes), polyacrylic acids), poly(methacrylic acids), copolymers of acrylic acid and methacrylic acid, poly(vinyl acetate), and sulfonated polymers, such as sulfonated polystyrene. Copolymers having acidic side groups formed by reaction of acrylic or methacrylic acid and vinyl ether monomers or polymers can also be used. Examples of acidic groups are carboxylic acid groups, sulfonic acid groups, halogenated (preferably fluorinated) alcohol groups, phenolic OH groups, and acidic OH groups.
[0381] The enhanced placental cells can be seeded onto a three-dimensional framework or scaffold and implanted in vivo. Such a framework can be implanted in combination with any one or more growth factors, cells, drugs or other components that stimulate tissue formation or otherwise enhance or improve the practice of the methods of treatment described elsewhere herein.
[0382] Examples of scaffolds that can be used in the methods of treatment described herein include nonwoven mats, porous foams, or self assembling peptides. Nonwoven mats can be formed using fibers comprised of a synthetic absorbable copolymer of glycolic and lactic acids (e.g., PGA/PLA) (VICRYL. Ethicon, Inc., Somerville, N.J.). Foams, composed of, e.g., poly(-caprolactone)/poly(glycolic acid) (PCUPGA) copolymer, formed by processes such as freeze-drying, or lyophilization (see, e.g., U.S. Pat. No. 6,355,699), can also be used as scaffolds.
[0383] In another embodiment, the scaffold is, or comprises, a nanofibrous scaffold, e.g., an electrospun nanofibrous scaffold. In a more specific embodiment, said nanotibrous scaffold comprises poly(L-lactic acid) (PLLA), type I collagen, a copolymer of vinylidene fluoride and tritluoroethylnee (PVDF-TrFE), poly(-caprolactone), poly(L-lactide-co--caprolactone) [PLLA-CL)] (e.g., 75:25), and/or a copolymer of poly 3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) and type I collagen. Methods of producing nanofibrous scaffolds, e.g., electrospun nanofibrous scaffolds, are known in the art. See, e.g., Xu et al., Tissue Engineering 10(7): 1160-1168 (2004); Xu et al., Biomaterials 25:877-886 (20040; Meng et al., J. Biomaterials Sci. Polymer Edition 18(1):81-94 (2007).
[0384] The enhanced placental stem cells described herein can also be seeded onto, or contacted with, a physiologically-acceptable ceramic material including, but not limited to, mono-, di-, tri-, alpha-tri-, beta-tri-, and tetra-calcium phosphate, hydroxyapatite, fluoroapatites, calcium sulfates, calcium fluorides, calcium oxides, calcium carbonates, magnesium calcium phosphates, biologically active glasses such as BIOGLASS, and mixtures thereof. Porous biocompatible ceramic materials currently commercially available include SUGRIBONE (CanMedica Corp., Canada). ENDOBON Merck Biomaterial France. Frances. CEROS (Mathys. AG. Bettlach. Switzerland), and mineralized collagen bone grafting products such as HEALOS (DePuy. Inc., Raynham, Mass.) and VITOSS, RHAKOSS, and CORTOSS (Orthovita, Malvern. Pa.). The framework can be a mixture, blend or composite of natural and/or synthetic materials.
[0385] In another embodiment, enhanced placental cells can be seeded onto, or contacted with, a felt, which can be, e.g., composed of a multifilament yarn made from a bioabsorbable material such as PGA. PLA. PCL copolymers or blends, or hyaluronic acid.
[0386] The enhanced placental cells described herein can, in another embodiment, be seeded onto foam scaffolds that may be composite structures. Such foam scaffolds can be molded into a useful shape. In some embodiments, the framework is treated, e.g., with 0.1M acetic acid followed by incubation in polylysine. PBS, and/or collagen, prior to inoculation of the immunosuppressive placental cells in order to enhance cell attachment. External surfaces of a matrix may be modified to improve the attachment or growth of cells and differentiation of tissue, such as by plasma-coating the matrix, or addition of one or more proteins (e.g., collagens, elastic fibers, reticular fibers), glycoproteins, glycosaminoglycans (e.g., heparin sulfate, chondroitin-4-sulfate, chondroitin-6-sulfate, dermatan sulfate, keratin sulfate, etc.), a cellular matrix, and/or other materials such as, but not limited to, gelatin, alginates, agar, agarose, and plant gums, and the like.
[0387] In some embodiments, the scaffold comprises, or is treated with, materials that render it non-thrombogenic. These treatments and materials may also promote and sustain endothelial growth, migration, and extracellular matrix deposition. Examples of these materials and treatments include but are not limited to natural materials such as basement membrane proteins such as laminin and Type IV collagen, synthetic materials such as EPTFE, and segmented polyurcthancurea silicones, such as PURSPAN (The Polymer Technology Group, Inc., Berkeley. Calif.). The scaffold can also comprise anti-thrombotic agents such as heparin; the scaffolds can also be treated to alter the surface charge (e.g., coating with plasma) prior to seeding with enhanced placental cells.
6. EXAMPLES
6.1 Example 1
PDACs Transfected with siRNAs of Human Nuclear Receptors Showed Enhanced Suppression of IL-23 by PBMCS
[0388] This working example provided herein demonstrates the successful enhancement of placental stem cells. In particular, this example demonstrates that inhibition of the expression of human nuclear receptors in placental stem cells enhances the ability of such placental stem cells to suppress PBMC expression of IL-23.
[0389] 6.1.1 Transfection of Placental Stem Cells
[0390] Reagents siPORT Amine Catalog # AM4503. Ambion; Silencer) Select Human Nuclear Hormone Receptor (HNR) siRNA Library V4, 0.25 nmol each siRNA, Cat #4397914. Ambion; Silencer Negative Control No. 1 siRNA (50 M) Catalog # AM4611, Ambion; Opti-Mem media Catalog#31985-062. Invitrogen; siRNA library Human ON-TARGETplus siRNA Nuclear Receptors Sub-Library Catalog #103400. Dharmacon; Dharmafect 3 Transfection Reagent Catalog# T-2003. Dharmacon; Dharmafect 1 Transfection Reagent Catalog # T-2001. Dharmacon; TaqMan Gene Expression Cells-to-CT Kit. AM 1728. Ambion; Bio-Plex Pro Human Cytokine HGF Set #171-B6008M. Bio-Rad; HGF ELISA. Catalog #KAC2211. Invitrogen; CellTiter 96 AQueous One Solution Cell Proliferation Assay (MTS) Catalog #G3580. Promega.
