VIRAL VECTOR DELIVERY SYSTEM FOR BOTH RESPIRATORY AND DIGESTIVE TRACTS OF PIGS AND APPLICATION THEREOF
20250134983 ยท 2025-05-01
Assignee
- JIANGSU ACADEMY OF AGRICULTURAL SCIENCES (Nanjing, CN)
- SNU R&DB FOUNDATION (Seoul, KR)
- GUOTAI (TAIZHOU) CENTER OF TECHNOLOGY INNOVATION FOR VETERINARY BIOLOGICALS, TAIZHOU (Taizhou, CN)
Inventors
- Xing XIE (Nanjing, CN)
- Zhixin Feng (Nanjing, CN)
- Daesub SONG (Seoul, KR)
- Rong CHEN (Nanjing, CN)
- Fei HAO (Nanjing, CN)
- Lulu XU (Nanjing, CN)
- Minjoo YEOM (Seoul, KR)
- Jongwoo Lim (Seoul, KR)
- Lei ZHANG (Nanjing, CN)
- Yuan Gan (Nanjing, CN)
- Long ZHAO (Nanjing, CN)
- Wenliang LI (Nanjing, CN)
- Qiyan Xiong (Nanjing, CN)
- Yongjie LIU (Nanjing, CN)
- Beibei LIU (Nanjing, CN)
- Yanfei YU (Nanjing, CN)
- Yun Bai (Nanjing, CN)
- Guoqing SHAO (Nanjing, CN)
Cpc classification
C12N2830/50
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N15/88
CHEMISTRY; METALLURGY
C12N2770/32344
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/88
CHEMISTRY; METALLURGY
Abstract
A viral vector delivery system for both respiratory and digestive tracts of pigs and an application thereof are provided. The viral vector delivery system includes a backbone plasmid and a helper plasmid. The backbone plasmid is produced by inserting a full-length cDNA of porcine enterovirus B (PEVB) into a pUC57 plasmid. The helper plasmid is produced by inserting a green fluorescent protein-coding gene into a plasmid pCAG-T7-polymerase. The viral vector delivery system can be constructed with high efficiency, can quickly cause a cytopathic effect (CPE) after infecting cells, has a viral titer up to 10.sup.7.75 TCID.sub.50/mL, and can maintain high stability. A pathogenic epitope for the respiratory and digestive tracts of pigs is inserted into the backbone plasmid to produce a vaccine antigen, which is non-pathogenic, has high stability and a high viral titer, and allows a prominent immunization effect after being inoculated in pigs.
Claims
1. A viral vector delivery system for both a respiratory tract and a digestive tract of a pig, comprising a backbone plasmid and a helper plasmid, wherein the backbone plasmid is produced by inserting a full-length cDNA of porcine enterovirus B (PEVB) into a pUC57 plasmid; and the helper plasmid is produced by inserting a green fluorescent protein-coding gene into a plasmid pCAG-T7-polymerase.
2. The viral vector delivery system according to claim 1, wherein a T7 promoter is inserted at a first terminus of the full-length cDNA of the PEVB in the backbone plasmid, and a his-tag and a polyA tail are inserted at a second terminus.
3. A construction method of the viral vector delivery system according to claim 1, comprising the following steps: constructing the backbone plasmid and the helper plasmid separately, and co-transfecting the backbone plasmid and the helper plasmid into monkey kidney cells or porcine bronchial epithelial cells.
4. The construction method according to claim 3, wherein a process for constructing the backbone plasmid is as follows: with a full-length cDNA of a PEVB strain PEV-B-KOR as a template, introducing a T7 promoter at a 5 terminus of the full-length cDNA of the PEVB strain PEV-B-KOR and a his-tag and a polyA tail at a 3 terminus through a polymerase chain reaction (PCR), and inserting into the pUC57 plasmid to produce the backbone plasmid.
5. The construction method according to claim 4, wherein a process for constructing the helper plasmid is as follows: inserting the green fluorescent protein-coding gene into the plasmid pCAG-T7-polymerase to produce the helper plasmid.
6. The construction method according to claim 5, wherein the backbone plasmid and the helper plasmid are co-transfected into monkey kidney cells veroE6 with a liposome Lipofectamine 3000, and a viral plaque producing green fluorescence is picked to produce the viral vector delivery system.
7. An application of the viral vector delivery system according to claim 1 in a construction of a vaccine antigen for a respiratory tract and a digestive tract of a pig.
8. The application according to claim 7, comprising: inserting an epitope-coding gene for the respiratory tract and/or the digestive tract between a VP4 gene and a 5UTR gene of the backbone plasmid, and conducting co-transfection with the helper plasmid using a liposome Lipofectamine 3000 into monkey kidney cells veroE6 or porcine bronchial epithelial cells hTERT-PBECs to produce the vaccine antigen.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0052] The porcine bronchial epithelial cell line hTERT-PBEC adopted in the present disclosure is published in the CN107338225A, with an accession number CCTCC NO: C201749. The porcine bronchial epithelial cell line can be stably passaged to the 60th generation or more with the characteristics of primary cells retained. Thus, the porcine bronchial epithelial cell line can be used in the research on pathogenic mechanisms of pathogenic infections in porcine respiratory tracts.
