DIETHER BASED BIODEGRADABLE CATIONIC LIPIDS FOR siRNA DELIVERY

20170001947 ยท 2017-01-05

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein are novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. The cationic lipids can demonstrate enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA.

Claims

1. A cationic lipid of Formula A: ##STR00097## wherein: R.sup.1 and R.sup.2 are independently selected from H, (C.sub.1-C.sub.6)alkyl, heterocyclyl, and polyamine, wherein said alkyl, heterocyclyl and polyamine are optionally substituted with one to three substituents selected from R; or R.sup.1 and R.sup.2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R; R.sup.5 is independently selected from (C.sub.4-C.sub.8)alkylene or (C.sub.4-C.sub.8)alkenylene, said alkylene or alkenylene optionally substituted with one to three substituents selected from R; R.sup.6 is (C.sub.1-C.sub.2)alkyl, said alkyl optionally substituted with one to three substituents selected from R; Q.sup.2 is a bond, OC(O), C(O)O, SC(O), C(O)S, OC(S), SS, C(R)N, NC(R), C(R)NO, ONC(R), C(O)(NR), N(R)C(O), C(S)(R), N(R)C(O), N(R)C(O)N(R), OC(O)O, OSi(R).sub.2O, C(O)(CR.sub.2)C(O)O, or OC(O)(CR.sub.2)C(O), with the proviso that when either Q.sup.1 or Q.sup.2 is a bond then the other is not a bond; each occurrence of R is independently selected from halogen, R, OR, SR, CN, CO.sub.2R or CON(R).sub.2; R is independently selected from H and (C.sub.1-C.sub.6)alkyl, wherein said alkyl is optionally substituted with halogen and OH; n is 0, 1, 2, 3, 4 or 5; and R.sup.3-Q.sup.1-R.sup.4 is selected from the group consisting of ##STR00098## or a pharmaceutically acceptable salt or stereoisomer thereof.

2. A cationic lipid of claim 1, wherein: R.sup.1 and R.sup.2 are each methyl; n is 0; R.sup.5 is independently selected from (C.sub.4-C.sub.8)alkylene and (C.sub.4-C.sub.8)alkenylene, said alkylene or alkenylene optionally substituted with one to three substituents selected from R; R.sup.6 is (C.sub.1-C.sub.2)alkyl, said alkyl optionally substituted with one to three substituents selected from R; Q.sup.2 is a bond or C(O)O; or a pharmaceutically acceptable salt or stereoisomer thereof.

3. A lipid nanoparticle comprising a cationic lipid of claim 1.

4. The lipid nanoparticle of claim 3, wherein the lipid particle comprises oligonucleotides.

5. The lipid nanoparticle of claim 4, wherein the oligonucleotides are siRNA.

6. A lipid nanoparticle comprising a cationic lipid of claim 1, cholesterol, DSPC and PEG-DMG.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0006] The various aspects and embodiments of the invention are directed to the utility of novel cationic lipids useful in lipid nanoparticles to deliver oligonucleotides, in particular, siRNA and miRNA, to any target gene. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US 2009/0285881 and PCT patent applications: WO 2009/086558, WO2009/127060, WO2009/132131, WO2010/042877, WO2010/054384, WO2010/054401, WO2010/054405, WO2010/054406, WO2011/153493, WO2011/143230, and US 2012/0027803). See also Semple S. C. et al., Rational design of cationic lipids for siRNA delivery, Nature Biotechnology, 2010, 28, 172-176.

[0007] The cationic lipids of the instant invention are useful components in a lipid nanoparticle for the delivery of oligonucleotides, specifically siRNA and miRNA.

[0008] In a first embodiment of this invention, the cationic lipids are illustrated by the Formula A:

##STR00001##

wherein:

[0009] R.sup.1 and R.sup.2 are independently selected from H, (C.sub.1-C.sub.6)alkyl, heterocyclyl, and polyamine, wherein said alkyl, heterocyclyl and polyamine are optionally substituted with one to three substituents selected from R, or R.sup.1 and R.sup.2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R;

[0010] R.sup.3 is independently selected from (C.sub.4-C.sub.20)alkyl and (C.sub.4-C.sub.20)alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R;

[0011] R.sup.4 is independently selected from (C.sub.1-C.sub.16)alkyl and (C.sub.1-C.sub.6)alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R;

[0012] R.sup.5 is independently selected from (C.sub.4-C.sub.8)alkyl and (C.sub.4-C.sub.8)alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R;

[0013] R.sup.6 is in (C.sub.1-C.sub.2)alkyl, said alkyl optionally substituted with one to three substituents selected from R;

[0014] Q.sup.1 and Q.sup.2 are each, independently, a bond, OC(O), C(O)O, SC(O), C(O)S, OC(S), SS, C(R)N, NC(R), C(R)NO, ONC(R), C(O)(NR), N(R)C(O), C(S)(NR), N(R)C(O), N(R)C(O)N(R), OC(O)O, OSi(R).sub.2O, C(O)(CR.sub.2)C(O)O, or OC(O)(CR.sub.2)C(O)), with the proviso that when either Q.sup.1 or Q.sup.2 is a bond then the other is not a bond;

[0015] Each occurrence of R is independently selected from halogen, R, OR, SR, CN, CO.sub.2R or CON(R).sub.2;

[0016] R is independently selected from H and (C.sub.1-C.sub.6)alkyl, wherein said alkyl is optionally substituted with halogen and OH;

[0017] n is 0, 1, 2, 3, 4 or 5;

[0018] or any pharmaceutically acceptable salt or stereoisomer thereof.

[0019] In a second embodiment, the invention features a compound having Formula A, wherein:

[0020] R.sup.1 and R.sup.2 are each methyl;

[0021] n is 0;

[0022] R.sup.3 is independently selected from (C.sub.4-C.sub.20)alkyl and (C.sub.4-C.sub.20)alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R;

[0023] R.sup.4 is independently selected from (C.sub.1-C.sub.16)alkyl and (C.sub.1-C.sub.16)alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R;

[0024] R.sup.5 is independently selected from (C.sub.4-C.sub.8)alkyl and (C.sub.4-C.sub.8)alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R;

[0025] R.sup.6 is (C.sub.1-C.sub.2)alkyl, said alkyl optionally substituted with one to three substituents selected from R;

[0026] Q.sup.1 and Q.sup.2 are each, independently, a bond or C(O)O, with the proviso that when either Q.sup.1 or Q.sup.2 is a bond then the other is not a bond;

[0027] or any pharmaceutically acceptable salt or stereoisomer thereof.