[0391] CD34.sup.+, CD10.sup.+, CD105.sup.+, CD200.sup.+, tissue culture plastic-adherent placental stem cells were transfected with human nuclear receptor siRNA libraries or control siRNA by direct or reverse transfection. The siRNA libraries and control siRNA were obtained from Ambion (Silencer Select Human Nuclear Hormone Receptor (HNR) siRNA library V4, 0.25 nmol each siRNA; Silencer Negative Control No. 1 siRNA 150 M)), and Dharmacon (siRNA library Human ON-TARGETplus siRNA Nuclear Receptors Sub-Library). Transfections were set up in a 96-well plate, and were carried out using 0.75-1.0% siPORT Amine transfection reagent (Ambion or 0.5% Dharmafect 1 or 3 transfection reagent (Dharmafect) in a final volume of 100 uL at 810.sup.4 to 1.210.sup.3 cells/mL. The supernantants or cells were collected after 48 hours of incubation for functional tests. The efficiency of gene silencing by siRNAs was confirmed by quantitative RT-PCR using TaqMan) Gene Expression Cells-to-CT Kit (Ambion).
[0392] 6.1.2 IL-23 Modulation Assay
[0393] PBMCs were collected from fresh buffy coat by Ficoll gradient centrifugation of the buffy coat at 300 g for 30 minutes. The layer containing PBMCs was removed, washed three times and counted.
[0394] The prepared PBMCs were diluted to 110/ml in RPMI-10% FBS complete media, supplemented with 10 ng/ml LPS. The supernatants were removed from the culture plate containing PDACs, and 200 microliters of the PBMC suspension was added to each well. After incubation at 37 C. overnight, the supernatants were collected for quantification of IL-23. The production of IL-23 was determined by IL-23 ELISA (eBioscience 88-7239) following the manufacturer's protocol.
[0395] Results siRNAs against six HNR genes (see Table 7) increased PDAC suppression of IL-23 production by PBMCs. The sequence and respective target for each siRNA are listed in Table 1. As shown in
TABLE-US-00012 TABLE 7 siRNAs against six HNR genes enhanced PDAC suppression of IL-23 production by PBMCs in the presence of enhanced placental stem cells ID# Symbol Description Entrez Gene Name Location Family D3 VDR vitamin D (1,25- vitamin D (1,25- Nucleus ligand- dihydroxyvitamin D3) dihydroxyvitamin D3) dependent receptor receptor nuclear receptor D4 NR4A3 nuclear receptor nuclear receptor Nucleus ligand- subfamily 4, group A, subfamily 4, group A, dependent member 3 member 3 nuclear receptor D5 NR0B2 nuclear receptor nuclear receptor Nucleus ligand- subfamily 0, group B, subfamily 0, group B, dependent member 2 member 2 nuclear receptor D6 NR1I2 nuclear receptor nuclear receptor Nucleus ligand- subfamily 1, group I, subfamily 1, group I, dependent member 2 member 2 nuclear receptor E1 NR1H3 nuclear receptor nuclear receptor Nucleus ligand- subfamily 1, group H, subfamily 1, group H, dependent member 3 member 3 nuclear receptor E2 DNTTIP1 deoxynucleotidyltransferase, deoxynucleotidyltransferase, Nucleus ligand- terminal, interacting terminal, interacting dependent protein 1 protein 1 nuclear receptor
[0396] In a confirmation study, siRNAs targeting VDR, NR4A3, or NR1H3 showed more than 50% gene silencing, and siRNAs against DNTTIP1 showed 95% of gene silencing, as determined by a quantitative RT-PCR analysis (see
6.2 Example 2
PDACs Transfected with Anti-MIRS Increased IL-1 Beta-Induced PGE2 Production
[0397] 6.2.1 Transfection of PDACs and PDAC Functional Assays
[0398] The example demonstrates that placental stem cells transfected with microRNA inhibitors of specific placental stem cell microRNAs increased prostaglandin-2 production by the placental stem cells upon induction by interferon-beta.
[0399] Reagents Anti-miR miRNA Precursor Library Human V13 (Ambion AM17005); siPort Amine (Ambion AM4502); Recombinant Human IL-1B (Peprotech AF-200-01B); PGE2 ELISA Kit (R&D Systems SKG004B)
[0400] CD34.sup.+, CD10.sup.+, CD105.sup.+, CD200.sup.+, tissue culture plastic-adherent placental stem cells were thawed out in an equal volume of medium w/out antibiotics, and centrifuged at 400g for 5 minutes. The supernatant was discarded and cells were resuspended in medium w/out antibiotics to 510.sup.5/mL. Cells were then counted by Trypan Blue staining. The density of cells was adjusted with media w/out antibiotics to 3,500 cells per 80 L (43.75 cells/L), 80 L of cells was dispensed into each well of a 96-well flat bottom plate using a liquid handling system. Cells were then incubated at 37 C. for 24 hrs. The transfections of the placental stem cells with Anti-miR inhibitors were set up in a 96-well plate, and were performed by direct or reverse transfection using 0.6% siPORT Amine transfection reagent (Ambion) in a final volume of 100 uL for 24 hours with 3,000 to 3,500 cells per well, 1 ng/mL of IL-1 (recombinant human IL-1,) was then added to the cells for another 24 hours.
[0401] The supernatants were collected for PGE2 assay following manufacturer's protocol. The IL-23 modulation assay was performed with PBMCs following the protocol as in Example 2.
[0402] Results The change in suppression of IL-23 protein produced by PBMCs in the presence of enhanced placental stem cells is summarized in Table 8 (the p value is noted as 0 when the value was less than 0.001). The percent suppression of IL-23 was calculated as follows: % suppression=((PBMC alone)(PBMC+PDAC))/(PBMC alone)*100. The amount of IL-23 production from PBMC was around 2000 pg/mL.
