Antisense antibacterial method and compound
09534220 ยท 2017-01-03
Assignee
Inventors
Cpc classification
C07F9/65613
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C07F9/6558
CHEMISTRY; METALLURGY
Abstract
A method and antisense compound for inhibiting the growth of pathogenic bacterial cells are disclosed. The compound contains no more than 12 nucleotide bases and has a targeting nucleic acid sequence of no fewer than 10 bases in length that is complementary to a target sequence containing or within 10 bases, in a downstream direction, of the translational start codon of a bacterial mRNA that encodes a bacterial protein essential for bacterial replication. The compound binds to a target mRNA with a T.sub.m of between 50 to 60 C. The relatively short antisense compounds are substantially more active than conventional antisense compounds having a targeting base sequence of 15 or more bases.
Claims
1. A method of inhibiting the growth of pathogenic bacterial cells, comprising exposing the bacterial cells to a growth-inhibiting amount of a substantially uncharged antisense oligonucleotide compound of 10 to 12 bases in length having a targeting sequence of at least 10 bases that are complementary to a target sequence containing or within 10 bases downstream of the translational start codon of a bacterial mRNA that encodes a bacterial protein selected from the group consisting of acyl carrier protein (acpP), gyrase A subunit (gyrA), and the cell division protein ftsZ, wherein the antisense oligonucleotide compound is a morpholino antisense oligonucleotide.
2. The method of claim 1, wherein the morpholino subunits of the antisense oligonucleotide compound are joined by phosphorus-containing linkages, in accordance with the structure: ##STR00003## where Y.sub.1O, ZO, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, amino or alkyl amino, including dialkylamino.
3. The method of claim 1, wherein the targeting sequence is complementary to a target sequence containing the translational start codon of the bacterial mRNA.
4. The method of claim 1, wherein the targeting sequence is complementary to a target sequence that is within 10 bases downstream of the translational start codon of the bacterial mRNA.
5. The method of claim 1, wherein the antisense oligonucleotide compound contains 11 bases, and has a nucleic acid sequence that is completely complementary to the mRNA target sequence.
6. The method of claim 1, for use in inhibiting a bacterial infection in a mammalian subject, wherein said exposing includes administering the antisense oligonucleotide compound in a therapeutically effective amount.
7. The method of claim 6, further comprising the step of treating the subject by administration of a non-antisense compound having antibacterial activity.
8. A substantially uncharged antisense oligonucleotide compound of 10 to 12 bases in length having a targeting sequence of at least 10 bases that are complementary to a target sequence containing or within 10 bases downstream of the translational start codon of a bacterial mRNA that encodes a bacterial protein selected from the group consisting of acyl carrier protein (acpP), gyrase A subunit (gyrA), and the cell division protein ftsZ, wherein the antisense oligonucleotide compound is a morpholino antisense oligonucleotide.
9. The antisense oligonucleotide compound of claim 8, wherein the bacterial mRNA encodes the ftsZ protein, and the targeting sequence is complementary to at least ten contiguous bases in a sequence selected from the group consisting of SEQ ID NOS: 1, 4, 7, 10, 13, 16, 19, 22, 27, 30, 33, 38, 41, 44, 47, 50, 53, and 56.
10. The antisense oligonucleotide compound of claim 8, wherein the bacterial mRNA encodes the acpP protein, and the targeting sequence is complementary to at least ten contiguous bases in a sequence selected from the group consisting of SEQ ID NOS: 2, 5, 8, 11, 14, 17, 23, 28, 31, 34, 36, 39, 42, 45, 48, 51, 54, and 57.
11. The antisense oligonucleotide compound of claim 8, wherein the bacterial mRNA encodes the gyrA protein, and the targeting sequence is complementary to at least ten contiguous bases in a sequence selected from the group consisting of SEQ ID NOS: 3, 6, 9, 12, 15, 18, 20, 24, 29, 32, 35, 37, 40, 43, 46, 49, 52, 55, and 58.
12. The antisense oligonucleotide compound of claim 8, wherein the morpholino subunits of the antisense oligonucleotide compound are joined by phosphorus-containing linkages, in accordance with the structure: ##STR00004## where Y.sub.1O, ZO, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, amino or alkyl amino, including dialkylamino.
13. The antisense oligonucleotide compound of claim 8, wherein the targeting sequence is complementary to a target sequence containing the translational start codon of the bacterial mRNA.
14. The antisense oligonucleotide compound of claim 8, wherein the targeting sequence is complementary to a target sequence that is within 10 bases downstream of the translational start codon of the bacterial mRNA.
15. The antisense oligonucleotide compound of claim 8, which contains 11 bases, and has a nucleic acid sequence that is completely complementary to the mRNA target sequence.
16. The antisense oligonucleotide compound of claim 8, which contains 10 bases, and has a nucleic acid sequence that is completely complementary to the mRNA target sequence.
17. The method of claim 1, wherein the bacterial mRNA encodes the ftsZ protein, and the targeting sequence is complementary to at least ten contiguous bases in a sequence selected from the group consisting of SEQ ID NOS: 1, 4, 7, 10, 13, 16, 19, 22, 27, 30, 33, 38, 41, 44, 47, 50, 53, and 56.
18. The method of claim 1, wherein the bacterial mRNA encodes the acpP protein, and the targeting sequence is complementary to at least ten contiguous bases in a sequence selected from the group consisting of SEQ ID NOS: 2, 5, 8, 11, 14, 17, 23, 28, 31, 34, 36, 39, 42, 45, 48, 51, 54, and 57.
19. The method of claim 1, wherein the bacterial mRNA encodes the gyrA protein, and the targeting sequence is complementary to at least ten contiguous bases in a sequence selected from the group consisting of SEQ ID NOS: 3, 6, 9, 12, 15, 18, 20, 24, 29, 32, 35, 37, 40, 43, 46, 49, 52, 55, and 58.
20. The method of claim 2, wherein the phosphorus-containing linkages are phosphorodiamidate linkages.
21. The method of claim 20, wherein each X is NR.sub.2 wherein each R is CH.sub.3.
22. The method of claim 2, wherein up to one of every five phosphorus-containing linkages is positively charged, wherein X is 1-piperazine.
23. The antisense oligonucleotide compound of claim 12, wherein the phosphorus-containing linkages are phosphorodiamidate linkages.
24. The antisense oligonucleotide compound of claim 23, wherein each X is NR.sub.2 wherein each R is CH.sub.3.
25. The antisense oligonucleotide compound of claim 12, wherein up to one of every five phosphorus-containing linkages is positively charged, wherein X is 1-piperazine.
26. An antisense oligonucleotide of 11 nucleotide bases for inhibiting the growth of pathogenic bacterial cells comprising a base sequence of CTTCGATAGTG (SEQ ID NO: 109) that is completely complementary to a bacterial mRNA that encodes the acyl carrier protein (acpP), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide.
27. The antisense oligonucleotide of claim 26, wherein the antisense oligonucleotide is conjugated to a polyethylene glycol moiety.
28. An antisense oligonucleotide of 10 nucleotide bases for inhibiting the growth of pathogenic bacterial cells comprising a base sequence of TTCGATAGTG (SEQ ID NO: 110) that is completely complementary to a bacterial mRNA that encodes the acyl carrier protein (acpP), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide.
29. The antisense oligonucleotide of claim 28, wherein the antisense oligonucleotide is conjugated to a polyethylene glycol moiety.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
(15) The terms below, as used herein, have the following meanings, unless indicated otherwise:
(16) As used herein, the terms compound, agent, oligomer and oligonucleotide may be used interchangeably with respect to the antisense oligonucleotides or oligonucleotide analogs of the invention.
(17) As used herein, the terms antisense oligonucleotide and antisense oligomer or antisense compound or antisense oligomer compound are used interchangeably and refer to a sequence of subunits, each having a base carried on a backbone subunit composed of ribose or other pentose sugar or morpholino group, and where the backbone groups are linked by intersubunit linkages (most or all of which are uncharged) that allow the bases in the compound to hybridize to a target sequence in an RNA by Watson-Crick base pairing, to form an RNA:oligomer heteroduplex within the target sequence. The oligomer may have exact sequence complementarity to the target sequence or near complementarity. Such antisense oligomers are designed to block or inhibit translation of the mRNA containing the target sequence, and may be said to be directed to a sequence with which it hybridizes. Exemplary structures for antisense oligonucleotides for use in the invention include the -morpholino subunit types shown in
(18) As used herein antisense oligonucleotide compound, or antisense compound, or oligonucleotide compound, refers to an antisense oligonucleotide, or antisense oligomer, or oligonucleotide compound, or oligonucleotide analog, that may also include one or more additional moieties conjugated to the oligomer, e.g., at its 3- or 5-end, such as a polyethyleneglycol moiety or other hydrophilic polymer, e.g., one having 10-100 monomeric subunits, which may be useful in enhancing solubility, or a moiety such as a lipid or peptide moiety that is effective to enhance the uptake of the compound into target bacterial cells and/or enhance the activity of the compound within the cell, e.g., enhance its binding to a target polynucleotide.
(19) Subunit A in
(20) Subunit B in
(21) Subunits C-D in
(22) As used herein, a morpholino oligomer refers to a polymeric molecule having a backbone which supports bases capable of hydrogen bonding to typical polynucleotides, wherein the polymer lacks a pentose sugar backbone moiety, and more specifically a ribose backbone linked by phosphodiester bonds which is typical of nucleotides and nucleosides, but instead contains a ring nitrogen with coupling through the ring nitrogen. A preferred morpholino oligonucleotide is composed of morpholino subunit structures of the form shown in
(23) This preferred aspect of the invention is illustrated in
(24) As used herein, a nuclease-resistant oligomeric molecule (oligomer) is one whose backbone is not susceptible to nuclease cleavage of a phosphodiester bond. Exemplary nuclease resistant antisense oligomers are oligonucleotide analogs, such as phosphorothioate and phosphate-amine DNA (pnDNA), both of which have a charged backbone, and methyl-phosphonate, and morpholino oligonucleotides, all of which may have uncharged backbones.