[0053] The present disclosure is further explained below in conjunction with specific examples. It should be understood that these examples are provided only for a purpose of illustration, and are not intended to limit the protection scope of the present disclosure.
Example 1 Construction Method of a Viral Vector Delivery System for Both Respiratory and Digestive Tracts of Pigs
1. Construction of a Backbone Plasmid and Acquisition of a Linearized Fragment of the Backbone Plasmid
[0054] 200 L of a cell culture suspension of a cryopreserved PEVB strain PEV-B-KOR (published in GenBank, with an NCBI GenBank accession number of JQ818253) was taken and subjected to total RNA extraction according to operating instructions of a viral RNA/DNA extraction kit (Axygen, Cat. No: AP-MN-BF-VNA-250, NY, USA). The extracted total RNA was reverse-transcribed with a viral RNA reverse-transcription kit (purchased from Vazyme, Item No. R223-01) to produce cDNA.
[0055] According to enzyme cleavage sites of the virus and a pUC57 Escherichia coli (E. coli) vector plasmid, a forward primer PEntero-F including a T7 promoter and a reverse primer PEntero-R including a polyA tail were designed. With the cDNA as a template and the PEntero-F and PEntero-R as primers, a full-length cDNA of the PEVB strain PEV-B-KOR that was introduced with the T7 promoter at a 5 terminus and a his-tag and a polyA tail at a 3 terminus was amplified. The amplified full-length cDNA and the pUC57 E. coli vector plasmid each were cleaved with EcoRV and then ligated with a T4 DNA ligase, such that the full-length cDNA (7,393 bp) of PEVB, the his-tag, the polyA tail, and the T7 promoter were inserted into the pUC57 plasmid to produce a recombinant plasmid pUC57-PEVB. The recombinant plasmid pUC57-PEVB was introduced into E. coli XL-10 competent cells, and positive clones carrying the recombinant plasmid pUC57-PEVB were selected with an ampicillin-resistant LB plate.
[0056] A sequence of the forward primer PEntero-F was as follows: 5-AATAATACGACTCACTATAGGGTTAAAACAGCCTGTGGGTTGTTCCCA-3 (SEQ ID NO: 8).
[0057] A sequence of the reverse primer PEntero-R was as follows: 5-AATTTTTTTTTTTTTTTTACACCCCATCCGGTGGGTGTATTGAATT-3 (SEQ ID NO: 9).
[0058] A complete genome sequence of the viral strain PEV-B-KOR was divided into target fragments 1, 2, and 3 (details were shown in Table 1). Three pairs of specific primers (as shown in Table 1) were designed with the software Primer Premier 5.0 to amplify the target fragments 1 to 3, respectively. The primers were sent to Nanjing GenScript Biotech Co., Ltd. for synthesis. With RNA of the positive clones carrying the recombinant plasmid pUC57-PEVB as a template, RT-PCR was conducted by a one-step RT-PCR kit (Beijing TransGen Biotech Co., Ltd.) with each pair of specific primers. An RT-PCR system had a total volume of 20 L, including: 2R-Mix Buffer: 10 L, upstream and downstream primers: each 0.5 L, E-Mix: 0.4 L, RNA template: 2 L, and Rnase-free water: making up to 20 L. An amplification procedure was as follows: reverse-transcription at 45 C. for 30 min; 94 C. for 5 min; 94 C. for 30 s, 55 C. to 60 C. for 30 s (an annealing temperature during amplification for each pair of primers was shown in Table 1), and 72 C. for 2 min, with 35 cycles; and 72 C. for 10 min. The target fragments 1 to 3 each were purified and recovered, then transformed into the E. coli XL-10, and identified and sequenced by colony PCR. According to sequencing results, a viral complete genome sequence produced by splicing target fragments 1 to 3 resulting from RT-PCR with RNA of a positive clone 1 carrying the recombinant plasmid pUC57-PEVB as a template had a sequence homology of 100% with the PEV-B-KOR, indicating that the recombinant plasmid pUC57-PEVB (the backbone plasmid) was successfully constructed. A schematic diagram of a structure of the recombinant plasmid was shown in
