Drought tolerant plants
09532520 ยท 2017-01-03
Assignee
Inventors
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
International classification
A01H1/06
HUMAN NECESSITIES
A01H5/00
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the field of transgenic and non-transgenic plants with novel phenotypes. Provided are SlPP2C1 proteins and nucleic acid sequences encoding these, which are useful in conferring novel phenotypes to plants, especially drought tolerance.
Claims
1. A non-transgenic Solanum lycopersicum F1 hybrid plant homozygous for a mutant SlPP2C1 allele in its genome, wherein said mutant allele encodes a polypeptide having one or more of the mutations selected from the group consisting of Gly148Arg, Ala155Thr, and Gly132Ser relative to the wild type polypeptide set forth in SEQ ID NO: 2, wherein said plant has enhanced drought tolerance as compared to a Solanum lycopersicum plant comprising the wild type SlPP2C1 allele.
2. A Solanum lycopersicum seed having a mutant SlPP2C1 allele in its genome, representative samples of said seed having been deposited under NCIMB Accession Numbers 42602, 42603, or 42604.
3. A fruit, seed, or a plant part of the F1 hybrid plant according to claim 1, wherein said fruit, seed, or plant part comprises said mutant SlPP2C1 allele.
4. The F1 hybrid plant of claim 1, wherein said SlPP2C1 allele encodes a protein comprising the amino acid substitution at position Ala155 as compared to SEQ ID NO: 2.
5. The F1 hybrid plant of claim 1, wherein said SlPP2C1 allele encodes a protein comprising the amino acid substitution at position Gly148 as compared to SEQ ID NO: 2.
6. The F1 hybrid plant of claim 1, wherein said SlPP2C1 allele encodes a protein comprising the amino acid substitution at position Gly132 as compared to SEQ ID NO: 2.
7. The F1 hybrid plant of claim 1, wherein the mutant SlPP2C1 allele is obtainable by TILLING.
8. An inbred tomato plant homozygous for a mutant SlPP2C1 allele in its genome, wherein said mutant allele encodes a SlPP2C1 polypeptide having one or more of the mutations selected from the group consisting of Gly148Arg, Ala155Thr, and Gly132Ser relative to the wild type polypeptide set forth in SEQ ID NO: 2.
9. A method of generating non-transgenic Solanum lycopersicum plants with enhanced drought tolerance comprising inducing one or more mutations in the wild-type SlPP2C1 allele of SEQ ID NO: 2 to produce a mutant SlPP2C1 allele, wherein said mutant SlPP2C1 allele encodes a polypeptide having one or more mutations selected from the group consisting of Gly148Arg, Ala155Thr, and Gly132Ser relative to the wild type polypeptide set forth in SEQ ID NO: 2.
10. The method of claim 9, wherein representative samples of seeds of said plant having enhanced drought tolerance and comprising said mutant SlPP2C1 allele having been deposited under NCIMB Accession Numbers 42602, 42603, or 42604.
11. The method of claim 9, wherein said SlPP2C1 allele encodes a protein comprising the amino acid substitution at position Ala155 as compared to SEQ ID NO: 2.
12. The method of claim 9, wherein said SlPP2C1 allele encodes a protein comprising the amino acid substitution at position Gly148 as compared to SEQ ID NO: 2.
13. The method of claim 9, wherein said SlPP2C1 allele encodes a protein comprising the amino acid substitution at position Gly132 as compared to SEQ ID NO: 2.
14. The method of claim 9 further comprising selecting a Solanum lycopersicum plant for enhanced drought tolerance as compared to a Solanum lycopersicum plant comprising the wild type SlPP2C1 allele.
15. The method of claim 9, further comprising crossing said Solanum lycopersicum plant having enhanced drought tolerance with itself or a second plant.
16. The method of claim 14 further comprising crossing said Solanum lycopersicum plant selected for enhanced drought tolerance with itself or a second plant.
17. The method of claim 16, wherein the crossing comprises crossing the Solanum lycopersicum plant comprising the mutant SlPP2C1 allele selected for enhanced drought tolerance with another Solanum lycopersicum plant.
18. The method of claim 16, wherein the crossing comprises crossing the Solanum lycopersicum plant comprising the mutant SlPP2C1 allele with itself.
