Recombinant <i>Acinetobacter baumannii </i>strain AB5075
12292441 ยท 2025-05-06
Assignee
Inventors
Cpc classification
C07K2317/70
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
G01N2333/212
PHYSICS
International classification
A61K39/00
HUMAN NECESSITIES
Abstract
In this application is described a mutant Acinobacter baumannii strain having a deletion or mutation in its genome. The deletion or mutation interrupts the proper translation of the Hcp protein.
Claims
1. An Acinetobacter baumannii strain comprising a transposon comprising an antibiotic resistance gene and two loxP sites, wherein the two loxP sites flank the antibiotic resistance gene, wherein the transposon is inserted into the genome of the Acinetobacter baumannii and interrupts the expression of hcp (hemolysin co-regulated protein), wherein the strain is AB5075 deposited as Patent Deposit Number PTA-127747.
2. The Acinetobacter baumannii strain of claim 1, wherein the transposon inserts 73 codons without a stop codon in-frame of the Acinetobacter baumannii genome, and interrupts the expression of hcp.
3. An immunogenic composition comprising the Acinetobacter baumannii strain of claim 1.
4. A method of inducing an immune response in a subject comprising administering to the subject an effective amount to induce the immune response of the Acinetobacter baumannii strain of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) These and other features, aspects, and advantages of the present invention will become better understood with reference to the following description and appended claims, and accompanying drawings where:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
(10) In the description that follows, a number of terms used in recombinant DNA, microbiology and immunology are extensively utilized. In order to provide a clearer and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided.
(11) The use of the word a or an when used in conjunction with the term comprising in the claims and/or the specification may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one.
(12) Throughout this application, the term about is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
(13) The use of the term or in the claims is used to mean and/or unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and and/or.
(14) As used in this specification and claim(s), the words comprising (and any form of comprising, such as comprise and comprises), having (and any form of having, such as have and has), including (and any form of including, such as includes and include) or containing (and any form of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
(15) It also is specifically understood that any numerical value recited herein includes all values from the lower value to the upper value, i.e., all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application. For example, if a range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification.
(16) Contacting refers to the process of bringing into contact at least two distinct species such that they can react. It should be appreciated, however, the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture.
(17) An isolated antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
(18) An antibody that specifically binds to or is specific for a particular polypeptide or polysaccharide or an epitope on a particular polypeptide or polysaccharide is one that binds to that particular polypeptide or polysaccharide or epitope on a particular polypeptide or polysaccharide without substantially binding to any other polypeptide or polypeptide epitope.
(19) Polyclonal antibodies are immunoglobulin molecules that react against a specific antigen, each antibody identifying a different epitope on the antigen. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation.
(20) Monoclonal antibodies are immunoglobulin molecules that recognize a specific epitope on a specific antigen. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). Other methods of preparing monoclonal antibodies are well known in the art. In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro.
(21) The immunizing agent will typically include the polypeptide or polysaccharide or a fusion protein thereof. Generally, either peripheral blood lymphocytes (PBLs) are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103). Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
(22) Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, Calif. and the American Type Culture Collection, Manassas, Va. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, 1984, J. Immunol., 133:3001; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63).
(23) The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against the desired antigen. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, 1980, Anal. Biochem., 107:220.
(24) After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, supra). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
(25) The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
(26) The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences (U.S. Pat. No. 4,816,567) or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
(27) The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.
(28) In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art.
(29) Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab, F(ab).sub.2, and Fv fragments; diabodies; linear antibodies (Zapata et al., 1995, Protein Eng. 8(10): 1057-1062); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
(30) Nucleic acid, oligonucleotide, and polynucleotide refer to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
(31) Conservatively modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids that encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are silent variations, which are one species of conservatively modified variations. Every nucleic acid sequence herein that encodes a polypeptide also describes every possible silent variation of the nucleic acid. one of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid that encodes a polypeptide is implicit in each described sequence.
(32) The word label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a labeled antibody. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
(33) As used herein, the term subject refers to humans, and other animals. Thus, veterinary treatment is provided in accordance with the presently-disclosed subject matter. As such, the presently-disclosed subject matter provides for the treatment of mammals such as humans, as well as those mammals of importance due to being endangered, such as Siberian tigers; of economic importance, such as animals raised on farms; and/or animals of social importance to humans, such as animals kept as pets or in zoos. Examples of such animals include but are not limited to: carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and/or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; and horses. Thus, also provided is the treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses (including race horses), poultry, and the like.
(34) The language biological sample is intended to include biological material, e.g. cells, blood, tissues, biological fluid, or a solution for administering to a subject, such as a vaccine, or immunoglobulin. By environmental sample is meant a sample such as soil and water. Food samples include canned goods, meats, milk, and other suspected contaminated food. Forensic sample includes any sample from a suspected terrorist attack, including paper, powder, envelope, container, hair, fibers, and others.
(35) Dry in the context of freeze drying or lyophilization, refers to residual moisture content less than about 10%. Dried compositions are commonly dried to residual moistures of 5% or less, or between about 3% and 0.1%.
(36) Lyophilization (or freeze-drying) is a dehydration technique in which the sample solution (e.g., an antibody composition) is frozen and the solvent (e.g., water or buffer) is removed by sublimation by applying high vacuum. The technique of lyophilization is well known to one of skill in the art (Rey and May, 1999).
(37) Excipients or protectants (including cryoprotectants and lyoprotectants) generally refer to compounds or materials that are added to ensure or increase the stability of the therapeutic agent during the dehydration processes, e.g. foam drying, spray drying, freeze drying, etc., and afterwards, for long term stability.
(38) A stable formulation or composition is one in which the biologically active material therein essentially retains its physical stability and/or chemical stability and/or biological activity upon storage. Stability can be measured at a selected temperature for a selected time period. Trend analysis can be used to estimate an expected shelf life before a material has actually been in storage for that time period.
(39) Pharmaceutically acceptable refers to those active agents, salts, and excipients which are, within the scope of sound medical judgment, suitable for use in contact with the tissues or humans and lower animals without undue toxicity, irritation, allergic response and the like, commensurate with a reasonable benefit/risk ratio, and effective for their intended use.
(40) A variety of methods exist in the art for the production of monoclonal antibodies. For example, the monoclonal antibodies may be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567. In this context, the term monoclonal antibody refers to an antibody derived from a single eukaryotic, phage, or prokaryotic clone. The DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies, or such chains from human, humanized, or other sources). Once isolated, the DNA may be placed into expression vectors, which are then transformed into host cells such as NS0 cells, Simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains of a desired species in place of the homologous human sequences (U.S. Pat. No. 4,816,567; Morrison et al, supra) or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
(41) The term epitope is art-recognized. It is generally understood by those of skill in the art to refer to the region of an antigen or antigens that interacts with an antibody. An epitope of a peptide or protein antigen can be linear or conformational, or can be formed by contiguous or noncontinguous amino acid sequences of the antigen. The Hcp antigen, like many proteins, contain many epitopes. The epitopes or peptides recognized by the antibodies of the present invention and conservative substitutions of these peptides which are still recognized by the antibody are an embodiment of the present invention. These peptides offer a convenient method for eluting Hcp to mAb on immunoaffinity columns. For example, when an antibody which recognizes the epitope for 13F7 is used in an immunoaffinity column to purify Hcp antigen, the peptide recognized by the antibody can be added to the immunoaffinity column to elute the Hcp antigen. Further truncation of these epitopes may be possible since antigenic epitopes have been reported to be represented by as few as five amino acid residues.