TABLE-US-00013 TABLE8 ChangeinsuppressionofsolubleIL-23proteinproducedbyPBMCs inthepresenceofenhancedplacentalstelcellsbymiRinhibitors Changevs. SEQ AvgIL-23 ID TargetmiR suppression pValue SequenceofInhibitor NO. hsa-miR-183 -38.25% 0 UAUGGCACUGGUAGAAUUCACU 15 hsa-miR-491-5p -36.41% 0.188 AGUGGGGAACCCUUCCAUGAGG 16 hsa-miR-132* -31.57% 0.107 ACCGUGGCUUUCGAUUGUUACU 17 hsa-miR-129-5p -29.85% 0 CUUUUUGCGGUCUGGGCUUGC 18 hsa-miR-636 -28.23% 0.006 UGUGCUUGCUCGUCCCGCCCGCA 19 hsa-miR-100 -25.71% 0.002 AACCCGUAGAUCCGAACUUGUG 20 hsa-miR-181a -25.54% 0 AACAUUCAACGCUGUCGGUGAGU 21 hsa-miR-519a -24.20% 0.028 AAAGUGCAUCCUUUUAGAGUGU 22 hsa-miR-338-3p -23.27% 0 UCCAGCAUCAGUGAUUUUGUUG 23 hsa-miR-1179 -23.25% 0.102 AAGCAUUCUUUCAUUGGUUGG 24 hsa-miR-521 -20.59% 0.017 AACGCACUUCCCUUUAGAGUGU 25 hsa-miR-621 -20.25% 0.001 GGCUAGCAACAGCGCUUACCU 26 hsa-miR-1306 -20.12% 0.054 ACGUUGGCUCUGGUGGUG 27 hsa-miR-543 -19.91% 0.062 AAACAUUCGCGGUGCACUUCUU 28 hsa-miR-542-3p -19.49% 0 UGUGACAGAUUGAUAACUGAAA 29 hsa-miR-23b -17.07% 0.001 AUCACAUUGCCAGGGAUUACC 30 hsa-miR-299-3p -15.30% 0.052 UAUGUGGGAUGGUAAACCGCUU 31 hsa-miR-597 -15.13% 0.096 UGUGUCACUCGAUGACCACUGU 32 hsa-miR-1976 -14.70% 0.001 CCUCCUGCCCUCCUUGCUGU 33 hsa-miR-1252 -14.14% 0 AGAAGGAAAUUGAAUUCAUUUA 34 hsa-miR-510 -14.13% 0.082 UACUCAGGAGAGUGGCAAUCAC 35 hsa-miR-1207-5p -13.42% 0.012 UGGCAGGGAGGCUGGGAGGGG 36 hsa-miR-518a-3p -13.16% 0 GAAAGCGCUUCCCUUUGCUGGA 37 hsa-miR-1250 -13.01% 0 ACGGUGCUGGAUGUGGCCUUU 38 hsa-miR-1274a -12.79% 0 GUCCCUGUUCAGGCGCCA 39 hsa-miR-141* -12.58% 0.064 CAUCUUCCAGUACAGUGUUGGA 40 hsa-miR-9* -12.58% 0.05 AUAAAGCUAGAUAACCGAAAGU 41 hsa-miR-566 -12.38% 0 GGGCGCCUGUGAUCCCAAC 42 hsa-miR-142-5p -12.13% 0.027 CAUAAAGUAGAAAGCACUACU 43 hsa-miR-23* -12.13% 0 GGGGUUCCUGGGGAUGGGAUUU 44 hsa-miR-519e* -11.75% 0.012 UUCUCCAAAAGGGAGCACUUUC 45 hsa-miR-1292 -11.64% 0 UGGGAACGGGUUCCGCAGACGCUG 46 hsa-miR-96 -11.63% 0.037 UUUGGCACUAGCACAUUUUUGCU 47 hsa-miR-886-3p -10.25% 0 CGCGGGUGCUUACUGACCCUU 48 hsa-miR-216b -10.10% 0.028 AAAUCUCUGCAGGCAAAUGUGA 49 hsa-miR-218-2* -9.93% 0.005 CAUGGUUCUGUCAAGCACCGCG 50 hsa-miR-182 -9.73% 0 UUUGGCAAUGGUAGAACUCACACU 51 hsa-miR-545* -9.48% 0 UCAGUAAAUGUUUAUUAGAUGA 52 hsa-miR-517a -9.19% 0 AUCGUGCAUCCCUUUAGAGUGU 53 hsa-miR-541* -9.07% 0 AAAGGAUUCUGCUGUCGGUCCCA 54 CU hsa-miR-1293 -8.70% 0.014 UGGGUGGUCUGGAGAUUUGUGC 55 hsa-miR-339-5p -8.45% 0 UCCCUGUCCUCCAGGAGCUCACG 56 hsa-miR-494 -7.33% 0 UGAAACAUACACGGGAAACCUC 57 hsa-miR-196a* -5.65% 0 CGGCAACAAGAAACUGCCUGAG 58 hsa-miR-371-5p 7.34% 0 ACUCAAACUGUGGGGGCACU 59 hsa-miR-136* 7.80% 0.049 CAUCAUCGUCUCAAAUGAGUCU 60 hsa-miR-214 7.89% 0.032 ACAGCAGGCACAGACAGGCAGU 61 hsa-miR-25* 8.05% 0 AGGCGGAGACUUGGCAAUUG 62 hsa-miR-452* 8.94% 0 CUCAUCUGCAAAGAAGUAAGUG 63 hsa-miR-454* 11.04% 0 ACCCUAUCAAUAUUGUCUCUGC 64 hsa-miR-548b-5p 11.12% 0 AAAAGUAAUUGUGGUUUUGGCC 65 hsa-miR-10b* 11.17% 0.001 ACAGAUUCGAUUCUAGGGGAAU 66 hsa-miR-218 11.19% 0 UUGUGCUUGAUCUAACCAUGU 67 hsa-miR-548m 11.28% 0 CAAAGGUAUUUGUGGUUUUUG 68 hsa-miR-520a-3p 11.96% 0.009 AAAGUGCUUCCCUUUGGACUGU 69 hsa-miR-1323 12.29% 0.097 70 hsa-miR-24-2* 12.67% 0 UGCCUACUGAGCUGAAACACAG 71 hsa-miR-613 13.16% 0.171 AGGAAUGUUCCUUCUUUGCC 72 hsa-miR-26a 13.28% 0.009 UUCAAGUAAUCCAGGAUAGGCU 73 hsa-miR-193a-3p 14.34% 0 AACUGGCCUACAAAGUCCCAGU 74 hsa-miR-1208 14.43% 0.152 UCACUGUUCAGACAGGCGGA 75 hsa-miR-767-5p 15.47% 0 UGCACCAUGGUUGUCUGAGCAUG 76 hsa-miR-491-3p 16.08% 0.119 CUUAUGCAAGAUUCCCUUCUAC 77 hsa-miR-626 16.14% 0 AGCUGUCUGAAAAUGUCUU 78 hsa-miR-216a 16.79% 0.009 UAAUCUCAGUGGCAAUGUGA 79 hsa-miR-635 18.39% 0.013 ACUUGGGCACUGAAACAAUGUCC 80 hsa-miR-1282 19.20% 0.011 UCGUUUGCCUUUUUCUGCUU 81 hsa-miR-497* 20.94% 0 CAAACCACACUGUGGUGUUAGA 82 hsa-miR-129-3p 28.54% 0.089 AAGCCCUUACCCCAAAAAGCAU 83
[0403] The change of PGE2 production in enhanced placental stem cells by miR inhibitors is summarized in Table 9. The change is expressed as % compared to negative control (p Value is noted as 0 when the value was less than 0.001).