TABLE-US-00001 TABLE1 PrimersforwholegenomeamplificationofthestrainPEV-B-KOR Annealing Primersequence temperature Targetfragment Primername (5-3) (C.) 1 Primer F1 TTAATAATACGACTCACTATAGGGT 56 (1-3010bp) 1 (SEQIDNO:10) 3005bp R1 GGAAGAAGACTGAAGGGTTT (SEQIDNO:11) 2 Primer F2 TGCAGCCAGATTTAGTGTACCG 60 (3000-5430bp) 2 (SEQIDNO:12) 2423bp R2 TCATCCCAACTCCAAAGTCCAT (SEQIDNO:13) 3 Primer F3 TCTTGGTGTAATCCAATCTGCAG 60 (5400-7393bp) 3 (SEQIDNO:14) 1950bp R3 GGCTGCTCTTTTCTCCTAAGTTTT (SEQIDNO:15)
2. Construction of a Helper Plasmid Carrying a T7 RNA Polymerase and a Green Fluorescent Marker
[0059] With a eukaryotic expression vector plasmid pEGFG-C1 (purchased from Clontech) as a template and E-F and E-R (Table 2) as primers, a green fluorescent protein-coding gene EGFP fragment was amplified. Based on the principle of homologous recombination, the amplified EGFP fragment was inserted into pCAG-T7-polymerase with a ClonExpress II One Step Cloning Kit (purchased from Vazyme, Item No. Vazyme.C112-01). The pCAG-T7-polymerase included a T7 RNA polymerase-coding gene. A specific method was as follows: The amplified green fluorescent protein-coding gene EGFP fragment was cleaved with HindIII, and then ligated by a T4 DNA ligase with pCAG-T7-polymerase that was also cleaved with HindIII to produce the eukaryotic helper plasmid carrying the T7 RNA polymerase-coding gene and the green fluorescent protein-coding gene, which was denoted as pCAG-T7 RNA polymerase-EGFP. A schematic diagram of the construction was shown in
TABLE-US-00002 TABLE2 Primersforconstructionofthehelperplasmid Annealing Primer Primersequence temperature Targetfragment name (5-3) (C.) T7RNA T7-pol-F TCTCATCACTACCCTACGCAATA 56 polymerase (SEQIDNO:16) T7-pol-R TCTCGTGATGGGACACTAAC (SEQIDNO:17) EnhancerpCAG C-F AAGGGAACTCTTGAGGTTAGAT 55 (SEQIDNO:18) C-R ACGATCAAGGGTCCGACT (SEQIDNO:19) Greenfluorescent E-F ctcgacctgcagcccaagcttACATAACTTAC 61 protein-coding GGTAAATGGCCCG(SEQIDNO:20) geneEGFP E-R GaccatgattacgccaagcttTAAGATACATT GATGAGTTTGGACAAAC(SEQID NO:21) Notes: In Table 2, a lowercase sequence is a recombinant sequence added at a 5terminus for homologous recombination, and the underlined indicates the enzyme cleavage site: AAGCTT.
[0060] The eukaryotic helper plasmid pCAG-T7 RNA polymerase-EGFP was transformed into DH5a competent cells, and the competent cells were coated on an LB plate including kanamycin and ampicillinum. 1 to 5 single colonies were picked, and PCR amplification was conducted with the three pairs of primers in Table 2. The electrophoresis and sequencing were conducted for identification. Results were shown in
3. Co-Transfection in Cells and Acquisition and Passage Identification of a Recombinant Porcine Enterovirus
[0061] A conventional method was used to co-transfect the linearized backbone plasmid obtained in section 1 of this example and the helper plasmid pCAG-T7 RNA polymerase-EGFP obtained in section 2 of this example into African green monkey kidney cells veroE6 with a liposome Lipofectamine 3000. A mass ratio of the linearized backbone plasmid to the helper plasmid was 3:2. Transfected cells were sub-cultured on veroE6 and observed under ultraviolet light with a wavelength of 488 nm. Cytopathic plaques emitting green fluorescence were picked and cultured on freshly-prepared monkey kidney cells veroE6. Then green plaques were picked several times consecutively (
[0062] An inappropriate liposome concentration or transfection ratio during transfection will lead to the mass dead of cells, will also greatly affect a transfection effect, and will reduce a proportion of successfully-transfected cells because a liposome itself is toxic to some extent. It was found through a large number of experiments that, when the mass ratio of the linearized backbone plasmid to the helper plasmid was 3:2, there was the highest transfection efficiency, and a fluorescence proportion after transfection reached 85% to 90% or more.