(42) The nucleotide and amino acid sequence of the heavy and light chain variable regions and the CDR domains of the mAbs of the invention are described in this application. The invention further provides polynucleotides comprising a nucleotide sequence encoding any number of CDR domains of the invention and fragments thereof still capable of binding Hcp. The invention also encompasses polynucleotides that hybridize under stringent or lower stringency hybridization conditions to polynucleotides that encode the heavy or light chain variable region or CDR domains of the antibody of the present invention.
(43) The polynucleotides may now be obtained by any method known in the art. For example, a polynucleotide may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
(44) Alternatively, a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3 and 5 ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.
(45) Since the nucleotide sequence and corresponding amino acid sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
(46) A vector comprising any of the above-described isolated or purified nucleic acid molecules, or fragments thereof, is further provided by the present invention. Any of the above nucleic acid molecules, or fragments thereof, can be cloned into any suitable vector and can be used to transform or transfect any suitable host. The selection of vectors and methods to construct them are commonly known to persons of ordinary skill in the art and are described in general technical references (see, in general, Recombinant DNA Part D, Methods in Enzymology, Vol. 153, Wu and Grossman, eds., Academic Press (1987)). Desirably, the vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA or RNA. Preferably, the vector comprises regulatory sequences that are specific to the genus of the host. Most preferably, the vector comprises regulatory sequences that are specific to the species of the host.
(47) Constructs of vectors, which are circular or linear, can be prepared to contain an entire nucleic acid sequence as described above or a portion thereof ligated to a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived from Co1E1, plasmid, phage, SV40, bovine papilloma virus, and the like.
(48) In addition to the replication system and the inserted nucleic acid, the construct can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like.
(49) Suitable vectors include those designed for propagation and expansion or for expression or both. For example, a cloning vector is selected from the group consisting of the pUC series, the pBluescript series (Stratagene, LaJolla, Calif.), the pET series (Novagen, Madison, Wis.), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, Calif.). Bacteriophage vectors, such as 1GT10, IGT11, 1ZapII (Stratagene), IEMBL4, and 1NM1149, also can be used. Examples of plant expression vectors include pBI110, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-C1, pMAM and pMAMneo (Clontech). The TOPO cloning system (Invitrogen, Carlsbad, Calif.) also can be used in accordance with the manufacturer's recommendations.
(50) An expression vector can comprise a native or nonnative promoter operably linked to an isolated or purified nucleic acid molecule as described above. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the skill in the art. Similarly, the combining of a nucleic acid molecule, or fragment thereof, as described above with a promoter is also within the skill in the art.
(51) Suitable viral vectors include, for example, retroviral vectors, parvovirus-based vectors, e.g., adeno-associated virus (AAV)-based vectors, AAV-adenoviral chimeric vectors, and adenovirus-based vectors, and lentiviral vectors, such as Herpes simplex (HSV)-based vectors. These viral vectors can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., Molecular Cloning, a Laboratory Manual, 2d edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989); and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York, N.Y. (1994).
(52) A retroviral vector is derived from a retrovirus. Retrovirus is an RNA virus capable of infecting a wide variety of host cells. Upon infection, the retroviral genome integrates into the genome of its host cell and is replicated along with host cell DNA, thereby constantly producing viral RNA and any nucleic acid sequence incorporated into the retroviral genome. As such, long-term expression of a therapeutic factor(s) is achievable when using retrovirus. Retroviruses contemplated for use in gene therapy are relatively non-pathogenic, although pathogenic retroviruses exist. When employing pathogenic retroviruses, e.g., human immunodeficiency virus (HIV) or human T-cell lymphotrophic viruses (HTLV), care must be taken in altering the viral genome to eliminate toxicity to the host. A retroviral vector additionally can be manipulated to render the virus replication-deficient. As such, retroviral vectors are considered particularly useful for stable gene transfer in vivo. Lentiviral vectors, such as HIV-based vectors, are exemplary of retroviral vectors used for gene delivery. Unlike other retroviruses, HIV-based vectors are known to incorporate their passenger genes into non-dividing cells and, therefore, can be of use in treating persistent forms of disease.
(53) Optionally, the isolated or purified nucleic acid molecule, or fragment thereof, upon linkage with another nucleic acid molecule, can encode a fusion protein. The generation of fusion proteins is within the ordinary skill in the art and can involve the use of restriction enzyme or recombinational cloning techniques (see, e.g., Gateway.. (Invitrogen)). See, also, U.S. Pat. No. 5,314,995.
(54) In view of the foregoing, the present invention also provides a composition comprising an above-described isolated or purified nucleic acid molecule, optionally in the form of a vector. The composition can comprise other components as described further herein.
(55) Also in view of the above, the present invention provides a host cell comprising an above-described isolated or purified nucleic acid molecule, optionally in the form of a vector. It is most preferable that the cell of the present invention expresses the vector, such that the oligonucleotide, or fragment thereof, is both transcribed and translated efficiently by the cell. Examples of cells include, but are not limited to, a human cell, a human cell line, E. coli (e.g., E. coli TB-1, TG-2, DH5a, XL-Blue MRF (Stratagene), SA2821 and Y1090), B. subtilis, P. aerugenosa, S. cerevisiae, N. crassa, insect cells (e.g., Sf9, Ea4) and others set forth herein below. The host cell can be present in a host, which can be an animal, such as a mammal, in particular a human.
(56) The term polypeptide is used herein as a generic term to refer to native protein, fragments, or analogs of a polypeptide sequence. Hence, native protein fragments, and analogs are species of the polypeptide genus. Polypeptides in accordance with the invention comprise the heavy chain CDR domains represented in SEQ ID NOS: 6, 7, 8, and the light chain CDR molecules represented in SEQ ID NOS: 2, 3, 4 as well as antibody molecules formed by combinations comprising the heavy chain immunoglobulin molecules with light chain immunoglobulin molecules, such as kappa light chain immunoglobulin molecules, and vice versa, as well as fragments and analogs thereof.
(57) In a specific embodiment, the amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the CDRs by well known methods, e.g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs may be inserted within framework regions, e.g., into human framework regions to humanize a non-human antibody. The framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a listing of human framework regions). Preferably, the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds a polypeptide of the invention. One or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art.
(58) Fully human antibodies are described in this application. Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/60433, WO 98/24893, WO 98/16664, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety. The techniques of Cole et al., and Boerder et al., are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Riss, (1985); and Boerner et al., J. Immunol., 147(1):86-95, (1991)).