[0028] Specific cationic lipids are: [0029] (Z)-methyl 17-(2-(dimethylamino)-3-(octyloxy)propoxy)heptadec-8-enoate (Compound 1); [0030] methyl 7-(2-(8-(2-(dimethylamino)-3-(octyloxy)propoxy)octyl)cyclopropyl)heptanoate (Compound 2); [0031] (Z)-methyl 16-(2-(dimethylamino)-3-(hexyloxy)propoxy)hexadec-7-enoate (Compound 3); [0032] (Z)-methyl 16-(2-(dimethylamino)-3-(heptyloxy)propoxy)hexadec-7-enoate (Compound 4); [0033] (Z)-methyl 16-(2-(dimethylamino)-3-(nonyloxy)propoxy)hexadec-7-enoate (Compound 5); [0034] (Z)-methyl 16-(3-(decyloxy)-2-(dimethylamino)propoxy)hexadec-7-enoate (Compound 6); [0035] methyl 6-(2-(8-(2-(dimethylamino)-3-(hexyloxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 7); [0036] methyl 6-(2-(8-(2-(dimethylamino)-3-(heptyloxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 8); [0037] methyl 6-(2-(8-(2-(dimethylamino)-3-(nonyloxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 9); [0038] methyl 6-(2-(8-(3-(decyloxy)-2-(dimethylamino)propoxy)octyl)cyclopropyl)hexanoate (Compound 10); [0039] (Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-(octyloxy)propoxy)hexanoate (Compound 11); [0040] (2-octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-(octyloxy)propoxy)hexanoate (Compound 12); [0041] (Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-(hexyloxy)propoxy)hexanoate (Compound 13); [0042] (Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-(heptyloxy)propoxy)hexanoate (Compound 14); [0043] (Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-(nonyloxy)propoxy)hexanoate (Compound 15); [0044] (Z)-undec-2-en-1-yl 6-(3-(decyloxy)-2-(dimethylamino)propoxy)hexanoate (Compound 16); [0045] (2-octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-(hexyloxy)propoxy)hexanoate (Compound 17); [0046] (2-octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-(heptyloxy)propoxy)hexanoate (Compound 18); [0047] (2-octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-(nonyloxy)propoxy)hexanoate (Compound 19); [0048] (2-octylcyclopropyl)methyl 6-(3-(decyloxy)-2-(dimethylamino)propoxy)hexanoate (Compound 20); [0049] (Z)-methyl 6-(2-(dimethylamino)-3-(octadec-9-en-1-yloxy)propoxy)hexanoate (Compound 21); [0050] methyl 6-(2-(dimethylamino)-3-((8-(2-octylcyclopropyl)octyl)oxy)propoxy)hexanoate (Compound 22); [0051] (Z)-methyl 4-(2-(dimethylamino)-3-(octadec-9-en-1-yloxy)propoxy)butanoate (Compound 23); [0052] (Z)-methyl 5-(2-(dimethylamino)-3-(octadec-9-en-1-yloxy)propoxy)pentanoate (Compound 24); [0053] (Z)-methyl 7-(2-(dimethylamino)-3-(octadec-9-en-1-yloxy)propoxy)heptanoate (Compound 25); [0054] (Z)-methyl 8-(2-(dimethylamino)-3-(octadec-9-en-1-yloxy)propoxy)octanoate (Compound 26); [0055] methyl 4-(2-(dimethylamino)-3-((8-(2-octylcyclopropyl)octyl)oxy)propoxy)butanoate (Compound 27); [0056] methyl 5-(2-(dimethylamino)-3-((8-(2-octylcyclopropyl)octyl)oxy)propoxy)pentanoate (Compound 28); [0057] methyl 7-(2-(dimethylamino)-3-((8-(2-octylcyclopropyl)octyl)oxy)propoxy)heptanoate (Compound 29); [0058] methyl 8-(2-(dimethylamino)-3-((8-(2-octylcyclopropyl)octyl)oxy)propoxy)octanoate (Compound 30); [0059] methyl 4-(2-(dimethylamino)-3-((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propoxy)butanoate (Compound 31); [0060] methyl 5-(2-(dimethylamino)-3-((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propoxy)pentanoate (Compound 32); [0061] methyl 6-(2-(dimethylamino)-3-((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propoxy)hexanoate (Compound 33); [0062] methyl 7-(2-(dimethylamino)-3-((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propoxy)heptanoate (Compound 34); [0063] methyl 8-(2-(dimethylamino)-3-((9Z,12Z)-octadeca-9,12-dien-1-yloxy)propoxy)octanoate (Compound 35); [0064] methyl 4-(2-(dimethylamino)-3-((8-(2-((2-pentylcyclopropyl)methyl)cyclopropyl)octyl)oxy)propoxy)butanoate (Compound 36); [0065] methyl 5-(2-(dimethylamino)-3-((8-(2-((2-pentylcyclopropyl)methyl)cyclopropyl)octyl)oxy)propoxy)pentanoate (Compound 37); [0066] methyl 6-(2-(dimethylamino)-3-((8-(2-((2-pentylcyclopropyl)methyl)cyclopropyl)octyl)oxy)propoxy)hexanoate (Compound 38); [0067] methyl 7-(2-(dimethylamino)-3-((8-(2-((2-pentylcyclopropyl)methyl)cyclopropyl)octyl)oxy)propoxy)heptanoate (Compound 39); [0068] methyl 8-(2-(dimethylamino)-3-((8-(2-((2-pentylcyclopropyl)methyl)cyclopropyl)octyl)oxy)propoxy)octanoate (Compound 40); [0069] (Z)-methyl 16-(2-(dimethylamino)-3-((6-methoxy-6-oxohexyl)oxy)propoxy)hexadec-7-enoate (Compound 41); [0070] methyl 6-(2-(8-(2-(dimethylamino)-3-((6-methoxy-6-oxohexyl)oxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 42); [0071] (Z)-methyl 16-(2-(dimethylamino)-3-(4-methoxy-4-oxobutoxy)propoxy)hexadec-7-enoate (Compound 43); [0072] (Z)-methyl 16-(2-(dimethylamino)-3-((5-methoxy-5-oxopentyl)oxy)propoxy)hexadec-7-enoate (Compound 44); [0073] (Z)-methyl 16-(2-(dimethylamino)-3-((7-methoxy-7-oxoheptyl)oxy)propoxy)hexadec-7-enoate (Compound 45); [0074] (Z)-methyl 16-(2-(dimethylamino)-3-((8-methoxy-8-oxooctyl)oxy)propoxy)hexadec-7-enoate (Compound 46); [0075] methyl 6-(2-(8-(2-(dimethylamino)-3-(4-methoxy-4-oxobutoxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 47); [0076] methyl 6-(2-(8-(2-(dimethylamino)-3-((5-methoxy-5-oxopentyl)oxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 48); [0077] methyl 7-(2-(dimethylamino)-3-((8-(2-(6-methoxy-6-oxohexyl)cyclopropyl)octyl)oxy)propoxy)heptanoate (Compound 49); [0078] methyl 8-(2-(dimethylamino)-3-((8-(2-(6-methoxy-6-oxohexyl)cyclopropyl)octyl)oxy)propoxy)octanoate (Compound 50); [0079] (Z)-methyl 6-(2-(dimethylamino)-3-((6-oxo-6-(undec-2-en-1-yloxy)hexyl)oxy)propoxy)hexanoate (Compound 51); [0080] methyl 6-(2-(dimethylamino)-3-((6-((2-octylcyclopropyl)methoxy)-6-oxohexyl)oxy)propoxy)hexanoate (Compound 52); [0081] (Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-(4-methoxy-4-oxobutoxy)propoxy)hexanoate (Compound 53); [0082] (Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-((5-methoxy-5-oxopentyl)oxy)propoxy)hexanoate (Compound 54); [0083] (Z)-methyl 7-(2-(dimethylamino)-3-((6-oxo-6-(undec-2-en-1-yloxy)hexyl)oxy)propoxy)heptanoate (Compound 55); [0084] (Z)-methyl 8-(2-(dimethylamino)-3-((6-oxo-6-(undec-2-en-1-yloxy)hexyl)oxy)propoxy)octanoate (Compound 56); [0085] (2-octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-(4-methoxy-4-oxobutoxy)propoxy)hexanoate (Compound 57); [0086] (2-octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-((5-methoxy-5-oxopentyl)oxy)propoxy)hexanoate (Compound 58); [0087] methyl 7-(2-(dimethylamino)-3-((6-((2-octylcyclopropyl)methoxy)-6-oxohexyl)oxy)propoxy)heptanoate (Compound 59); and [0088] methyl 8-(2-(dimethylamino)-3-((6-((2-octylcyclopropyl)methoxy)-6-oxohexyl)oxy)propoxy)octanoate (Compound 60);
or any pharmaceutically acceptable salt or stereoisomer thereof.

[0089] In another embodiment, the cationic lipids disclosed are useful in the preparation of lipid nanoparticles.

[0090] In another embodiment, the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of oligonucleotides.

[0091] In another embodiment, the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of siRNA and miRNA.

[0092] In another embodiment, the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of siRNA.

[0093] The cationic lipids of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E. L. Eliel and S. H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 1119-1190), and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, being included in the present invention. In addition, the cationic lipids disclosed herein may exist as tautomers and both tautomeric forms are intended to be encompassed by the scope of the invention, even though only one tautomeric structure is depicted.

[0094] It is understood that substituents and substitution patterns on the cationic lipids of the instant invention can be selected by one of ordinary skill in the art to provide cationic lipids that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.

[0095] It is understood that one or more Si atoms can be incorporated into the cationic lipids of the instant invention by one of ordinary skill in the art to provide cationic lipids that are chemically stable and that can be readily synthesized by techniques known in the art from readily available starting materials.

[0096] In the compounds of Formula A, the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number predominantly found in nature. The present invention is meant to include all suitable isotopic variations of the compounds of Formula A. For example, different isotopic forms of hydrogen (H) include protium (.sup.1H) and deuterium (.sup.2H). Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples. Isotopically-enriched compounds within Formula A can be prepared without undue experimentation by conventional techniques well known to those skilled in the art or by processes analogous to those described in the Scheme and Examples herein using appropriate isotopically-enriched reagents and/or intermediates.

[0097] As used herein, alkyl means a straight chain, cyclic or branched saturated aliphatic hydrocarbon having the specified number of carbon atoms.

[0098] As used herein, alkenyl means a straight chain, cyclic or branched unsaturated aliphatic hydrocarbon having the specified number of carbon atoms including but not limited to diene, triene and tetraene unsaturated aliphatic hydrocarbons.

[0099] Examples of a cyclic alkyl or alkenyl include, but are not limited to:

##STR00002##

[0100] As used herein, heterocyclyl or heterocycle means a 4- to 10-membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups. Heterocyclyl therefore includes, the following: benzoimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridinyl, pyridazinyl, pyridyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, tetrahydropyranyl, tetrazolyl, tetrazolopyridyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, azetidinyl, 1,4-dioxanyl, hexahydroazepinyl, piperazinyl, piperidinyl, pyrrolidinyl, morpholinyl, thiomorpholinyl, dihydrobenzoimidazolyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, dihydrobenzoxazolyl, dihydrofuranyl, dihydroimidazolyl, dihydroindolyl, dihydroisooxazolyl, dihydroisothiazolyl, dihydrooxadiazolyl, dihydrooxazolyl, dihydropyrazinyl, dihydropyrazolyl, dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dihydroquinolinyl, dihydrotetrazolyl, dihydrothiadiazolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, methylenedioxybenzoyl, tetrahydrofuranyl, and tetrahydrothienyl, and N-oxides thereof all of which are optionally substituted with one to three substituents selected from R.

[0101] As used herein, polyamine means compounds having two or more amino groups. Examples include putrescine, cadaverine, spermidine, and spermine.

[0102] As used herein, halogen means Br, Cl, F or I.

[0103] In an embodiment of Formula A, R.sup.1 and R.sup.2 are independently selected from H and (C.sub.1-C.sub.6)alkyl, wherein said alkyl is optionally substituted with one to three substituents selected from R; or R.sup.1 and R.sup.2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R.

[0104] In an embodiment of Formula A, R.sup.1 and R.sup.2 are independently selected from H, methyl, ethyl and propyl, wherein said methyl, ethyl and propyl are optionally substituted with one to three substituents selected from R; or R.sup.1 and R.sup.2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R.

[0105] In an embodiment of Formula A, R.sup.1 and R.sup.2 are independently selected from H, methyl, ethyl and propyl.