(25) As used herein, an oligonucleotide or antisense oligomer specifically hybridizes to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a Tm greater than 37 C. As will be seen below, the oligomeric compounds of the present invention have Tm values with respect to their target mRNAs of between 50 and 60 C.
(26) The Tm of an oligonucleotide compound, with respect to its target mRNA, is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Tm is determined under standard conditions in physiological saline, as described, for example, in Miyada C. G. and Wallace R. B., 1987.
(27) Polynucleotides are described as complementary to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. A double-stranded polynucleotide can be complementary to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second. Complementarity (the degree that one polynucleotide is complementary with another) is quantifiable in terms of the proportion of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules.
(28) As used herein the term analog with reference to an oligomer means a substance possessing both structural and chemical properties similar to those of a reference oligomer.
(29) As used herein, a first sequence is an antisense sequence with respect to a second sequence if a polynucleotide whose sequence is the first sequence specifically binds to, or specifically hybridizes with, the second polynucleotide sequence under physiological conditions.
(30) As used herein, a base-specific intracellular binding event involving a target RNA refers to the sequence specific binding of an oligomer to a target RNA sequence inside a cell. For example, a single-stranded polynucleotide can specifically bind to a single-stranded polynucleotide that is complementary in sequence.
(31) As used herein, nuclease-resistant heteroduplex refers to a heteroduplex formed by the binding of an antisense oligomer to its complementary target, which is resistant to in vivo degradation by ubiquitous intracellular and extracellular nucleases.
(32) As used herein, essential bacterial genes are those genes whose products play an essential role in an organism's functional repertoire as determined using genetic footprinting or other comparable techniques to identify gene essentiality.
(33) An agent is actively taken up by bacterial cells when the agent can enter the cell by a mechanism other than passive diffusion across the cell membrane. The agent may be transported, for example, by active transport, referring to transport of agents across a mammalian cell membrane by e.g. an ATP-dependent transport mechanism, or by facilitated transport, referring to transport of antisense agents across the cell membrane by a transport mechanism that requires binding of the agent to a transport protein, which then facilitates passage of the bound agent across the membrane. For both active and facilitated transport, the oligonucleotide compound preferably has a substantially uncharged backbone, as defined below.
(34) As used herein, the terms modulating expression and antisense activity relative to an oligonucleotide refers to the ability of an antisense oligonucleotide (oligomer) to either enhance or reduce the expression of a given protein by interfering with the expression, or translation of RNA. In the case of reduced protein expression, the antisense oligomer may directly block expression of a given gene, or contribute to the accelerated breakdown of the RNA transcribed from that gene.
(35) As used herein, the term inhibiting bacterial growth refers to blocking or inhibiting replication and/or reducing the rate of replication of bacterial cells in a given environment, for example, in an infective mammalian host.
(36) As used herein, the term pathogenic bacterium, or pathogenic bacteria, or pathogenic bacterial cells, refers to bacterial cells capable of infecting a mammalian host and producing infection-related symptoms in the infected host, such as fever or other signs of inflammation, intestinal symptoms, respiratory symptoms, dehydration, and the like.
(37) As used herein, effective amount or therapeutically effective amount or growth-inhibiting amount relative to an antisense oligomer refers to the amount of antisense oligomer administered to a mammalian subject, either as a single dose or as part of a series of doses and which is effective to inhibit bacterial replication in an infected host, by inhibiting translation of a selected bacterial target nucleic acid sequence. The ability to block or inhibit bacterial replication in an infected host may be evidence by a reduction in infection-related symptoms.
(38) As used herein treatment of an individual or a cell is any type of intervention used in an attempt to alter the natural course of the individual or cell. Treatment includes, but is not limited to, administration of e.g., a pharmaceutical composition, and may be performed either prophylactically, or subsequent to the initiation of a pathologic event or contact with an etiologic agent.
II. Exemplary Oligomer Backbones
(39) Examples of nonionic linkages that may be used in oligonucleotide analogs are shown in
(40) A preferred oligomer structure employs morpholino-based subunits bearing base-pairing moieties as illustrated in
(41) Important properties of the morpholino-based subunits include: the ability to be linked in a oligomeric form by stable, uncharged backbone linkages; the ability to support a nucleotide base (e.g. adenine, cytosine, guanine, thymidine, uracil and inosine) such that the polymer formed can hybridize with a complementary-base target nucleic acid, including target RNA, Tm values above about 50 C. in relatively short oligomers (e.g., 10-12 bases); the ability of the oligomer to be actively or passively transported into bacterial cells; and the ability of the oligomer:RNA heteroduplex to resist RNAse degradation.
(42) A. Exemplary Oligomeric Compounds
(43) Exemplary backbone structures for antisense oligonucleotides of the invention include the -morpholino subunit types shown in
(44) The linkages shown in
(45) As noted above, the substantially uncharged oligomer may advantageously include a limited number of charged linkages, e.g. up to about 1 per every 5 uncharged linkages, more preferably up to about 1 per every 10 uncharged linkages. Therefore a small number of charged linkages, e.g. charged phosphoramidate or phosphorothioate, may also be incorporated into the oligomers. One such exemplary cationic linkage is shown in
(46) The antisense compounds can be prepared by stepwise solid-phase synthesis, employing methods detailed in the references cited above. In some cases, it may be desirable to add additional chemical moieties to the antisense compound, e.g. to enhance pharmacokinetics or to facilitate capture or detection of the compound. Such a moiety may be covalently attached, typically to a terminus of the oligomer, according to standard synthetic methods. For example, addition of a polyethyleneglycol moiety or other hydrophilic polymer, e.g., one having 10-100 monomeric subunits, may be useful in enhancing solubility. One or more charged groups, e.g., anionic charged groups such as an organic acid, may enhance cell uptake. A reporter moiety, such as fluorescein or a radiolabeled group, may be attached for purposes of detection. Alternatively, the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin. In selecting a moiety for attachment or modification of an antisense oligomer, it is generally of course desirable to select chemical compounds of groups that are biocompatible and likely to be tolerated by a subject without undesirable side effects.
(47) B. Antibacterial Antisense Oligomers
(48) In addition to the structural features described above, the antisense compound of the present invention contains no more than 15 nucleotide bases, preferably no more than 14 nucleotides, more preferably, no more than 12 nucleotide bases, and has a targeting nucleic acid sequence (the sequence which is complementary to the target sequence) of no fewer than 10 contiguous bases. The targeting sequence is complementary to a target sequence containing or within 10 bases, in a downstream direction, of the translational start codon of a bacterial mRNA that encodes a bacterial protein essential for bacterial replication. The compound has a T.sub.m, when hybridized with the target sequence, between about 50 to 60 C., although the Tm may be higher, e.g., 65 C. The selection of bacterial targets, and bacterial mRNA target sequences and complementary targeting sequences are considered in the two sections below.
III. Bacterial Targets
(49) This section considers a number of bacterial targets, including pathogenic bacteria, and specific bacterial protein targets against which the antisense compound can be directed.
(50) A. Bacterial Targets
(51) Escherichia coli (E. coli) is a Gram negative bacteria that is part of the normal flora of the gastrointestinal tract. There are hundreds of strains of E. coli, most of which are harmless and live in the gastrointestinal tract of healthy humans and animals. Currently, there are four recognized classes of enterovirulent E. coli (the EEC group) that cause gastroenteritis in humans. Among these are the enteropathogenic (EPEC) strains and those whose virulence mechanism is related to the excretion of typical E. coli enterotoxins. Such strains of E. coli can cause various diseases including those associated with infection of the gastrointestinal tract and urinary tract, septicemia, pneumonia, and meningitis. Antibiotics are not effective against some strains and do not necessarily prevent recurrence of infection.
(52) For example, E. coli strain O157:H7 is estimated to cause 10,000 to 20,000 cases of infection in the United States annually (Federal Centers for Disease Control and Prevention). Hemorrhagic colitis is the name of the acute disease caused by E. coli O157:H7. Preschool children and the elderly are at the greatest risk of serious complications. E. coli strain 0157: H7 was recently reported as the cause the death of four children who ate under cooked hamburgers from a fast-food restaurant in the Pacific Northwest. (See, e.g., Jackson et al., 1998)
(53) Exemplary sequences for enterovirulent E. coli strains include GenBank Accession Numbers AB011549, X97542, AF074613, Y11275 and AJ007716.
(54) Salmonella thyphimurium, are Gram negative bacteria which cause various conditions that range clinically from localized gastrointestinal infections, gastroenteritis (diarrhea, abdominal cramps, and fever) to enteric fevers (including typhoid fever) which are serious systemic illnesses. Salmonella infection also causes substantial losses of livestock.
(55) Typical of Gram-negative bacilli, the cell wall of Salmonella spp. contains a complex lipopolysaccharide (LPS) structure that is liberated upon lysis of the cell and may function as an endotoxin, which contributes to the virulence of the organism.
(56) Contaminated food is the major mode of transmission for non-typhoidal salmonella infection, due to the fact that Salmonella survive in meats and animal products that are not thoroughly cooked. The most common animal sources are chickens, turkeys, pigs, and cows; in addition to numerous other domestic and wild animals. The epidemiology of typhoid fever and other enteric fevers caused by Salmonella spp. is associated with water contaminated with human feces.
(57) Vaccines are available for typhoid fever and are partially effective; however, no vaccines are available for non-typhoidal Salmonella infection. Non-typhoidal salmonellosis is controlled by hygienic slaughtering practices and thorough cooking and refrigeration of food. Antibiotics are indicated for systemic disease, and Ampicillin has been used with some success. However, in patients under treatment with excessive amounts of antibiotics; patients under treatment with immunosuppressive drugs; following gastric surgery; and in patients with hemolytic anemia, leukemia, lymphoma, or AIDS, Salmonella infection remains a medical problem.
(58) Pseudomonas spp. are motile, Gram-negative rods which are clinically important because they are resistant to most antibiotics, and are a major cause of hospital acquired (nosocomial) infections. Infection is most common in: immunocompromised individuals, burn victims, individuals on respirators, individuals with indwelling catheters, IV narcotic users and individual with chronic pulmonary disease (e.g., cystic fibrosis). Although infection is rare in healthy individuals, it can occur at many sites and lead to urinary tract infections, sepsis, pneumonia, pharyngitis, and numerous other problems, and treatment often fails with greater significant mortality.