(59) Human antibodies produced using other techniques but retaining the variable regions or CDR domains or parts thereof of the mAb of the present invention are part of this invention. Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous mouse immunoglobulins, but which can express human immunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring which express human antibodies. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,886,793; 5,916,771; and 5,939,598, which are incorporated by reference herein in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, Calif.), Genpharm (San Jose, Calif.), and Medarex, Inc. (Princeton, N.J.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.
(60) Also human mAbs could be made by immunizing mice transplanted with human peripheral blood leukocytes, splenocytes or bone marrows (e.g., Trioma techniques of XTL). Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as guided selection. In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology 12; 899-903 (1988)).
(61) The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of Hcp antigen or may be specific for an antigen as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
(62) Bispecific antibodies are monoclonal antibodies that have binding specificities for at least two different antigens. In the present invention, one of the binding specificities may be directed towards Hcp, the other may be for any other A. baumannii antigen, Gram negative protein, or for a cell-surface protein, receptor, receptor subunit, tissue-specific antigen, virally derived protein, virally encoded envelope protein, bacterially derived protein, or bacterial surface protein, etc.
(63) Methods for making bispecific antibodies are well known. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, Nature, 305:537-539 (1983). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published May 13, 1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
(64) Heteroconjugate antibodies are also contemplated by the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980). It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving cross-linking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioester bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Pat. No. 4,676,980.
(65) In addition, techniques developed for the production of chimeric antibodies (Morrison et al., Proc. Natl. Acad. Sci. 81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. As described supra, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, e.g., humanized antibodies.
(66) Generally, a humanized antibody has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the methods of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986); Reichmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possible some FR residues are substituted from analogous sites in rodent antibodies.
(67) Further included in the present invention are antibodies that bind to the same epitope as the antibodies of the present invention. Antibodies which compete with 13F7 are considered to recognize the epitope of the 13F7 anti-Hcp antibody and are considered equivalent to the antibody of the present invention. Assays for determining whether or not an antibody competes with an antibody of the present invention are known to a person with ordinary skill in the art and are described below.
(68) To determine if an antibody can compete for binding to the same epitope as the epitope bound by the antibodies of the present invention including the antibodies produced by the hybridomas deposited with the ATCC, a cross-blocking assay, e.g., a competitive ELISA assay, can be performed. In an exemplary competitive ELISA assay, antigen coated on the wells of a microtiter plate is pre-incubated with or without candidate competing antibody and then the biotin-labeled anti-Hcp antibody of the invention is added. The amount of labeled antibody bound to the antigen in the wells is measured using avidin-peroxidase conjugate and appropriate substrate. The antibody can be labeled with a radioactive or fluorescent label or some other detectable and measurable label. The amount of labeled antibody that bound to the antigen will have an indirect correlation to the ability of the candidate competing antibody (test antibody) to compete for binding to the same epitope, i.e., the greater the affinity of the test antibody for the same epitope, the less labeled antibody will be bound to the antigen-coated wells. A candidate competing antibody is considered an antibody that binds substantially to the same epitope or that competes for binding to the same epitope as an antibody of the invention if the candidate antibody can block binding of the antibody by at least 20%, preferably by at least 20-50%, even more preferably, by at least 50% as compared to the control performed in parallel in the absence of the candidate competing antibody. It will be understood that variations of this assay can be performed to arrive at the same quantitative value.
(69) By further mapping of the binding site of the monoclonal antibodies described in this application other peptides useful as a vaccine or a therapeutic can be predicted. Therefore, in another aspect, this invention relates to a method for identifying protective antigenic epitopes as described in the Examples below. Other methods are known in the art and include a method comprising (i) reacting a monoclonal antibody described in this application to different overlapping fragments encompassing the complete antigen, (ii) identifying a fragment to which the protective antibody binds, (iii) narrowing the region containing sites further by reacting the monoclonal with smaller overlapping fragments encompassing the region identified in (ii), and (iv) choosing peptides to which the antibody binds as possible antigenic epitopes. The peptides can then be assayed for their ability to protect an animal from disease, or to reduce the severity of disease. Peptides defining antigenic protective epitopes can be used in a vaccine, for example.
(70) The epitopes or peptides to which the monoclonal antibodies of the present invention bind can constitute all or part of an eventual active vaccine candidate. An active vaccine or therapeutic candidate might comprise these peptide sequences and others. These might be delivered as synthetic peptides, or as fusion proteins, alone or co-administered with cytokines and/or adjuvants or carriers safe for human use, e.g. aluminum hydroxide, to increase immunogenicity. In addition, sequences such as ubiquitin can be added to increase antigen processing for more effective immune responses.
(71) The present invention also pertains to hybridomas producing antibodies which bind to an epitope of Hcp protein or antigen. The term hybridoma is art recognized and is understood by those of ordinary skill in the art to refer to a cell produced by the fusion of an antibody-producing cell and an immortal cell, e.g. a multiple myeloma cell. This hybrid cell is capable of producing a continuous supply of antibody. See the definition of monoclonal antibody above for a more detailed description of the method of fusion.
(72) The present invention still further pertains to a method for detecting Hcp or T6SS needle protein in a sample suspected of containing A. baumannii, or Gram negative bacteria expressing T6SS needle protein. After checking 33 complete genomes and 1025 draft genomes (taking into account redundancy in the NCBI draft genome data set), it was found that Hcp is present in 82% of A. baumannii strains, indicating that the method of the present invention would detect at least 82% of A. baumannii strains. The method includes contacting the sample with an antibody which binds an epitope of the antigen, allowing the antibody to bind to the antigen to form an immunological complex, detecting the formation of the immunological complex and correlating the presence or absence of the immunological complex with the presence or absence of the antigen in the sample. The sample can be biological, environmental or a food sample.
(73) The language detecting the formation of the immunological complex is intended to include discovery of the presence or absence of Hcp antigen in a sample. The presence or absence of Hcp antigen can be detected using an immunoassay. A number of immunoassays used to detect and/or quantitate antigens are well known to those of ordinary skill in the art. See Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, New York 1988 555-612). Such immunoassays include antibody capture assays, antigen capture assays, and two-antibody sandwich assays. These assays are commonly used by those of ordinary skill in the art. In an antibody capture assay, the antigen is attached to solid support, and labeled antibody is allowed to bind. After washing, the assay is quantitated by measuring the amount of antibody retained on the solid support. A variation of this assay is a competitive ELISA wherein the antigen is bound to the solid support and two solutions containing antibodies which bind the antigen, for example, serum from a subject infected with a Gram negative bacteria or A. baumannii and a monoclonal antibody of the present invention, are allowed to compete for binding of the antigen. The amount of monoclonal bound is then measured, and a determination is made as to whether the serum contains anti-Hcp antibodies. This competitive ELISA can be used to indicate immunity to known protective epitopes in a vaccinee following vaccination and to identify competing antibodies.
(74) In an antigen capture assay, the antibody is attached to a solid support, and labeled antigen is allowed to bind. The unbound proteins are removed by washing, and the assay is quantitated by measuring the amount of antigen that is bound. In a two-antibody sandwich assay, one antibody is bound to a solid support, and the antigen is allowed to bind to this first antibody. The assay is quantitated by measuring the amount of a labeled second antibody that can bind to the antigen.