[0106] In an embodiment of Formula A, R.sup.1 and R.sup.2 are each methyl.

[0107] In an embodiment of Formula A, R.sup.3 is independently selected from: (C.sub.4-C.sub.20)alkyl and alkenyl.

[0108] In an embodiment of Formula A, R.sup.3 is (C.sub.14-C.sub.18) alkenyl.

[0109] In an embodiment of Formula A, R.sup.3 is (C.sub.16) alkenyl.

[0110] In an embodiment of Formula A, R.sup.3 is (C.sub.14-C.sub.18) alkyl.

[0111] In an embodiment of Formula A, R.sup.3 is (C.sub.16) alkyl.

[0112] In an embodiment of Formula A, R.sup.3 is (C.sub.4-C.sub.9)alkyl.

[0113] In an embodiment of Formula A, R.sup.3 is (C.sub.5)alkyl.

[0114] In an embodiment of Formula A, R.sup.4 is independently selected from: (C.sub.1-C.sub.16)alkyl and alkenyl.

[0115] In an embodiment of Formula A, R.sup.4 is (C.sub.11) alkenyl.

[0116] In an embodiment of Formula A, R.sup.4 is (C.sub.11) alkyl.

[0117] In an embodiment of Formula A, R.sup.4 is (C.sub.1-C.sub.4)alkyl.

[0118] In an embodiment of Formula A, R.sup.4 is (C.sub.1-C.sub.2)alkyl.

[0119] In an embodiment of Formula A, R.sup.4 is methyl.

[0120] In an embodiment of Formula A, R.sup.3 is (C.sub.5)alkyl and R.sup.4 is (C.sub.11)alkenyl.

[0121] In an embodiment of Formula A, R.sup.3 is (C.sub.5)alkyl and R.sup.4 is (C.sub.11)alkyl.

[0122] In an embodiment of Formula A, R.sup.3 is (C.sub.16)alkenyl and R.sup.4 is (C.sub.1)alkyl.

[0123] In an embodiment of Formula A, R.sup.3 is (C.sub.16)alkyl and R.sup.4 is (C.sub.1)alkyl.

[0124] In an embodiment of Formula A, R.sup.5 is independently selected from (C.sub.4-C.sub.8) alkyl and alkenyl.

[0125] In an embodiment of Formula A, R.sup.5 is (C.sub.4-C.sub.8) alkyl.

[0126] In an embodiment of Formula A, R.sup.5 is (C.sub.5)alkyl.

[0127] In an embodiment of Formula A, R.sup.6 is (C.sub.1-C.sub.2) alkyl.

[0128] In an embodiment of Formula A, R.sup.6 is methyl.

[0129] In an embodiment of Formula A, R.sup.5 is (C.sub.5)alkyl and R.sup.6 is (C.sub.1)alkyl.

[0130] In an embodiment of Formula A, Q.sup.1 and Q.sup.2 are each, independently a bond, OC(O), C(O)O, SC(O), C(O)S, OC(S), SS, C(R)N, NC(R), C(R)NO, ONC(R), C(O)(NR), N(R)C(O), C(S)(NR), N(R)C(O), N(R)C(O)N(R), OC(O)O, OSi(R).sub.2O, C(O)(CR.sub.2)C(O)O, or OC(O)(CR.sub.2)C(O), with the proviso that when either Q.sup.1 or Q.sup.2 is a bond then the other is not a bond.

[0131] In an embodiment of Formula A, Q.sup.1 and Q.sup.2 are each, independently a bond or C(O)O, with the proviso that when either Q.sup.1 or Q.sup.2 is a bond then the other is not a bond.

[0132] In an embodiment of Formula A, R is R.

[0133] In an embodiment of Formula A, R is independently selected from H, methyl, ethyl and propyl, wherein said methyl, ethyl and propyl are optionally substituted with one or more substituents independently selected from: halogen and OH.

[0134] In an embodiment of Formula A, R is independently selected from H, methyl, ethyl and propyl.

[0135] In an embodiment of Formula A, n is 0, 1, 2 or 3.

[0136] In an embodiment of Formula A, n is 0, 1 or 2.

[0137] In an embodiment of Formula A, n is 0.

[0138] In an embodiment of Formula A, heterocyclyl is pyrolidine, piperidine, morpholine, imidazole or piperazine.

[0139] In an embodiment of Formula A, monocyclic heterocyclyl is pyrolidine, piperidine, morpholine, imidazole or piperazine.

[0140] In an embodiment of Formula A, polyamine is putrescine, cadaverine, spermidine or spermine.

[0141] In an embodiment, alkyl is a straight chain saturated aliphatic hydrocarbon having the specified number of carbon atoms.

[0142] In an embodiment, alkenyl is a straight chain unsaturated aliphatic hydrocarbon having the specified number of carbon atoms.

[0143] Included in the instant invention is the free form of cationic lipids of Formula A, as well as the pharmaceutically acceptable salts and stereoisomers thereof. Some of the isolated specific cationic lipids exemplified herein are the protonated salts of amine cationic lipids. The term free form refers to the amine cationic lipids in non-salt form. The encompassed pharmaceutically acceptable salts not only include the isolated salts exemplified for the specific cationic lipids described herein, but also all the typical pharmaceutically acceptable salts of the free form of cationic lipids of Formula A. The free form of the specific salt cationic lipids described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate. The free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention.

[0144] The pharmaceutically acceptable salts of the instant cationic lipids can be synthesized from the cationic lipids of this invention which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic cationic lipids are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.

[0145] Thus, pharmaceutically acceptable salts of the cationic lipids of this invention include the conventional non-toxic salts of the cationic lipids of this invention as formed by reacting a basic instant cationic lipids with an inorganic or organic acid. For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic (TFA) and the like.

[0146] When the cationic lipids of the present invention are acidic, suitable pharmaceutically acceptable salts refers to salts prepared from pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, N,N-dibenzylethylenediamine, diethylamin, 2-diethylaminoethanol 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like.

[0147] The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described by Berg et al., Pharmaceutical Salts, J. Pharm. Sci., 1977:66:1-19.

[0148] It will also be noted that the cationic lipids of the present invention are potentially internal salts or zwitterions, since under physiological conditions a deprotonated acidic moiety in the compound, such as a carboxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom.

EXAMPLES

[0149] Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof. The reagents utilized in synthesizing the cationic lipids are either commercially available or readily prepared by one of ordinary skill in the art.

[0150] Synthesis of the novel cationic lipids is a linear process starting from lipid alcohol (i). Alkylation with epichlorohydrin (or either of its pure chiral forms) gives epoxide (ii). This epoxide is opened regioselectively with an alcohol to give a secondary alcohol (iii) which is then silyl protected (iv). This alkene is hydroxylated to diol (v), which is oxidatively cleaved with sodium periodate to provide aldehyde (vi). This aldehyde is converted to the carboxylic acid containing olefin (vii) by a Wittig olefination. The acid is converted to the ester (viii) followed by silyl ether deprotection to give alcohol (ix). The alcohol is oxidized to the ketone (x) which is further converted to the cyclopropanated material (xi). Either ketone (x or xi) is reductively aminated to give final cationic lipids (xii or xiii, respectively).

##STR00003## ##STR00004##

[0151] Synthesis of ester containing lipids (xxii and xxiii) is achieved by oxidation of aldehyde vi to carboxylic acid xx, followed by ester formation (xxi). Conversion to xxii and xxiii is completed in a manner analogous to that described in General Scheme 1.

##STR00005##

[0152] Synthesis of ester containing lipids xxv and xxxvi is a linear sequence beginning with epoxide ii. The epoxide is opened with a monosilyl protected diol to give xxx, which was then deprotected to give xxxi. This diol is oxidized to xxxii then esterified to give xxxiii, which also may be cyclopropanted to xxxiv. xxxiii and xxxiv are converted to final amines xxxv and xxxvi by reductive amination.

##STR00006##

[0153] Synthesis of diester amines is accomplished as outlined in General Scheme 4. Beginning with silyl protection of secondary alcohol xxx, similar steps to General Schemes 1 and 3 are used to produce diesters xlix and l.

##STR00007## ##STR00008##

[0154] Synthesis of diester amines is accomplished as outlined in General Scheme 5. Beginning with silyl protected diol xlii, similar steps to General Schemes 1, 2, and 3 are used to produce diesters liii and liv.

##STR00009## ##STR00010##

(Z)-methyl 17-(2-dimethylamino)-3-(octyloxy)propoxy)heptadec-8-enoate (Compound 1)

[0155] ##STR00011##

Oleyl alcohol (a) is mixed with tetrabutylammonium bromide, sodium hydroxide, and epichlorohydrin and stirred overnight. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude epoxide (b). The crude product is purified by flash column chromatography.

##STR00012##

Epoxide (b) is mixed with octanol and tin tetrachloride in DCM and stirred overnight. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol (c). The crude product is purified by flash column chromatography.

##STR00013##

Alcohol (c) is taken up in dichloromethane and treated with triethylamine and DMAP. To this solution is added TBDPSCl in a single portion at ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude silyl ether (d). The crude product is purified by flash column chromatography.

##STR00014##

Silyl ether (d) is taken up in a mixture of tert-butanol, THF, and water and treated with osmium tetroxide and NMO. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude diol (c). The crude product is purified by flash column chromatography.

##STR00015##

Diol (e) is taken up in a mixture of THF, dichloromethane, methanol and water and treated with sodium periodate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude aldehyde (f). The crude product is purified by flash column chromatography.