(59) Vibrio cholera is a Gram negative rod which infects humans and causes cholera, a disease spread by poor sanitation, resulting in contaminated water supplies. Vibrio cholerae can colonize the human small intestine, where it produces a toxin that disrupts ion transport across the mucosa, causing diarrhea and water loss. Individuals infected with Vibrio cholerae require rehydration either intravenously or orally with a solution containing electrolytes. The illness is generally self-limiting, however, death can occur from dehydration and loss of essential electrolytes. Antibiotics such as tetracycline have been demonstrated to shorten the course of the illness, and oral vaccines are currently under development.
(60) Neisseria gonorrhoea is a Gram negative coccus, which is the causative agent of the common sexually transmitted disease, gonorrhea. Neisseria gonorrhoea can vary its surface antigens, preventing development of immunity to reinfection. Nearly 750,000 cases of gonorrhea are reported annually in the United States, with an estimated 750,000 additional unreported cases annually, mostly among teenagers and young adults. Ampicillin, amoxicillin, or some type of penicillin used to be recommended for the treatment of gonorrhea. However, the incidence of penicillin-resistant gonorrhea is increasing, and new antibiotics given by injection, e.g., ceftriaxone or spectinomycin, are now used to treat most gonococcal infections.
(61) Staphylococcus aureus is a Gram positive coccus which normally colonizes the human nose and is sometimes found on the skin. Staphylococcus can cause bloodstream infections, pneumonia, and surgical-site infections in the hospital setting nosocomial infections). Staph. aureus can cause severe food poisoning, and many strains grow in food and produce exotoxins. Staphylococcus resistance to common antibiotics, e.g., vancomycin, has emerged in the United States and abroad as a major public health challenge both in community and hospital settings. Recently a vancomycin-resistant Staph. aureus isolate has also been identified in Japan.
(62) Mycobacterium tuberculosis is a Gram positive bacterium which is the causative agent of tuberculosis, a sometimes crippling and deadly disease. Tuberculosis is on the rise and globally and the leading cause of death from a single infectious disease (with a current death rate of three million people per year). It can affect several organs of the human body, including the brain, the kidneys and the bones, however, tuberculosis most commonly affects the lungs.
(63) In the United States, approximately ten million individuals are infected with Mycobacterium tuberculosis, as indicated by positive skin tests, with approximately 26,000 new cases of active disease each year. The increase in tuberculosis (TB) cases has been associated with HIV/AIDS, homelessness, drug abuse and immigration of persons with active infections. Current treatment programs for drug-susceptible TB involve taking two or four drugs (e.g., isoniazid, rifampin, pyrazinamide, ethambutol or streptomycin), for a period of from six to nine months, because all of the TB germs cannot be destroyed by a single drug. In addition, the observation of drug-resistant and multiple drug resistant strains of Mycobacterium tuberculosis is on the rise.
(64) Helicobacter pylori (H. pylori) is a micro-aerophilic, Gram negative, slow-growing, flagellated organism with a spiral or S-shaped morphology which infects the lining of the stomach. H. pylori is a human gastric pathogen associated with chronic superficial gastritis, peptic ulcer disease, and chronic atrophic gastritis leading to gastric adenocarcinoma. H. pylori is one of the most common chronic bacterial infections in humans and is found in over 90% of patients with active gastritis. Current treatment includes triple drug therapy with bismuth, metronidazole, and either tetracycline or amoxicillin which eradicates H. pylori in most cases. Problems with triple therapy include patient compliance, side effects, and metronidazole resistance. Alternate regimens of dual therapy which show promise are amoxicillin plus metronidazole or omeprazole plus amoxicillin.
(65) Streptococcus pneumoniae is a Gram positive coccus and one of the most common causes of bacterial pneumonia as well as middle ear infections (otitis media) and meningitis. Each year in the United States, pneumococcal diseases account for approximately 50,000 cases of bacteremia; 3,000 cases of meningitis; 100,000-135,000 hospitalizations; and 7 million cases of otitis media. Pneumococcal infection causing an estimated 40,000 deaths annually in the United States. Children less than 2 years of age, adults over 65 years of age and persons of any age with underlying medical conditions, including, e.g., congestive heart disease, diabetes, emphysema, liver disease, sickle cell, HIV, and those living in special environments, e.g., nursing homes and long-term care facilities, at highest risk for infection.
(66) Drug-resistant S. pneumoniae strains have become common in the United States, with many penicillin-resistant pneumococci also resistant to other antimicrobial drugs, such as erythromycin or trimethoprim-sulfamethoxazole.
(67) Treponema palliclium is a spirochete which causes syphilis. T. pallidum is exclusively a pathogen which causes syphilis, yaws and non-venereal endemic syphilis or pinta. Treponema pallidum cannot be grown in vitro and does replicate in the absence of mammalian cells. The initial infection causes an ulcer at the site of infection; however, the bacteria move throughout the body, damaging many organs over time. In its late stages, untreated syphilis, although not contagious, can cause serious heart abnormalities, mental disorders, blindness, other neurologic problems, and death.
(68) Syphilis is usually treated with penicillin, administered by injection. Other antibiotics are available for patients allergic to penicillin, or who do not respond to the usual doses of penicillin. In all stages of syphilis, proper treatment will cure the disease, but in late syphilis, damage already done to body organs cannot be reversed.
(69) Chlamydia trachomatis is the most common bacterial sexually transmitted disease in the United States and it is estimated that 4 million new cases occur each year. the highest rates of infection are in 15 to 19 year olds. Chlamydia is a major cause of non-gonococcal urethritis (NGU); cervicitis, bacterial vaginitis, and pelvic inflammatory disease (PID). Chlamydia infections may have very mild symptoms or no symptoms at all, however, if left untreated Chlamydia infections can lead to serious damage to the reproductive organs, particularly in women. Antibiotics such as azithromycin, erythromycin, ofloxacin, amoxicillin or doxycycline are typically prescribed to treat Chlamydia infection.
(70) Bartonella henselae. Cat Scratch Fever (CSF) or cat scratch disease (CSD), is a disease of humans acquired through exposure to cats, caused by a Gram negative rod originally named Rochalimaea henselae, and currently known as Bartonella henselae. Symptoms include fever and swollen lymph nodes and CSF is generally a relatively benign, self-limiting disease in people, however, infection with Bartonella henselae can produce distinct clinical symptoms in immunocompromised People, including, acute febrile illness with bacteremia, bacillary angiomatosis, peliosis hepatis, bacillary splenitis, and other chronic disease manifestations such as AIDS encephalopathy.
(71) The disease is treated with antibiotics, such as doxycycline, erythromycin, rifampin, penicillin, gentamycin, ceftriaxone, ciprofloxacin, and azithromycin.
(72) Haemophilus influenzae (H. influenza) is a family of Gram negative bacteria; six types of which are known, with most H. influenza-related disease caused by type B, or HIB. Until a vaccine for HIB was developed, HIB was a common causes of otitis media, sinus infections, bronchitis, the most common cause of meningitis, and a frequent culprit in cases of pneumonia, septic arthritis (joint infections), cellulitis (infections of soft tissues), and pericarditis (infections of the membrane surrounding the heart). The H. influenza type B bacterium is widespread in humans and usually lives in the throat and nose without causing illness. Unvaccinated children under age 5 are at risk for HIB disease. Meningitis and other serious infections caused by H. influenza infection can lead to brain damage or death.
(73) Shigella dysenteriae (Shigella dys.) is a Gram negative rod which causes dysentery. In the colon, the bacteria enter mucosal cells and divide within mucosal cells, resulting in an extensive inflammatory response. Shigella infection can cause severe diarrhea which may lead to dehydration and can be dangerous for the very young, very old or chronically ill. Shigella dys. forms a potent toxin (shiga toxin), which is cytotoxic, enterotoxic, neurotoxic and acts as a inhibitor of protein synthesis. Resistance to antibiotics such as ampicillin and TMP-SMX has developed, however, treatment with newer, more expensive antibiotics such as ciprofloxacin, norfloxacin and enoxacin, remains effective.
(74) Listeria is a genus of Gram-positive, motile bacteria found in human and animal feces. Listeria monocytogenes causes such diseases as listeriosis, meningoencephalitis and meningitis. This organism is one of the leading causes of death from food-borne pathogens especially in pregnant women, newborns, the elderly, and immunocompromised individuals. It is found in environments such as decaying vegetable matter, sewage, water, and soil, and it can survive extremes of both temperatures and salt concentration making it an extremely dangerous food-born pathogen, especially on food that is not reheated. The bacterium can spread from the site of infection in the intestines to the central nervous system and the fetal-placental unit. Meningitis, gastroenteritis, and septicemia can result from infection. In cattle and sheep, listeria infection causes encephalitis and spontaneous abortion.
(75) Proteus mirabilis is an enteric, Gram negative commensal, distantly related to E. coli. It normally colonizes the human urethra, but is an opportunistic pathogen that is the leading cause of urinary tract infections in catheterized individuals. P. mirabilis has two exceptional characteristics: 1) it has very rapid motility, which manifests itself as a swarming phenomenon on culture plates; and 2) it produce urease, which gives it the ability to degrade urea and survive in the genitourinary tract.
(76) Yersinia pestis is the causative agent of plague (bubonic and pulmonary) a devastating disease which has killed millions worldwide. The organism can be transmitted from rats to humans through the bite of an infected flea or from human-to-human through the air during widespread infection. Yersinia pestis is an extremely pathogenic organism that requires very few numbers in order to cause disease, and is often lethal if left untreated. The organism is enteroinvasive, and can survive and propagate in macrophages prior to spreading systemically throughout the host.
(77) Bacillus anthracis is also known as anthrax. Humans become infected when they come into contact with a contaminated animal. Anthrax is not transmitted due to person-to-person contact. The three forms of the disease reflect the sites of infection which include cutaneous (skin), pulmonary (lung), and intestinal. Pulmonary and intestinal infections are often fatal if left untreated. Spores are taken up by macrophages and become internalized into phagolysozomes (membranous compartment) whereupon germination initiates. Bacteria are released into the bloodstream once the infected macrophage lyses whereupon they rapidly multiply, spreading throughout the circulatory and lymphatic systems, a process that results in septic shock, respiratory distress and organ failure. The spores of this pathogen have been used as a terror weapon.