(75) These immunoassays typically rely on labeled antigens, antibodies, or secondary reagents for detection. These proteins can be labeled with radioactive compounds, enzymes, biotin, or fluorochromes. Of these, radioactive labeling can be used for almost all types of assays and with most variations. Enzyme-conjugated labels are particularly useful when radioactivity must be avoided or when quick results are needed. Biotin-coupled reagents usually are detected with labeled streptavidin. Streptavidin binds tightly and quickly to biotin and can be labeled with radioisotopes or enzymes. Fluorochromes, although requiring expensive equipment for their use, provide a very sensitive method of detection. Antibodies useful in these assays include monoclonal antibodies, polyclonal antibodies, and affinity purified polyclonal antibodies. Those of ordinary skill in the art will know of other suitable labels which may be employed in accordance with the present invention. The binding of these labels to antibodies or fragments thereof can be accomplished using standard techniques commonly known to those of ordinary skill in the art. Typical techniques are described by Kennedy, J. H., et al., 1976 (Clin. Chim. Acta 70:1-31), and Schurs, A. H. W. M., et al. 1977 (Clin. Chim Acta 81:1-40). Coupling techniques mentioned in the latter are the glutaraldehyde method, the periodate method, the dimaleimide method, and others, all of which are incorporated by reference herein.
(76) The language biological sample is intended to include biological material, e.g. cells, tissues, organs, biological fluid, or a solution for administering to a subject, such as a vaccine, or immunoglobulin. By environmental sample is meant a sample such as soil and water. Food samples include canned goods, meats, and others.
(77) Yet another aspect of the present invention is a kit for detecting Hcp or A. baumannii bacteria expressing Hcp, in a biological sample. The kit includes a container holding one or more antibodies which binds an epitope of Hcp and instructions for using the antibody for the purpose of binding to the antigen to form an immunological complex and detecting the formation of the immunological complex such that the presence or absence of the immunological complex correlates with presence or absence of the antigen in the sample. Examples of containers include multiwell plates which allow simultaneous detection of Hcp in multiple samples.
(78) As described in greater detail in the Examples, the present inventors have isolated a monoclonal antibodies which bind to epitopes on Hcp and display in vitro and/or in vivo protective properties. Significantly, the reactivity of the mAbs is applicable against a broad variety of different wild type and laboratory A. baumannii strains of different types that express Hcp as determined in vitro using ELISA, western blot, radioimmunoprecipitation; or in vivo against challenge with A. baumannii. After checking 33 complete genomes and 1025 draft genomes (taking into account redundancy in the NCBI draft genome data set), it was found that Hcp is present in 82% of A. baumannii strains. Some of these strain include for example Acinetobacter baumannii 1656-2, Acinetobacter baumannii A1, Acinetobacter baumannii AB0057, Acinetobacter baumannii AB030, Acinetobacter baumannii AbO4-mff, Acinetobacter baumannii AB307-0294, Acinetobacter baumannii AB5075-UW, Acinetobacter baumannii AbH120-A2, Acinetobacter baumannii AC29, Acinetobacter baumannii AC30, Acinetobacter baumannii ACICU, Acinetobacter baumannii ATCC17978, Acinetobacter baumannii AYE, Acinetobacter baumannii BJAB07104, Acinetobacter baumannii BJAB0715, Acinetobacter baumannii BJAB0868, Acinetobacter baumannii CIP70.10, Acinetobacter baumannii IOMTU433, Acinetobacter baumannii MDR-TJ, Acinetobacter baumannii MDR-ZJ06, Acinetobacter baumannii NCGM237, Acinetobacter baumannii PKAB07, Acinetobacter baumannii SDF, Acinetobacter baumannii TCDC-AB0715, Acinetobacter baumannii TYTH-1, Acinetobacter baumannii XH386, Acinetobacter baumannii ZW85-1. Laboratory strains can be derived from wild type strains and include those which have been adapted, and those derived by site-directed mutagenesis.
(79) Given these results, monoclonal antibodies according to the present invention are suitable both as therapeutic and prophylactic agents for treating or preventing infections in a subject caused by at least 82% of A. baumannii strains, in addition to Gram negative bacterial infections wherein Hcp is expressed.
(80) In general, this will comprise administering a therapeutically or prophylactically effective amount of one or more monoclonal antibodies of the present invention to a susceptible subject or one exhibiting infection. Any active form of the antibody can be administered, including Fab and F(ab) fragments. Antibodies of the present invention can be produced in any system, including insect cells, baculovirus expression systems, chickens, rabbits, goats, cows, or plants such as tomato, corn, potato, banana or strawberry. Methods for the production of antibodies in these systems are known to a person with ordinary skill in the art. Preferably, the antibodies used are compatible with the recipient species such that the immune response to the mAbs does not result in clearance of the mAbs before bacteria can be controlled, and the induced immune response to the mAbs in the subject does not induce serum sickness in the subject. Preferably, the mAbs administered exhibit some secondary functions such as binding to Fc receptors of the subject.
(81) Treatment of individuals having A. baumannii infection or a Gram negative bacterial infection wherein Hcp is expressed may comprise the administration of a therapeutically effective amount of one or more of the above nucleic acid molecules, vectors, host cells, antibodies, fusion proteins, conjugates, and in particular monoclonal antibodies of the present invention with or without antibiotics. The above nucleic acid molecules, vectors, host cells, antibodies, fusion proteins and conjugates can be administered to cells, tissue, organ, or animal by at least one mode selected from parenteral, subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracerebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intramyocardial, intraosteal, intrapelvic, intrapericardiac, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrathecal, intra-Ommaya, intravitreous, intraocular, intrasynovial, intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal, sublingual, intranasal, or transdermal. The method can optionally further comprise administering, prior, concurrently, or after the antibody contacting or administering at least one composition comprising an effective amount of at least one compound or protein or cell selected from at least one of a detectable label or reporter, a TNF antagonist, an antirheumatic, a muscle relaxant, a narcotic, a non-steroid anti-inflammatory drug (NSAID), an analgesic, an anesthetic, a sedative, a local anesthetic, a neuromuscular blocker, an antimicrobial, an antipsoriatic, a corticosteriod, an anabolic steroid, an erythropoietin, an immunization, an immunoglobulin, antibody or antibody derived conjugates, an immunosuppressive, a growth hormone, a hormone replacement drug, a radiopharmaceutical, an antidepressant, an antipsychotic, a stimulant, an asthma medication, a beta agonist, an inhaled steroid, an epinephrine or analog thereof, a cytotoxic or other anti-cancer agent, an anti-metabolite such as methotrexate, an anti-proliferative agent, a cytokine, interleukin, growth factors, a cytokine antagonist, and an anti-TNF, white cells, T-cells, LAK cells, TIL cells, natural killer (NK) cells, monocytes, NKT cells, engineered T cells or NK cells or monocytes or granulocytes.
(82) Formulations for administration can include injections, aerosol suspensions, respirable particles, ingestible liquid suspensions or solutions in water or non-aqueous media, or solid capsules, sachets, or tablets, ointments, lotions, creams, gels, drops, suppositories, sprays, powder, droppers, swabs, inhalers, among others known in the art. Methods and apparatus for administering the formulations are well known in the art.