[0063] The P0 generation of the recombinant porcine enterovirus r-PEVB was passaged on immortalized porcine bronchial epithelial cells hTERT-PBECs (published in the Chinese patent application ZL201710556520.4, with an accession number CCTCC NO: C201749). A cell culture medium was prepared as follows: Australian fetal bovine serum (FBS) at a final concentration of 5% (volume percentage concentration), an antibiotic G418 at 200 g/mL, and a complete set of epithelial cell regulatory factors in a BEGM kit (LONZA, cat. no. CC-4175) were added to a DMEM/F12 medium (Gibco). A concentration of each of the complete set of epithelial cell regulatory factors from the BEGM kit in the cell culture medium was as follows: a bovine pituitary extract (BPE): 26 g/mL, human epithelial growth factor (hEGF): 15.5 ng/mL, human insulin: 5 g/mL, hydrocortisone: 1.4 M, epinephrine: 2.7 M, iodothyronine: 9.7 nM, tretinoin: 0.3 nM, and transferrin: 10 g/mL. The immortalized porcine bronchial epithelial cells hTERT-PBECs were cultured with the cell culture medium in a 37 C. and 5% CO.sub.2 incubator. When a cell confluency reached 85% to 90%, the P0-generation recombinant porcine enterovirus r-PEVB was inoculated at 10.sup.4TCID.sub.50, incubated for 2 h, and washed twice with serum-free DMEM. Then the cell culture medium was replaced with a DMEM/F12 medium including 2% (volume percentage concentration) of FBS, and the culture was conducted for 72 h to 96 h. A resulting cell supernatant was collected and centrifuged at 4 C. and 1,500 rpm, and a resulting supernatant was collected as a virus solution. Then, the passage could be conducted by the same method consecutively for 30 generations or more. CPE in a passaging process was observed. CPE of a P30 generation on immortalized cells was shown in
TABLE-US-00003 TABLE3 Nucleotidesequencesofthereal-timePCRprimersandtheprobe Primeror Annealing probename Primersequence(5-3) temperature(C.) PEVB-F AGGCTGACTGGACGGGGCAA(SEQIDNO:22) 56 PEVB-R GCGCCTTGGGAAACGACGAG(SEQIDNO: 23) PEVB-probe CTACCGTTCTCGTTCTAGCTGGCCG(SEQID 55 NO:24)
TABLE-US-00004 TABLE 4 CT values of real-time PCR for P0 to P30 generations (every 2 generations) of the recombinant virus r-PEVB Generation of r-PEVB CT value P0 18.855 P2 18.999 P4 19.400 P6 22.551 P8 23.277 P10 24.894 P12 24.996 P14 25.016 P16 25.489 P18 25.914 P20 26.614 P22 27.263 P24 29.798 P26 31.343 P28 32.196 P30 33.816 NC Undetermined Notes: In Table 4, NC represents a negative control, where real-time PCR is conducted with a DMEM/F12 medium instead of viral RNA. Undetermined means that there is no detection value.
4. Identification and Biological Characteristic Study for the Recombinant Porcine Enterovirus r-PEVB
4.1 Determination of TCID.sub.50 of the recombinant virus on porcine bronchial epithelial cells hTERT-PBECs
[0064] Growth curves of a porcine enterovirus parental strain (a PEVB strain PEV-B-KOR) and the recombinant porcine enterovirus r-PEVB were determined on porcine bronchial epithelial cells hTERT-PBECs. A specific method was as follows: hTERT-PBECs were infected with each of the recombinant porcine enterovirus r-PEVB (P25 generation) and the parental strain PEV-B-KOR strain (P5 generation) at 10.sup.3 TCID.sub.50, incubated for 2 h, and then cultured with a DMEM/F12 medium including 2% (volume percentage concentration) of FBS instead in a 37 C. and 5% CO.sub.2 incubator. At 24 h, 48 h, 72 h, 96 h, and 120 h after the inoculation, virus samples were collected and subjected to three freeze-thaw cycles. TCID.sub.50 of a virus sample at each time point was determined. A one-step growth curve of the recombinant porcine enterovirus r-PEVB was plotted according to viral titers. A difference in growth kinetics between the recombinant porcine enterovirus and the parental strain as a control was determined. According to results (
4.2 Identification of the recombinant porcine enterovirus r-PEVB
[0065] A VP4 protein gene of PEVB (a sequence was shown in SEQ ID NO: 1) was inserted into a protein expression vector pET-32a, and then a resulting protein expression vector was introduced into an E. coli host to produce recombinant bacteria VP4-32a. The expression of a recombinant VP4 protein (carrying his-tag) was induced with isopropylthio--galactoside (IPTG). A precipitate resulting from lysis of recombinant bacteria VP4-32a included a large amount of a target protein (
[0066] The renatured recombinant VP4 protein as an immunogen was inoculated into New Zealand white rabbits to prepare a rabbit-derived anti-VP4 protein polyclonal antibody. According to ELISA antibody detection (the renatured recombinant VP4 protein was coated at 3 g/well), the renatured recombinant VP4 protein had an ELISA antibody titer of 100,000 or more. The rabbit-derived anti-VP4 protein polyclonal antibody could be used subsequently for the IFA and WB identification of r-PEVB (P25).