19. A Solanum lycopersicum plant grown from the seed of claim 2.
20. An F1 hybrid seed produced by crossing the plant of claim 19 with a second plant, wherein said F1 hybrid seed comprises the mutant SlPP2C1 allele.
Description
FIGURE LEGENDS
(1)
(2)
(3) The following non-limiting Examples describe the use of SlPP2C1 genes for modifying plant phenotypes. Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols as described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, and Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R. D. D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK.
EXAMPLES
Example 1
Isolation and Characterization of SlPP2C1
1.1 Materials and Methods
(4) 1.1.1 Plant Material
(5) Tomato plants (Solanum lycopersicum L. cv. Moneymaker) were grown under greenhouse conditions from March to October under 16/8 h day-night rhythm. Supplementary lights (600 Watt high pressure sodium lights, Philips, Eindhoven, The Netherlands) turned on below 200 W/m.sup.2 and turned off above 300 W/m.sup.2. Temperature was kept above 20 C. during the light period and 17 C. during the dark period with the PRIVA Integro versie 724 system. Plants were watered daily and given fertilizer weekly. Leaf and ovary tissues were dissected form adult tomato plants and root and hypocotyls from 10-day-old seedlings. Tissues were harvested between 11.00 hrs and 13.00 hrs and directly frozen in liquid nitrogen.
(6) 1.1.2 SlPP2C1 Gene-Expression Analysis and Q-PCR
(7) cDNA-AFLP was preformed as described in Vriezen et al. (2008, New Phytologist, 177:60-76, see page 61 and 62), comparing pollinated ovaries with gibberellic acid (GA.sub.3) treated ovaries. A differentially expressed fragment of 326 bp was cut out from the gel and the eluted DNA was re-amplified under the same conditions as used for the selective amplification. The fragment was ligated in a T-tailed EcoRV digested phagemid pBluescriptII SK(+) (Stratagene, La Jolla, Calif., USA) and sequenced using the CEQ DTCS Quick Start Kit and CEQ2000 DNA Analysis System (Beckman Coulter, Fullerton, Calif., USA).
(8) For quantitative PCR analysis RNA was isolated with the Trizol (Invitrogen, Carlsbad, Calif., USA). Photometric RNA measurements were done to equilibrate the RNA concentrations of different samples. Equal amounts of RNA were DNAse treated with RNAse free DNAse (RQ1, Promega, Madison, USA). RNA (0.5 g) was reverse transcribed (RT) using a cDNA synthesis kit (iScript, Bio-rad Laboratories, Hercules, Calif., USA) following protocol.
(9) Real-time-quantitative PCR (Q-PCR) primers for quantifying SlPP2C1 mRNA transcript levels were designed using a computer program (Beacon Designer Software, Premier Biosoft International, CA, USA), and checked for cross-homology with other PP2C sequences.
(10) TABLE-US-00002 (SEQIDNO:3) Primer1:5-TCGGAAGGAGAAGATTACG-3 (SEQIDNO:4) Primer2:5-TCCACAATTCGCAACAAC-3
(11) Primer pair 1 and 2 amplifies the following fragment of the SIPP2C1 transcript (174 bp):
(12) TABLE-US-00003 (SEQIDNO:22) 5TCGGAAGGAGAAGATTACGATGGGAAGAGTATTAACTGGGAGAAAGTT ATGACGGAGAGTTTCCGTAAAATGGACGAAAAGGTGAACAAGGAAGGGGC GGAGATGGCGACGATAGGATCAACGGCGGTGGTAGCGGTGGTGGGAGTGG AGGAATTTGTTGTTGCGAATTGTGGA3
(13) PCR reactions were preformed in a 96-well thermocycler (Bio-Rad iCycler, Bio-rad laboratories) using SYBR green mix (iB-SYBR Green supermix, Bio-rad laboratories). The PCR program started with 3 minutes at 95 C. then 40 cycles consisting of 15 second at 95 C. and 45 seconds at 57 C. and finally the melting temperature of the amplified product was determined to verify the presence of a specific product. Five microliter of 25-fold diluted cDNA was used per sample. Technical and biological replicates were always preformed.
(14) Both actin mRNA and ubiquitin were used as internal control genes.
