USE OF INTERFERENCE PEPTIDE IN PREPARATION OF ANTI-SARS-CoV-2 MEDICAMENT
20220323537 · 2022-10-13
Inventors
Cpc classification
International classification
Abstract
An agent for inhibiting binding of transferrin receptor to SARS-CoV-2 spike protein or an anti-SARS-CoV-2 medicament is provided, where active pharmaceutical ingredients of the agent or the medicament include interference peptides, and the interference peptides include: SL8, FG8, DL12, RK4, SD6, HF7, and/or QK8.
Claims
1. An agent for inhibiting binding of transferrin receptor to SARS-CoV-2 spike protein, wherein active pharmaceutical ingredients of the agent comprise interference peptides, and the interference peptides comprise: SL8, FG8, DL12, RK4, SD6, HF7, and/or QK8; the SL8 has an amino acid sequence as shown in SEQ ID NO. 1, the FG8 has an amino acid sequence as shown in SEQ ID NO. 2, the DL12 has an amino acid sequence as shown in SEQ ID NO. 3, the RK4 has an amino acid sequence as shown in SEQ ID NO. 4, the SD6 has an amino acid sequence as shown in SEQ ID NO. 5, the HF7 has an amino acid sequence as shown in SEQ ID NO. 6, and the QK8 has an amino acid sequence as shown in SEQ ID NO. 7.
2. The agent according to claim 1, wherein the interference peptides have a working concentration of 0.5-5 μM/60 nM SARS-CoV-2 spike protein.
3. An anti-SARS-CoV-2 medicament, wherein active pharmaceutical ingredients of the medicament comprise interference peptides, and the interference peptides comprise: SL8, FG8, DL12, RK4, SD6, HF7, and/or QK8; the SL8 has an amino acid sequence as shown in SEQ ID NO. 1, the FG8 has an amino acid sequence as shown in SEQ ID NO. 2, the DL12 has an amino acid sequence as shown in SEQ ID NO. 3, the RK4 has an amino acid sequence as shown in SEQ ID NO. 4, the SD6 has an amino acid sequence as shown in SEQ ID NO. 5, the HF7 has an amino acid sequence as shown in SEQ ID NO. 6, and the QK8 has an amino acid sequence as shown in SEQ ID NO. 7.
4. The medicament according to claim 3, wherein pharmaceutical dosage forms of the medicament comprise powder, tablet, granules, capsule, solution, emulsion, suspension, or injection.
5. A method for treating diseases caused by SARS-CoV-2 infection, wherein the agent according to claim 1 is injected intravenously.
6. The method according to claim 5, wherein the agent or the medicament has an injection dose of 0.5-1 mg/kg based on the interference peptides.
7. The method according to claim 5, wherein a single polypeptide is injected during the injection.
8. The method according to claim 5, wherein the interference peptides have a working concentration of 0.5-5 μM/60 nM SARS-CoV-2 spike protein.
9. A method for treating diseases caused by SARS-CoV-2 infection, wherein the medicament according to claim 3 is injected intravenously.
10. The method according to claim 7, wherein pharmaceutical dosage forms of the medicament comprise powder, tablet, granules, capsule, solution, emulsion, suspension, or injection.
11. The method according to claim 6, wherein the agent or the medicament has an injection dose of 0.5-1 mg/kg based on the interference peptides.
12. The method according to claim 7, wherein the agent or the medicament has an injection dose of 0.5-1 mg/kg based on the interference peptides.
13. The method according to claim 8, wherein the agent or the medicament has an injection dose of 0.5-1 mg/kg based on the interference peptides.
14. The method according to claim 6, wherein a single polypeptide is injected during the injection.
15. The method according to claim 7, wherein a single polypeptide is injected during the injection.
16. The method according to claim 8, wherein a single polypeptide is injected during the injection.
17. The method according to claim 9, wherein a single polypeptide is injected during the injection.
18. The method according to claim 10, wherein a single polypeptide is injected during the injection.
19. The method according to claim 11, wherein a single polypeptide is injected during the injection.
20. The method according to claim 12, wherein a single polypeptide is injected during the injection.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0016]
[0017]
[0018]
[0019]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0020] The present disclosure will be further described below with reference to examples.