(78) Burkholderia mallei is rarely associated with human infection and is more commonly seen in domesticated animals such as horses, donkeys, and mules where it causes glanders, a disease first described by Aristotle. This organism is similar to B. pseudomallei and is differentiated by being nonmotile. The pathogen is host-adapted and is not found in the environment outside of its host. Glanders is often fatal if not treated with antibiotics, and transmission can occur through the air, or more commonly when in contact with infected animals. Rapid-onset pneumonia, bacteremia (spread of the organism through the blood), pustules, and death are common outcomes during infection. The virulence mechanisms are not well understood, although a type ill secretion system similar to the one from Salmonella typhimurium is necessary. No vaccine exists for this potentially dangerous organism which is thought to have potential as a biological terror agent. The genome of this organism carries a large number of insertion sequences as compared to the related Bukholderia pseudomallei (below), and a large number of simple sequence repeats that may function in antigenic variation of cell surface proteins.
(79) Burkholderia pseudomallei is the organism that causes meliodosis, a disease found in certain parts of Asia, Thailand, and Australia. It is typically a soil organism and has been recovered from rice paddles and moist tropical soil, but as an opportunistic pathogen can cause disease in susceptible individuals such as those that suffer from diabetes mellitus. The organism can exist intracellularly, and causes pneumonia and bacteremia (spread of the bacterium through the bloodstream). The latency period can be extremely long, with infection preceding disease by decades, and treatment can take months of antibiotic use, with relapse a commonly observed phenomenon. Intercellular spread can occur via induction of actin polymerization at one pole of the cell, allowing movement through the cytoplasm and from cell-to-cell. This organism carries a number of small sequence repeats which may promoter antigenic variation, similar to what was found with the B. mallei genome.
(80) Francisella tularensis was first noticed as the causative agent of a plague-like illness that affected squirrels in Tulare county in California in the early part of the 20th century by Edward Francis. The organism now bears his namesake. The disease is called tularemia and has been noted throughout recorded history. The organism can be transmitted from infected ticks or deerflies to a human, through infected meat, or via aerosol, and thus is a potential bioterrorism agent. It is an aquatic organism, and can be found living inside protozoans, similar to what is observed with Legionella. It has a high infectivity rate, and can invade phagocytic and nonphagocytic cells, multiplying rapidly. Once within a macrophage, the organism can escape the phagosome and live in the cytosol.
(81) Veterinary Applications.
(82) A healthy microflora in the gastro-Intestinal tract of livestock is of vital importance for health and corresponding production of associated food products. As with humans, the gastrointestinal tract of a healthy animal contains numerous types of bacteria (i.e., E. coli, Pseudomonas aeruginosa and Salmonella spp.), which live in ecological balance with one another. This balance may be disturbed by a change in diet, stress, or in response to antibiotic or other therapeutic treatment, resulting in bacterial diseases in the animals generally caused by bacteria such as Salmonella, Campylobacter, Enterococci, Tularemia and E. coli. Bacterial infection in these animals often necessitates therapeutic intervention, which has treatment costs as well being frequently associated with a decrease in productivity.
(83) As a result, livestock are routinely treated with antibiotics to maintain the balance of flora in the gastrointestinal tract. The disadvantages of this approach are the development of antibiotic resistant bacteria and the carry over of such antibiotics and the resistant bacteria into resulting food products for human consumption.
(84) B. Cell Division and Cell Cycle Target Proteins
(85) The antisense oligomers of the invention are designed to hybridize to a region of a bacterial mRNA that encodes an essential bacterial gene. Exemplary genes are those required for cell division, cell cycle proteins, or genes required for lipid biosynthesis or nucleic acid replication. Any essential bacterial gene can be targeted once a gene's essentiality is determined. One approach to determining which genes in an organism are essential is to use genetic footprinting techniques as described (Gerdes, Scholle et al. 2003). In this report, 620 E. coli genes were identified as essential and 3,126 genes as dispensable for growth under culture conditions for robust aerobic growth. Evolutionary context analysis demonstrated that a significant number of essential E. coli genes are preserved throughout the bacterial kingdom, especially the subset of gene's for key cellular processes such as DNA replication and protein synthesis.
(86) In various aspects, the invention provides an antisense oligomer which is a nucleic acid sequence effective to stably and specifically bind to a nucleic acid target sequence which encodes an essential bacterial protein including the following; (1) a sequence specific to a particular strain of a given species of bacteria, such as a strain of E. coli associated with food poisoning, e.g., O157:H7 (see Table 1 below); (2) a sequence common to two or more species of bacteria; (3) a sequence common to two related genera of bacteria (i.e., bacterial genera of similar phylogenetic origin); (4) a sequence generally conserved among Gram-negative bacteria; (5) generally conserved among Gram-positive bacteria; or (6) a consensus sequence for essential bacterial protein-encoding nucleic acid sequences in general.
(87) In general, the target for modulation of gene expression using the antisense methods of the present invention comprises an mRNA expressed during active bacterial growth or replication, such as an mRNA sequence transcribed from a gene of the cell division and cell wall synthesis (dcw) gene cluster, including, but not limited to, zipA, sulA, secA, dicA, dicB, dicC; dicF, ftsA, ftsI, ftsN, ftsK, ftsL, ftsQ, ftsW, ftsZ, murC, murD, murE, murF, murG, minC, minD, minE, mraY, mraW, mraZ, seqA and ddlB. See (Bramhill 1997), and (Donachie 1993), both of which are expressly incorporated by reference herein, for general reviews of bacterial cell division and the cell cycle of E. coli, respectively. Additional targets include genes involved in lipid biosynthesis (e.g. acpP) and replication (e.g. gyrA).
(88) Cell division in E. coli involves coordinated invagination of all 3 layers of the cell envelope (cytoplasmic membrane, rigid peptidoglycan layer and outer membrane). Constriction of the septum severs the cell into 2 compartments and segregates the replicated DNA. At least 9 essential gene products participate in this process: ftsZ, ftsA, ftsQ, ftsL, ftsI, ftsN, ftsK, ftsW and zipA (Hale and de Boer 1999). Preferred protein targets are the three discussed below.
(89) FtsZ, one of the earliest essential cell division genes in E. coli, is a soluble, tubulin-like GTPase that forms a membrane-associated ring at the division site of bacterial cells. The ring is thought to drive cell constriction, and appears to affect cell wall invagination. FtsZ binds directly to a novel integral inner membrane protein in E. coli called zipA, an essential component of the septal ring structure that mediates cell division in E. coli (Lutkenhaus and Addinall 1997).
(90) GyrA refers to subunit A of the bacterial gyrase enzyme, and the gene therefore. Bacterial gyrase is one of the bacterial DNA topoisomerases that control the level of supercoiling of DNA in cells and is required for DNA replication.
(91) AcpP encodes acyl carrier protein, an essential cofactor in lipid biosynthesis. The fatty acid biosynthetic pathway requires that the heat stable cofactor acyl carrier protein binds intermediates in the pathway.
(92) For each of these latter three proteins, Table 1 provides exemplary bacterial sequences which contain a target sequence for each of a number important pathogenic bacteria. The gene sequences are derived from the GenBank Reference full genome sequence for each bacterial strain (world wide web.ncbi.nlm.nih.gov/genomes/lproks.cgi). The gene location on either the positive (+) or negative () strand of the genome is listed under Strand, it being recognized that the strand indicated is the coding sequence for the protein, that is, the sequence corresponding to the mRNA target sequence for that gene. For example, the two E. coli genes (ftsZ and acpP) in which the coding sequence is on the positive strand, the sequence is read 5 to 3 in the left-to-right direction. Similarly for the E. coli gyrA gene having the coding region on the minus genomic strand, the coding sequence is read as the reverse complement in the right to left direction (5 to 3).
(93) TABLE-US-00001 TABLE 1 Exemplary Bacterial Target Gene Sequences GenBank Target Organism Ref. Gene Strand Nucleotide Region Escherichia coli NC ftsZ + 105305-106456 000913 acpP + 1150838-1151074 gyrA 2334813-2337440 Escherichia coli NC ftsZ + 109911-111062 0157:H7 002655 acpP + 1595796-1596032 gyrA 3133832-3136459 Salmonella NC ftsZ + 155683-156834 thyphimurium 003197 acpP + 1280113-1280349 gyrA 2373711-2376347 Pseudomonas NC ftsZ 4939299-4940483 aeruginosa 002516 acpP 3324946-3325182 gyrA 3556426-3559197 Vibrio cholera NC ftsZ 2565047-2566243 002505 acpP + 254505-254747 gyrA + 1330207-1332891 Neisseria NC ftsZ 1498872-1500050 gonorrhoea 002946 acpP + 1724401-1724637 gyrA 618439-621189 Staphylococcus NC ftsZ + 1165782-1166954 aureus 002745 gyrA + 7005-9674 fmhB 2321156-2322421 Mycobacterium NC ftsZ 2407076-2408281 tuberculosis 002755 acpP + 1510182-1510502 gyrA + 7302-9818 pimA 2934009-2935145 cysS2 4014534-4015943 Helicobacter NC ftsZ + 1042237-1043394 pylori 000915 acpP 594037-594273 gyrA + 752512-754995 Streptococcus NC ftsZ 1565447-1566706 pneumoniae 003028 acp + 396691-396915 gyrA 1147387-1149855 Treponema NC ftsZ + 414751-416007 palladium 000919 acp + 877632-877868 gyrA + 4391-6832 Chlamydia NC acpP 263702-263935 trachomatis 000117 gyrA 755022-756494 Bartonella NC ftsZ 1232094-1233839 henselae 005956 acpP + 623143-623379 gyrA 1120562-1123357 Hemophilis NC ftsZ + 1212021-1213286 influenza 000907 acpP 170930-171160 gyrA 1341719-1344361 Listeria NC ftsZ 2102307-2101132 monocytogenes 002973 acpP 1860771-1860538 gyrA + 8065-10593 Yersinia pestis NC ftsZ + 605874-607025 003143 acpP + 1824120-1824356 gyrA + 1370729-1373404 Bacillus NC ftsZ 3724197-3725357 anthracis 005945 acpP 3666663-3666896 gyrA + 6596-9067 Burkholderia NC ftsZ 2649616 ... 2650812 mallei 006348 acpP + 559430 ... 559869 gyrA 459302 ... 461902 Burkholderia NC ftsZ 3599162-3600358 pseudomallei 006350 acpP 2944967-2945206 gyrA 3036533-3039133 Francisella NC ftsZ + 203748-204893 tularensis 006570 acpP + 1421900-1422184 gyrA 1637300-1639906
(94) C. Selection of Oligomer Target Sequences and Lengths
(95) As noted above, the present invention derives from the discovery herein that oligomeric antisense compounds having a ribose or morpholino subunit backbone are most effective in inhibiting bacterial growth when the subunit length is between 10-12 bases, preferably 11 bases, where the compound contains at least 10 bases, preferably 11-12 bases, that are complementary to the target mRNA sequence. These studies were carried out on bacterial gene expression in pure culture, a bacterial cell free protein expression system and an in vivo murine peritonitis model, as discussed in detail in the examples below.