(15) TABLE-US-00004 (SEQIDNO:5) Actinprimer1:5-GGACTCTGGTGATGGTGTTAG-3 (SEQIDNO:6) Actinprimer2:5-CCGTTCAGCAGTAGTGGTG-3 (SEQIDNO:7) Ubiquitinprimer1:5-CCCTGGCTGATTACAACATTC-3 (SEQIDNO:8) Ubiquitinprimer2:5-TGGTGTCAGTGGGTTCAATG-3
(16) Diluted DNase treated RNA was also included in the Q-PCR as a control for genomic DNA contamination.
(17) 1.1.3 Plant Transformation
(18) To generate transgenic SlPP2C1-lines, the coding region of SlPP2C1 (SEQ ID NO: 1) was PCR amplified and cloned in pDONR vector. PCR primers used for amplifying the complete SlPP2C1 cDNA were designed as follows:
(19) TABLE-US-00005 Primer1(forward): (SEQIDNO:9) 5CACCTGCAGTCACCGTCTTCACATTAAAAT3 Primer2(reverse): (SEQIDNO:10) 5ATTTGTATGGGAAGCTTAACTATCA3
(20) Using Gateway cloning the SlPP2C1 was cloned behind the Cauliflower Mosaic Virus 35S promoter in the pAD625 vector (de Folter et al. 2006, The Plant Journal 47: 934-946) which also contains a nopaline synthase terminator (3 nos). Transgenic tomato plants were generated by Agrobacterium tumefaciens-mediated transformation and tissue culture as described in De Jong et al. (2008, supra).
(21) 1.1.4 Water Stress Experiment
(22) The pots of wild type and SlPP2C1 transgenic lines of the same age and size, were saturated with water at the start of the experiment. Several plants were used per line. Plants were withheld from water for ten days. Wilting of leaves was assessed visually when the first signs of wilting (slight wilting or moderate wilting) was seen in the wild type control at day 8 and 9, respectively. A scale of 1-4 was used, with 4 being severely wilted, 3 being moderately wilted, 2 being slightly wilted and 1 showing no signs of leaf wilting.
(23) Photographs depicted in
(24) 1.1.5 Seed Germination Assay and Root Growth Assay
(25) Seed Germination:
(26) Seeds of the transgenic lines were harvested, dried and stored at 4 degrees Celsius. Seeds were sterilized in diluted bleach (4% (w/v) hypochlorite) containing 0.1% (v/v) Tween-20, washed and sown on MS media (2.25 mg MS basal salts supplied with 1% (w/v) sucrose, and Nitsch vitamins, Duchefa, Haarlem, the Netherlands) containing, 0, 1, 3, 10, or 30 WI ABA (Acros, Geel, Belgium). At least 40 seeds per ABA concentration were used.
(27) The plates were placed in a growth chamber at 25 C. under 16/8 h day-night rhythm. Seed germination (radicle protrusion) was scored after ten days and seed germination percentages were calculated.
(28) Root Growth:
(29) Seeds were sterilized as described above and sown in water containing 1 l GA.sub.3. After radicle protrusion ten seeds of each line were placed on MS media containing either 0, 5, 10, or 40 M ABA. The roots were measured and the plates were placed in vertical position and grown under conditions described above. Seven days after transfer the length of the root was measured again and root growth was calculated as a percentage of root growth compared to MS media without ABA (100%). Experiments were carried out three times and mean values plus SD are shown. Student's t-tests were performed to test for significance (p<0.05).
1.2. Results
(30) 1.2.1 Expression of SlPP2C1 During Fruit Set (Data not Shown)
(31) The SlPP2C1 gene is differentially expressed during fruit set (Vriezen et al. 2008, supra). SlPP2C1 is expressed highest in the pericarp of unpollinated ovaries and lower after pollination and GA.sub.3-treatment. The expression in ovules/placenta does not seem to change. We confirmed the expression of SlPP2C1 within the tissues of the tomato ovary by quantitative PCR. Again it was observed that the mRNA levels of SlPP2C1 are higher in the pericarp than in the ovules or placenta in control tissue. In the pericarp, but also in the placenta, a lower mRNA level of SlPP2C1 was found three days after pollination. In ovules mRNA levels did not change. The SlPP2C1 gene is expressed in mature unpollinated ovaries at anthesis at a relatively high level compared to vegetative tissues such as leaf, root and hypocotyl. In flower buds and in ovaries three days before anthesis the SlPP2C1 mRNA level is comparable to leaf, and it is much lower than in ovaries at anthesis (control, Ct). Three days after pollination SlPP2C1 mRNA levels in the ovary were reduced to approximately 50% of the level in unpollinated ones.