[0021] The present disclosure provides use of interference peptides in the preparation of an anti-SARS-CoV-2 medicament, and the interference peptides include: SL8, FG8, DL12, RK4, SD6, HF7, and/or QK8;
[0022] the SL8 has an amino acid sequence as shown in SEQ ID NO. 1, the FG8 has an amino acid sequence as shown in SEQ ID NO. 2, the DL12 has an amino acid sequence as shown in SEQ ID NO. 3, the RK4 has an amino acid sequence as shown in SEQ ID NO. 4, the SD6 has an amino acid sequence as shown in SEQ ID NO. 5, the HF7 has an amino acid sequence as shown in SEQ ID NO. 6, and the QK8 has an amino acid sequence as shown in SEQ ID NO. 7.
[0023] The information on sequences of the interference peptides of the present disclosure is shown in Table 1:
TABLE-US-00001 TABLE 1 The sequences of the interference peptides Peptide name Sequence SEQ ID NO. SL8 SKVEKLTL 1 FG8 FPFLAYSG 2 DL12 DQTKFPIVNAEL 3 RK4 RAGK 4 SD6 SDWKTD 5 HF7 HPVTGQF 6 QK8 QDSNWASK 7
[0024] Preparation methods of the interference peptides are not particularly limited in the present disclosure, and the interference peptides may preferably be prepared by artificial synthesis. In the present disclosure, the transferrin receptor may bind to the SARS-CoV-2 spike protein and thus infect human cells; the interference peptides may inhibit the binding of the transferrin receptor to the SARS-CoV-2 spike protein, thereby achieving anti-SARS-CoV-2 and SARS-CoV-2 infection-treating effects.
[0025] The present disclosure further provides an agent for inhibiting binding of transferrin receptor to SARS-CoV-2 spike protein, where active pharmaceutical ingredients of the agent include interference peptides, and the interference peptides include: SL8, FG8, DL12, RK4, SD6, HF7, and/or QK8;
[0026] the SL8 has an amino acid sequence as shown in SEQ ID NO. 1, the FG8 has an amino acid sequence as shown in SEQ ID NO. 2, the DL12 has an amino acid sequence as shown in SEQ ID NO. 3, the RK4 has an amino acid sequence as shown in SEQ ID NO. 4, the SD6 has an amino acid sequence as shown in SEQ ID NO. 5, the HF7 has an amino acid sequence as shown in SEQ ID NO. 6, and the QK8 has an amino acid sequence as shown in SEQ ID NO. 7.
[0027] In the present disclosure, the interference peptides may preferably have a working concentration of 0.5-5 μM/60 nM SARS-CoV-2 spike protein. In the present disclosure, the active pharmaceutical ingredients of the agent may be either a single interference peptide or a mixture of more interference peptides, and further, the mixing ratio of all interference peptides in the mixture is not particularly limited, as long as total concentration may reach 0.5-5 μM/60 nM SARS-CoV-2 spike protein.
[0028] The present disclosure further provides an anti-SARS-CoV-2 medicament, where active pharmaceutical ingredients of the medicament include interference peptides, and the interference peptides include: SL8, FG8, DL12, RK4, SD6, HF7, and/or QK8;
[0029] the SL8 has an amino acid sequence as shown in SEQ ID NO. 1, the FG8 has an amino acid sequence as shown in SEQ ID NO. 2, the DL12 has an amino acid sequence as shown in SEQ ID NO. 3, the RK4 has an amino acid sequence as shown in SEQ ID NO. 4, the SD6 has an amino acid sequence as shown in SEQ ID NO. 5, the HF7 has an amino acid sequence as shown in SEQ ID NO. 6, and the QK8 has an amino acid sequence as shown in SEQ ID NO. 7. The working concentrations and the mixing ratio of the interference peptides of the present disclosure are the same as those described above, and the details will not be repeated herein.