4.2.1 IFA identification
[0067] The recombinant porcine enterovirus r-PEVB was cultured with porcine bronchial epithelial cells hTERT-PBECs for 96 h, fixed with paraformaldehyde, then washed with phosphate buffered saline (PBS) 3 times, permeabilized with a 0.2% Triton X-100 aqueous solution at room temperature for 5 min, washed with PBS 3 times, blocked with a 3% BSA aqueous solution at room temperature for 1 h, washed with PBS 3 times, incubated with the rabbit-derived anti-VP4 protein polyclonal antibody as a primary antibody overnight at 4 C., washed with PBS 3 times, incubated with Alexa Fluor 555-labeled donkey anti-rabbit IgG (H+L) (purchased from Beyotime, Item No.: A0453) at 37 C. for 1 h in the dark, washed with PBS 3 times, and observed under a fluorescence microscope. Porcine bronchial epithelial cells hTERT-PBECs not infected with the recombinant porcine enterovirus r-PEVB were adopted as NC. Porcine bronchial epithelial cells hTERT-PBECs that were not infected with the recombinant porcine enterovirus r-PEVB and incubated with PBS instead of the rabbit-derived anti-VP4 protein polyclonal antibody were adopted as a blank control. It can be seen from
4.2.2 WB identification
[0068] Porcine bronchial epithelial cells hTERT-PBECs (normal control), porcine bronchial epithelial cells hTERT-PBECs infected with the recombinant porcine enterovirus r-PEVB, and porcine bronchial epithelial cells hTERT-PBECs infected with the parental strain (the PEVB strain PEV-B-KOR) each were collected and subjected to total protein extraction with an RIPA protein lysis buffer (Item No. P0013B) of Beyotime. Each total protein was subjected to SDS-PAGE and then transferred to a PVDF membrane. The membrane was taken out, washed with PBST 3 times, blocked with a 5% skimmed milk solution at 37 C. for 2 h, washed with PBST 3 times, incubated with the rabbit-derived anti-VP4 protein polyclonal antibody (prepared in section 4.2 of this example) overnight at 4 C., washed with PBST 3 times, incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) (purchased from Beyotime, Item No. A0208) at room temperature for 1 h, washed with PBST 3 times, and subjected to electrochemiluminescence (ECL). In addition, the hTERT-PBECs infected with the recombinant porcine enterovirus r-PEVB were subjected to WB verification with a his antibody by the same method as the WB verification with the rabbit-derived anti-VP4 protein polyclonal antibody, except that the his antibody (purchased from BOSTER, Item No.: M30975-) was used instead of the rabbit-derived anti-VP4 protein polyclonal antibody. Specific results were shown in
Example 2 Application of a Viral Vector for Both Respiratory and Digestive Tracts of Pigs
1. Research on related characteristics of the recombinant porcine enterovirus r-PEVB as a viral vector
[0069] A gene sequence (SEQ ID NO: 2) for a T cell epitope of ASFV was inserted between a VP4 gene and a 5UTR gene of the recombinant porcine enterovirus r-pEVB to produce a recombinant expression plasmid A-T-r-PEVB. An amino acid sequence for the T cell epitope of ASFV was shown in SEQ ID NO: 3. The gene fragment for the T cell epitope of ASFV was synthesized by GenScript. A specific method for constructing the recombinant expression plasmid A-T-r-PEVB was as follows: The recombinant plasmid pUC57-PEVB constructed in Example 1 was cleaved with EcoRI and HindIII, and then ligated with the synthesized gene fragment for the T cell epitope of ASFV by a conventional method with a T4 DNA ligase to produce the recombinant expression plasmid A-T-r-PEVB.
[0070] A gene (SEQ ID NO: 4) for a B cell epitope of a major protective adhesion factor antigen P97R1 of Mhp was inserted between a VP4 gene and a 5UTR gene of the recombinant porcine enterovirus r-pEVB to produce a recombinant expression plasmid M-r-PEVB. An amino acid sequence for the B cell epitope of the major protective adhesion factor antigen P97R1 of Mhp was shown in SEQ ID NO: 5. A specific method for constructing the recombinant expression plasmid M-r-PEVB was as follows: The recombinant plasmid pUC57-PEVB constructed in Example 1 was cleaved with EcoRI and HindIII, and then ligated with the synthesized gene fragment for the B cell epitope of P97R1 by a conventional method with a T4 DNA ligase to produce the recombinant expression plasmid M-r-PEVB.
[0071] A gene fragment with a sequence shown in SEQ ID NO: 6 that included the T cell epitope of ASFV and the B cell epitope of P97R1 of Mhp was inserted between a VP4 gene and a 5UTR gene of the recombinant porcine enterovirus r-pEVB to produce a recombinant expression plasmid A-M-r-PEVB. An amino acid sequence including the T cell epitope of ASFV and the B cell epitope of P97R1 of Mhp was shown in SEQ ID NO: 7. A specific method for constructing the recombinant expression plasmid A-M-r-PEVB was as follows: The recombinant plasmid pUC57-PEVB constructed in Example 1 was cleaved with EcoRI and HindIII, and then ligated with the synthesized gene fragment with the sequence shown in SEQ ID NO: 6 by a conventional method with a T4 ligase to produce the recombinant expression plasmid A-M-r-PEVB.