##STR00016##

Ylide precursor triphenylphosphinium bromide is taken up in THF and treated with HMPA and lithium hexamethyldisilazide to generate the ylide. To this solution is added aldehyde (f). Upon reaction completion, the reaction is worked up with 1 N HCl and hexanes, the hexanes layer evaporated to crude acid. This crude acid was treated with MeOH, EDC, and DMAP in DCM to obtain the methyl ester. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester (g). The crude product is purified by flash column chromatography.

##STR00017##

Ester (g) is taken up in THF and treated with TBAF. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol (h). The crude product is purified by flash column chromatography.

##STR00018##

Alcohol (h) is dissolved in DCM and treated with the Dess Martin reagent. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ketone (i). The crude product is purified by flash column chromatography.

##STR00019##

Ketone (i) is mixed with 2 M dimethylamine in THF and titanium isopropoxide and stirred overnight. The next day, EtOH and sodium borohydride are added. After 10 min, the reaction is loaded directly onto a silica column and purified by flash column chromatography to give (Z)-methyl 17-(2-(dimethylamino)-3-(octyloxy)propoxy)heptadec-8-enoate (Compound 1).

Methyl 7-(2-(8-(2-(dimethylamino)-3-(octyloxy)propoxy)octyl)cyclopropyl)heptanoate (Compound 2)

[0156] ##STR00020##

A solution of diethylzinc in dichloromethane is cooled to 1 C. and treated dropwise with TFA. After 30 minutes, diiodomethane is added and the resulting solution aged for 30 minutes in an ice bath. To this solution is added ketone (i) and the resulting solution is warmed slowly to ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude cyclopropane (j). The crude product is purified by flash column chromatography.

##STR00021##

Ketone (j) is carried on to methyl 7-(2-(8-(2-(dimethylamino)-3-(octyloxy)propoxy)octyl)cyclopropyl)heptanoate (Compound 2) as described for Compound 1 above.

[0157] Compounds 3-10 are novel cationic lipids and are prepared according to the General Scheme 1 above.

TABLE-US-00001 Compound Structure Name 3 [00022]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- (hexyloxy)propoxy) hexadec-7-enoate 4 [00023]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- (heptyloxy)propoxy) hexadec-7-enoate 5 [00024]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- (nonyloxy)propoxy) hexadec-7-enoate 6 [00025]embedded image (Z)-methyl 16-(3- (decyloxy)-2- (dimethylamino) propoxy)hexadec-7- enoate 7 [00026]embedded image Methyl 6-(2-(8-(2- (dimethylamino)-3- (hexyloxy)propoxy) octyl)cyclopropyl) hexanoate 8 [00027]embedded image Methyl 6-(2-(8-(2- (dimethylamino)-3- (heptyloxy)propoxy) octyl)cyclopropyl) hexanoate 9 [00028]embedded image Methyl 6-(2-(8-(2- (dimethylamino)-3- (nonyloxy)propoxy) octyl)cyclopropyl) hexanoate 10 [00029]embedded image Methyl 6-(2-(8-(3- (decyloxy)-2- (dimethylamino) propoxy)octyl) cyclopropyl)hexanoate

(Z)-undec-2-en-1-yl 6-(2-(dimethylamino)-3-(octyloxy)propoxy)hexanoate (Compound 11)

[0158] ##STR00030##

A solution of aldehyde (k) in DMF is treated with PDC at ambient temperature. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid (l). This material is purified by flash chromatography.

##STR00031##

A solution of acid (l) and the alcohol shown in DCM is treated with EDCI and DMAP. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester (m). This material is purified by flash chromatography to give purified ester (m).

##STR00032##

[0159] Conversion of (m) to Compound 11 is carried out in a manner analogous to that described for Compound 1 above.

(2-Octylcyclopropyl)methyl 6-(2-(dimethylamino)-3-(octyloxy)propoxy)hexanoate (Compound 12)

[0160] ##STR00033##

Compound 12 is prepared from (m) in a manner analogous to that described for compound 2 above.

[0161] Compounds 13-20 are novel cationic lipids and are prepared according to General Schemes 1 and 2 above.

TABLE-US-00002 Compound Structure Name 13 [00034]embedded image (Z)-undec-2-en-1-yl 6-(2- (dimethylamino)-3- (hexyloxy)propoxy) hexanoate 14 [00035]embedded image (Z)-undec-2-en-1-yl 6-(2- (dimethylamino)-3- (heptyloxy)propoxy) hexanoate 15 [00036]embedded image (Z)-undec-2-en-1-yl 6-(2- (dimethylamino)-3- (nonyloxy)propoxy) hexanoate 16 [00037]embedded image (Z)-undec-2-en-1-yl 6-(3-(decyloxy)-2- (dimethylamino) propoxy)hexanoate 17 [00038]embedded image (2- Octylcyclopropyl) methyl 6-(2- (dimethylamino)-3- (hexyloxy)propoxy) hexanoate 18 [00039]embedded image (2- Octylcyclopropyl) methyl 6-(2- (dimethylamino)-3- (heptyloxy)propoxy) hexanoate 19 [00040]embedded image (2- Octylcyclopropyl) methyl 6-(2- (dimethylamino)-3- (nonyloxy)propoxy) hexanoate 20 [00041]embedded image Octylcyclopropyl) methyl 6-(3-(decyloxy)- 2-(dimethylamino) propoxy)hexanoate

(Z)-methyl 6-(2-(dimethylamino)-3-(octadec-9-en-1-yloxy)propoxy)hexanoate (Compound 21)

[0162] ##STR00042##

Epoxide (b) is mixed with mono TBDPS protected diol and tin tetrachloride in DCM and stirred overnight. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol (n). The crude product is purified by flash column chromatography.

##STR00043##

A solution of silyl ether (n) in THF is treated with TBAF. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude diol (o). This material is purified by flash chromatography.

##STR00044##

A solution of alcohol (o) in DMF is treated with pyridinium dichromate at 0 C. The solution is warmed to ambient temperature. The reaction is quenched with water and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid (p). This material is purified by flash chromatography.

##STR00045##

A solution of acid (p) in DCM is treated with MeOH, EDC, and DMAP at ambient temperature. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto-ester (q). This material is purified by flash chromatography.
Ketone (q) is carried forward to Compound 21 in a manner analogous to that described above for Compound 1.

##STR00046##

Ketone (q) may also be carried forward to methyl 6-(2-(dimethylamino)-3-((8-(2-octylcyclopropyl)octyl)oxy)propoxy)hexanoate (Compound 22) in a manner analogous to that described above for Compound 2.

##STR00047##

Compounds 23-40 are novel cationic lipids and are prepared according to General Scheme 3 above.

TABLE-US-00003 Compound Structure Name 23 [00048]embedded image (Z)-methyl 4-(2- (dimethylamino)-3- (octadec-9-en-1- yloxyl)propoxy) butanoate 24 [00049]embedded image (Z)-methyl 5-(2- (dimethylamino)-3- (octadec-9-en-1- yloxy)propoxy) pentanoate 25 [00050]embedded image (Z)-methyl 7-(2- (dimethylamino)-3- (octadec-9-en-1- yloxy)propoxy) heptanoate 26 [00051]embedded image (Z)-methyl 8-(2- (dimethylamino)-3- (octadec-9-en-1- yloxy)propoxy) octanoate 27 [00052]embedded image Methyl 4-(2- (dimethylamino)-3- ((8-(2- octylcyclopropyl) octyl)oxy)propoxy) butanoate 28 [00053]embedded image Methyl 5-(2- (dimethylamino)-3- ((8-(2- octylcyclopropyl) octyl)oxy)propoxy) pentanoate 29 [00054]embedded image Methyl 7-(2- (dimethylamino)-3- ((8-(2- octylcyclopropyl) octyl)oxy)propoxy) heptanoate 30 [00055]embedded image Methyl 8-(2- (dimethylamino)-3- ((8-(2- octylcyclopropyl) octyl)oxy)propoxy) octanoate 31 [00056]embedded image Methyl 4-(2- (dimethylamino)-3- ((9Z,12Z)-octadeca- 9,12-dien-1- yloxy)propoxy) butanoate 32 [00057]embedded image Methyl 5-(2- (dimethylamino)-3- ((9Z,12Z)-octadeca- 9,12-dien-1- yloxy)propoxy) pentanoate 33 [00058]embedded image Methyl 6-(2- (dimethylamino)-3- ((9Z,12Z)-octadeca- 9,12-dien-1- yloxy)propoxy) hexanoate 34 [00059]embedded image Methyl 7-(2- (dimethylamino)-3- ((9Z,12Z)-octadeca- 9,12-dien-1- yloxy)propoxy) heptanoate 35 [00060]embedded image Methyl 8-(2- (dimethylamino)-3- ((9Z,12Z)-octadeca- 9,12-dien-1- yloxy)propoxy) octanoate 36 [00061]embedded image Methyl 4-(2- (dimethylamino)-3- ((8-(2-((2- pentylcyclopropyl) methyl)cyclopropyl) octyl)oxy)propoxy) butanoate 37 [00062]embedded image Methyl 5-(2- (dimethylamino)-3- ((8-(2-((2- pentylcyclopropyl) methyl)cyclopropyl) octyl)oxy)propoxy) pentanoate 38 [00063]embedded image Methyl 6-(2- (dimethylamino)-3- ((8-(2-((2- pentylcyclopropyl) methyl)cyclopropyl) octyl)oxy)propoxy) hexanoate 39 [00064]embedded image Methyl 7-(2- (dimethylamino)-3- ((8-(2-((2- pentylcyclopropyl) methyl)cyclopropyl) octyl)oxy)propoxy) heptanoate 40 [00065]embedded image Methyl 8-(2- (dimethylamino)-3- ((8-(2-((2- pentylcyclopropyl) methyl)cyclopropyl) octyl)oxy)propoxy) butanoate

(Z)-methyl 16-(2-(dimethylamino)-3-((6-methoxy-6-oxohexyl)oxy)propoxy)hexadec-7-enoate (Compound 41)

[0163] ##STR00066##

Alcohol (n) is taken up in dichloromethane and treated with triethylamine and DMAP. To this solution is added TBDPSCl in a single portion at ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude silyl ether (r). The crude product is purified by flash column chromatography.

