Tumor antigens for determining cancer therapy

Abstract

The present invention relates to the treatment of cancer, in particular breast cancer, particularly triple-negative breast cancer. More particularly, the invention concerns methods and means for cancer treatment involving a specific set of tumor antigens.

Claims

1. A method for treating triple negative breast cancer in a patient comprising a) determining the expression pattern of a set of tumor antigens in a sample from the patient, wherein the set of tumor antigens comprises CXorf61 and preferentially expressed antigen in melanoma (PRAME); b) diagnosing the patient as needing a cancer therapy regimen based on the determined expression pattern of CXorf61 and PRAME; and c) treating the patient with an immunotherapeutic that targets those tumor antigens selected from the set of tumor antigens expressed in the patient.

2. The method of claim 1 wherein the set of tumor antigens further comprises cancer antigen 1 (CAGE1).

3. The method of claim 1 wherein the expression pattern is determined in a sample obtained from a triple negative breast cancer patient.

4. The method of claim 3 wherein the sample comprises cancer cells.

5. The method of claim 1 wherein determining the expression pattern comprises a quantitative and/or qualitative determination of the expression of the tumor antigens.

6. The method of claim 1 wherein determining the expression pattern comprises determining the expression of RNA and/or protein of the tumor antigens.

7. The method of claim 1 wherein the immunotherapeutic provides one or more T cell epitopes of each of those tumor antigens of the set of tumor antigens which are expressed in cancer cells of the patient.

8. The method of claim 1 wherein the immunotherapeutic is an RNA vaccine.

9. A method for preventing or treating triple negative breast cancer in a patient comprising administering to said patient an immunotherapeutic targeting each tumor antigen of a set of tumor antigens, wherein the set of tumor antigens comprises CXorf61 and preferentially expressed antigen in melanoma (PRAME).

10. The method of claim 9 wherein the set of tumor antigens further comprises cancer antigen 1 (CAGE1).

11. The method of claim 9 which comprises inducing an immune response in the patient against each tumor antigen of the set of tumor antigens.

12. The method of claim 11 wherein the immune response comprises a cellular response.

13. The method of claim 12 wherein the immunotherapeutic is a vaccine and the cellular response is induced by administering the vaccine providing one or more T cell epitopes of each tumor antigen of the set of tumor antigens to the patient.

14. The method of claim 13 wherein the one or more T cell epitopes are comprised in the vaccine in one or more peptides or polypeptides wherein said one or more peptides or polypeptides following administration are processed to produce the one or more T cell epitopes.

15. The method of claim 13 wherein the vaccine is an RNA vaccine.

Description

FIGURES

(1) FIG. 1: Analysis of Tumor Antigen Expression in Breast Cancer

(2) FIG. 2: Analysis of Tumor Antigen Expression in Triple-Negative Breast Cancer (TNBC)

(3) A combination of only three tumor antigens, CXorf61, CAGE1 and PRAME, is sufficient to represent 95% of the analysed samples.

(4) FIGS. 3A, 3B, and 3C: Box-Whiskers-Plot Showing the Distribution of Transcripts in Breast Cancer Samples

(5) Distribution of transcripts for CXORF61 (FIG. 3A), PRAME (FIG. 3B), and CAGE1 (FIG. 3C) is shown irrespectively of the subtype (allbreast:tumor), in the breast cancer samples without the TNBC subtype (breast:tumor) and the TNBC subtype.

(6) FIG. 4: Expression of CXORF61 on the Protein Level

(7) FIG. 5: Tumor Specificity of CXORF61, CAGE1 and PRAME

(8) FIGS. 6A and 6B: Identification of T Cell Epitopes for CXORF61

(9) FIG. 6A shows predicted HLA-A*0201 binding peptides. FIG. 6B shows spleen cell reactivity against CXORF61 peptide pool or predicted HLA-A*02-binding CXORF61-derived peptides A2-1-6.

(10) FIG. 7: Testing of T Cell Receptors for Specificity with T Cell Epitopes for CXORF61

(11) FIG. 8: CXorf61 Transcript Sequence Predicted from NGS Analysis

(12) The known CXorf61 sequence (NM_001017978.3) is indicated. The new predicted sequence is in bold.