TABLE-US-00014 TABLE9 ChangeofPGE2productioninenhancedplacentalstemcellsbymiR inhibitors ChangeinPGE2 production (Comparedto SEQ Negative ID TargetmiR control) pValue SequenceofInhibitor NO hsa-miR-886-3p -97.06 0 CGCGGGUGCUUACUGACCCUU 48 hsa-miR-371-3p -97.00 0 AAGUGCCGCCAUCUUUUGAGUGU 84 hsa-miR-25* -96.69 0 AGGCGGAGACUUGGGCAAUUG 62 hsa-miR-376c -96.23 0 AACAUAGAGGAAAUUCCACGU 85 hsa-miR-888 -94.55 0 UACUCAAAAAGCUGUCAGUCA 86 hsa-miR-517b -56.00 0 UCGUGCAUCCCUUUAGAGUGUU 87 hsa-miR-433 -54.45 0.013 AUCAUGAUGGGCUCCUCGGUGU 88 hsa-miR-200a* -54.17 0 CAUCUUACCGGACAGUGCUGGA 89 hsa-miR-520a-5p -51.23 0 CUCCAGAGGGAAGUACUUUCU 90 hsa-miR-1286 -48.41 0 UGCAGGACCAAGAUGAGCCCU 91 hsa-miR-182* -47.87 0 UGGUUCUAGACUUGCCAACUA 92 hsa-miR-1273 -45.38 0.014 GGGCGACAAAGCAAGACUCUUUC 93 UU hsa-miR-1280 -44.48 0.014 UCCCACCGCUGCCACCC 94 hsa-miR-563 -43.55 0.001 AGGUUGACAUACGUUUCCC 95 hsa-miR-501-5p -42.56 0 AAUCCUUUGUCCCUGGGUGAGA 96 hsa-miR-448 -40.98 0.04 UUGCAUAUGUAGGAUGUCCCAU 97 hsa-miR-485-3p -39.62 0 GUCAUACACGGCUCUCCUCUCU 98 hsa-miR-29c -39.62 0 UAGCACCAUUUGAAAUCGGUUA 99 hsa-miR-548f -36.65 0.043 AAAAACUGUAAUUACUUUU 100 hsa-miR-1248 -36.62 0 ACCUUCUUGUAUAAGCACUGUGCU 101 AAA hsa-miR-7d* -35.72 0 CUAUACGACCUGCUGCCUUUCU 102 hsa-miR-618 -34.90 0 AAACUCUACUUGUCCUUCUGAGU 103 hsa-miR-30c -4.74 0 UGUAAACAUCCUACACUCUCAGC 104 hsa-miR-136 -34.50 0 ACUCCAUUUGUUUUGAUGAUGGA 105 hsa-miR-181a -33.46 0 AACAUUCAACGCUGUCGGUGAGU 152 hsa-miR-26a -32.94 0 UUCAAGUAAUCCAGGAUAGGCU 73 hsa-miR-10a -32.56 0.012 UACCCUGUAGAUCCGAAUUUGUG 106 hsa-miR-557 -32.47 0 GUUUGCACGGGUGGGCCUUGUCU 107 hsa-miR-564 -32.27 0.013 AGGCACGGUGUCAGCAGGC 108 hsa-miR-520g -31.72 0 ACAAAGUGCUUCCCUUUAGAGUGU 109 hsa-miR-122* -31.69 0.002 AACGCCAUUAUCACACUAAAUA 110 hsa-miR-548k -31.59 0 AAAAGUACUUGCGGAUUUUGCU 111 hsa-miR-423-3p -31.29 0.002 AGCUCGGUCUGAGGCCCCUCAGU 112 hsa-miR-548j -30.77 0 AAAAGUAAUUGCGGUCUUUGGU 113 hsa-miR-340* -30.59 0 UCCGUCUCAGUUACUUUAUAGC 114 hsa-miR-573 -30.58 0.035 CUGAAGUGAUGUGUAACUGAUCAG 115 hsa-miR-548i -29.80 0.003 AAAAGUAAUUGCGGAUUUUGCC 116 hsa-miR-555 -29.54 0.001 AGGGUAAGCUGAACCUCUGAU 117 hsa-miR-144 -29.49 0.001 UACAGUAUAGAUGAUGUACU 118 hsa-miR-567 -29.37 0.003 AGUAUGUUCUUCCAGGACAGAAC 119 hsa-miR-191* -29.11 0.001 GCUGCGCUUGGAUUUCGUCCCC 120 hsa-miR-566 -28.90 0.001 GGGCGCCUGUGAUCCCAAC 42 hsa-miR-335 -28.84 0.005 UCAAGAGCAAUAACGAAAAAUGU 121 hsa-miR-126* -28.72 0.046 CAUUAUUACUUUUGGUACGCG 122 hsa-miR-22* -28.42 0.001 AGUUCUUCAGUGGCAAGCUUUA 123 hsa-miR-572 -28.18 0.001 GUCCGCUCGGCGGUGGCCCA 124 hsa-miR-517c -28.01 0.001 AUCGUGCAUCCUUUUAGAGUGU 125 hsa-miR-380* -27.92 0.015 UGGUUGACCAUAGAACAUGCGC 126 hsa-miR-106a* -27.76 0.031 CUGCAAUGUAAGCACUUCUUAC 127 hsa-miR-519c -27.53 0.004 AAGUGCCUCCUUUUAGAGUGUU 128 hsa-miR-520c-3p -27.18 0.004 AAAGUGCUUCCUUUUAGAGGGU 129 hsa-miR-517* -26.66 0.001 CCUCUAGAUGGAAGCACUGUCU 130 hsa-miR-432* -26.47 0.039 CUGGAUGGCUCCUCCAUGUCU 