##STR00067##

Silyl ether (r) is taken up in a mixture of tert-butanol, THF, and water and treated with osmium tetroxide and NMO. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude diol (s). The crude product is purified by flash column chromatography.

##STR00068##

A solution of diol (s) is taken up in THF, dichloromethane, methanol and water and treated with sodium periodate. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude aldehyde (t). This material is purified by flash chromatography.

##STR00069##

Ylide precursor triphenylphosphinium bromide is taken up in THF and treated with HMPA and lithium hexamethyldisilazide to generate the ylide. To this solution is added aldehyde (t). Upon reaction completion, the reaction is worked up with 1 N HCl and hexanes, the hexanes layer evaporated to crude acid. This crude acid was treated with MeOH, EDC, and DMAP in DCM to obtain the methyl ester. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester (u). The crude product is purified by flash column chromatography.

##STR00070##

A solution of silyl ether (u) in THF is treated with TBAF. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol. The crude product is purified by flash column chromatography to obtain diol (v).

##STR00071##

A solution of diol (v) in DMF is treated with pyridinium dichromate. The reaction is quenched with water upon completion. The reaction mixture is partitioned between 1 N aqueous HCl and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid. A solution of this crude acid in DCM is treated with MeOH, EDC, and DMAP at ambient temperature. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto-ester (w). This material is purified by flash chromatography.
Ketone (w) is converted to Compound 41 in a manner analogous to that described for Compound 1.

##STR00072##

Methyl 6-(2-(8-(2-(dimethylamino)-3-((6-methoxy-6-oxohexyl)oxy)propoxy)octyl)cyclopropyl)hexanoate (Compound 42

[0164] ##STR00073##

Ketone (w) is converted to Compound 42 in a manner analogous to that described for Compound 1.
Compounds 43-50 are novel cationic lipids and are prepared according to General Scheme 4 above.

TABLE-US-00004 Compound Structure Name 43 [00074]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- (4-methoxy-4- oxobutoxy)propoxy) hexadec-7-enoate 44 [00075]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- ((5-methoxy-5- oxopentyl)oxy) propoxy)hexadec- 7-enoate 45 [00076]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- ((7-methoxy-7- oxoheptyl)oxy) propoxy)hexadec- 7-enoate 46 [00077]embedded image (Z)-methyl 16-(2- (dimethylamino)-3- ((8-methoxy-8- oxooctyl)oxy) propoxy) hexadec-7-enoate 47 [00078]embedded image Methyl 6-(2-(8-(2- (dimethylamino)-3- (4-methoxy-4- oxobutoxy)propoxy) octyl)cyclopropyl) hexanoate 48 [00079]embedded image Methyl 6-(2-(8-(2- (dimethylamino)-3- ((5-methoxy-5- oxopentyl)oxy) propoxy)octyl) cyclopropyl) hexanoate 49 [00080]embedded image Methyl 7-(2- (dimethylamino)-3- ((8-(2-(6-methoxy-6- oxohexyl)cyclopropyl) octyl)oxy)propoxy) heptanoate 50 [00081]embedded image Methyl 8-(2- (dimethylamino)-3- ((8-(2-(6-methoxy-6- oxohexyl)cyclopropyl) octyl)oxy)propoxy) octanoate
Diesters similar to Compounds 41 and 42 are prepared wherein modifications to the structure are similar to those outlined in the tables above, i.e. varying lipid chain lengths, methyl and ethyl esters, inclusion of cylcopropanes, modifying position of unsaturation or cyclopropane incorporation, homologation of the dimethylamine headgroup by one or two carbons, and all possible combinations of above.

(Z)-methyl 6-(2-(dimethylamino)-3-((6-oxo-6-(undec-2-en-1-yloxy)hexyl)oxy)propoxy)hexanoate (Compound 51)

[0165] ##STR00082##

A solution of aldehyde (x) in DMF is treated with pyridinium dichromate. The reaction is quenched with water upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid (y). The crude product is purified by flash column chromatography.

##STR00083##

A solution of acid (y) and the alcohol shown in DCM is treated with EDCI and DMAP. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester. This material is purified by flash chromatography to give ester (z).

##STR00084##

A solution of silyl ether (z) in THF is treated with TBAF. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol. The crude product is purified by flash column chromatography to obtain diol (aa).

##STR00085##

A solution of diol (aa) in DMF is treated with pyridinium dichromate. The reaction is quenched with water upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid (ab). The crude product is purified by flash column chromatography.

##STR00086##

A solution of acid (ab) in DCM is treated with MeOH, EDC, and DMAP at ambient temperature. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto-ester (ac). This material is purified by flash chromatography.

##STR00087##

Ketone (ac) is mixed with 2 M dimethylamine in THF and titanium isopropoxide and stirred overnight. The next day, EtOH and sodium borohydride are added. After 10 min, the reaction is loaded directly onto a silica column and purified by flash column chromatography to give Compound 51.

Methyl 6-(2-(dimethylamino)-3-((6-((2-octylcyclopropyl)methoxy)-6-oxohexyl)oxy)propoxy hexanoate (Compound 52)

[0166] ##STR00088##

Ketone (ac) is converted to Compound 52 in a manner analogous to that described for Compound 1.
Compounds 53-60 are novel cationic lipids and are prepared according to General Scheme 5 above.

TABLE-US-00005 Compound Structure Name 53 [00089]embedded image (Z)-undec-2-en-1-yl 6-(2- (dimethylamino)-3- (4-methoxy-4- oxobutoxy)propoxy) hexanoate 54 [00090]embedded image (Z)-undec-2-en-1-yl 6-(2- (dimethylamino)-3- ((5-methoxy-5- oxopentyl)oxy) propoxy)hexanoate 55 [00091]embedded image (Z)-methyl 7-(2- (dimethylamino)-3- ((6-oxo-6-(undec-2- en-1- yloxy)hexyl)oxy) propoxy)heptanoate 56 [00092]embedded image (Z)-methyl 8-(2- (dimethylamino)-3- ((6-oxo-6-(undec-2- en-1- yloxy)hexyl)oxy) propoxy)octanoate 57 [00093]embedded image (2- Octylcyclopropyl) methyl 6-(2- (dimethylammo)-3- (4-methoxy-4- oxobutoxy) propoxy)hexanoate 58 [00094]embedded image (2- Octylcyclopropyl) methyl 6-(2- (dimethylamino)-3- ((5-methoxy-5- oxopentyl)oxy) propoxy)hexanoate 59 [00095]embedded image Methyl 7-(2- (dimethylamino)-3- octylcyclopropyl) methoxy)-6- oxohexyl)oxy) propoxy)heptanoate 60 [00096]embedded image Methyl 8-(2- (dimethylamino)-3- ((6-((2- octylcyclopropyl) methoxy)-6- oxohexyl)oxy) propoxy)octanoate
Diesters similar to Compounds 51 and 52 are prepared wherein modifications to the structure are similar to those outlined in the tables above, i.e. varying lipid chain lengths, methyl and ethyl esters, inclusion of cylcopropanes, modifying position of unsaturation or cyclopropane incorporation, homologation of the dimethylamine headgroup by one or two carbons, and all possible combinations of above.

LNP Compositions

[0167] The following lipid nanoparticle compositions (LNPs) of the instant invention are useful for the delivery of oligonucleotides, specifically siRNA and miRNA:

Cationic Lipid/Cholesterol/PEG-DMG 56.6/38/5.4;

Cationic Lipid/Cholesterol/PEG-DMG 60/38/2;

Cationic Lipid/Cholesterol/PEG-DMG 67.3/29/3.7;

Cationic Lipid/Cholesterol/PEG-DMG 49.3/47/3.7;

Cationic Lipid/Cholesterol/PEG-DMG 50.3/44.3/5.4;

Cationic Lipid/Cholesterol/PEG-C-DMA/DSPC40/48/2/10;

Cationic Lipid/Cholesterol/PEG-DMG/DSPC40/48/2/10; and

Cationic Lipid/Cholesterol/PEG-DMG/DSPC58/30/2/10.