(83) Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders can be desirable. Some of the compositions potentially can be administered as a pharmaceutically acceptable acid- or base-addition salt, formed by reaction with inorganic acids, such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base, such as sodium hydroxide, ammonium hydroxide, and potassium hydroxide, and organic bases, such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
(84) In some embodiments, the co-administered antimicrobial is an antibiotic. In some embodiments, the antibiotic has an intracellular target. In some embodiments, the antibiotic targets aerobically-growing bacteria. In some embodiments, the antibiotic is an aminoglycoside. In some embodiments, the antibiotic is selected from the following: Ample Spectrum Penicillins, Amoxicillin, Ampicillin, Bacampicillin, Carbenicillin Indanyl, Mezlocillin, Piperacillin, Ticarcillin, Penicillins and Beta Lactamase Inhibitors, Amoxicillin-Clavulanic Acid, Ampicillin-Sulbactam, Benzylpenicillin, Cloxacillin, Dicloxacillin, Methicillin, Oxacillin, Penicillin G (Benzathine, Potassium, Procaine), Penicillin V, Piperacillin+Tazobactam, Ticarcillin+Clavulanic Acid, Nafcillin, Cephalosporins, Cefadroxil, Cefazolin, Cephalexin, Cephalothin, Caphapirin, Cephradine, Cefaclor, Cefamandol, Cefonicid, Cefotetan, Cefoxitin, Cefprozil, Ceftmetazole, Cefuroxime, Cefuroxime axetil, Loracarbef, Cefdinir, Ceftibuten, Cefoperazone, Cefixime, Cefotaxime, Cefpodoxime proxetil, Ceftazidime, Ceftizoxime, Ceftriaxone, Cefepime, Macrolides and Lincosamines, Azithromycin, Clarithromycin, Clindamycin, Dirithromycin, Erythromycin, Lincomycin, Troleandomycin, Quinolones and Fluoroquinolones, Cinoxacin, Ciprofloxacin, Enoxacin, Gatifloxacin, Grepafloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Nalidixic acid, Norfloxacin, Ofloxacin, Sparfloxacin, Trovafloxacin, Oxolinic acid, Gemifloxacin, Perfloxacin, Carbepenems, Imipenem-Cilastatin, Meropenem, Monobactams, Aztreonam, Aminoglycosides, Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Paromomycin, Glycopeptides, Teicoplanin, Vancomycin, Tetracyclines, Demeclocycline, Doxycycline, Methacycline, Minocycline, Oxytetracycline, Tetracycline, Chlortetracycline, Sulfonamides, Mafenide, Silver Sulfadiazine, Sulfacetamide, Sulfadiazine, Sulfamethoxazole, Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole, Sulfamethizole, Rifampin, Rifabutin, Rifampin, Rifapentine, Oxazolidonones, Linezolid, Streptogramins, Quinopristin+Dalfopristin, Bacitracin, Chloramphenicol, Colistemetate, Fosfomycin, Isoniazid, Methenamine, Metronidazol. Mupirocin, Nitrofurantoin, Nitrofurazone, Novobiocin, Polymyxin B, Spectinomycin, Trimethoprim, Colistin, Cycloserine, Capreomycin, Ethionamide, Pyrazinamide, Para-aminosalicyclic acid Erythromycin ethylsuccinate+sulfisoxazole and others known in the art.
(85) Antibodies of the present invention can be used or administered as a mixture, for example in equal amounts, or individually, provided in sequence, or administered all at once. Effective dosages and schedules for administering the above nucleic acid molecules, vectors, host cells, antibodies, and fusion proteins can be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage that must be administered will vary depending on, for example, the subject, the route of administration, whether a nucleic acid molecule, vector, host cell, antibody, fusion protein or conjugate is being administered, and whether other drugs being administered, not to mention the age, condition, and gender of the human and the extent of disease. Guidance in selecting appropriate doses for antibodies (or fusion proteins comprising same) is found in the literature on therapeutic uses of antibodies, e.g., Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, N.J. (1985), Ch. 22 and pp. 303-357; Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press, New York (1977), pp. 365-389. Nucleic acids, vectors and host cells should be administered so as to result in comparable levels of production of antibodies or fusion proteins thereof.
(86) In general, it is desirable to provide the recipient with a dosage of antibody which is in the range of from about 1 pg/kg-100 g/kg, 100 pg/kg-500 pg/kg, 500 pg/kg-1 ng/kg, 1 ng/kg-100 ng/kg, 100 ng/kg-500 ng/kg, 500 ng/kg-1 ug/kg, 1 pg/kg-100 pg/kg, 100 pg/kg-500 pg/kg, 500 pg/kg-1 mg/kg, 1 mg/kg-50 mg/kg, 50 mg/kg-100 mg/kg, 100 mg/kg-500 mg/kg, 500 mg/kg-1 g/kg, 1 g/kg-5 g/kg, 5 g/kg-10 g/kg (body weight of recipient), although a lower or higher dosage may be administered.
(87) The antibodies capable of protecting against A. baumannii are intended to be provided to recipient subjects in an amount sufficient to effect a reduction in the A. baumannii infection symptoms. An amount is said to be sufficient to effect the reduction of infection symptoms if the dosage, route of administration, etc. of the agent are sufficient to influence such a response. Responses to antibody administration can be measured by analysis of subject's vital signs.
(88) A composition is said to be pharmacologically acceptable if its administration can be tolerated by a recipient patient. Such an agent is said to be administered in a therapeutically effective amount if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
(89) The compounds of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby these materials, or their functional derivatives, are combined in admixture with a pharmaceutically acceptable carrier vehicle. Suitable diluents can be sterile water, sterile buffered water, or at least one preservative selected from the group consisting of phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercuric nitrite, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride, alkylparaben, benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal, mannitol, sucrose, mannose, other sugars, tween 80, or mixtures thereof in an aqueous diluent.
(90) Additional pharmaceutical methods may be employed to control the duration of action. Controlled release preparations may be achieved through the use of polymers to complex or absorb the compounds. The controlled delivery may be exercised by selecting appropriate macromolecules (for example polyesters, polyamino acids, polyvinyl, pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, or protamine sulfate) and the concentration of macromolecules as well as the method of incorporation in order to control release. Another possible method to control the duration of action by controlled release preparations is to incorporate the compounds of the present invention into particles of a polymeric material such as polyesters, polyamino acids, hydrogels, poly (lactic acid) or ethylene vinylacetate copolymers. Alternatively, instead of incorporating these agents into polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly(methylmethacylate)-microcapsules, respectively, or in colloidal drug delivery systems, for example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences (1980).
(91) Prior to administration, the compositions of the invention can be sterilized by conventional, well-known sterilization techniques or may be produced under sterile conditions. Aqueous solutions can be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration. The compositions can contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, and the like, e.g., sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate. Sugars can also be included for stabilizing the compositions, such as a stabilizer for lyophilized compositions.