131 hsa-miR-520e -26.07 0.002 AAAGUGUUCCUUUUUGAGGG 132 hsa-miR-9* -26.00 0 AUAAAGCUAGAUAACCGAAAGU 41 hsa-miR-551a -25.73 0.006 GCGACCCACUCUUGGUUUCCA 133 hsa-miR-1471 -25.54 0 GCCCGCGUGUGGAGCCAGGUGU 134 hsa-miR-613 -25.30 0.012 AGGAAUGUUCCUUCUUUGCC 72 hsa-miR-562 -25.28 0.002 AAAGUAGCUGUACCAUUUGC 135 hsa-miR-922 -25.02 0.001 GCAGCAGAGAAUAGGACUACGUC 136 hsa-miR-216a -24.79 0.022 UAAUCUCAGCUGGCAACUGUGA 79 hsa-miR-499-5p -24.37 0.023 UUAAGACUUGCCAGUGAUGUUU 137 hsa-miR-25 -24.08 0.002 CAUUGCACUUGUCUCGGUCUGA 138 hsa-miR-197 -23.77 0.018 UUCACCACCUUCUCCACCCAGC 139 hsa-miR-500* -23.41 0.003 AUGCACCUGGGCAAGGAUUCUG 140 hsa-miR-365* -23.05 0 AGGGACUUUCAGGGGCAGCUGU 141 hsa-miR-1247 -22.96 0.022 ACCGUCCCGUUCGUCCCCGGA 142 hsa-miR-586 -22.75 0.003 UAUGCAUUGUAUUUUUAGGUCC 143 hsa-miR-548d-3p -22.71 0.003 CAAAAACCACAGUUUCUUUUGC 144 hsa-miR-27a* -22.68 0.005 AGGGCUUAGCUGCUUGUGAGCA 145 hsa-miR-598 -22.54 0.026 UACGUCAUCGUUGUCAUCGUCA 146 hsa-miR-609 -22.43 0.006 AGGGUGUUUCUCUCAUCUCU 147 hsa-miR-132 -22.04 0.004 UAACAGUCUACAGCCAUGGUCG 148 hsa-miR-411* -21.97 0 UAUGUAACACGGUCCACUAACC 149 hsa-miR-135a -21.85 0.004 UAUGGCUUUUUAUUCCUAUGUGA 150 hsa-miR-31 -21.83 0.004 AGGCAAGAUGCUGGCAUAGCU 151 hsa-miR-181a* -21.81 0.004 ACCAUCGACCGUUGAUUGUACC 152 hsa-miR-1245 -21.74 0 AAGUGAUCUAAAGGCCUACAU 153 hsa-miR-758 -21.26 0.005 UUUGUGACCUGGUCCACUAACC 154 hsa-miR-924 -21.22 0.001 AGAGUCUUGUGAUGUCUUGC 155 hsa-miR-1246 -21.19 0.015 AAUGGAUUUUUGGAGCAGG 156 hsa-miR-23b -21.16 0.005 AUCACAUUGCCAGGGAUUACC 30 hsa-miR-631 -20.40 0.006 AGACCUGGCCCAGACCUCAGC 157 hsa-miR-1 -20.21 0.006 UGGAAUGUAAAGAAGUAUGUAU 158 hsa-miR-920 -20.00 0 GGGGAGCUGUGGAAGCAGUA 159 hsa-miR-589* -19.95 0.006 UCAGAACAAUGCCGGUUCCCAGA 160 hsa-miR-638 -19.86 0.006 AGGGAUCGCGGGCGGGUGGCGGC 161 CU hsa-miR-1244 -19.85 0 AAGUAGUUGGUUUGUAUGAGAUG 162 GUU hsa-miR-328 -19.71 0.047 CUGGCCCUCUCUGCCCUUCCGU 163 hsa-miR-7i -19.65 0.007 UGAGGUAGUAGUUUGUGCUGUU 164 hsa-miR-429 -19.45 0.036 UAAUACUGUCUGGUAAAACCGU 165 hsa-miR-380 -19.40 0.007 UAUGUAAUAUGGUCCACAUCUU 166 hsa-miR-7b* -19.15 0.01 CUAUACAACCUACUGCCUUCCC 167 hsa-miR-614 -18.73 0.009 GAACGCCUGUUCUUGCCAGGUGG 168 hsa-miR-1225-5p -18.71 0.002 GUGGGUACGGCCCAGUGGGGGG 169 hsa-miR-545* -18.55 0.036 UCAGUAAAUGUUUAUUAGAUGA 52 hsa-miR-320c -18.15 0.003 AAAAGCUGGGUUGAGAGGGU 170 hsa-miR-579 -18.12 0.01 UUCAUUUGGUAUAAACCGCGAUU 171 hsa-miR-1282 -18.01 0.05 UCGUUUGCCUUUUUCUGCUU 81 hsa-miR-455-5p -17.12 0.015 UAUGUGCCUUUGGACUACAUCG 172 hsa-miR-615-3p -16.81 0.014 UCCGAGCCUGGGUCUCCCUCUU 173 hsa-miR-606 -16.72 0.015 AAACUACUGAAAAUCAAAGAU 174 hsa-miR-559 -16.52 0.015 UAAAGUAAAUAUGCACCAAAA 175 hsa-miR-571 -16.09 0.037 UGAGUUGGCCAUCUGAGUGAG 176 hsa-miR-191 -15.73 0.031 CAACGGAAUCCCAAAAGCAGCUG 177 hsa-miR-187 -15.63 0.028 UCGUGUCUUGUGUUGCAGCCGG 178 hsa-miR-29b -15.39 0.021 UAGCACCAUUUGAAAUCAGUGUU 179 hsa-miR-769-5p -15.12 0.042 UGAGACCUCUGGGUUCUGAGCU 180 