[0030] Pharmaceutical dosage forms of the medicament of the present disclosure are not particularly limited, preferably including powder, tablet, granules, capsule, solution, emulsion, suspension, or injection. The medicament of the present disclosure further includes pharmaceutically acceptable excipients. In the present disclosure, when the pharmaceutical dosage forms of the medicament are prepared, the medicament may preferably be prepared according to the preparation methods of different pharmaceutical dosage forms.
[0031] The present disclosure further provides a method for treating SARS-CoV-2-infected cells, i.e., the SARS-CoV-2-infected cells are mixed with the interference peptides, where the mixing ratio of the cells to the peptides may be 4×10.sup.4 cells: 800 nM.
[0032] The present disclosure further provides a method for treating diseases caused by SARS-CoV-2 infection, i.e., the foregoing interference peptides are injected intravenously, where the interference peptides may preferably have an injection dose of 0.5-1 mg/kg. In the present disclosure, during the intravenous injection, a single polypeptide may preferably be injected.
[0033] The use of interference peptides in the preparation of an anti-SARS-CoV-2 medicament provided by the present invention will be described in detail below with reference to the examples, but they should not be construed as limiting the protection scope of the present disclosure.
Example 1
[0034] Verification of the Binding of SARS-CoV-2 Spike Protein RBD to Transferrin Receptor by SPR
[0035] Transferrin receptor (11020-H07H, Sino biological, China) was diluted (20 μg/ ml) with 200 μl of sodium acetate buffer (10 mM, pH 5), and flew through a CMS sensor chip (BR100012, GE, USA) at a flow rate of 5 μl/min to reach 2,000 resonance units (RU). The remaining active sites on the chip were blocked with 75 μl of ethanolamine solution (1 M, pH 8.5). The interactions between serial concentrations of spike protein RBD (3.90625, 7.8125, 15.625, 31.25, 62.5, 125, and 250 nM) in Tris-HC1 buffer (20 mM, pH 7.4) and immobilized transferrin receptor were analyzed at a flow rate of 10 μl/min. The BIA software (GE, USA) was used to determine the bound KD and the rate constants Ka and Kd. Results are shown in
Example 2
[0036] Prediction of SARS-CoV-2 Spike Protein-Transferrin Receptor by Protein-Protein Docking Analysis
[0037] Well-known transferrin receptor crystal structure (PDB ID: 1CX8) and SARS-CoV-2 spike protein crystal structure (PDB ID: 6LZG) were used, and protein-protein docking analysis was conducted by using ZDOCK. Results are shown in
Example 3
[0038] Chemical Preparation Method of Interference Peptides, Synthesized by Fmoc-Lys(Boc)-Wang Resin
[0039] 1. Resin Swelling
[0040] 5 g of Fmoc-Leu-Wang Resin with a degree of substitution of 0.3 was weighed, poured into a reaction column, swollen with 50 ml of DCM, and soaked for 30 min.
[0041] 2. Deprotection
[0042] The DCM in the reaction column was suctioned to dryness; Fmoc was removed with 20% piperidine in DMF; nitrogen was blown for 30 min; after suctioning to dryness, the reaction column was washed with DMF five times, and the DMF was suctioned to dryness.
[0043] 3. Condensation Reaction
[0044] Condensation was conducted with a combination of TBTU/DIEA activators; TBTU and linking amino acids were calculated and weighed based on 3-fold feed capacity, dissolved in 50 ml of DMF, and charged into the reaction column; DIEA (1.55 ml) was added, nitrogen was blown, and the reaction was conducted for 1 h.
[0045] 4. Detection and Washing
[0046] A little resin was sampled from the reaction column using a sampling tube, decanted into a small test tube, and washed once with DMF; after DMF was discarded, three drops each of solutions A, B, and C (solution A: ninhydrin in ethanol, solution B: mixture of 20% ethanol and 80% phenol, solution C: redistilled pyridine) were charged into the small test tube, and the small test tube was placed and heated in a heater at 120° C. for 3 min; after removing the small test tube, colors of the solution and the resin were observed, where a yellow solution and colorless or yellowish resin indicate a complete condensation reaction; the reaction in the reaction column was stopped, the solution was suctioned to dryness, and the reaction column was washed with DMF thrice.