(92) Following administration of a nucleic acid molecule, vector, host cell, antibody, fusion protein or conjugate for treating, inhibiting, or reducing the severity of an A. baumannii infection, the efficacy of the therapeutic agent can be assessed in various ways well-known to the skilled practitioner. For instance, one of ordinary skill in the art will understand that an antibody of the invention is efficacious in treating or inhibiting an A. baumannii infection in a subject by observing that the antibody reduces bacterial load or prevents a further increase in bacterial load. Bacterial loads can be measured by methods that are known in the art, for example, using polymerase chain reaction assays to detect the presence of A. baumannii nucleic acid or antibody assays to detect the presence of A. baumannii protein in a sample (e.g., but not limited to, blood) from a subject or patient, or by measuring the level of circulating anti-bacterial antibody levels in the patient.
(93) The nucleic acid molecules, vectors, host cells, antibodies, fusion proteins and/or conjugates of the invention can be administered prophylactically to patients or subjects who are at risk for being exposed to A. baumannii or who have been newly exposed to A. baumannii. In subjects who have been newly exposed to A. baumannii but who have not yet displayed the presence of the bacteria (as measured by PCR or other assays for detecting the bacteria) in blood or other body fluid, efficacious treatment with an antibody of the invention partially or completely inhibits the appearance of the bacteria in the blood or other body fluid.
(94) The nucleic acid molecules, vectors, host cells, antibodies, fusion proteins and/or conjugates of the invention can be combined with other well-known therapies and prophylactic vaccines already in use. Such combinations can generate an additive or a synergistic effect with current treatments. The nucleic acid molecules, vectors, host cells, antibodies and/or conjugates of the invention can be combined with other A. baumannii antibodies for other virulence proteins such as bauA and F17, to name a few, in addition to other antibiotics and vaccines. Such therapies can be administered in the manner already in use for the known treatment providing a therapeutic or prophylactic effect.
(95) As described above, the compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject's cells in vivo and/or ex vivo by a variety of mechanisms well-known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
(96) If ex vivo methods are employed, cells or tissues can be removed and maintained outside the body according to standard protocols well-known in the art. Compositions comprising a nucleic acid, optionally in the form of a vector encoding the antibody or fusion protein comprising same, can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells then can be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
(97) Thus, in view of the above, the present invention provides a method of inhibiting an infection of a human at risk of becoming infected with A. baumannii. The method comprises administering to the human an infection-inhibiting amount of an above-described nucleic acid, vector, host cell, antibody or fusion protein, whereupon the infection of the human is inhibited. Preferably, the infection is inhibited to such a degree that the human does not evidence the signs and symptoms of infection.
(98) Also in view of the above, the present invention provides a method of reducing the severity of an infection of a human infected with A. baumannii. The method comprises administering to the human a severity of infection-reducing amount of an above-described nucleic acid, vector, host cell, antibody or fusion protein, whereupon the severity of the infection of the human is reduced. Preferably, the reduction in the severity of infection is to such a degree that the human does not evidence the signs and symptoms of infection, or preferably the human does not experience an increase in the severity of disease.
(99) In a similar approach, another therapeutic use of the monoclonal antibodies of the present invention is the active immunization of a patient using an anti-idiotypic antibody raised against one or more of the present monoclonal antibodies. Immunization with an anti-idiotype which mimics the structure of the epitope could elicit an active anti-Hcp response (Linthicum, D. S. and Farid, N. R., Anti-Idiotypes, Receptors, and Molecular Mimicry (1988), pp 1-5 and 285-300).
(100) Active immunization can be induced by administering one or more antigenic and/or immunogenic epitopes as a component of a subunit vaccine. Vaccination could be performed orally or parenterally in amounts sufficient to enable the recipient to generate protective antibodies against this biologically functional region, prophylactically or therapeutically. The host can be actively immunized with the antigenic/immunogenic peptide, with or without adjuvant, in pure form, a fragment of the peptide, or a modified form of the peptide. One or more amino acids, not corresponding to the original protein sequence can be added to the amino or carboxyl terminus of the original peptide, or truncated form of peptide. Such extra amino acids are useful for coupling the peptide to another peptide, to a large carrier protein, or to a support. Amino acids that are useful for these purposes include: tyrosine, lysine, glutamic acid, aspartic acid, cysteine and derivatives thereof. Alternative protein modification techniques may be used e.g., NH.sub.2-acetylation or COOH-terminal amidation, to provide additional means for coupling or fusing the peptide to another protein or peptide molecule or to a support.
(101) The present invention also provides kits which are useful for carrying out the present invention. The present kits comprise a first container means containing the above-described antibodies. The kit also comprises other container means containing solutions necessary or convenient for carrying out the invention. The container means can be made of glass, plastic or foil and can be a vial, bottle, pouch, tube, bag, etc. The kit may also contain written information, such as procedures for carrying out the present invention or analytical information, such as the amount of reagent contained in the first container means. The container means may be in another container means, e.g. a box or a bag, along with the written information.
(102) In one aspect, in the kit, the concentration of anti-Hcp antibody or specified portion or variant in the first container is reconstituted to a concentration of about 0.1 mg/ml to about 500 mg/ml with the contents of the second container. In another aspect, the second container further comprises an isotonicity agent. In another aspect, the second container further comprises a physiologically acceptable buffer. Suitable vehicles and their formulation, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pharmaceutical Sciences (16th ed., Osol, A. ed., Mack Easton Pa. (1980)). In order to form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of the above-described compounds together with a suitable amount of carrier vehicle.
(103) The contents of all cited references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference.
(104) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors and thought to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
(105) Model Strain
(106) While previous studies attempted to examine the virulence of different clinical A. baumannii strains utilizing in vivo model systems (de Breij et al., 2012, PloS One 7, e30673; Eveillard et al., 2010, J. Infect. 60, 154-161), the majority of A. baumannii researchers still use two American Type Culture Collection (ATCC) strains, ATCC 19606.sup.T and ATCC 17978, which were isolated more than fifty years ago and are not significantly antibiotic resistant. These strains are certainly more amenable to genetic manipulation than most clinical isolates (Smith et al., 2007, Genes Dev. 21, 601-614; Tomaras et al., 2003, Microbiology 149, 3473-3484), share considerable genome homology (>90%) compared to current A. baumannii isolates (Sahl et al., 2011, BMC Genomics 12, 291), but they are not representative of contemporary isolates of this rapidly-evolving pathogen. Some researchers, recognizing that the ATCC isolates were dated, have performed studies with more recent clinical isolates; however, genetic manipulation of such isolates has depended on susceptibility to aminoglycosides (Loehfelm et al., 2008, J. Bacteriol. 190, 1036-1044; Ramirez et al., 2010, J. Clin. Microbiol. 48, 1488-1490; Russo et al., 2008, Infect. Immun. 76, 3577-3586), which is often not found in clinical strains (Vila and Pchon, 2012, Expert Opin. Pharmacother. 13, 2319-2336). Therefore, our goal was to carry out a systematic study of our own contemporary clinical strains isolated from patients in the U.S. military healthcare system to identify a strain that is more representative of current clinical isolates, that is highly virulent in established model infections, and can be genetically manipulated without a potential sacrifice with respect to virulence and antibiotic resistance.