(96) Example 1 describes the study on the effect of antisense length and position on inhibition of a marker gene (myc-luc) in E coli, with the results shown in
(97) The effect of antisense compound length in a bacterial cell-free expression system is shown in
(98) The data in
(99) Recent evidence suggests that peptide-PNA inhibited -lactamase expression only when targeted to either the Shine-Dalgarno ribosome binding sequence (RBS) or the region around the start codon but not to anywhere else along the entire length of the mRNA (Dryselius, Aswasti et al. 2003). Results obtained in support of the present invention indicate that the RBS was not an effective target for PMO inhibition, at least for the myc-luc chimeric reporter gene, unlike the results observed for a PNA antisense compound.
(100) The results from
(101) To confirm that an oligomer antisense compound having relatively short lengths, e.g., 10-12 bases, gave optimal inhibition of a bacterial protein, antisense compounds directed against the AUG start site region of the bacterial AcpP gene were tested for their ability to inhibit bacterial growth in culture. These studies are reported in Example 2, with reference to
(102) Other characteristics of the PMO were analyzed to detect a correlation with inhibition of myc-luc. The G plus C content of the PMO did not correlate with inhibition. However, a significant correlation between inhibition and theoretical secondary structure of the targeted region suggests that base pairing within the targeted region may reduce efficacy of the PMO (
(103) Studies conducted in support of the present invention, and described below with respect to
(104) Based on these considerations, exemplary targeting sequences for use in practicing the invention are those having between 10-14 bases, preferably complete, but at least 10-base complementarity with the mRNA target sequence, and complementary to a region of the mRNA that includes the AUG start site or a region up to 10 bases downstream of the start site. Where the compound of the invention is used in inhibiting infection by one of the bacteria identified in the table below, by inhibiting one of the three identified bacterial proteins, the antisense oligomer compound has a sequence that is complementary to at least 10 contiguous bases of the corresponding target sequence indicated in the table, where these target sequences are identified in the sequence listing below by SEQ ID NOS: 1-58.
(105) TABLE-US-00002 TABLE 2 Exemplary bacterial target regions Organism Target SEQ ID (GenBank Ref.) Gene Nucleotide Region NO. Escherichia coli ftsZ 105295-105325 1 (NC 000913) acpP 1150828-1150858 2 gyrA 2337422-2337452 3 Escherichia coli O157:H7 ftsZ 109901-109931 4 (NC 002655) acpP 1595786-1595816 5 gyrA 3136439-3136469 6 Salmonella thyphimurium ftsZ 155673-155703 7 (NC 003197) acpP 1280103-1280133 8 gyrA 2376327-2376357 9 Pseudomonas aeruginosa ftsZ 4940463-4940493 10 (NC 002516) acpP 3325162-3325192 11 gyrA 3559177-3559207 12 Vibrio cholera ftsZ 2566223-2566253 13 (NC 002505) acpP 254495-254525 14 gyrA 1330197-1330227 15 Neisseria gonorrhoea ftsZ 1500031-1500060 16 (NC 002946) acpP 1724391-1724420 17 gyrA 621170-621199 18 Staphylococcus aureus ftsZ 1165772-1165802 19 (NC 002745) gyrA 6995-7025 20 fmhB 2322402-2322431 21 Mycobacterium tuberculosis ftsZ 2408265-2408295 22 (NC 002755) acp 1510172-1510202 23 gyrA 7292-7322 24 pimA 2935126-2935126 25 cysS2 4015924-4015953 26 Helicobacter pylori ftsZ 1042227-1042257 27 (NC 000915) acp 594253-594283 28 gyrA 752502-752532 29 Streptococcus pneumoniae ftsZ 1566686-1566716 30 (NC 003028) acp 396681-396711 31 gyrA 1149835-1149865 32 Treponema palladium ftsZ 414741-414771 33 (NC 000919) acp 877626-877656 34 gyrA 4381-4411 35 Chlamydia trachomatis acpP 263915-263945 36 (NC 000117) gyrA 756474-756504 37 Bartonella henselae ftsZ 1232075-1232104 38 (NC 005956) acp 623133-623162 39 gyrA 1123338-1123367 40 Hemophills Influenza ftsZ 1212011-1212041 41 (NC 000907) acp 171140-171170 42 gyrA 1344341-1344371 43 Yersinia pestis ftsZ 605864-605893 44 (NC 003143) acp 1824110-1824139 45 gyrA 1370719-1370748 46 Bacillus anthracis ftsZ 3725338-3725367 47 (NC 005945) acp 3666877-3666906 48 gyrA 6586-6615 49 Burkholderia mallei ftsZ 2650793-2850822 50 (NC 006348) acp 559420-559449 51 gyrA 461883-461912 52 Burkholderia pseudomallei ftsZ 3600339-3600368 53 (NC 006350) acp 2945187-2945216 54 gyrA 3039114-3039143 55 Francisella tularensis ftsZ 203738-203767 56 (NC 006570) acp 1421890-1421919 57 gyrA 1639887-1639916 58
(106) Any essential bacterial gene can be targeted using the methods of the present invention. As described above, an essential bacterial gene for any bacterial species can be determined using a variety of methods including those described by Gerdes for E. coli (Gerdes, Scholle et al. 2003). Many essential genes are conserved across the bacterial kingdom thereby providing additional guidance in target selection. Target regions can be obtained using readily available bioinformatics resources such as those maintained by the National Center for Biotechnology Information (NCBI). Complete reference genomic sequences for a large number of microbial species can be obtained (e.g., see world wide web.ncbi.nlm.nih.gov/genomes/lproks.cgi) and sequences for essential bacterial genes identified. Bacterial strains can be obtained from the American Type Culture Collection (ATCC). Simple cell culture methods, such as those described in the Examples, using the appropriate culture medium and conditions for any given species, can be established to determine the antibacterial activity of antisense compounds.
(107) The first step in selecting a suitable antisense selection is to identify, by the methods above, a targeting sequence that includes the AUG start site and/or contains at least about 10-20 bases downstream of the start site. Table 2 above gives the base-number locations of 30- to 31-base targeting sequences that span the AUG start site by about 10 bases on the upstream (5 side) and about 20 bases (including the start site) in the downstream coding region. The actual target sequences corresponding to these target-site locations are given in the sequence listing below, identified by SEQ ID NOS: 1-58.
(108) For purposes of illustration, assume that the antisense compound to be prepared is for use in inhibiting an E. coli bacterial infection in an individual infected with E. coli strain O157:H7, and that the essential gene being targeted is the E coli acpP gene. One suitable target sequence for this gene identified by the methods above is SEQ ID NO: 2 having the sequence 5-ATTTAAGAGTATGAGCACTATCGAAGAACGC-3 where the sequence gives the DNA thymine (T) bases rather than the RNA uracil (U) bases, and where the AUG start site (ATG) is shown in bold.
(109) Again, for purposes of illustration, four model antisense targeting sequence, each of them 11 bases in length, are selected: (i) an antisense sequence that spans the AUG start site with four bases of each side and has the sequence identified by SEQ ID NO: 126; (ii) an antisense sequence that overlaps the AUG starts at its 5 end and extends in a 3 direction an additional 8 bases into the coding region of the gene, identified as SEQ ID NO: 127; (iii) an antisense sequence complementary to bases 5-15 of the gene's coding region, identified as SEQ ID NO: 109, and (iv) an antisense sequence complementary to bases 11-21 of the gene's coding region, identified as SEQ ID NO: 128. These sequences are listed in Table 3 below.
(110) Once antisense sequences have been selected and the antisense compound synthesized, the compounds may be tested for ability to inhibit bacterial growth, in this case growth of an E coli strain in culture. Following the protocol in Example 2, for example, the four 11 mer sequences described above are individually tested for optimal activity, e.g., maximum drop in CFU/ml at a given dose, e.g., 5-20 M, against an E. coli culture. Compound(s) showing optimal activity are then tested in animal models, as described in Example 3, or veterinary animals, prior to use for treating human infection.