[0072] The recombinant expression plasmids each were cleaved with EcoRI and then identified by electrophoresis. Results were shown in
[0073] The recombinant viruses A-T-r-PEVB, M-r-PEVB, and A-M-r-PEVB could be passaged continuously on hTERT-PBECs, and could be stably passaged for 25 generations or more. During a passaging process, CPE was observed. CPE of a P14 generation on immortalized hTERT-PBECs was shown in
TABLE-US-00005 TABLE 5 CT values of real-time PCR for P0 to P30 generations (measured every 5 generations) of each recombinant virus Generation Generation Generation of the of the of the recombinant recombinant recombinant virus A-T-r- CT virus M-r- CT virus A-M-r- CT PEVB value PEVB value PEVB value P0 18.400 P0 18.158 P0 18.499 P5 23.277 P5 27.551 P5 24.894 P10 26.016 P10 23.996 P10 28.489 P15 28.614 P15 27.914 P15 25.263 P20 30.343 P20 30.174 P20 29.798 P25 31.770 P25 31.816 P25 30.196 P30 35.500 P30 34.794 P30 35.137 NC Undeter- mined Note: NC in Table 5 represents a negative medium control.
[0074] A plurality of sites had also be selected by the applicants for inserting the cell epitope genes of the above three antigens. It was found that there was a very low transfection efficiency of less than 10%, such as inserting between a 2A gene and a VP1 gene.
2. Identification of each recombinant virus
[0075] hTERT-PBECs were cultured according to the method in section 3 of Example 1. The recombinant viruses A-T-r-PEVB, M-r-PEVB, and A-M-r-PEVB of a P25 generation each were inoculated for proliferation, and cultured for 72 h to 96 h. Three freeze-thaw cycles were conducted, and centrifugation was conducted at 10,000 rpm and 4 C. for 10 min. IFA and WB were conducted for identification. Uninfected hTERT-PBECs were adopted as NC. For the PEVB VP4 protein, with a rabbit-derived anti-VP4 protein polyclonal antibody as a primary antibody and Alexa Fluor 555-labeled donkey anti-rabbit IgG (H+L) (purchased from Beyotime, Item No. A0453) as a secondary antibody, the recombinant viruses A-T-r-PEVB, M-r-PEVB, and A-M-r-PEVB each were identified by IFA and WB. For the recombinant virus M-r-PEVB, with an Mhp P97R1 antibody (published in Xie Xing et al., 2022, Construction of a telomerase-immortalized porcine tracheal epithelial cell model for swine-origin mycoplasma infection, Journal of Integrative Agriculture 2022, 21 (2): 504-520) as a primary antibody and Alexa Fluor 555-labeled donkey anti-mouse IgG (H+L) (purchased from Beyotime, Item No. A0460) as a secondary antibody, IFA and WB were conducted. For the recombinant virus A-T-r-PEVB, with an ASFV-positive serum antibody as a primary antibody and an FITC-labeled goat anti-pig fluorescent secondary antibody (purchased from Beijing Biodragon, Item No. BD9448) as a secondary antibody, IFA and WB were conducted. For A-M-r-PEVB, with an ASFV-positive serum antibody as a primary antibody and an FITC-labeled goat anti-pig fluorescent secondary antibody (purchased from Beijing Biodragon, Item No. BD9448) as a secondary antibody, IFA and WB were conducted, and IFA and WB were also conducted with an Mhp P97R1 antibody. Porcine bronchial epithelial cells hTERT-PBECs not infected with the recombinant porcine enterovirus r-PEVB were adopted as NC for both IFA and WB identification.
[0076] Results of IFA (
[0077] As shown in
3. Immunogenicity (Mhp and ASFV) of pigs immunized with each recombinant virus and protective efficacy evaluation (Mhp)
[0078] The feasibility of using the recombinant virus r-PEVB as a viral vector of a vaccine for both respiratory and digestive tracts of pigs was comprehensively evaluated.
[0079] A preparation method of each recombinant virus was as follows: The recombinant virus r-PEVB that was passaged on hTERT-PBECs to the 14th generation (P14) and cryopreserved at-70 C. was subjected to expansion culture on hTERT-PBECs for 96 h until obvious CPE was observed. Three freeze-thaw cycles were conducted, centrifugation was conducted, and a resulting supernatant was collected as the recombinant virus r-PEVB. Preparation methods of the recombinant viruses A-T-r-PEVB and M-r-PEVB were the same as the preparation method of the recombinant virus r-PEVB. Thus, all recombinant viruses for immunization were of the 15th generation.