(32) 1.2.2 Functional Analysis of SlPP2C1
(33) Overexpression of SlPP2C1
(34) The over-expression (OE) approach resulted in three transgenic tomato lines with on average 25-fold higher mRNA levels of SlPP2C1 in leaves (overexpressing lines T6.sub.OE, T34.sub.OE and T55.sub.OE,
(35) Silencing of SlPP2C1
(36) Additionally, two lines (co-suppression lines T12.sub.CS and T35.sub.CS) were obtained that had lower SlPP2C1 mRNA levels in leaves and unpollinated ovaries, as compared to wild type (
(37) Sensitivity to ABA
(38) Phenotypic characterization of the transgenic lines revealed changed sensitivity for ABA.
(39) Root growth after germination is reduced by ABA in wild type. In
(40) Thus, co-suppression of SlPP2C1 leads to plants having a significantly enhanced ABA sensitivity than wild type (seed germination is inhibited more and root growth is inhibited more than in wild type), while overexpression leads to plants having a reduced ABA sensitivity, indicating that SlPP2C1 encodes a negative regulator of ABA.
(41) Drought Tolerance
(42)
(43) These data indicate that down-regulation of SlPP2C1 leads to plants having significantly enhanced drought tolerance compared to wild type.
(44) Discussion
(45) Two of the transgenic lines harbouring an over-expression construct had lower levels of SlPP2C1 mRNA in both leaves and ovaries. RNA silencing by co-suppression is a well accepted phenomenon although the mechanism is not fully understood. It has been suggested that co-suppression is induced by hairpin-RNA transcripts from inverted-repeat transgene copies, resulting in siRNAs that are incorporated into the RNAi pathway (Tomita et al. 2004, FEBS Lett. 2004 Aug. 27; 573(1-3):117-20; Wang and Metzlaff 2005, Curr Opin Plant Biol. 8(2): 216-22). Southern blot analysis (data not shown) revealed that in the two co-suppression lines of SlPP2C1 multiple insertions were present, which might have resulted in a hairpin-like structure that could silence the endogenous SlPP2C1 gene.
(46) The three lines with a 25-fold higher mRNA level of SlPP2C1 in leaf did not have higher SlPP2C mRNA levels in ovaries. This might be partly explained by the relatively high mRNA level of the endogenous gene in ovaries, which is seven fold higher than in leaf. The contribution of the transgene to the total expression levels of SlPP2C1 in ovaries might therefore have been very small. Remarkable is that in line T6.sub.OE and T34.sub.OE the mRNA level of SlPP2C1 in ovary is even lower (10-50%) than in wild type. Tissue specific control of endogenous mRNA levels by a transgene has however been reported before. Tomita et al. (2004, supra) showed that in the same plant the NtFAD3 gene was co-suppressed in leaf but over-expressed in root, resulting in the equivalent phenotypes in leaves and roots. The mechanisms by which tissue specific regulation of co-suppression occurs are unknown, but the level of endogenous transcript seems to be important (Tomita et al. 2004, supra).
(47) The two tomato transgenic lines with reduced mRNA levels in leaf and ovary also displayed ABA-hypersensitive responses during seed germination and root growth and enhanced tolerance to water stress. This indicates that the SlPP2C1 gene is a negative regulator of the ABA signalling cascade in tomato. Moreover, the three transgenic lines with relative high mRNA levels of SlPP2C1 in leaf also wilted stronger.