(111) TABLE-US-00003 TABLE3 PMOSequencesfortheEcoilacpPprotein Sequence(5 to3) Target SEQIDNO TGCTCATACTC EcoliacpP 126 ATAGTGCTCAT EcoliacpP 127 CTTCGATAGTG EcoliacpP 109 CGTTCTTCCG EcoliacpP 128
IV. Method for Inhibiting Bacteria
(112) In one aspect, the invention includes a method of inhibiting bacterial infection, by exposing the infecting bacteria to a 10-12 base oligomeric antisense compound of the type characterized above. This general method is demonstrated by the study reported in Example 2 and described above with respect to
(113) In one aspect, the method is applied to inhibiting a bacterial infection in a mammalian subject, including a human subject, by administering the antisense compound to the subject in a therapeutic amount. To demonstrate the method, groups of 4 mice were injected IP with E. coli AS19, which has a genetic defect that makes it abnormally permeable to high MW solutes. Immediately following infection, each mouse was injected IP with 300 g of an 11-base PMO complementary to acpP, an 11-base nonsense sequence PMO, or PBS, as detailed in Example 3. As seen in
(114) The same PMOs were again tested, except with E. coli SM105, which has a normal outer membrane. In this method, anti-acpP PMO reduced CFU by 84% compared to nonsense PMO at 12 h post-infection. There was no reduction of CFU at 2, 6, or 24 h (
(115) To demonstrate that the effect on bacterial infection was sequence specific, a luciferase reporter gene whose expression would not affect growth was used, and luciferase expression was measured directly by two independent criteria, luciferase activity and luciferase protein abundance. As detailed in Example 3, the study demonstrated that an antisense compound complementary to the luciferase mRNA inhibited luciferase expression at two different times after administration of the PMO. Moreover, inhibition was quantitatively similar with both methods of measurement. These results show directly that PMO inhibit bacterial target gene expression in vivo in a sequence-specific manner.
(116) It will be understood that the in vivo efficacy of such an antisense oligomer in a subject using the methods of the invention is dependent upon numerous factors including, but not limited to, (1) the target sequence; (2) the duration, dose and frequency of antisense administration; and (3) the general condition of the subject.
(117) In another embodiment of the invention, the antisense oligonucleotides of the invention find utility in the preparation of anti-bacterial vaccines. In this aspect of the invention, a culture of a particular type of bacteria is incubated in the presence of a morpholino-based antisense oligomer of the type described above, in an amount effective to produce replication-crippled and/or morphologically abnormal bacterial cells. Such replication-crippled and/or morphologically abnormal bacterial cells are administered to a subject and act as a vaccine.
(118) The efficacy of an in vivo administered antisense oligomer of the invention in inhibiting or eliminating the growth of one or more types of bacteria may be determined by in vitro culture or microscopic examination of a biological sample (tissue, blood, etc.) taken from a subject prior to, during and subsequent to administration of the antisense oligomer. (See, for example, Pari, G. S. et al., Antimicrob. Agents and Chemotherapy 39(5):1157-1161, 1995; Anderson, K. P. et al., Antimicrob. Agents and Chemotherapy 40(9):2004-2011, 1996.) The efficacy of an in vivo administered vaccine of antisense oligomer-treated bacteria may be determined by standard immunological techniques for detection of an immune response, e.g., ELISA, Western blot, radioimmunoassay (RIA), mixed lymphoctye reaction (MLR), assay for bacteria-specific cytotoxic T lymphocytes (CTL), etc.
(119) A. Administration Method
(120) Effective delivery of the antisense oligomer to the target nucleic acid is an important aspect of treatment. In accordance with the invention, such routes of antisense oligomer delivery include, but are not limited to, various systemic routes, including oral and parenteral routes, e.g., intravenous, subcutaneous, intraperitoneal, and intramuscular, as well as inhalation, transdermal and topical delivery. The appropriate route may be determined by one of skill in the art, as appropriate to the condition of the subject under treatment. For example, an appropriate route for delivery of an antisense oligomer in the treatment of a bacterial infection of the skin is topical delivery, while delivery of an antisense oligomer in the treatment of a bacterial respiratory infection is by inhalation. Methods effective to deliver the oligomer to the site of bacterial infection or to introduce the oligonucleotide into the bloodstream are also contemplated.
(121) Transdermal delivery of antisense oligomers may be accomplished by use of a pharmaceutically acceptable carrier adapted for e.g., topical administration. One example of morpholino oligomer delivery is described in PCT patent application WO 97/40854, incorporated herein by reference.
(122) In one preferred embodiment, the oligomer is a morpholino oligomer, contained in a pharmaceutically acceptable carrier, and is delivered orally.
(123) The antisense oligonucleotide may be administered in any convenient vehicle which is physiologically acceptable. Such an oligonucleotide composition may include any of a variety of standard pharmaceutically accepted carriers employed by those of ordinary skill in the art. Examples of such pharmaceutical carriers include, but are not limited to, saline, phosphate buffered saline (PBS), water, aqueous ethanol, emulsions such as oil/water emulsions, triglyceride emulsions, wetting agents, tablets and capsules. It will be understood that the choice of suitable physiologically acceptable carrier will vary dependent upon the chosen mode of administration.
(124) In some instances liposomes may be employed to facilitate uptake of the antisense oligonucleotide into cells. (See, e.g., Williams, S. A., Leukemia 10(12):1980-1989, 1996; Lappalainen et al., Antiviral Res. 23:119, 1994; Uhlmann of al.,
(125) Sustained release compositions are also contemplated within the scope of this application. These may include semipermeable polymeric matrices in the form of shaped articles such as films or microcapsules.
(126) Typically, one or more doses of antisense oligomer are administered, generally at regular intervals for a period of about one to two weeks. Preferred doses for oral administration are from about 10 mg oligomer/patient to about 250 mg oligomer/patient (based on a weight of 70 kg). In some cases, doses of greater than 250 mg oligomer/patient may be necessary. For IV administration, the preferred doses are from about 1.0 mg oligomer/patient to about 100 mg oligomer/patient (based on an adult weight of 70 kg). The antisense compound is generally administered in an amount and manner effective to result in a peak blood concentration of at least 200-400 nM antisense oligomer.
(127) In a further aspect of this embodiment, a morpholino antisense oligonucleotide is administered at regular intervals for a short time period, e.g., daily for two weeks or less. However, in some cases the antisense oligomer is administered intermittently over a longer period of time. Administration of a morpholino antisense oligomer to a subject may also be followed by, or concurrent with, administration of an antibiotic or other therapeutic treatment.
(128) In one aspect of the method, the subject is a human subject, e.g., a patient diagnosed as having a localized or systemic bacterial infection. The condition of a patient may also dictate prophylactic administration of an antisense oligomer of the invention or an antisense oligomer treated bacterial vaccine, e.g. in the case of a patient who (1) is immunocompromised; (2) is a burn victim; (3) has an indwelling catheter; or (4) is about to undergo or has recently undergone surgery.
(129) In another application of the method, the subject is a livestock animal, e.g., a chicken, turkey, pig, cow or goat, etc, and the treatment is either prophylactic or therapeutic. The invention also includes a livestock and poultry food composition containing a food grain supplemented with a subtherapeutic amount of an antibacterial antisense compound of the type described above. Also contemplated is in a method of feeding livestock and poultry with a food grain supplemented with subtherapeutic levels of an antibiotic, an improvement in which the food grain is supplemented with a subtherapeutic amount of an antibacterial oligonucleotide composition as described above.
(130) The methods of the invention are applicable, in general, to treatment of any condition wherein inhibiting or eliminating the growth of bacteria would be effective to result in an improved therapeutic outcome for the subject under treatment.
(131) One aspect of the invention is a method for treatment of a bacterial infection which includes the administration of a morpholino antisense oligomer to a subject, followed by or concurrent with administration of an antibiotic or other therapeutic treatment to the subject.
(132) B. Treatment Monitoring Methods
(133) It will be understood that an effective in vivo treatment regimen using the antisense oligonucleotide compounds of the invention will vary according to the frequency and route of administration, as well as the condition of the subject under treatment (i.e., prophylactic administration versus administration in response to localized or systemic infection). Accordingly, such in vivo therapy may benefit from monitoring by tests appropriate to the particular type of bacterial infection under treatment and a corresponding adjustment in the dose or treatment regimen in order to achieve an optimal therapeutic outcome.
(134) The efficacy of a given therapeutic regimen involving the methods described herein may be monitored, e.g., by general indicators of infection, such as complete blood count (CBC), nucleic acid detection methods, immunodiagnostic tests, or bacterial culture.
(135) Identification and monitoring of bacterial infection generally involves one or more of (1) nucleic acid detection methods, (2) serological detection methods, i.e., conventional immunoassay, (3) culture methods, and (4) biochemical methods. Such methods may be qualitative or quantitative.
(136) Nucleic acid probes may be designed based on publicly available bacterial nucleic acid sequences, and used to detect target genes or metabolites (i.e., toxins) indicative of bacterial infection, which may be specific to a particular bacterial type, e.g., a particular species or strain, or common to more than one species or type of bacteria (i.e., Gram positive or Gram negative bacteria). Nucleic amplification tests (e.g., PCR) may also be used in such detection methods.
(137) Serological identification may be accomplished using a bacterial sample or culture isolated from a biological specimen, e.g., stool, urine, cerebrospinal fluid, blood, etc. Immunoassay for the detection of bacteria is generally carried out by methods routinely employed by those of skill in the art, e.g., ELISA or Western blot. In addition, monoclonal antibodies specific to particular bacterial strains or species are often commercially available.
(138) Culture methods may be used to isolate and identify particular types of bacteria, by employing techniques including, but not limited to, aerobic versus anaerobic culture, growth and morphology under various culture conditions. Exemplary biochemical tests include Gram stain (Gram, 1884; Gram positive bacteria stain dark blue, and Gram negative stain red), enzymatic analyses (i.e., oxidase, catalase positive for Pseudomonas aeruginosa), and phage typing.
(139) It will be understood that the exact nature of such diagnostic, and quantitative tests as well as other physiological factors indicative of bacterial infection will vary dependent upon the bacterial target, the condition being treated and whether the treatment is prophylactic or therapeutic.
(140) In cases where the subject has been diagnosed as having a particular type of bacterial infection, the status of the bacterial infection is also monitored using diagnostic techniques typically used by those of skill in the art to monitor the particular type of bacterial infection under treatment.
(141) The antisense oligomer treatment regimen may be adjusted (dose, frequency, route, etc.), as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment.
(142) From the foregoing, it will be appreciated how various objects and features of the invention are met. The method provides an improvement in therapy against bacterial infection, using relatively short antisense sequences to achieve enhanced cell uptake and anti-bacterial action. As a result, drug therapy is more effective and less expensive, both in terms of cost and amount of compound required.