(13) FIG. 9: The Existence of the CXorf61-iso1 transcript can be confirmed by PCR RT-PCR analysis was performed with the indicated primers (for primer sequences see Table 1) using the following cDNAs: 1 Normal testis, 2 MDA-MB468, 3 MDA-MB231.

(14) FIG. 10: CXorf61-iso1 is Not Expressed in Normal Tissues

(15) The indicated normal tissues (n=65) were analysed by qRT-PCR with primers specific for CXorf61 or CXorf61-iso1. Relative expression was calculated with the ΔΔCt method using HPRT as housekeeping gene.

(16) FIG. 11: CXorf61-iso1 is Expressed in Triple Negative Breast Cancer Tissues

(17) 29 triple negative breast cancer tissues were analysed by qRT-PCR with primers specific for CXorf61-iso1. Relative expression was calculated with the ΔΔCt method using HPRT as housekeeping gene.

(18) FIG. 12: Positions of the New Identified CAGE1 Exons

(19) As reference the CAGE1 structure as described in UCSC was used. The position of the primers used for expression analysis is shown. SEQ ID NO: 45 [NEW EXON 1]: light grey, SEQ ID NO: 46 [NEW EXON 2], dark grey

(20) FIG. 13: Expression of New CAGE1 Isoforms in Normal Tissues

(21) Expression of CAGE1-Tron1 (black columns) and CAGE1-Tron2 (grey columns) was analysed by qRT-PCR with primers 5527+4783 and primers 4782+5540 respectively in the indicated normal tissues. A positive tumor tissue was used as control. Relative expression was calculated with the ΔΔCt method using HPRT as housekeeping gene.

(22) FIG. 14: Expression of New CAGE1 Isoforms in Cancer Tissues

(23) 34 Tissues from Triple negatives breast cancer patients were analysed by qRT-PCR with primers specific for CAGE1-Tron1 (primers 5527+4783, dark columns) and CAGE1-Tron2 (primers 4782+5540, grey columns) respectively. Relative expression was calculated with the ΔΔCt method using HPRT as housekeeping gene.

EXAMPLES

(24) The techniques and methods used herein are described herein or carried out in a manner known per se and as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. All methods including the use of kits and reagents are carried out according to the manufacturers' information unless specifically indicated.

Example 1

Establishing a Set of Tumor Antigens Useful in a Large Fraction of Cancer Patients

(25) It was assessed whether it is possible to establish a set of tumor antigens which is shared at least partially by a large fraction of tumor patients and on the basis of which a set of vaccine products applicable to a broad spectrum of cancer patients can be provided.

(26) To this end, RNA was extracted from normal tissues or breast cancer samples using the RNeasy Lipid Tissue Mini Kit (Qiagen). cDNA synthesis was performed using the SuperScript II Reverse Transcriptase Kit (Invitrogen) and oligo-dT. Expression was analysed using the BioMark™ HD System system (Fluidigm) and the relative expression was calculated using HPRT as house keeping gene.

(27) In this manner, the relative expression of several genes could be detected. The % of positive samples, using a threshold of relative expression of 30000, changed depending on whether all breast cancer samples, irrespectively of the subtype (n=35), were analysed (FIG. 1) or only the TNBC (n=61) subtype was analysed (FIG. 2). Particularly the three transcripts PRAME, CXORF61 and CAGE1, are sufficient to represent about 95% of the analysed patient samples in the TNBC group and 35% in the all breast cancer group. The distribution of the three transcripts in the breast cancer samples, irrespectively of the subtype (allbreast:tumor), in the breast cancer samples without the TNBC subtype (breast:tumor) and the TNBC subtype is shown as Box-Whiskers-Plot in FIG. 3A (CXORF61), FIG. 3B (PRAME), FIG. 3C (CAGE1).

(28) FIG. 4 shows expression of CXORF61 also on the protein level. For the analysis, total protein extracts were generated from 8 human TNBC samples and normalized to β-actin (FIG. 4, lowest panel). CXORF61 expression was analyzed by immunoblotting with a specific antibody (FIG. 4, upper panel). A negative cell lines (Hek-mock) and a positive cell line, Hek transfected with a plasmid coding for CXORF61 (Hek-CXORf61) were used as control. CXORF6 is detectable in 5 out of 8 tested triple-negative breast cancer samples (FIG. 4, lanes 3-5, 7-8).