LNP Process Description:

[0168] The Lipid Nano-Particles (LNP) is prepared by an impinging jet process. The particles are formed by mixing lipids dissolved in alcohol with siRNA dissolved in a citrate buffer. The mixing ratio of lipids to siRNA are targeted at 45-55% lipid and 65-45% siRNA. The lipid solution can contain a novel cationic lipid of the instant invention, a helper lipid (cholesterol), PEG (e.g. PEG-C-DMA, PEG-DMG) lipid, and DSPC at a concentration of 5-15 mg/mL with a target of 9-12 mg/mL in an alcohol (for example ethanol). The ratio of the lipids can have a mole percent range of 25-98 for the cationic lipid with a target of 35-65, the helper lipid can have a mole percent range from 0-75 with a target of 30-50, the PEG lipid can have a mole percent range from 1-15 with a target of 1-6, and the DSPC can have a mole percent range of 0-15 with a target of 0-12. The siRNA solution can contain one or more siRNA sequences at a concentration range from 0.3 to 1.0 mg/mL with a target of 0.3-0.9 mg/mL in a sodium citrate buffered salt solution with pH in the range of 3.5-5. The two liquids are heated to a temperature in the range of 15-40 C. targeting 30-40 C., and then mixed in an impinging jet mixer instantly forming the LNP. The teeID can have a range from 0.25 to 1.0 mm and a total flow rate from 10-600 mL/min. The combination of flow rate and tubing ID can have the effect of controlling the particle size of the LNPs between 30 and 200 nm. The solution can then be mixed with a buffered solution at a higher pH with a mixing ratio in the range of 1:1 to 1:3 vol:vol but targeting 1:2 vol:vol. This buffered solution is at a temperature in the range of 15-40 C., targeting 30-40 C. The mixed LNPs are held from 30 minutes to 2 hrs prior to an anion exchange filtration step. The temperature during incubating is in the range of 15-40 C., targeting 30-40 C. After incubating the solution is filtered through a 0.8 um filter containing an anion exchange separation step. This process can use tubing IDs ranging from 1 mm ID to 5 mm ID and a flow rate from 10 to 2000 mL/min. The LNPs are concentrated and diafiltered via an ultrafiltration process where the alcohol is removed and the citrate buffer is exchanged for the final buffer solution such as phosphate buffered saline. The ultrafiltration process can use a tangential flow filtration format (TFF). This process can use a membrane nominal molecular weight cutoff range from 30-500 KD. The membrane format is hollow fiber or flat sheet cassette. The TFF processes with the proper molecular weight cutoff can retain the LNP in the retentate and the filtrate or permeate contains the alcohol; citrate buffer; final buffer wastes. The TFF process is a multiple step process with an initial concentration to a siRNA concentration of 1-3 mg/mL. Following concentration, the LNPs solution is diafiltered against the final buffer for 10-20 volumes to remove the alcohol and perform buffer exchange. The material can then be concentrated an additional 1-3 fold. The final steps of the LNP process are to sterile filter the concentrated LNP solution and vial the product.

Analytical Procedure:

[0169] 1) siRNA Concentration

[0170] The siRNA duplex concentrations are determined by Strong Anion-Exchange High-Performance Liquid Chromatography (SAX-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford Mass.) with a 2996 PDA detector. The LNPs, otherwise referred to as RNAi Delivery Vehicles (RDVs), are treated with 0.5% Triton X-100 to free total siRNA and analyzed by SAX separation using a Dionex BioLC DNAPac PA 200 (4250 mm) column with UV detection at 254 nm. Mobile phase is composed of A: 25 mM NaClO.sub.4, 10 mM Tris, 20% EtOH, pH 7.0 and B: 250 mM NaClO.sub.4, 10 mM Tris, 20% EtOH, pH 7.0 with liner gradient from 0-15 min and flow rate of 1 ml/min. The siRNA amount is determined by comparing to the siRNA standard curve.

[0171] 2) Encapsulation Rate

[0172] Fluorescence reagent SYBR Gold is employed for RNA quantitation to monitor the encapsulation rate of RDVs. RDVs with or without Triton X-100 are used to determine the free siRNA and total siRNA amount. The assay is performed using a SpcctraMax M5e microplate spectrophotometer from Molecular Devices (Sunnyvale, Calif.). Samples are excited at 485 nm and fluorescence emission is measured at 530 nm. The siRNA amount is determined by comparing to the siRNA standard curve.


Encapsulation rate=(1free siRNA/total siRNA)100%

3) Particle Size and Polydispersity

[0173] RDVs containing 1 g siRNA are diluted to a final volume of 3 ml with 1PBS. The particle size and polydispersity of the samples is measured by a dynamic light scattering method using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, N.Y.). The scattered intensity is measured with HeNe laser at 25 C., with a scattering angle of 90.

4) Zeta Potential Analysis

[0174] RDVs containing 1 g siRNA are diluted to a final volume of 2 ml with 1 mM Tris buffer (pH 7.4). Electrophoretic mobility of samples is determined using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, N.Y.) with electrode and HeNe laser as a light source. The Smoluchowski limit is assumed in the calculation of zeta potentials.

5) Lipid Analysis

[0175] Individual lipid concentrations is determined by Reverse Phase High-Performance Liquid Chromatography (RP-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford Mass.) with a Corona charged aerosol detector (CAD) (ESA Biosciences, Inc, Chelmsford, Mass.). Individual lipids in RDVs are analyzed using an Agilent Zorbax SB-C18 (504.6 mm, 1.8 m particle size) column with CAD at 60 C. The mobile phase is composed of A: 0.1% TFA in H.sub.2O and B: 0.1% TFA in IPA. The gradient can change from 60% mobile phase A and 40% mobile phase B from time 0 to 40% mobile phase A and 60% mobile phase B at 1.00 min; 40% mobile phase A and 60% mobile phase B from 1.00 to 5.00 min; 40% mobile phase A and 60% mobile phase B from 5.00 min to 25% mobile phase A and 75% mobile phase B at 10.00 min; 25% mobile phase A and 75% mobile phase B from 10.00 min to 5% mobile phase A and 95% mobile phase B at 15.00 min; and 5% mobile phase A and 95% mobile phase B from 15.00 to 60% mobile phase A and 40% mobile phase B at 20.00 min with flow rate of 1 ml/min. The individual lipid concentration is determined by comparing to the standard curve with all the lipid components in the RDVs with a quadratic curve fit. The molar percentage of each lipid is calculated based on its molecular weight.

[0176] Utilizing the above described LNP process, specific LNPs with the following ratios are identified:

Nominal Composition:

Cationic Lipid/Cholesterol/PEG-DMG 60/38/2

Cationic Lipid/Cholesterol/PEG-DMG/DSPC58/30/2/10

[0177] Luc siRNA

TABLE-US-00006 (SEQ.ID.NO.:1) 5-iB-AUAAGGCUAUGAAGAGAUATT-iB-3 (SEQ.ID.NO.:2) 3-UUUAUUCCGAUACUUCUCUAU-5 [0178] AUGCRibose [0179] iBInverted deoxy abasic [0180] UC2 Fluoro [0181] AGT2 Deoxy [0182] AGU2OCH.sub.3

Nominal Composition

Cationic Lipid/Cholesterol/PEG-DMG 60/38/2

Cationic Lipid/Cholesterol/PEG-DMG/DSPC40/48/2/10

Cationic Lipid/Cholesterol/PEG-DMG/DSPC58/30/2/10

[0183] ApoB siRNA

TABLE-US-00007 (SEQIDNO.:3) 5-iB-CUUUAACAAUUCCUGAAAUTsT-iB-3 (SEQIDNO.:4) 3-UsUGAAAUUGUUAAGGACUsUsUsA-5 [0184] AUGCRibose [0185] iBInverted deoxy abasic [0186] UC2 Fluoro [0187] AGT2 Deoxy [0188] AGU2 OCH.sub.3 [0189] UsAphophorothioate linkage
Beta-Catenin siRNA

TABLE-US-00008 (SEQIDNO.:5) 5-iB-CUGUUGGAUUGAUUCGAAAUsU-iB-3 (SEQIDNO.:6) 3-UsUGACAACCUAACUAAGCUUU-5 [0190] AUGCRibose [0191] iBInverted deoxy abasic [0192] UC2 Fluoro [0193] AGT2 Deoxy [0194] AGU2 OCH.sub.3 [0195] UsAphophorothioate linkage

TABLE-US-00009 (SEQIDNO.:7) 5-iB-ACGACUAGUUCAGUUGCUUUsU-iB-3 (SEQIDNO.:8) 3-UsUUGCUGAUCAAGUCAACGAA-5 [0196] AUGCRibose [0197] iBInverted deoxy abasic [0198] UC2 Fluoro [0199] AGT2 Deoxy [0200] AGU2 OCH.sub.3 [0201] UsAphophorothioate linkage

TABLE-US-00010 (SEQIDNO.:9) 5-iB-ACGACUAGUUCAGUUGCUUUU-iB-3 (SEQIDNO.:101 3-UUUGCUGAUCAAGUCAACGAA-5 [0202] AUGCRibose [0203] iBInverted deoxy abasic [0204] UC2 Fluoro [0205] AGT2 Deoxy [0206] AGU2 OCH.sub.3 [0207] UsAphophorothioate linkage

[0208] Oligonucleotide synthesis is well known in the art. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US 2009/0285881 and PCT patent applications: WO 2009/086558, WO2009/127060, WO2009/132131, WO2010/042877, WO2010/054384, WO2010/054401, WO2010/054405 and WO2010/054406). The siRNAs disclosed and utilized in the Examples are synthesized via standard solid phase procedures.