[0047] 5. Refeeding
[0048] If the resin color is detected as other colors, e.g., green, blue, and purple, the reaction may be incomplete. Similarly, suctioning and washing were conducted thrice; the same amounts of reactants as the current reaction were weighed and poured into the reaction column to react again, until a complete reaction was detected.
[0049] 6. Continuous Condensation
[0050] For subsequent linkage of amino acids, steps 2 to 5 were repeated; the amounts of different amino acids to be weighed were calculated and weighed according to the same calculation method; the amount of TBTU/DIEA remained unchanged.
[0051] 7. Shrinkage
[0052] After the completion of the linkage of the last amino acid, step 2 was repeated; the reaction column was washed with DCM thrice and methanol thrice, and suctioned to dryness; the resin was poured out, dried over a drying lamp, and filled in a 500 ml beaker.
[0053] 8. Cleavage
[0054] 100 ml of cleavage cocktail (TFA/thioanisole/phenol/EDT/water=86/5/4/3/2) was charged into a beaker; the beaker was placed on a magnetic stirrer, a magneton was put in the beaker, and the reaction was conducted for 2 h under stirring; after that, the resin was filtered through a sand core funnel and rinsed with TFA twice; the cleavage cocktail was decanted into 600 ml of ice ether, during which polypeptides were precipitated to form a polypeptide ether suspension; a large centrifuge was used for repeated centrifugation, respectively; the supernatant was discarded, and precipitates were washed with ether thrice and baked over a drying lamp to remove residual ether; the resulting solid was a target crude polypeptide product.
[0055] Purification
[0056] The crude product was dissolved in water, filtered, and separated and purified by high performance liquid chromatography (HPLC), and finally a target fine polypeptide product with a purity of over 95% was obtained.
[0057] 10. Preparation
[0058] 7 g of crude product was dissolved in a solution of ACN:H.sub.2O 1:4 (V/V), and a small portion of the sample was collected to analyze the peak time of the sample. (HPLC was conducted by a high performance liquid chromatograph) Cartridges for preparing the 100DAC column were selected; the sample was injected into the column, and a gradient was selected for separation according to the peak time of the crude product; impurities were separately collected according to the HPLC chart; LC-MS was used to determine whether the products collected were necessary or not, and the necessary substances were left for detection. Products qualified in HPLC were subjected to rotary evaporation and lyophilization. An amount of desired product (white powder) was obtained.
Example 4
[0059] Verification of the Inhibition of Interference Peptides against the Binding of SARS-CoV-2 Spike Protein to Transferrin Receptor by SPR
[0060] Spike proteins (60 nM) doped with different concentrations (0.5 and 5 μM) of interference peptides were injected at a flow rate of 20 μl/ min to detect the inhibition of interference peptides against the binding of spike protein to transferrin receptor.
[0061] Results are shown in
Example 5
[0062] Inhibition of Interference Peptides against SARS-CoV-2-Infected Vero E6 Cells
[0063] Vero E6 cells (from Kunming Cell Bank) were pre-treated with different interference peptides for 1 h and infected with SARS-CoV-2 for 1 h. Subsequently, a virus-interference peptides mixture was removed, and the cells were further cultured with a fresh medium supplemented with interference peptides. At 48 h, a cell supernatant was collected, and lysed with Cell Lysis Buffer (Cat# 15596018, Thermo, USA) to conduct further cytopathogenic effect (CPE) and quantitative RT-PCR (qRT-PCR) analysis.
[0064] Amplified primers used in qRT-PCR were NP gene primers:
[0065] Target-2-F (SEQ ID NO. 8): GGGGAACTTCTCCTGCTAGAAT,
[0066] Target-2-R (SEQ ID NO. 9): CAGACATTTTGCTCTCAAGCTG, and
[0067] Target-2-P (SEQ ID NO. 10): 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′.
[0068] Results are shown in
[0069] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.