(107) In order to identify potential reference strains, a diverse set of 33 A. baumannii isolates was chosen based on genetic, isolation site, and antibiotic resistance differences from more than 200 A. baumannii strains isolated between 2004 and 2010 from patients in the U.S. military healthcare system. AB0057, first isolated in 2004 at Walter Reed Army Medical Center, was also included as a comparator because this strain is well characterized, and its genome was previously sequenced (Adams et al., 2008, J. Bacteriol. 290, 8053-8064).
(108) The diversity set of A. baumannii isolates was determined via Pulsed-Field Gel Electrophoresis (PFGE) analysis, and a multiplex PCR assay previously developed to identify the International clonal complexes (ICC) (Jacobs et al., 2014, supra). Separately, antibiograms were determined using two different automated bacterial identification systems. The majority of strains were found to be multidrug resistant, typical of current clinical strains (data not shown). The genetic similarity of the strains determined by PFGE ranged from 45 to 100% (data not shown). PFGE types were considered to represent the same clones when their genetic similarity was >80% (van Belkum et al., 2007, Clin. Microbial. Infect. 13:1-46); based on this cut off, the 33 strains represent 19 unique clones. When comparing the genetic relatedness of these 19 clones, it was found that the majority of them clustered into three groups, which generally aligned with the ICC designations determined by multiplex PCR (data not shown (Turton et al., 2007, Clin. Microbiol. Infect. 13, 807-81.5). These data were used to select four representative strains for genome sequencing and evaluation in animal models.
(109) Three of the strains chosen represented each one of the three ICC groups, AB5075 (ICC I), AB5711 (ICC II), and AB4857 (ICC III). The fourth strain, AB5256 was an outlier as the OXA-51 allele from this strain amplified with Group 1 primers (Turton et al., 2007, supra), while the csuE allele did not. The isolates were sequenced (Zurawski et al., 2012, J. Bacteriol. 194, 1619-1620) and compared to previously sequenced A. baumannii genomes using the BLAST Score Ratio (BSR) approach (Rasko et al., 2005, BMC Bioinformatics 6, 2). This method compares putative peptides encoded in each genome based on the ratio of BLAST scores to determine if they are conserved (BSR value 20.8), divergent (0.8>BSR>0.4), or unique (BSR<0.4). The majority of the proteomes were similar among strains, meaning they had a BSR>0.4, however, each isolate also had a set of unique proteins (data not shown). These results are similar to what has been found previously with MDR A. baumannii clinical isolates (Sahl et al. 2011, supra), suggesting that the strains used in this study are not genetic outliers.
(110) Strains were first tested in a Galleria mellonella infection model, as this model is well-established to assess virulence and novel therapeutics for bacterial pathogens, including A. baumannii (Desbois and Coote, 2012, Adv. Appl. Microbiol. 78, 25-53; Manepalli et al., 2013, J. Med. Microbiol. 62, 1747-1754). AB5075 was found statistically to be more lethal than AB4857, AB5711, and AB0057 (all P values<0.0125).
(111) Separately, to compare the lethality of AB5075 to more commonly utilized A. baumannii model strains, the LD.sub.50 of AB5075, ATCC 17978, and ATCC 19606.sup.7 were determined in G. mellonella. The LD.sub.50 of AB5075 was equal to 1.010.sup.4 CFU. In contrast, the LD.sub.50 of ATCC 17978, and ATCC 19606.sup.T were 5.010.sup.9 and 1.010.sup.8, respectively.
(112) A. baumannii strains were examined in a murine pulmonary model of infection because this model is commonly used to assess bacterial virulence and drug efficacy, and survival can be assessed rapidly after an inoculum is delivered(Eveillard et al., 2010, supra; Manepalli et al., 2013, supra). The animals were immunocompromised with two doses of cyclophosphamide before inoculation, a treatment that allows A. baumannii to establish an infection (Eveillard et al., 2010, supra). Mice were inoculated on day 0 with one of the five A. baumannii representative strains at a dose of 5.010.sup.6 CFU and monitored over the course of six days. Consistently, mice infected with AB5075 had a mortality rate of 70% within 48-72 hours, and a six day survival rate of 25% (data not shown). The other four strains tested, AB0057, AB5711, AB5256, and AB4857, were less lethal than AB5075 in this model, with six day survival rates of 65, 80, 80, and 85 percent, respectively.
(113) Our success in establishing A85075 infections in multiple animal models suggests the isolate would be an attractive model strain for studying A. baumannii virulence. However, in addition to an ideal model strain being highly virulent in animal models, the ability to genetically manipulate the isolate is vital for the study of A. baumannii pathogenicity. Because antibiotic resistance determinants are central to many types of genetic manipulations, such as transposon mutagenesis, the antibiotic sensitivity profile of AB5075 was examined in detail. It was observed that AB5075 is susceptible to tetracycline, doxycycline and related antibiotics and to high levels of erythromycin and hygromycin.
(114) With these known susceptibilities, a method previously developed in A. baumannii (Dorsey et al., 2002, Appl. Environ. Microbiol. 68, 6353-6360) was adapted for creating AB5075 isogenic mutants by utilizing the hph gene, encoding hygromycin resistance, from pMQ300 (Kalivoda et al., 2011, Mol. Biotechnol. 48, 7-14) and the EZ Tn5.sup.TH (Epicentre Biotechnologies, Madison, WI) to develop a Tn5-based mutagenesis system. This system was used to generate a library of 6,700 transposon mutants. DNA sequencing of the library was performed as previously described (Gallagher et al., 2013, mBio 4:e00604-13), yielding 2,548 unique transposon insertions and 68.5% coverage of the genome.
(115) As a further means to modify the genome, the same hygromycin cassette was inserted into the pUCl8T-mini-Tn7T-Zeo vector and this vector was introduced via conjugation into AB5075. Tn7 insertion into the chromosome was selected for by growth on 250 g/mL hygromycin, and confirmed by PCR across the attTn7 site on the 3 prime end of the glmS gene in the AB5075 chromosome. As proof of concept for the use of Tn7 for gene insertion in the chromosome, the lux operon was inserted into the attTn7 site. This resulted in bioluminescence of this strain, and subsequent sub-culturing of AB5075::Tn7-lux over seven days without antibiotic selection did not affect the bioluminescent signal (data not shown), suggesting that the Tn7 insertion in the chromosome is stable. Additionally, when this strain was cultured in LB broth, there was no growth defect when compared to the wild type AB5075 isolate (data not shown). These methods provide us with a means of interrupting and inserting genes on the chromosome, both of which are essential in studying bacterial pathogenesis.
(116) In addition to the successful use of AB5075 in animal models, we were able to exploit the susceptibility of AB5075 to hygromycin to generate a Tn5 transposon insertion library and use a Tn7 transposon derivative to insert genes into the genome of this strain.