Example 1

Mouse In Vivo Evaluation of Efficacy

[0209] LNPs utilizing Compounds 1-60, in the nominal compositions described immediately above, are evaluated for in vivo efficacy. The siRNA can target the mRNA transcript for the firefly (Photinus pyralis) luciferase gene (Accession # M15077). The primary sequence and chemical modification pattern of the luciferase siRNA is displayed above. The in vivo luciferase model employs a transgenic mouse in which the firefly luciferase coding sequence is present in all cells. ROSA26-LoxP-Stop-LoxP-Luc (LSL-Luc) transgenic mice licensed from the Dana Farber Cancer Institute are induced to express the Luciferase gene by first removing the LSL sequence with a recombinant Ad-Cre virus (Vector Biolabs). Due to the organo-tropic nature of the virus, expression is limited to the liver when delivered via tail vein injection. Luciferase expression levels in liver are quantitated by measuring light output, using an IVIS imager (Xenogen) following administration of the luciferin substrate (Caliper Life Sciences). Pre-dose luminescence levels is measured prior to administration of the RDVs. Luciferin in PBS (15 mg/mL) is intraperitoneally (IP) injected in a volume of 150 L. After a four minute incubation period mice are anesthetized with isoflurane and placed in the IVIS imager. The RDVs (containing siRNA) in PBS vehicle are tail vein injected in a volume of 0.2 mL. Final dose levels can range from 0.1 to 0.5 mg/kg siRNA. PBS vehicle alone is dosed as a control. Mice are imaged 48 hours post dose using the method described above. Changes in luciferin light output directly correlate with luciferase mRNA levels and represent an indirect measure of luciferase siRNA activity. In vivo efficacy results are expressed as % inhibition of luminescence relative to pre-dose luminescence levels.

Example 2

In Vitro ApoE Binding Assay

[0210] LNPs are incubated at 37 C. in 90% rhesus serum at a final LNP concentration of 4 ug/mL. Incubation is for 20 minutes with orbital rotation. After incubation, the samples are diluted 1:20 in PBS and 100 L of each diluted sample is aliquoted to wells of an anti-PEG antibody coated 96-well plate (Life Diagnostics Cat. No. P-0001PL. After incubation at room temperature for 1 hour, the plate is washed 5 with 300 uL PBS. After washing, 50 uL of 0.2% Triton X-100 is added to each well and the plate incubated at 37 C. for 10 minutes, followed by shaking on a plate shaker for 1 minute at 750 rpm. Samples are frozen prior to performing the ApoE ELISA and stem loop PCR analysis of samples.

[0211] An ApoE ELISA assay is performed to quantitate ApoE bound to the LNPs after incubation in rhesus scrum. Anti-ApoE antibody (Milipore, Cat No. AB947) is diluted 1:1000 in PBS and 100 L of diluted antibody is added to each well of a polystyrene high binding plate. The plate with antibody is incubated overnight at 4 C., after which the plate is washed 2 with 200 L of PBS. Next, 200 L of buffer containing 1% BSA and 0.05% Tween-20 in PBS (Incubation Buffer) is added to each well followed by incubation at room temperature for 1 hour. Plates are washed 5 with PBS containing 0.05% Tween-20. Frozen Triton lysis test samples are thawed and diluted 1:6 with incubation buffer and 100 L of test sample is aliquoted to wells of the ApoE antibody plate. Incubation is for 1 hour at room temperature followed by a 5 wash with PBS containing 0.05% Tween-20. After washing, 100 L of biotinylated anti-ApoE antibody (Mabtech, Cat. ANo. E887-biotin), diluted 1:500 in incubation buffer, is added to each well and incubated for 1 hour at room temperature, followed by a 5 wash with 0.05% Tween-20 in PBS. 100 L per well, of Streptavidin-HPR (Thermo, Cat. No. TS-125-HR), is then added and incubated for 1 hour at room temperature. After washing 5 with 0.05% Tween-20 in PBS, 100 L of TMB Substrate (Thermo, Cat. No. 34028) is added to each well, followed by incubation at room temperature for 20 minutes in the dark. The colorimetric reaction is stopped with 100 L of TMB Stop Solution (KPL, Cat. No. 50-85-04) and absorbance at 450 nm is determined. An ApoE standard curve is prepared by diluting rhesus Recombinant ApoE in incubation buffer with 0.03% Triton X-100 with concentrations ranging from 100 ng/mL to 0.78 ng/mL. ApoE standards are evaluated in the ELISA in parallel to the test samples. A rhesus serum only (no LNP) control is utilized to obtain a background subtraction for non-LNP dependent ApoE signal in the ELISA.

Stem Loop RT-PCR Protocol

[0212] To normalize to the ApoE bound to the amount of LNP bound to the anti-PEG antibody plate, the amount of siRNA retained in the anti-PEG antibody well is quantitated by stem-loop PCR and related to the number of siRNAs encapsulated per LNP, to give an approximate measure of total LNP particles bound per well.

Preparation of the Spiked Standard Curve Samples:

[0213] The standard curve is prepared using the molecular weight of the siRNA (13693 g/mol for ApoB 17063) to calculate the copy number. The high standard should contain 10.sup.11 copies per 3 l. A 10-fold serial dilution is performed across a row of an assay plate until the lowest standard contains 10.sup.2 copies per 3 l. One could dilute 0.2% Triton X-100 1:80 in water and pipette 20 L of the diluted Triton X-100 into 10 wells of a 96 well plate. 30 L of the serial diluted standard curve and mix is added to each well of the plate. 10 L of the spiked standard curve is used in the reverse transcription reaction.

Stem-Loop RT-PCRTest Samples and Standard Curve:

[0214] Triton lysates from the PEG antibody plate capture is diluted 1 to 2000 in nuclease free water. 10 L of RT-Primer Mix (Applied Biosystem's TaqMan MicroRNA Reverse Transcription Kit Cat. No. 4366596) is added to each well of a 96-well Micro-Amp QPCR plate (ABI Cat# N801-0560).

TABLE-US-00011 RT Primer Mix Components L/rxn Final conc. ApoB RT-primer (10 uM) 0.6 200 nM 10x buffer 2 Water 7.4

TABLE-US-00012 ApoBRTprimersequence: (SEQ.ID.NO.:11) 5 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCT TTAACA3

[0215] 10 L of each test sample (diluted 1 to 2000) or spiked standard curve (above) is aliquoted into the 96-well plate. The plate is covered with a mat (ABI Cat. No. N801-0550), to minimize evaporation. The plate is briefly centrifuged at 800 rpm for 1 minute. Next, the plate is run on a thermocycler using the following cycling parameters:

TABLE-US-00013 Cycling: 94 C. 10 minutes 75 C. 2 minutes 60 C. 3 minutes 50 C. 3 minutes 40 C. 3 minutes 30 C. 3 minutes 4 C. hold

[0216] Next, 10 L of RT Mix is added to each well (Applied Biosystem's TaqMan MicroRNA Reverse Transcription Kit Cat. No. 4366596)

TABLE-US-00014 RT Mix Components L/rxn 100 mM dNTP 0.3 10x RT buffer 1 Rnase Inhibitor 0.38 Multiscribe RT enzyme 1 Water 7.32

[0217] The RT cycling reaction is composed of 10 L test sample, 10 L of RT primer mix and 10 L of RT Mix components for a total volume of 30 L. The final concentration of the RT-primer in the total 30 L total RT mix is 200 nM. The plate is then sealed with the same plate mat, briefly centrifuged at 800 rpm for 1 minute, then run on the thermocycler using the following cycling parameters:

TABLE-US-00015 Cycling: 16 C. 30 minutes 42 C. 30 minutes 85 C. 5 minutes 4 C. hold

[0218] Next, 15 L of Fast Enzyme/primer-probe mix is added to each well of a new Fast 96-well plate (Applied Biosystem's TaqMan Fast Universal PCR Master Mix, Cat. No. 4352042)

TABLE-US-00016 ApoB PCR Master Mix Components L/rxn Final Conc. Fast Enyzme Mix (2x stock) 10 forward primer (100 uM) 0.18 900 nM reverse primer (100 uM) 0.18 900 nM probe (10 uM) 0.05 250 nM Water 4.59

TABLE-US-00017 ApoBprimersandprobesequence: 17063DCF3 (SEQ.ID.NO.:12) GGCGCGAAATTTCAGGAATTGT 17063DCPr2 (SEQ.ID.NO.:13) CACTGGATACCTACCTTTAACA UniversalR2 (SEQ.ID.NO.:14) AGTGCAGGGTCCGAG

[0219] 5 L of each RT reaction is added to the Fast Enzyme Mix plate. The plate is centrifuged for 1 minute at 1000 rpm and the QPCR analysis is performed on an ABI7900 with Fast Block. Cycling parameters is: 1 cycle95 C. for 20 seconds, followed by 40 Cycles95 C. for 1 seconds, 60 C. for 20 seconds.

[0220] The QPCR result is utilized to calculate the siRNA concentration in the PEG antibody capture plate Triton lysates. Based on an estimate of 500 siRNA per LNP particle, the number of LNPs retained in each well of the anti-PEG antibody plate can be calculated. Using the ApoE concentration per well, as determined by the ApoE ELISA and the number of LNP particles per well, an approximate ApoE molecules bound per LNP particle can be calculated.

Example 3

Heparin Sepharose HI-TRAP Binding Assay

[0221] Lipid nanoparticles (LNP) with neutral surface charge are not retained after injection onto heparin sepharose with 1 Dulbecco's phosphate buffered saline (DPBS) as the running buffer but elute in the column void volume. Serum apolipoprotein E (ApoE) exhibits high affinity binding with heparin sulfate and it can be shown that LNPs bind to heparin sepharose to an extent dependent on their intrinsic ability to bind ApoE (depending on both lipid nanoparticle composition and ApoE concentration) after incubation with purified and/or recombinant human ApoE or serum samples. Lipid nanoparticles with surface bound ApoE bind to heparin sepharose with high affinity can be eluted only at high salt (1 M NaCl).