Example 2

Analysis of Tumor Specificity of CXORF61, CAGE1 and PRAME

(29) The tumor specificity of the three transcripts was analysed by qRT-PCR in a large set of normal tissues (n=65). As shown in FIG. 5, high expression (>30.000) of CXORF61 was detectable only in testis, high expression of PRAME was detectable in testis, endometrium and epididymis. CAGE1 shows only weak expression in testis. In contrast, Erbb2, a generally accepted target for vaccination and other immunotherapeutic approaches, shows a high expression in several normal tissues.

Example 3

T Cell Epitopes of CXORF61, CAGE1 and PRAME

(30) For CXORF61, TCR epitopes were identified by ex-vivo reactivity, analyzed by IFNγ-ELISPOT assay, of spleen cells from CXORF6 immunized HLA-A*02-transgenic mice against CXORF61-derived peptides. To this end, HLA-A*02 binding peptides derived from CXORF61 were predicted applying the SYFPEITHY algorithm (FIG. 6A). Spleen cells were analyzed for reactivity against CXORF61 peptide pool or predicted HLA-A*02-binding CXORF61-derived peptides A2-1-6 (FIG. 6B). Positive control: PMA-treated spleen cells; negative control: an irrelevant peptide pool (HIV-gag), irrelevant nonamer peptide (PLAC1-31-39). Two A2-restricted epitopes were identified (peptide A2-2 and A2-4).

(31) After isolation of TCRs from CD8+ T cells of CXORF61-immunized mice, CD8+ T cells of a HLA-A*02-positive healthy donor were transfected with TCR-α/β chain RNAs and tested by IFNγ-ELISPOT assay for recognition of K562-A2 cells transfected with CXORF61 RNA or pulsed with CXORF61 overlapping 15mer peptides (=CXORF61 pool) or HLA-A*02 binding peptides CXORF61-A2-2/4 (FIG. 7). Negative controls: irrelevant peptide pool (HIV-gag), irrelevant 9mer peptide (Plac1-31-39); Positive control: SEB. Three TCRs were specific for peptide A-2 and one TCR for peptide A2-4.

(32) For PRAME a large number of T cell epitopes has been reported to elicit antitumoral cytotoxic T cell responses. In a publication by Kessler et al. (2001, J. Exp. Med. 193(1):73-88) four HLA-A*0201-presented cytotoxic T lymphocyte (CTL) PRAME epitopes (VLDGLDVLL, SLYSFPEPEA, ALYVDSLFFL, and SLLQHLIGL) are reported. The publication demonstrated the lysis of mammary carcinoma cell lines for these epitopes. Further PRAME epitopes eliciting a immune response by cytotoxic T lymphocytes have been identified by Kessler et al. (2003, Hum Immunol. 64(2):245-55) (LPRELFPPL, LPRRLFPPLF, FPPLFMAAF, IPVEVLVDLF, LPTLAKFSPY, CPHCGDRTFY, EPILCPCFM, HLA-B35), Kawahara et al. (2006, Exp Hematol. 34(11):1496-504) (GQHLHLETF, HLA-B*62), and Quintarelli et al. (2011, Blood 117(12):3353-62) (NLTHVLYPV, HLA-A*02).

(33) For CAGE1 a publication about serological analysis of cDNA expression libraries (SEREX) showed that cancer patients specifically developed auto-antibodies against this target (Park et al., 2003, Biochim Biophys Acta. 1625(2):173-82). Induction of cytolytic T lymphocyte (CTL) reactions has been reported for several cancer/testis antigens.

Example 4

Identification of a CXorf61 Isoform Strictly Expressed in Tumor Tissues

(34) A new CXorf61 transcript was identified by Next Generation Sequencing, which is expressed in tumor cell lines but not in normal testis. This sequence has a longer 3′ UTR and does not change the CXorf61 Open Reading Frame (ORF) (FIG. 8).

(35) To confirm the existence of a longer CXorf61 transcript, the predicted sequence was amplified using primers binding at the 5′ of the known sequence and in the new predicted 3′ (primers 3873+3875) (FIG. 9). As control, primers binding in NM_001017978.3 were used (primers 3873+3874). While the NM_001017978.3 sequence can be detected in normal testis and breast tumor cell lines MDA-MB468 and MDA-MB231, the new sequence can be detected only in the breast tumor cell lines. The PCR product was sent to sequencing, confirming the existence of the predicted sequence.