Example 2
TILLING Mutants Comprising Enhanced Drought Tolerance and Comprising Mutant SlPP2C1 Alleles
(48) 2.1 Tomato TILLING Population
(49) A highly homozygous inbred line used in commercial processing tomato breeding was used for mutagenesis treatment with the following protocol. After seed germination on damp Whatman paper for 24 h, 20,000 seeds, divided in 8 batches of 2500 respectively, were soaked in 100 ml of ultra pure water and ethyl methanesulfonate (EMS) at a concentration of 1% in conical flasks. The flasks were gently shaken for 16 h at room temperature. Finally, EMS was rinsed out under flowing water. Following EMS treatment, seeds were directly sown in the greenhouse. Out of the 60% of the seeds that germinated, 10600 plantlets were transplanted in the field. From the 8810 M1 lines that gave fruits, two fruits per plant were harvested. DNA was isolated from seeds coming from the first fruit, constituting the M2 population DNA stock. These were selfed and M3 seeds were isolated from the fruits and the seeds were used for DNA isolation and constitute the M3 population DNA bank.
(50) 2.2 Target SlPP2C1 Gene for PCR Amplification from TILLING Population
(51) Genomic sequence containing the complete transcribed region including coding region (COD), untranslated 5 end region (5 UTR) and 3 end region (3 UTR) was determined using PCR with genomic tomato DNA as template and primers designed on the flanks of the tomato SlPP2C1 sequence. By comparison of the genomic gene sequence with the SlPP2C1 cDNA sequence the location, number and size of introns and exons in this gene was determined.
(52) The genomic sequence is depicted in SEQ ID NO: 11. The primary RNA (transcribed region) is from nucleotide 2591-5050, comprising a 5 UTR (2591-2675), exon 1 (2676-3419), intron 1 (3420-4246), exon 2 (4247-4351), intron 2 (4352-4631), exon 3 (4632-4975) and the 3 UTR (4976-5050).
(53) DNA of the tomato TILLING population described above was then screened for single nucleotide polymorphisms in the SlPP2C1 target gene. For this purpose PCR primer pairs were designed to amplify overlapping fragments of about 400-500 bp from the coding (exon) sequences of the SlPP2C1 gene (SEQ ID NO: 1) or a sequence comprising all or part of the nucleic acid which encodes the C-terminus of the SlPP2C1 protein (as mutations in the catalytic domain are likely to result in reduced function or loss of function of the protein), i.e. encoding amino acids 84-391 of SEQ ID NO: 2. See Example 4 below, where mutations in amino acids 101-192 were identified.
(54) The primer pairs were used to amplify target sequences from the M2 or M3 DNA of the TILLING population and heteroduplexes between mutant and wild type target sequences were detected using CSCE or HRM as described below. The ID number of the DNA samples is linked to seed batches of plants carrying the wild type allele or the mutated allele either in heterozygous or in homozygous form.
(55) Seeds were germinated and the presence of the particular mutation in individual plants was confirmed by PCR using primers flanking the mutated site and genomic DNA of these plants as templates. DNA sequencing of the fragments identified mutants homozygous and heterozygous for the expected mutation. Homozygous mutants are selected or obtained after selfing and subsequent selection and the effect of the mutation on the corresponding protein and phenotype of the plant is determined.
(56) Plants comprising one or more mutations in the target sequences are screened phenotypically for drought tolerance using e.g. the assay described above and/or field assessment.
(57) 2.3 Conformation Sensitive Capillary Electrophoresis (CSCE)
(58) Multiplex PCR reactions are performed in 10 l volume with 0.15 ng, 4 times pooled genomic DNA. Labeled primers are added to the PCR master mix to a concentration 5 times lower (1 M) than that of the unlabeled primers. Post PCR, samples are diluted 10 times. Before the CSCE run, 2 l of the diluted products are added to 38 l of MQ water.
(59) The samples are loaded on 50 cm capillaries (injection time and voltage: 16 seconds, 10 KVolts; Run voltage: 15 KVolts) from the ABI 3130xl apparatus filled with semi-denaturating polymers of the following composition: 5 g Conformation Analysis Polymer (CAP) (Applied Biosystems, 434037, 9%), 2.16 g Ureum, 0.45 g 20TTE (national diagnostics, EC-871), completed with MQ water up to 9 g. The running buffer is prepared with 1 diluted TTE and 10% glycerol. The oven temperature is set to 18 C.)
(60) Raw data is analysed with the HeteroDuplex Analysis (HDA) software from BioNumerics, The program differentiates peak patterns of hetero-duplexes (mutant) and homo-duplex molecules (wild type) thus providing the possibility of selecting DNA-pools containing an individual line mutated in the target gene.