(143) An important advantage of the invention is that compounds effective against virtually any pathogenic bacterium can be readily designed and tested, e.g., for rapid response against new drug-resistant bacteria, or in cases of bioterrorism. Once a target bacterium is identified, the sequence selection methods described allow one to readily identify one or more likely gene targets, among a number of essential genes, and prepare antisense compounds directed against the identified target. Because clinical testing on the safety and efficacy, once established for a small group of compounds, can be extrapolated to virtually any new target, relatively little time is needed in addressing new bacterial-infection challenges as they arise.
(144) The following examples are intended to illustrate but not to limit the invention.
(145) Material and Methods
(146) Phosphorodiamidate Morpholino Oligomers.
(147) PMO were synthesized and purified at AVI BioPharma, Inc. (Corvallis, Oreg.) as previously described (Geller, Deere et al. 2003, Summerton and Weller, 1997), dissolved in water, filtered through a 0.2 M membrane (HT Tuffryn, Gelman Sciences, Inc., Ann Arbor, Mich.), and stored at 4 C. Sequences of PMO used in this study are shown in Table 3. The concentration of PMO was determined spectrophotometrically by measuring the absorbance at 260 nm and calculating the molarity using the appropriate extinction coefficient.
(148) Bacteria and Growth Conditions
(149) Bacterial strains were obtained from the American Type Culture Collection (ATCC) or the E. coli Genetic Stock Center at Yale University. All pure culture experiments were done in 96-well plates. OD600 readings and plating of cells for CFU/ml determinations were done in triplicate.
(150) Escherichia coli AS19 and SM101, which have defects in lipopolysaccharide synthesis that result in outer membrane permeability to high MW solutes, were grown aerobically in LB broth at 37 C., and 30 C., respectively. Transformants that expressed pSE380myc-luc were grown in LB plus 100 g/ml ampicillin.
(151) E. coli AS19 and SM105 were grown in LB broth (supplemented with 100 g/ml ampicillin for transformants that expressed luciferase) to OD.sub.600=0.12, centrifuged (4,000g, 10 min, 20 C.), and resuspended in 5% mucin (type II, Sigma Chemical Co., St. Louis)/PBS to final concentrations as follows: AS19, 1.510.sup.8 CFU/ml; SM105, 5.710.sup.7 CFU/ml; AS19 (pT7myc-luc), 7.210.sup.9 CFU/ml.
(152) Reporter Gene.
(153) Standard molecular biology procedures were used for all constructions. All constructs were sequenced. Two reporter systems (pT7myc-luc and pSE380myc-luc) for antisense inhibition were previously constructed as described (Geller, Deere et al. 2003) by fusing 30 bp of the 5 end of human c-myc to all but the start codon of the gene for luciferase (luc). The constructs were separately transformed into E. coli SM101 and AS19.
(154) The acpP-luc reporter (pCNacpP-luc) was made by ligating a SalI-NotI restriction fragment of luc with the SalI-NotI fragment of pCiNeo (Promega Corp., Madison, Wis.), removing the adenosine from the start codon by site-directed mutagenesis, then directionally cloning a synthetic fragment of acpP (bp 17 to +23, inclusive, where +1 is adenosine of the start codon) between the NheI-SalI sites. pCNmyc-luc was made in the same way, except myc sequence from 14 through +16, inclusive (numbering adenosine of the start codon as +1) instead of acpP was cloned into the NheI-SalI sites. Luciferase enzyme activity was measured in bacteria as described (Geller, Deere et al. 2003).
(155) Cell-Free Protein Synthesis
(156) Bacterial, cell-free protein synthesis reactions were performed by mixing reactants on ice according to the manufacturer's instruction (Promega Corp.). Reactions were programmed with either pT7myc-luc plasmid in a coupled transcription/translation reaction, or with mRNA synthesized in a cell free RNA synthesis reaction (Ambion, Inc., Austin, Tex., MEGAscript T7 High Yield Transcription Kit) programmed with pT7myc-luc. All acp-luc reactions were programmed with pCNacpP-luc. Where indicated, cell-free reactions were composed with rabbit reticulocyte lysate as described by the manufacturer (Promega Corp.). PMO was added to a final concentration of either 100 nM or 200 nM as indicated. After 1 h at 37 C., the reactions were cooled on ice and luciferase was measured as described (Geller, Deere et al. 2003).
(157) Mammalian Tissue Culture
(158) HeLa cells were transfected in T75 tissue culture flasks (Nalge Nunc, Inc., Rochester, N.Y.) with a luciferase reporter plasmid (pCNmyc-luc) using Lipofectamine Reagent (Gibco BRL, Grand Island, N.Y.) according to user's manual in serum-free media (Gibco, Inc., Carlsbad, Calif., Opti-MEM1) for 5 hours before re-addition of growth medium (Hyclone, Inc., Logan, Utah, HyQ DME/F12 supplemented with 10% Fetal Bovine Serum and Gibco Antibiotic-Antimycotic 15240-062) at 37 C. in 5% CO.sub.2. After 24 hours, the cells were pooled and 110.sup.6 were added to each well of a 6-well plate (BD Biosciences, San Jose, Calif.) in 2 ml of growth media. After an additional 24 hours, PMO was added to a final concentration of 10 M in 2 ml fresh growth media and the cells were scraped from the plate surface with a rubber policeman to deliver the PMO to the cell as previously described (Partridge, Vincent et al. 1996). After scrape-loading, the cells were transferred to fresh 6-well plates and incubated at 37 C. until the time of assay. At 7 and 24 hours the cells were examined by microscopy to verify that each culture had the same number of cells, harvested by centrifugation, and lysed in Promega Cell Culture Lysis Reagent (Promega Corp.). Luciferase was measured by mixing the cell lysate with Luciferase Assay Reagent (Promega Corp.) and reading light emission in a Model TD-20e luminometer (Turner Designs, Inc., Mountain View, Calif.).
(159) RNA Secondary Structure.
(160) The RNA folding algorithm M-Fold (Zuker 2003) was used to predict the secondary structure of bases 1-120 or 90-1745 of the mRNA transcribed from pT7myc-luc. The folded structure of bases 1-120 had a minimum G=6.5 kcal/mol, and that of bases 90-1745 was G=452.28 kcal/mol. Each PMO was scored (referred to as 2 score) by calculating the fraction of bases (in the PMO) that are complementary to double stranded (duplex) regions within the folded target mRNA. For example, PMO 331 (Table 4, SEQ ID NO:80) is 10 bases in length and complementary to a region of myc-luc mRNA that, according to M-Fold prediction, forms duplex RNA at 4 of its 10 bases (the other 6 bases are not paired). The 2 score for PMO 331 would therefore be 4 bases/10 bases=0.400.
(161) Animals
(162) Female, 6 to 8 week old Swiss Webster mice (Simonsen Labs, Inc., Gilroy, Calif.) were used in all but one experiment, but identical results were obtained with males. Infection was established as described in (Frimodt-Moller, Knudsen et al. 1999). Each mouse was injected IP with 0.1 ml of bacteria resuspended in 5% mucin/PBS, then Immediately Injected IP with 0.1 ml of PMO (3.0 mg/ml) or PBS. At various times after Infection (as indicated in the figures), groups (n=3 to 5) of mice were injected IP with 2.0 ml PBS, and their abdomens gently massaged for 2 min. Peritoneal lavage was removed and stored on ice for 1 h. The lavages were diluted in PBS and plated in triplicate on LB to determine CFU.
(163) Luciferase and Western Blot
(164) Peritoneal lavages (1.00 ml) from mice infected with AS19 (pT7myc-luc) were centrifuged (10,000g, 2 min, 4 C.) and the supernatants discarded. The pellets were resuspended in 50 l PBS. An aliquot of resuspended cells was mixed with an equal volume of 2 cell culture lysis reagent (Promega, Inc., Madison, Wis.) and frozen at 85 C. Frozen lysates were thawed and luciferase light production was measured in duplicate in a luminometer as described (Geller, Deere et al. 2003). A second aliquot of the cell suspension was mixed with 2SDS sample buffer and analyzed by western blot using 4-20% gradient Gene Mate Express Gels (ISC BioExpress, Inc., Kaysville, Utah). Blots were prepared with primary antibody to luciferase (Cortex Biochmical, San Leandro, Calif.) or antisera to OmpA (Geller and Green 1989), secondary goat anti-rabbit IgG-horse radish peroxidase conjugate (Santa Cruz Biotechnology, Inc., Santa, Cruz, Calif.), and ECL Western Blotting Reagent (Amersham Biosciences, Buckinghamshire, England). Film negatives were scanned and digitized on a Kodak Image Station 440 CF. The net intensity of each band was calculated by subtracting the mean background intensity. Luciferase protein was normalized to OmpA by dividing the net intensity of the luciferase band by the net intensity of the OmpA band in the same sample. The % inhibition was calculated by subtracting the mean luciferase/OmpA of luc PMO-treated mice from mean luciferase/OmpA of nonsense PMO-treated mice, dividing the difference by mean luciferase/OmpA of nonsense PMO-treated mice, then multiplying by 100%.
(165) Statistical Analysis
(166) Spearman's rank-order correlation was used to analyze correlations between the inhibitory effects of PMO and either G+C content or secondary structure score of each PMO. The one-tailed, non-parametric Mann-Whitney test was used to analyze treatment group means.
(167) Oligomer Sequences
(168) Exemplary targeting oligomers used in describing the present invention are listed below in Table 4. The listed oligomers all target E. coli, the experimental bacterial strain used in experiments in support of the invention.