(1) Evaluation of safety of the recombinant virus r-PEVB and a parental strain PEV-B-KOR in pigs
[0080] The recombinant virus r-PEVB of 10.sup.6.5 TCID50/mL and the strain PEV-B-KOR of 10.sup.6.5 TCID.sub.50/mL each were intramuscularly injected into 10-day-old SPF pigs at a dose of 2 mL/pig, and clinical symptoms were observed within 14 d. The necropsy was conducted 14 d later. The results showed that, like the parental strain, the recombinant virus r-PEVB did not cause any clinical symptoms or diarrhea after being intramuscularly injected into pigs. The intestinal pathological sections (
(2) Immunogenicity of the recombinant virus A-T-r-PEVB against ASFV after immunization of pigs
[0081] 28-day-old SPF pigs were selected for testing, and randomly divided into two groups with 5 pigs in each group. The two groups were inoculated with the recombinant virus A-T-r-PEVB and a DMEM/F12 medium (NC group), respectively. The day on which the first immunization was conducted was day 0, which was denoted as 0 dpi. The second and third immunization were conducted with the recombinant virus A-T-r-PEVB for pigs. The second immunization was conducted on day 14 after the first immunization, and the third immunization was conducted on day 21 after the first immunization. Each immunization was conducted through both intranasal administration and intramuscular injection. For the intranasal administration or intramuscular injection, each pig was inoculated at a dose of 1 mL of a virus solution with 10.sup.7.0 TCID50/mL, such that each pig was inoculated each time at a total dose of 2 mL of a virus solution with a virus content of 10.sup.7.0 TCID50/mL. For the NC group, each pig was inoculated with 2 mL of a DMEM/F12 medium each time.
[0082] Pigs inoculated with the recombinant virus A-T-r-PEVB were evaluated for immunogenicity. Serum IgG antibody expression levels against ASFV whole virus protein and ASFV p30, p22, p10, p54, cd2v-N, and B602L proteins before and after immunization were compared. A detection method of a serum antibody level against ASFV p30 could be seen in Xie Qinyun et al., 2023, Dynamics of Serological and Mucosal Antibody Responses against African Swine Fever Viruses in Experimentally Infected Pigs. Transboundary and emerging diseases, Article ID 9959847. Detection methods of serum antibody levels against other proteins were the same as the detection method of the serum antibody level against ASFV p30, except that only a coating protein was replaced with a corresponding protein. sIgA antibody levels in oral fluids before and after immunization were determined (a method was the same as the method in Xie Qinyun et al., 2023, Dynamics of Serological and Mucosal Antibody Responses against African Swine Fever Viruses in Experimentally Infected Pigs. Transboundary and emerging diseases, Article ID 9959847, except that a microplate plate was coated with ASFV p22 and p30 proteins in a protein concentration ratio of 2:1). Expression levels of cell-mediated immunity-associated and pro-inflammatory cytokines were determined by qPCR. A method for determining the expression levels of cell-mediated immunity-associated and pro-inflammatory cytokines by qPCR was as follows: Quantitative fluorescence primers for pro-inflammatory cytokines of pigs (shown in a table below) were designed. RNA was extracted from serum and then reverse-transcribed into cDNA using a reverse-transcription kit HiScript III RT SuperMix for qPCR (+gDNA wiper) (purchased from Vazyme, Item No. R323-01). A -actin gene was adopted as an internal reference control. A 2-AACT method (Livak and Schmittgen, 2001, Analysis of relative gene expression data using real-time quantitative PCR and the 2 (T) (-Delta Delta C) method. Methods 25, 402-408.) was used to determine fold changes in the mRNA expression of porcine cytokine genes between the immunization group and the NC group.
TABLE-US-00006 TABLE6 Quantitativefluorescenceprimersforthepro-inflammatorycytokinesofpigs Cytokine Senseprimersequence(5-3) Antisenseprimersequence(5-3) TNF- CCAATGGCAGAGTGGGTATG TGAAGAGGACCTGGGAGTAG (SEQIDNO:25) (SEQIDNO:26) IFN- GGCTCTGGTGCATGAGATGC CAGCCAGGATGGAGTCCTCC (SEQIDNO:27) (SEQIDNO:28) IFN- GCTCTGGGAAACTGAATGAC TCTCTGGCCTTGGAACATAG (SEQIDNO:29) (SEQIDNO:30) IL-6 ATCAGGAGACCTGCTTGATG TGGTGGCTTTGTCTGGATTC (SEQIDNO:31) (SEQIDNO:32) IL-10 GCATCCACTTCCCAACCA CTTCCTCATCTTCATCGTCAT (SEQIDNO:33) (SEQIDNO:34) IL-2 AAGCACAGCAGCAGCAGCAG GCCGCAGAGGTCCAAGTTCATC (SEQIDNO:35) (SEQIDNO:36) -actin CATCACCATCGGCAACGA GCGTAGAGGTCCTTCCTGATGT (SEQIDNO:37) (SEQIDNO:38)
[0083] T cell clustering was conducted for porcine PBMCs (a specific method could be seen in Chung C J, Cha S-H, Grimm A L, Ajithdoss D, Rzepka J, Chung G, et al. (2018) Pigs that recover from porcine reproduction and respiratory syndrome virus infection develop cytotoxic CD4+CD8+ and CD4+CD8-T-cells that kill virus infected cells. PLOS ONE 13 (9): e0203482). The immunogenicity of the recombinant virus A-T-r-PEVB carrying the T cell epitope of ASFV in pigs was comprehensively evaluated.