(61) 2.4 High Resolution Melt Curve Analysis (HRM)
(62) The LCgreen PCRs are performed on 8 flat pools in FramStar 96-wells plates (4titude, UK). 2 l (15 ng) of pooled DNA is mixed with 2 l of F-524 Phire 5 reaction buffer (FINNZYMES, Finland), 0.1 l Phire Hot Start DNA Polymerase (FINNZYMES, Finland), 1 l LCGreen Plus+ (BioChem, USA), 0.25 l of 5 mM primers, and completed to 10 l with MQ water) according to manufacturer recommendations. Pools containing a mutation are screened using a LightScanner System (Idaho Technology Inc., USA). Positive pools are selected by analyzing the melting temperature profiles; when the pool contains a mutation it will show a lower melting temperature.
Example 3
Transfer of Mutant SlPP2C1 Alleles into Tomato Cultivars
(63) TILLING mutants comprising a mutant SlPP2C1 allele are crossed with different tomato lines in order to transfer the mutant allele into these lines, generating tomato plants with good agronomic characteristics and significantly enhanced drought tolerance.
(64) A TaqMan SNP Genotyping Assays (Applied Biosystems) marker is developed to identify the presence of the modified nucleotide. This assay is used for Marker-assisted foreground selection which is effective for the transfer of recessive genes to a required background, for example commercial tomato parent lines, since their classical transfer requires additional recurrent selfing generations (Ribaut et al. Plant Molecular Biology Reporter 15:154-162).
Example 4
(65) DNA of the M2 TILLING population described in Example 2.1 was screened for single nucleotide polymorphisms in the SlPP2C1 target gene (as described in 2.2), in particular for mutations in the sequence encoding amino acids 101 to 192.
(66) For this purpose the following PCR primer pair was designed to amplify a 277 bp fragment of nucleotides 301-577 of SEQ ID NO: 1:
(67) TABLE-US-00006 Fowardprimer:3863 (SEQIDNO:12) 5-GTGACGTGCTGTTCACATGGATC-3 Reverseprimer:3861 (SEQIDNO:13) 5-TACGGAAACTCTCCGTCATAAC-3
(68) The primer pair was used to amplify target sequences from the M2 DNA of the Tilling population. The amplified target sequence comprises nucleotide 301 to 577 of SEQ ID NO: 1, i.e. the region encoding amino acids 101 to 192 of SEQ ID NO: 2. Heteroduplexes between mutant and wild type target sequence were identified using HRM as described in Example 2.3 (or 2.4).
(69) Ten plants comprising a SNP in the target region were identified and the PCR product of the target sequence was sequenced in order to determine the nature and position of the SNP. The results are shown in Table 2 below.
(70) TABLE-US-00007 TABLE 2 Plant SIFT number Mutation effect on prediction (M2, hetero- protein sequence on protein zygous) SNP in target sequence (SEQ ID NO: 2) function 1 T .fwdarw. A at nucleotide 372 Ile 124 .fwdarw. Ile silent of SEQ ID NO: 1 (atT .fwdarw. atA) 2 G .fwdarw. A at nucleotide 442 Gly 148 .fwdarw. Arg deleterious of SEQ ID NO: 1 (Ggg .fwdarw. Agg) 3 C .fwdarw. T at nucleotide 512 Ser 171 .fwdarw. Leu tolerated of SEQ ID NO: 1 (tCg .fwdarw. tTg) 4 G .fwdarw. A at nucleotide 504 Gln 168 .fwdarw. Gln 168 silent of SEQ ID NO: 1 (caG .fwdarw. caA) 5 G .fwdarw. A at nucleotide 463 Ala 155 .fwdarw. Thr deleterious of SEQ ID NO: 1 (Gcg .fwdarw. Acg) 6 G .fwdarw. A at nucleotide 465 Ala 155 .fwdarw. Ala silent of SEQ ID NO: 1 (gcG .fwdarw. gcA) 7 G .fwdarw. A at nucleotide 394 Gly 132 .fwdarw. Ser tolerated of SEQ ID NO: 1 (Ggc .fwdarw. Agc) 8 To be determined To be determined To be determined 9 To be determined To be determined To be determined 10 G .fwdarw. A at nucleotide 463 Ala 155 .fwdarw. Thr deleterious of SEQ ID NO: 1 (Gcg .fwdarw. Acg)
(71) Based on SIFT analysis (Pauline C. Ng and Henikoff 2003, Nucleic Acid Research Vol. 31, pp 3812-3814) the effect on protein function was predicted, see Table 2.