hsa-miR-640 16.81 0.015 AUGAUCCAGGAACCUGCCUCU 181 hsa-miR-516a-3p 17.46 0.017 UGCUUCCUUUCAGAGGGU 182 hsa-miR-938 17.60 0.012 UGCCCUUAAAGGUGAACCCAGU 183 hsa-miR-936 18.04 0.015 ACAGUAGAGGGAGGAAUCGCAG 184 hsa-miR-373* 18.18 0.01 ACUCAAAAUGGGGGCGCUUUCC 185 hsa-miR-1184 18.26 0.018 CCUGCAGCGACUUGAUGGCUUCC 186 hsa-miR-122 18.47 0.009 UGGAGUGUGACAAUGGUGUUUG 187 hsa-miR-208b 18.98 0.002 AUAAGACGAACAAAAGGUUUGU 188 hsa-miR-223* 19.15 0.025 CGUGUAUUUGACAAGCUGAGUU 189 hsa-miR-1972 19.20 0.018 UCAGGCCAGGCACAGUGGCUCA 190 hsa-miR-520h 19.70 0.008 ACAAAGUGCUUCCCUUUAGAGU 191 hsa-miR-330-3p 19.73 0.01 GCAAAGCACACGGCCUGCAGAGA 192 hsa-miR-149 20.79 0 UCUGGCUCCGUGUCUUCACUCCC 193 hsa-miR-7 21.30 0.005 UGGAAGACUAGUGAUUUUGUUGU 194 hsa-miR-29b-2* 22.10 0 CUGGUUUCACAUGGUGGCUUAG 195 hsa-miR-520d-5p 22.16 0 CUACAAAGGGAAGCCCUUUC 196 hsa-miR-592 22.23 0.004 UUGUGUCAAUAUGCGAUGAUGU 197 hsa-miR-940 22.50 0.004 AAGGCAGGGCCCCCGCUCCCC 198 hsa-miR-146b-3p 22.58 0.003 UGCCCUGUGGACUCAGUUCUGG 199 hsa-miR-518e* 23.08 0.004 CUCUAGAGGGAAGCGUUUCUG 200 hsa-miR-1255a 23.32 0 AGGAUGAGCAAAGAAAGUAGAUU 201 hsa-miR-935 25.52 0 CCAGUUACCGCUUCCGCUACCGC 202 hsa-miR-633 25.97 0.004 CUAAUAGUAUCUACCACAAUAAA 203 hsa-miR-513a-5p 26.20 0.008 UUCACAGGGAGGUGUCAU 204 hsa-miR-361-3p 26.53 0.001 UCCCCCAGGUGUGAUUCUGAUUU 205 hsa-miR-194 26.62 0.017 UGUAACAGCAACUCCAUGUGGA 206 hsa-miR-1185 26.72 0 AGAGGAUACCCUUUGUAUGUU 207 hsa-miR-875-3p 27.12 0.044 CCUGGAAACACUGAGGUUGUG 208 hsa-miR-200a 27.36 0.002 UAACACUGUCUGGUAACGAUGU 209 hsa-miR-1201 27.67 0.002 AGCCCUGAUUAAACACAUGCUCU 210 GA hsa-miR-629 28.98 0 UGGGUUUACGUUGGGAGAACU 211 hsa-miR-139-5p 29.02 0 UCUACAGUGCACGUGUCUCCAG 212 hsa-miR-504 30.84 0.04 AGACCCUGGUCUGCACUCUAUC 213 hsa-miR-452 31.32 0 AACUGUUUGCAGAGGAAACUGA 214 hsa-miR-517a 32.41 0 AUCGUGCAUCCCUUUAGAGUGU 53 hsa-miR-543 33.29 0 AAACAUUCGCGGUGCACUUCUU 28 hsa-miR-616* 33.83 0.024 ACUCAAAACCCUUCAGUGACUU 215 hsa-miR-651 34.09 0.024 UUUAGGAUAAGCUUGACUUUUG 216 hsa-miR-1254 35.96 0 AGCCUGGAAGCUGGAGCCUGCAGU 217 hsa-miR-339-3p 37.00 0.007 UGAGCGCCUCGACGACAGAGCCG 218 hsa-miR-510 37.14 0 UACUCAGGAGAGUGGCAAUCAC 35 hsa-miR-181c* 39.58 0 AACCAUCGACCGUUGAGUGGAC 219 hsa-miR-19b-1* 40.92 0.001 AGUUUUGCAGGUUUGCAUCCAGC 220 hsa-miR-1274a 42.43 0 GUCCCUGUUCAGGCGCCA 39 hsa-miR-1294 42.66 0.006 UGUGAGGUUGGCAUUGUUGUCU 221 hsa-miR-1306 43.90 0 ACGUUGGCUCUGGUGGUG 27 hsa-miR-1226* 44.07 0.019 GUGAGGGCAUGCAGGCCUGGAUGG 222 GG hsa-miR-541* 48.09 0.042 AAAGGAUUCUGCUGUCGGUCCCACU 54
6.3 Example 3
Mouse EAE Model for Testing Enhanced Placental Stem Cells
[0404] The immunosuppressive effect of ePSCs treated with modulatory RNA molecules such as siRNAs that confer additional immunosuppressive activity to the ePSCs, as compared to an equivalent number of unmodified placental stein cells, is assessed. e.g., using a murine experimental autoimmune encephalomyelitis (EAE) model for multiple sclerosis.