(36) Relative expression of CXorf61-iso1 was analyzed by qRT-PCR using the Fluidigm system (primers 2898+3876). While expression of CXorf61 (primers 2898+2899) was detectable very strongly in normal testis and weakly in epididymis and placenta, only irrelevant expression in normal testis was found for CXorf61-iso1 (FIG. 10).

(37) Relative expression of CXorf61-iso1 was analyzed by qRT-PCR using the Fluidigm system in triple negative breast cancer patient samples with primers 2898+3876 (FIG. 11). Using a threshold of 10000, 59% of the samples were positive for CXorf61-iso1.

(38) TABLE-US-00001 TABLE 1 Sequence of the primers used Primer Sequence (5′-3′) 3873 CCAAAGTTTCCCAAATCCAGGC 3874 ATCTACTCAAAGTGTCTTTAATGATTTCC 2898 GTGTGCCTTGATTGTCTTCTGG 3875 CTTTCTCTATTGTGCTTCCATTCC 3876 GTATCTGGATTTTTTGTATGTGACTTGGAAT 2899 CCTGGCTATTGAGTGTGGG

Example 5

Identification of CAGE1 Isoforms Strictly Expressed in Tumor Tissues

(39) By using Next Generation sequencing an alternative start codon in the CAGE1 sequence was identified. The existence of the new exon was confirmed by RT-PCR and sequencing. RT-PCR analysis was performed with primers 5274 and 5527 (for primers sequence see Table 2, for primers position see FIG. 12) using the cDNA of a Triple negative breast cancer patient. The amplified products were extracted from the gel and were sequenced.

(40) TABLE-US-00002 TABLE 2 Sequence of the primers used for expression analysis Primer number Sequence (5′-3′) 5274 GACTCTTCCTGGAGTGGTTGA 5540 GAACCCCGGAAGTGGAGGTT 4783 GGTCATGGACTTCGGATGATT 4782 AGGATTTAATTAGAAAGCCCAGAGA 5527 CTCTACCCCTGTATTTCGCTTG

(41) The position of the primers used for expression analysis is shown in FIG. 12. The light grey bar indicates the exon at 5′ and the dark grey bar the exon at 3′ of the same figure. The new isoforms are shorter as the known CAGE1 isoforms. The new identified CAGE1 isoforms are SEQ ID NO: 41 [CAGE1-TRON1] and 42 [CAGE1-TRON2] encoding for the predicted ORFs of SEQ ID NO: 43 [CAGE1-TRON1-ORF] and 44 [CAGE1-TRON2-ORF], respectively. CAGE1-TRON1 comprises the new exon of SEQ ID NO: 45 and CAGE1-TRON2 comprises the new exons SEQ ID NO: 45 and 46. As reference the CAGE1 structure as described in UCSC was used:

(42) TABLE-US-00003 TABLE 3 CAGE1 reference sequences CAGE1 (uc021ylc.1) at chr6: 7326887-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 3, mRNA. CAGE1 (uc003mxl.2) at chr6: 7326887-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 1, mRNA. CAGE1 (uc003mxk.2) at chr6: 7329330-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 2, mRNA. CAGE1 (uc003mxj.3) at chr6: 7326887-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 1, mRNA. CAGE1 (uc003mxh.3) at chr6: 7326887-7374364 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 1, mRNA.

(43) CAGE1-Tron1 and CAGE1-Tron2 have a restricted expression in normal tissues. Relative expression of CAGE1-Tron1 and CAGE1-Tron2 was analysed in 60 normal tissues, including several brain areas by qRT-PCR using the Fluidigm technology. Expression of CAGE1-Tron1 was detected in placenta and at less extent in testis. No expression of CAGE1-Tron 2 was detected in any normal tissues (FIG. 13).

(44) CAGE1-Tron1 and CAGE1-Tron2 are expressed in Triple negative breast cancer tissues. Relative expression of CAGE1-Tron1 and CAGE1-Tron2 was analyzed by qRT-PCR in 34 triple negative breast cancer patient samples. Using a cut off of 100, 73% of the tumors are positive for CAGE1-Tron1 and 32% for CAGE1-Tron2 (FIG. 14).