(72) Three plants (plants number 1, 4 and 6) contained a silent mutation in the SlPP2C1 gene, while five plants (number 2, 3, 5, 7 and 10) contained SNPs that lead to amino acid substitutions. Plants 5 and 10 contained identical mutations. Based on SIFT analysis, it is predicted that plants number 2, 5 and 10 comprise mutations in the SlPP2C1 allele which reduce or abolish PP2C1 protein function and therefore confer enhanced drought tolerance. It is noted that the mutant SlPP2C1 allele found in plant 2 is in the Asp-Gly-His (DGH) domain.
(73) Plants number 3 and 7 may also comprise a mutant allele which may confer enhanced drought tolerance.
(74) To test the response of plants 2, 3, 5, 7 and 10 to drought and/or other abiotic stresses, 14-d-old seedlings are subjected to various forms of stress treatments selected from one or more of the following treatments. 1. Drought stress can be imposed as described in the general description, the Examples above and/or by growing seedlings for 21 days in vitro on MS (to obtain homogenous populations) after which they are transferred to pots containing sandy soil. Two weeks after transfer water is withheld for 6 days after which 50 ml water/plant is added once. Results are scored when the azygous and control plants turn yellow (modified from The Plant Journal, 2004, 41, 95-106). 2. Salinity stress is imposed by growing seedlings on MS medium containing 250 mM NaCl for 0 to 48 h. 3. Osmotic stress can be imposed by growing seedlings on MS medium with added mannitol at 75 mM or ABA at 0.1 or 1.0 mM. Total root length and the amount of lateral roots developing during plant growth is a measure for osmotic stress tolerance and ABA sensitivity, respectively (modified from Xion et al., Plant Physiology, 2006, 142, 1065-1074).
DEPOSIT FORMATION
(75) A representative sample of seeds of the Solanum lycopersicum plant number 2 (as referred to in Table 2) (Gly148Arg mutant) comprising a substitution of the glycine at amino acid position 148 into arginine, was deposited by Nunhems B. V. and accepted for deposit on Jun. 23, 2016 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn Aberdeen, Scotland AB21 9YA. UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). The seed of the Gly148Arg mutant was given the following deposit number: NCIMB 42602.
(76) A representative sample of seeds of the Solanum lycoperiscum plant number 5 (as referred to in Table 2) (Ala155Thr mutant) comprising a substitution of the alanine at amino acid position 155 into threonine, was deposited by Nunhems B.V. and accepted for deposit on Jun. 23, 2016 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). The seed of the Ala155Thr mutant was given the following deposit number NCIMB 42604.
(77) A representative sample of seed of the Solanum lycoperiscum plant number 7 (as referred to in Table 2) (Gly132Ser mutant) comprising a substitution of the glycine at amino acid position 132 into serine, was deposited by Nunhems B.V. and accepted for deposit on Jun. 23, 2016 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate Bucksburn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty. under the Expert Solution (EPC 2000, Rule 32(1)). The seed of the Gly132Ser mutant was given the following deposit number: NCIMB 42603.
(78) Access to the deposits will be available during the pendency of this application to persons determined by the Director of the Patent and Trademark Office to be entitled thereto upon request. Applicant requests that samples of the seeds and any material derived from said samples, be only released to a designated Expert in accordance with Rule 32(1) EPC or related legislation of countries or treaties having similar rules and regulation. Subject to 37 C.F.R. 1.808(b), all restrictions imposed by the depositor on the availability to the public of one or more deposits will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years. or 5 years after the most recent request, or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 U.S.C. 2321 et seq.).
(79) Plants comprising significantly enhanced stress tolerance, especially drought tolerance, compared to controls are used to generate tomato cultivars with good agronomic characteristics as e.g. described in Example 3. Plants with significantly enhanced drought tolerance may also in addition or alternatively comprise significantly enhanced salinity and/or osmotic stress tolerance compared to controls.