[0084] Results: Serum IgG antibody levels against the five antigens (CD2V-N, P10, P30, P54, and B602L) all were greatly improved on day 28 after immunization compared with the control group. A serum IgG antibody level against P22 was significantly increased on day 14 after immunization compared with the control group. Details were shown in
(3) Immunogenicity of pigs immunized with the recombinant virus M-r-PEVB against Mhp and protective efficacy evaluation
[0085] 28 d-old SPF pigs were randomly divided into three groups (immune challenge group, challenge control group, and NC group) with 5 pigs in each group. In the immune challenge group, three immunizations were conducted. The day on which the first immunization was conducted was day 0, which was denoted as 0 dpi. The second immunization was conducted on day 14 after the first immunization, and the third immunization was conducted on day 28 after the first immunization. Each immunization was conducted through both intranasal administration and intramuscular injection with 1 mL of an M-r-PEVB virus solution with a virus content of 10.sup.7.0 TCID50/mL, and each pig was immunized with 2 mL of a virus solution with a virus content of 10.sup.7.0 TCID50/mL in total. The NC group was immunized three times according to the same method as above, except that only the M-r-PEVB virus solution was replaced with a DMEM/F12 medium. In the immune challenge group, on day 42 after the first immunization, 5 mL of an Mhp 168 strain virus solution was administered through tracheal injection at a dose of 1010.sup.9.5 CCU/pig/time. In the NC group (denoted as a KM2 control group), three immunizations all were conducted by administering a KM2 liquid medium through tracheal injection with the same volume as the M-r-PEVB virus solution for each immunization, and no challenge was conducted. In the challenge control group, three immunizations all were conducted by administering a same volume of a KM2 liquid medium through tracheal injection, and on day 42 after the first immunization, an Mhp 168 strain was administered through tracheal injection for challenge at the same dose as the immune challenge group. During the whole test period, pigs in each group were observed every day for clinical symptoms such as cough of the respiratory tract. On day 28 after the challenge, namely, on day 70 after the first immunization, pigs were dissected. Lung lesions in the immune challenge group, the challenge control group, and the NC group after necropsy were scored (a scoring method could be seen in Madec F, Kobisch M, Bilaan Lesionnel des poumons des porcs chaarcutiers alabattoir, Journees de la Recherche Porcine en France, 1982, 14:405-412.). Levels of a serum antibody against Mhp P97R1 and levels of a mucosal sIgA antibody in a BALF before immunization and after challenge were determined by ELISA (detection methods could be seen in Gan & Xie et al., 2020, Establishment of a model of Mycoplasma hyopneumoniae infection using Bama miniature pigsFood Production, Processing and Nutrition (2020) 2:19). Cilia of lungs before immunization and after challenge were observed under an electron microscope (a specific method could be seen in Gan & Xie et al., 2020, Establishment of a model of Mycoplasma hyopneumoniae infection using Bama miniature pigsFood Production, Processing and Nutrition (2020) 2:19). The immunogenicity and immune protection of pigs immunized with the recombinant virus M-r-PEVB against Mhp were comprehensively evaluated.
[0086] During the whole experimental process of challenged immunization, no pathological changes were found at an injection site, indicating that the recombinant virus M-r-PEVB is relatively safe when used as a candidate viral vector vaccine strain for Mhp.
[0087] According to results of apparent lesions in lungs after necropsy shown in
[0088] After necropsy, a bronchial ring of each pig was cut, fixed with glutaraldehyde, and observed by electron microscopy for cilia. Results were shown in
[0089] Before the first immunization and after the challenge, 3 mL of whole blood was collected from each pig to prepare serum, and a nasal swab was collected. A serum IgG antibody level against Mhp was detected, and a mucosal antibody sIgA level against Mbp in the nasal swab was detected. As shown in
[0090] After necropsy, BALF of each pig was collected. Through a constructed standard positive plasmid PMD-T-P97 carrying an Mhp P97 antigen (a P97 sequence of an Mhp strain 168 (GeneBank accession number NC_017509.1) was inserted into a PMD-18T vector to finally produce the standard positive plasmid carrying the Mhp P97 antigen), an Mhp copy number in BALF of each pig was determined by quantitative fluorescence PCR. A specific detection method was shown in Wu, Y., Ishag, H. Z. A., Hua, L., Zhang, L., Liu, B., Zhang, Z., et al. (2019). Establishment and application of a real-time, duplex PCR method for simultaneous detection of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis. Kafkas Universitesi Veterinary Fakultesi Dergisi, 25, 405-414. It can be seen from
[0091] In summary, M-r-PEVB is safe when used as a recombinant viral vector expression strain for Mhp, and has a prominent immune protection effect against Mhp infection.
[0092] r-PEVB exhibits high safety when used as a vaccine vector for respiratory and gastrointestinal tracts, and has a prominent immune protection effect against Mhp and African swine fever virus.