[0405] In a proof-of-concept study, C57B16 mice are separated into four groups of eight mice each.
[0406] Group 1 mice receive 1.510.sup.6 placental stem cells (unmodified) at Day 0, 6 hours after inoculation with a fragment of monocyte-oligodendrocyte glycoprotein amino acids 35-55 (MOG.sub.35-55, sequence MEVGWYRSPFSRVVHLYRNGK (SEQ ID NO: 223)) in an amount previously determined to induce onset of EAE.
[0407] Group 2 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 1 and 2, at Day 6, prior to onset of symptoms.
[0408] Group 3 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 1 and 2 at Day 11 or Day 12, after early onset of EAE symptoms.
[0409] Group 4 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 3 and 4, at Day 6, prior to onset of symptoms.
[0410] Group 5 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 3 and 4 at Day 11 or Day 12, after early onset of EAE symptoms.
[0411] Group 6 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 5 and 6, at Day 6, prior to onset of symptoms.
[0412] Group 7 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 5 and 6 at Day 11 or Day 12, after early onset of EAE symptoms.
[0413] Group 8 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 7 and 8, at Day 6, prior to onset of symptoms.
[0414] Group 9 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 7 and 8 at Day 11 or Day 12, after early onset of EAE symptoms.
[0415] Group 10 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 9 and 10, at Day 6, prior to onset of symptoms.
[0416] Group 11 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 9 and 10 at Day 11 or Day 12, after early onset of EAE symptoms.
[0417] Group 12 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 11 and 12, at Day 6, prior to onset of symptoms.
[0418] Group 13 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 11 and 12 at Day 11 or Day 12, after early onset of EAE symptoms.
[0419] Group 14 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 13 and 14, at Day 6, prior to onset of symptoms.
[0420] Group 15 mice receive 1.510.sup.6 placental stem cells transfected with siRNAs comprising the sequences of SEQ ID NOS 13 and 14 at Day 11 or Day 12, after early onset of EAE symptoms.
[0421] Control Group 16 mice receive vehicle at Day 0, Day 6 and Day 12.
[0422] Control Group 17 mice receive no MOG.sub.35-55.
[0423] The immunosuppressive activity of the ePSCs (Groups 2-15) can be measured by the abrogation of symptom development in comparison with Groups 1, 16 and 17.
6.4 Example 4
Down-Regulation of VDR and NR4A3 in Placental Stem Cells Showed Enhanced Suppression of IL-23 Produced by PBMCS
[0424] This example demonstrates suppression of peripheral blood mononuclear cell (PBMC) 11-23 production by enhanced placental stem cells (ePSCs) treated with short hairpin RNA (shRNA) targeting vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR) or nuclear receptor subfamily 4, group A, member 3 (NR4A3) genes.
[0425] IL-23 assay: Freshly isolated PBMCs from buffy coat were stimulated with LPS at 10 ng/ml for overnight at 37 C. and added to pre-attached PDACs in the plate for co-culture overnight. IL-23 in the culture supernatant was measured by IL-23 ELISA kit (eBioscience) following the manufacturer's protocol. The percent Suppression (see Tables 9 and 10) was calculated as follows: % suppression=(LPS-treated PBMCsPDAC:PBMCs co-culture)/LPS-treated PBMCs*100%.
[0426] Viral transduction in PDACs: Early passage (P2) CD10.sup.+, CD34.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells were thawed and plated at a density of 4,000 cells/cm2 in DMEM media supplemented with 10% FBS in a 100 mm cell culture dish. The next day the media was removed and the viral particles were added at 25-50 MOI in serum-free and antibiotics-free media supplemented with Polybrene (0.6 g/ml) in a total volume of 3 mL. After 4 hours of incubation (37 C. 5% CO.sub.2), 12 ml, of complete media was added to the culture dish. The media was replaced with DMEM media supplemented with 10% FBS and Puromycin (1.0 g/mL) after 24-48 hours of incubation. The culture was checked every 2-3 days for confluence to collect cells in the next passage (P3) when the culture reached confluency, or to change the media with DMEM media supplemented with 10% FBS and Puromycin (1.0 g/mL).
[0427] The viral particles used in this study contain GIPZ lentiviral shRNAmir constructs from Open Biosystems with the following genes (or non-silencing control): non-Silencing Control (Cat# RHS4348, Lot EV16118, titer 3.69E8 tu/ml); targeting NR4A3 (Open Biosystems Cat#VGH5523-100994599. Lot HV111111, titer 2.84E8 tu/mL) or targeting VDR (Open Biosystems Cat#VGH5523-101070492. Lot KV121001, titer 2.50E8 tu/mL). The sequences for the shRNAmirs are listed in Table 9.
[0428] Results
[0429] Suppression of IL-23 produced by PBMC in the presence of enhanced placental stem cells is showed in Tables 11A-B. The gene silencing efficiency of both VDR and NR4A3 was >90% as compared to the non-targeting controls (NTP-shRNA or NTP2-shRNA).