(169) TABLE-US-00004 TABLE4 PMOSequences PMO# Sequence(5 to3) %GC 2 Score Target SEQIDNO 328 ACGTTGA 43 0 myc-luc 59 327 ACGTTGAG 50 0 myc-luc 60 328 ACGTTGAGG 56 0 myc-luc 61 208 ACGTTGAGGG 60 0 myc-luc 62 340 ACGTTGAGGGG 64 0 myc-luc 63 298 ACGTTGAGGGGC 67 0 myc-luc 64 250 ACGTTGAGGGGCA 62 0 myc-luc 65 249 ACGTTGAGGGGCAT.sup.3 57 0 myc-luc 66 248 ACGTTGAGGGGCATC 60 0 myc-luc 67 247 ACGTTGAGGGGCATCG 62 .0625 myc-luc 68 246 ACGTTGAGGGGCATCGT 59 .1176 myc-luc 69 245 ACGTTGAGGGGCATCGTC 61 .1667 myc-luc 70 126 ACGTTGAGGGGCATCGTC 65 .2000 myc-luc 71 239 GTTGAGGGGCATCGTCGC 67 .2222 myc-luc 72 240 TTGAGGGGCATCGTCGC 65 .2353 myc-luc 73 241 TGAGGGGCATCGTCGC 69 .2500 myc-luc 74 242 GAGGGGCATCGTCGC 73 .2667 myc-luc 75 243 AGGGGCATCGTCGC 71 .2857 myc-luc 76 244 GGGGCATCGTCGC 77 .3077 myc-luc 77 329 GGGCATCGTCGC 75 .3333 myc-luc 78 330 GGCATCGTCGC 73 .3636 myc-luc 79 331 GCATCGTCGC 70 .4000 myc-luc 80 332 CATCGTCGC 67 .4444 myc-luc 81 333 ATCGTCGC 62 NC.sup.4 myc-luc 82 334 TCGTCGC 71 NC myc-luc 83 341 GGAAACCGTTGTGGTCTC 60 .7500 myc-luo5 84 342 ACCGTTGTGGTCTCCC 62 .6875 myc-luc5 85 343 GTTGTGGTCTCCC 69 .6154 myc-luc5 86 344 GTGGTCTCCC 70 .8000 myc-luc5 87 345 CGTCGCGGGATTCCTTCT 61 .3889 RBS&3 of 88 346 AAAGTTAAACAAAATTAT 11 .1667 5 ofRBS 89 347 TCCTTCTTAAAGTTAAAC 28 .3333 RBS&5 of 90 356 CGTTGAGGGG 70 0 myc-luc 91 357 GTTGAGGGGC 70 0 myc-luc 92 358 TTGAGGGGCA 60 0 myc-luc 93 359 TGAGGGGCAT 60 0 myc-luc 94 360 GAGGGGCATC 70 0 myc-luc 95 361 AGGGGCATCG 70 .1000 myc-luc 96 362 GGGGCATCGT 70 .2000 myc-luc 97 363 GGGCATCGTC 70 .3000 myc-luc 98 364 GGCATCGTCG 70 .4000 myc-luc 99 214 AATAGGGTTGG 45 0 luc, 100 215 TTTGCAACCCC 55 .9091 luc, 101 143 ATCCTCCCAACTTCGACATA 45 NC Nonsense 102 371 TGCCGAGCACCGGCTTCA 60 NC Nonsense 103 373 TCCACTTGCC 60 NC Nonsense 104 62-1 TTCTTCGATAGTGCTCATAC 40 NC acpP 105 62-2 TCTTCGATAGTGCTCATA 39 NC acpP 106 62-3 CTTCGATAGTGCTCAT 44 NC acpP 107 62-4 TCGATAGTGCTCAT 43 NC acpP 108 169 CTTCGATAGTG 45 NC acpP 109 379 TTCGATAGTG 40 NC acpP 110 380 TTCGATAGT 33 NC acpP 111 381 TCGATAGT 38 NC acpP 112 382 TCGATAG 43 NC acpP 113 383 CGATAG 50 NC acpP 114 62-5 TTGTCCTGAATATCACTTCG 40 NC Nonsense 115 62-7 GTCCTGAATATCACTT 38 NC Nonsense 116 62-8 TCGTGAGTATCACT 43 NC Nonsense 117 170 TCTCAGATGGT 45 NC Nonsense 118 384 AATCGGA 43 NC Nonsense 119 ACGTTGAGGC 60 NC luc 120 TCCACTTGCC 60 NC luc 121 13 TTCCATTGGTTCAAACATAG 35 NC FtsZ 122 162 CCATTGGTTC 50 NC FtsZ 123 17 CTCTCGCAAGGTCGCTCA 80 NC GyrA 124 164 CTCTCGCAAGG 70 NC GyrA 125
Example 1
Antisense Activity as a Function of Varying Length and Target Position
(170) PMO (Table 4) of various length (from 7 to 20 bases) that are complementary to the region around the start codon of myc-luc mRNA were added to growing cultures of E. coli SM101 (pSE380myc-luc). One series of PMO was constructed by reducing the length at the 3 end (SEQ ID NOS:59-71), and another by reducing the length at the 5 end (SEQ ID NOS:71-83). After 8 h in culture, luciferase was measured. Compared to a culture without PMO, 3 truncated PMO inhibited luciferase from 16 to 95% (
(171) PMO from the same two series were added individually to bacterial, cell-free protein synthesis reactions programmed to express myc-luciferase. These experiments were designed to eliminate the effects of entry of PMO into the cell, and to test the PMO at 37 C. instead of the permissive growth temperature (30 C.) of the conditional mutant SM101. PMO truncated at the 3 end from 10 to 20 bases in length inhibited about the same (
(172) A series of isometric (10-base) PMO, which varied by one base at each end (Table 4, SEQ ID NOS:91-99) and was targeted to the region around the AUG start codon of myc-luc, was added to bacterial, cell-free reactions programmed to synthesize myc-luc. All PMO inhibited luciferase expression (
(173) PMO of various lengths were targeted to various positions within the transcript of the myc-luc, including the extreme 5 end of the transcript (PMO 341-344, SEQ ID NOS:84-87), the ribosome binding site (PMO 345 and 347, SEQ ID NOS:88 and 90), the region upstream of the ribosome binding site (PMO 346, SEQ ID NO:89), the region around and immediately downstream of the start codon (PMO 126, SEQ ID NO:71), and 3 coding region of luciferase (PMO 214 and 215, SEQ ID NOS:100 and 101). Each PMO was added to a bacterial cell free protein synthesis reaction programmed with myc-luc mRNA, and luciferase light production was measured after 1 h at 37 C. The results show that only PMO 126 inhibited significantly (
(174) Statistical analysis of all PMO targeted to myc-luc, or only the 10-base isometric series indicated no correlation (r=0.09785, P=0.5428, and r=0.4572, P=0.1912, respectively) between inhibition in the cell-free reactions and percent C+G content. However, an analysis of 37 myc PMO (
(175) Previous work in eukaryotic systems suggests that PMO in the 13-14 subunit length are ineffective. We treated HeLa cell cultures that expressed myc-luc with 10 M myc PMO of 2 lengths (11- and 20-bases, PMO 340 and 126, SEQ ID NOS:63 and 71). Luciferase was measured at 7 and 24 hours after treatment. The results show that both PMO inhibited luciferase expression (
(176) The 3 truncated series of myc PMO were tested for inhibition of luciferase in a cell-free protein translation reaction made with eukaryotic (rabbit reticulocyte) components. The 20 base PMO inhibited significantly more than the shorter PMO (
Example 2
Acyl Carrier Protein as an Endogenous Bacterial Gene Target
(177) The effect of PMO was tested on an endogenous bacterial gene that encodes acyl carrier protein, acpP, which is essential for viability (Zhang and Cronan 1996) and has been used previously to inhibit bacterial growth (Good, Awasthi et al. 2001; Geller, Deere et al. 2003). PMO from 6 to 20 bases in length and complementary to region around the start codon in mRNA for acpP (Table 3, SEQ ID NOS:105-114) were added to growing cultures of AS19 and growth at 37 C was monitored by optical density and viable cell counts. Growth curves were normal for all cultures except for that with the 11 base PMO, which caused significant inhibition (
(178) PMO of various lengths (from 6 to 20 bases) and targeted to acpP were added to bacterial, cell-free protein synthesis reactions programmed to express an acpP-luc reporter. The results (
Example 3
In Vivo Antisense Antibacterial Activity
(179) Groups of 4 mice were injected IP with E. coli AS19, which has a genetic defect that makes it abnormally permeable to high MW solutes. Immediately following infection, each mouse was injected IP with 300 g of an 11-base PMO complementary to acpP, an 11-base nonsense sequence PMO, or PBS.
(180) Peritoneal lavages were collected at 2, 7, 13, and 23 h post-Infection, and plated for bacteria. The results show that at all times analyzed, the acpP PMO-treated mice had significantly (P<0.05) lower CFU than the mice treated with either nonsense PMO or PBS (
(181) The same PMOs were again tested, except with E. coli SM105, which has a normal outer membrane. AcpP PMO reduced CFU by 84% compared to nonsense PMO at 12 h post-infection. There was no reduction of CFU at 2, 6, or 24 h (
(182) The above results with acpP and nonsense PMOs suggest that inhibition was sequence specific. To demonstrate directly a sequence-specific effect, mice were infected with E. coli AS19 that expresses firefly luciferase, then treated at 0 and 13 h post-infection with a PMO (luc) complementary to the region around the start codon of the luciferase transcript, or a nonsense PMO. Peritoneal lavages were collected at 13 and 22 h post-infection and analyzed for CFU, luciferase activity, and luciferase and OmpA protein (western immuno-blot). As expected, the results show no inhibition of growth with luc PMO treatment compared to nonsense PMO treatment (Table 4). Luciferase activity in samples from luc PMO-treated mice was inhibited 53% and 46% at 13 and 22 h, respectively, compared to samples from nonsense PMO-treated mice (Table 4).
(183) Western blot analysis agreed closely with the results of luciferase activity. In samples from luc PMO-treated mice, there was a 68% and 47% reduction in the amount of luciferase protein at 13 and 22 h, respectively, compared to samples from nonsense PMO-treated mice (Table 2).
(184) TABLE-US-00005 TABLE 4 Gene Specific Inhibition Luciferase Activity Western Blot Time RLU/CFU Luc/OmpA after CFU/ Mean Mean PMO treatment ml (SEM) % (SEM) % Treatment (h) (10.sup.6) n = 8 P Inhibition n = 7-8 P Inhibition Luc 13 6.3 2.90 .0035 53 0.122 .0002 68 (0.629) (.0312) Nonsense 13 4.3 6.19 0 0.382 0 (0.773) (.0296) Luc 22 0.96 3.20 .0093 46 0.147 .0145 57 (0.582) (.0363) Nonsense 22 0.39 8.12* 0 0.339 0 (1.94) (.0668)