[0222] A heparin sepharose binding assay is developed to assess serum ApoE binding to lipid nanoparticles based on the high affinity interaction that ApoE-LNP complexes exhibit toward heparin sepharose.

Incubations

[0223] Lipid nanoparticles are incubated at 37 C. for 20 min at a final siRNA concentration of 50 g/mL with various concentrations of either purified or recombinant human apolipoprotein E or 0.1-50% rat/mouse/rhesus monkey/human serum in 1 Dulbecco's phosphate buffered saline (DPBS). After incubation with ApoE or serum LNP samples are diluted 10-fold using 1DPBS and analyzed by heparin sepharose chromatography. Peak area of retained LNP (after subtraction of appropriate blank signals) is compared to total peak area of LNP control without ApoE and/or serum incubation to determine the percentage of the LNP which undergoes shift to high affinity heparin interaction after incubation with ApoE/serum.

Heparin Sepharose HI-TRAP Chromatographic Conditions

[0224] A heparin sepharose HI-TRAP chromatography column (GE Healthcare; 1 mL bed volume) is equilibrated with either 1 or 2 Dulbecco's PBS; the higher 2 salt concentration is used for LNPs with higher intrinsic retention on heparin sepharose (presumably due to higher positive surface charge).

Mobile Phase A: 1 or 2DPBS

[0225] Mobile Phase B: 1M NaCl in 10 mM sodium phosphate buffer, pH 7.0
100% A delivered isocratically for 10 min followed by step gradient to 100% B; hold for additional 10 min; step gradient back to 100% A and reequilibrate for additional 10 min prior to injection of next sample
Flow rate: 1 mL/min
Sample injection volume: 50 L.

Detection: UV @260 nm

Example 4

Rat In Vivo Evaluation of Efficacy and Toxicity

[0226] LNPs utilizing compounds in the nominal compositions described above, are evaluated for in vivo efficacy and increases in alanine amino transferase and aspartate amino transferase in Sprague-Dawley (Crl:CD(SD) female rats (Charles River Labs). The siRNA targets the mRNA transcript for the ApoB gene (Accession # NM 019287). The primary sequence and chemical modification pattern of the ApoB siRNA is displayed above. The RDVs (containing siRNA) in PBS vehicle are tail vein injected in a volume of 1 to 1.5 mL. Infusion rate is approximately 3 ml/min. Five rats are used in each dosing group. After LNP administration, rats are placed in cages with normal diet and water present. Six hours post dose, food is removed from the cages. Animal necropsy is performed 24 hours after LNP dosing. Rats are anesthetized under isoflurane for 5 minutes, then maintained under anesthesia by placing them in nose cones continuing the delivery of isoflurane until ex-sanguination is completed. Blood is collected from the vena cava using a 23 gauge butterfly venipuncture set and aliquoted to serum separator vacutainers for serum chemistry analysis. Punches of the excised caudate liver lobe is taken and placed in RNALater (Ambion) for mRNA analysis. Preserved liver tissue is homogenized and total RNA isolated using a Qiagen bead mill and the Qiagen miRNA-Easy RNA isolation kit following the manufacturer's instructions. Liver ApoB mRNA levels are determined by quantitative RT-PCR. Message is amplified from purified RNA utilizing a rat ApoB commercial probe set (Applied Biosystems Cat #RN01499054_m1). The PCR reaction is performed on an ABI 7500 instrument with a 96-well Fast Block. The ApoB mRNA level is normalized to the housekeeping PPIB (NM 011149) mRNA. PPIB mRNA levels are determined by RT-PCR using a commercial probe set (Applied Biosytems Cat. No. Mm00478295_m1). Results are expressed as a ratio of ApoB mRNA/PPIB mRNA. All mRNA data is expressed relative to the PBS control dose. Serum ALT and AST analysis is performed on the Siemens Advia 1800 Clinical Chemistry Analyzer utilizing the Siemens alanine aminotransferase (Cat#03039631) and aspartate aminotransferase (Cat#03039631) reagents.

Example 5

Determination of Cationic Lipid Levels in Rat/Monkey Liver

[0227] Liver tissue is weighed into 20-ml vials and homogenized in 9 v/w of water using a GenoGrinder 2000 (OPS Diagnostics, 1600 strokes/min, 5 min). A 50 L aliquot of each tissue homogenate is mixed with 300 L of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 L of each supernatant is then transferred to separate wells of a 96-well plate and 10 l samples were directly analyzed by LC/MS-MS.

[0228] Standards are prepared by spiking known amounts of a methanol stock solution of compound into untreated rat liver homogenate (9 vol water/weight liver). Aliquots (50 L) each standard/liver homogenate is mixed with 300 L of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 L of each supernatant is transferred to separate wells of a 96-well plate and 10 l of each standard is directly analyzed by LC/MS-MS.

[0229] Absolute quantification versus standards prepared and extracted from liver homogenate is performed using an Aria LX-2 HPLC system (Thermo Scientific) coupled to an API 4000 triple quadrupole mass spectrometer (Applied Biosystems). For each run, a total of 10 L sample is injected onto a BDS Hypersil C8 HPLC column (Thermo, 502 mm, 3 m) at ambient temperature.

[0230] Mobile Phase A: 95% H.sub.2O/5% methanol/10 mM ammonium formate/0.1% formic acid Mobile Phase B: 40% methanol/60% n-propanol/10 mM ammonium formate/0.1% formic acid The flow rate is 0.5 mL/min and gradient elution profile is as follows: hold at 80% A for 0.25 min, linear ramp to 100% B over 1.6 min, hold at 100% B for 2.5 min, then return and hold at 80% A for 1.75 min. Total run time is 5.8 min. API 4000 source parameters is CAD: 4, CUR: 15, GS1: 65, GS2: 35, IS: 4000, TEM: 550, CXP: 15, DP: 60, EP: 10.

Example 6

Rhesus Monkey In Vivo Evaluation of ApoB Efficacy

[0231] LNPs utilizing compounds in the nominal compositions described above, are evaluated for in vivo efficacy in male or female Macaca mulatta (rhesus) monkeys. The siRNA targets the mRNA transcript for the ApoB gene (Accession # XM 001097404). The primary sequence and chemical modification pattern of the ApoB siRNA is displayed above. The RDVs (containing siRNA) in PBS vehicle are administered by intravenous injection in the saphenous vein at an injection rate of 20 mL/minute to a dose level of 0.25 mg/kilogram siRNA. The injection volumes are from 1.9 to 2.1 mL/kilogram and monkeys can range in weight from 2.5 to 4.5 kilograms. The RDV or PBS control is administered to three monkeys. At multiple days post dose, 1 mL blood samples are drawn from the femoral artery for serum chemistry analysis. Monkeys are fasted overnight prior to blood draws. As a measure of efficacy, LDL-C is monitored as a downstream surrogate marker of ApoB mRNA reduction.

Example 7

Rhesus Monkey In Vivo Evaluation of -Catenin Efficacy

[0232] On study day 7 predose liver biopsy samples (0.5-1 gram/sample) are collected from male rhesus monkeys by laparoscopic surgical resection (resection of one biopsy sample from outer edge of one randomly selected liver lobe per monkey). A 5 mm tissue punch is used to sample three non-adjacent 50 mg samples from each predose biopsy. Samples are preserved in RNAlater (Ambion) for later CTNNB1 mRNA analysis.

[0233] On study day 0 monkeys are administered suspensions of the lipid nanoparticle (LNP) test articles in phosphate buffered saline (0.05-0.1 mg siRNA/mL) via single-dose intravenous bolus injection at target doses of 0.67, 1.34 or 3.34 mg siRNA/m.sup.2. For dosing purposes, body surface area (m.sup.2) is estimated from body weight according to the established allometric scaling relationship given below (1):


BSA (m.sup.2)=0.11 BW (in kg).sup.0.65

[0234] On study days 2 and 7, at 48 hours and 168 hrs post LNP administration, liver biopsy samples (0.5-1 gram/sample) are collected from monkeys by laparoscopic surgical resection (2 separate randomly selected liver lobes were resected per monkey). A 5 mm tissue punch is used to sample three non-adjacent 50 mg samples per each 48 hr and 168 hr surgical biopsy sample. Samples are preserved in RNAlater (Ambion) for later CTNNB1 mRNA analysis.

[0235] CTNNB1 mRNA levels are measured by relative quantitative RT-PCR using a primer/probe set validated for CTNNB1 and normalized against mRNA levels of peptidylprolyl isomerase B (also known as PPIB or cyclophilin B) and RNA levels of 18S ribosomal RNA (18S rRNA). Change in CTNNB1 mRNA liver expression are measured as the difference in PCR threshold cycle number (Ct) between post-dose samples and each corresponding monkey's predose liver samples.

[0236] Calculation of CTNNB1 mRNA knockdown (with respect to pretreatment levels) is calculated from Ct using the following relationship:


mRNA (% knockdown)=100(100/2.sup.Ct)

(1) FDA Guidance Document: Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers July 2005, US Department of Health and Human Services, Food and Drug AdministrationCenter for Drug Evaluation and Research (CDER)

Example 8

Rhesus Monkey In Vivo Evaluation of ALT Increases

[0237] Alanine aminotransferase (ALT) is measured in serum that is harvested from clotted monkey whole blood after centrifugation. A Roche Modular System automated chemistry analyzer measures the enzymatic activity of ALT in the serum by using International Federation of Clinical Chemistry standardized procedures and reagents. The analyzer's computer uses absorbance measurements to calculated ALT activity in the sample as compared to a standard curve. The ALT activity is reported in International Units per Liter (IU/L).