TABLE-US-00015 TABLE10 DNAsequencesencodingshRNAmirs SEQID shRNAmirs Sequence NO. VDR: Harpin TCTGTTGACAGTGAGCGCCCG 224 v3LHS_337628 sequence CGTCAGTGACGTGACCAATAGT GAAGCCACAGATGTATTGGTCA CGTCACTGACGCGGTTGCCTAC TGCCTCGGA Mature CGCGTCAGTGACGTGACCA 225 Sense Sequence NR4A3: Harpin TGCTGTTGACAGTGAGCGACC 226 V3LHS_348138 sequence CAAAGAAGATCAGACATTAT AGTGAAGCCACAGATGTATAA TGTCTGATCTTCTTTGGGGTGC CTACTGCCTCGGA Mature CCAAAGAAGATCAGACATT 227 Sense Sequence
TABLE-US-00016 TABLE 11A Suppression of IL-23 produced by PBMC (from Donor #1) in the presence of enhanced placental stem cells Mean IL-23 Name #PDACs (pg/mL) Std Dev % Suppression LPS-treated 482 58.951 PBMCs PDACs 2500 cells 275 111 43% NTP2-shRNA 116 7 76% VDR-shRNA 33 1 93% PDACs 5000 cells 233 18 52% NTP2-shRNA 142 32 71% VDR-shRNA 36 1 92% PDACs 10000 cells 246 79 49% NTP2-shRNA 103 23 79% VDR-shRNA 30 11 94%
TABLE-US-00017 TABLE 11B Suppression of IL-23 produced by PBMC (from Donor #2) in the presence of enhanced placental stem cells Mean IL-23 Name #PDACs (pg/mL) Std Dev % Suppression LPS-treated 217.78 23.33 PBMCs PDACs 2000 cells 63.64 15.00 70.78% NTP-shRNA 68.97 7.72 68.33% NTP2-shRNA 35.54 4.25 83.68% NR4A3 shRNA 24.62 19.03 88.70% VDR-shRNA 30.68 6.95 85.91% PDACs 3000 cells 20.103 6.965 90.77% NTP-shRNA 16.521 16.65 92.41% NTP2-shRNA 9.509 8.444 95.63% NR4A3-shRNA 3.079 98.59% VDR-shRNA Below detection
6.5 Example 5
Modulation of IL-23 Production of LPS-Stimulated PBMCS in the Presence of PDACs
[0430] This example demonstrates that CD10.sup.+, CD34.sup.+, CD105.sup.+, CD200.sup.+ placental stem cells transfected with certain microRNA mimics showed enhanced suppression of IL-23 produced by LPS-stimulated PBMCs.
[0431] Briefly, PDACs were seeded on Day 0 at 3,000 cells/well in DMEM media +10% FBS without antibiotics. On Day 1, cells were transfected with 30 nM miR mimics using SiPort Amine Transfection Reagent (Ambion. Cat # AM4502) at a ratio of 1:2 of miR mimics:Amine Transfection Reagent (2 of the manufacturer's recommended concentration). On Day 2, the transfection media was removed and replaced with 10% FBS-RPMI media. On Day 3, the supernatants were collected and frozen for the IL-23 suppression assay and RNA was extracted from the modified cells. RNA (mRNA and miRNA) was extracted and purified using Ambion's mirVana miRNA Isolation Kit (Ambion. Cat #1566) and the Taqman MicroRNA Cells-to-Ct Kit (Ambion. Cat #4391848) according to manufacturer's recommended procedure, miR and target gene modification were evaluated using Taqman Expression Assays. For the IL-23 suppression assay, the supernatants were thawed and added to freshly isolated PBMCs from buffy coat that were stimulated with LPS at 10 ng/ml for overnight at 37 C. The IL-23 in the culture supernatant was measured by IL-23 ELISA kit from eBioscience. The percent Suppression of IL-23 (see Table 12) was calculated as follows: % suppression=(LPS-treated PBMCsPDAC:PBMCs co-culture)/LPS-treated PBMCs*100%. The negative control was calculated without the inclusion of outliers.
[0432] Results
[0433] The results are shown in Table 12. The transfection of placental stem cells with miR-1, miR-129-3p, miR-129-5p, miR-24, and miR-218 mimics resulted in successful knock-up of microRNAs (2.89-4,860 fold increase), knock-down of target genes (2.06-24.2% decrease in Twinfilin-1, NR4A3, and VDR), and augmentation of IL-23 suppression (13.5-18.4% absolute increase) with LPS-stimulated PBMCs. The transfection of placental stem cells with miR-24-1* and miR-21-1* also resulted in successful miR knock-up and IL-23 suppression augmentation. These results are consistent with the data of placental stein cells treated with miRNA inhibitors, which are summarized in Example 1, above.
TABLE-US-00018 TABLE12 SummaryofsuppressionofIL-23producedbyLPS-stimulatedPBMCsbyplacental stemcellstransfectedwithmicroRNAmimics AbsoluteChangein IL-23%Suppression (TestSuppresion%- qPCR CtlSuppression%) NR4A3/VDRKD MiRKnock-up miR SEQ Target Percent microRNA Mimicsvs. vs.Avg Mature ID Gene microRNA Decrease FoldChange NetCtl VehCtl sequenceoftargetmiR NO Twinfilin- hsa-miR-1 24.16 506.49 38.12 17.33 UGGAAUGUAAAGAAGUAUGUAU 228 1 hsa-miR-129-3p 18.86 4,860.00 34.33 13.54 AAGCCCUUACCCCAAAAAGCAU 83 hsa-miR-129-5p 2.06 3,810.12 37.77 16.98 CUUUUUGCGGUCUGGGCUUGC 18 hsa-miR-129* 24.15 953.05 19.19 -1.60 AAGCCCUUACCCCAAAAAGUAU 229 hsa-miR-24 17.32 2.89 38.78 17.99 UGGCUCAGUUCAGCAGGAACAG 230 hsa-miR-24-1* -31.04 613.79 39.82 19.03 UGCCUACUGAGCUGAUAUCAGU 231 hsa-miR-24-2* -30.12 341.95 16.01 -4.78 UGCCUACUGAGCUGAAACACAG 71 VDR hsa-miR-218 21.36 25.61 39.17 18.38 UUGUGCUUGAUCUAACCAUGU 67 hsa-miR-218-1* -9.04 14,009.81 25.42 4.63 AUGGUUCCGUCAAGCACCAUGG 232 hsa-miR-218-2* 11.98 171,905.48 -71.55 -92.34 CAUGGUUCUGUCAAGCACCGCG 50 hsa-miR-183 17.64 18,990.37 -228.11 -248.90 UAUGGCACUGGUAGAAUUCACU 233 hsa-miR-183* -6.51 1,758.84 -42.66 -63.48 GUGAAUUACCGAAGGGCCAUAA 234
EQUIVALENTS
[0434] The compositions and methods disclosed herein are not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the compositions and methods in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
[0435] Various publications, patents and patent applications are cited herein, the disclosures of which are incorporated by reference in their entireties.