Example 2
(117) Transposon Library Generation
(118) As a resource for genetic analysis of AB5075, a Tn5 insertion library utilizing a tetracycline-based transposon system was generated (Gallagher et al., 2015, supra). We created an arrayed library of mutants with defined transposon insertions in most nonessential genes of the organism. Our goal was to create a colony-purified library with relatively complete genome coverage that was small enough to facilitate efficient phenotype screening. We also wanted it to include several different mutations for each gene to minimize missed genotype-phenotype associations arising from non-inactivating mutations or library cross-contamination, and to provide immediate confirmation of associations observed. To meet these objectives, we created a library made up of two to three different insertion mutants per non-essential gene. The library was created in two stages. First a large primary collection of mutants generated by random insertion mutagenesis and selection on LB agar was arrayed and sequence-defined. This collection contained an average of over ten unique insertion mutants per coding gene. Second, individual mutants from this primary collection were colony purified, re-arrayed and re-sequenced. This smaller library is made up of two to three unique, sequence-verified mutants for most genes and is called the three-allele-library. The three mutants chosen for each gene corresponded where possible to insertions distributed between 5% and 90% of the coding sequence.
(119) Two Tn5 transposons with different resistance markers were used to generate the mutants, with a transposon conferring tetracycline resistance (T26) accounting for the majority (95%) of the mutants in the three-allele set. Transposon T26 includes loxP sites flanking the tetracycline resistance marker, enabling excision of the marker by transient expression of Cre site-specific recombinase. For insertions in one of the six possible translational reading frames, the recombination results in an in-frame insertion of 73 codons without a stop codon, generating presumptive non-polar mutations. In addition, double mutants may be constructed by first excising the resistance marker from one mutant, then introducing a second insertion by transformation of genomic DNA from another mutant. Through iteration, strains bearing three or more mutations may also be constructed.
(120) Three mutants were chosen with the T26 inserted into the hcp gene: 1. Item no: AB06793 Strain name: tnab1_kr121211p02q106 Chromosome location: 2571476 Direction: Forward A. baumannii locus: ABUW_2578type VI secretion system effector, Hcp1 family Position within gene/total bp of gene: 450(504) 2. Item no. A806794 Strain name: tnab1_kr121210p03q152 Chromosome location: 2571476 Direction: Reverse A. baumannii locus: ABUW 2578type VI secretion system effector, Hcp1 family Position within gene/total bp of gene: 450(504) 3. Item no.: AB06795 Strain name; tnab1_kr130913p01q167 Chromosome location: 2571791 Direction: R A. baumannii locus: ABUW_2578-type VI secretion system effector, Hcp1 family Position within gene/total bp of gene: 135(504)
(121) All three mutants had Tn5 DNA plus the tet resistance gene for selection inserted into the genome at the hcp sequence interrupting the proper translation of the protein (Gallagher et al., 2015, supra). All three were tested and mutant number three having an insertion of 135 bp was used for further study.
Example 3
(122) Wound Model
(123) In order to test the efficacy of a monoclonal antibody as a therapeutic antimicrobial, we sought to develop a wound infection model that utilized A. baumannii as a sole infectious agent and that included multiple measurable outcomes with effects that entailed quantitative end-points, which permitted small sample sizes for antimicrobial evaluation. In order to develop a new model of A. baumannii wound infection, three important selections were made from the outset of the study. First, female BALB/c mice were chosen, because immune responses in BALB/c mice are skewed more toward a Th2 than a Th1 response (Prabhakara et al., 2011, Infect. Immun. 79, 5010-5018; Gabaglia et al., 1999, J. Immunol. 162, 753-760), and this immune response favors the establishment of infection by the Gram-negative ESKAPE pathogens. Second, a cutaneous wound model was selected based on findings of a previous study, where an open wound did not adversely affect animal health during a >15-day protocol (Hoffman, et al., 2006, Blood 108, 3053-3060), which allowed for a large window of time to quantitatively and qualitatively measure drug efficacy in the model. Lastly, it was important that the chosen A. baumannii strain was virulent enough to cause an infection after a small inoculating dose. For this purpose, AB5075 was chosen for this model, as our laboratory has shown this strain is more virulent than the other A. baumannii isolates that were tested (Jacobs et al., 2014, supra) and, because the antibiotic susceptibilities of AB5075 were known, we could validate the model via i.p. treatment with doxycycline or rifampin. It should be noted, however, that we have evaluated other A. baumannii strains in this model as well (in our pilot studies). In particular, we evaluated AB5711 (Zurawski et al., 2012, J. Bacteriol. 194, 1619-1620), which was also able to cause an infection that retarded wound healing past 15 days post-inoculation (data not shown).
(124) We developed an excisional, murine wound model in which a diminutive inoculum of a clinically relevant, multidrug-resistant A. baumannii isolate can proliferate, form biofilms, and be effectively treated with antibiotics (Thompson et al., 2014, Antimicrobial Agents and Chemotherapy 58, 1332-1342). The model requires a temporary, cyclophosphamide-induced neutropenia to establish an infection that can persist. A 6-mm-diameter, full-thickness wound is created in the skin overlying the thoracic spine, and after the wound bed id inoculated, it is covered with a dressing for 7 days. Uninoculated control wounds healed within 13 days, whereas infected, placebo-treated wounds remained unclosed beyond 21 days. Treated and untreated wounds are assessed with multiple quantitative and qualitative techniques that included gross pathology, weight loss and recovery, wound closure, bacterial burden, 16S rRNA community profiling, histopathology, peptide nucleic acid-fluorescence in situ hybridization, and scanning electron microscopy assessment of biofilms. The range of differences that we are able to identify with these measures in antibiotic-versus placebo-treated animals provides a clear window within which novel antimicrobial therapies can be assessed. The model can be used to evaluate antimicrobials for their ability to reduce specific pathogen loads in wounded tissues and clear biofilms. Ultimately, the mouse model approach allows for highly powered studies and serves as an initial multifaceted in vivo assessment prior to testing in larger animals.
(125) The retarded wound closure rate that we observed in our model using AB5075 was accompanied by a weight loss of up to 25% from the infection day body weight at 2 days postinfection (Thompson et al., 2014, Antimicrobial Agents of Chemotherapy 58, 1332-1342). Therefore, we can use weight loss as an indicator of A. baumannii infection in this model. Gross pathology of infected wounds indicated tissue may begin to devitalize as soon as 3 days post-infection around the wound perimeter and remain visibly swollen until 15 days after inoculation with AB5075. An evaluation of the wound using standard histopathology showed inflammation throughout the large wound perimeter that extended down to the spinal column by day 7 (data not shown). Histopathology from infected mice on day 23 revealed wounds had re-epithelialized but showed little evidence of wound perimeter contraction (data not shown). In order to investigate the dissemination of AB5075 throughout the wound bed, sections of tissue were fixed 24 hours post-infection and interrogated with Acinetobacter-specific PNA probes. The PNA probes revealed that the bacteria had spread rapidly beyond the wound bed through the underlying muscle and down to the spinal column (data not shown). A. baumannii appeared to localize in the interstitial spaces between muscle fibers and between epithelial cells (data not shown).
(126) Regardless of the role invasion plays in vivo, the sequelae of infection that we observed postinoculation are consistent to what is observed in skin and soft tissue infections of human patients. For example, we found that A. baumannii penetrated the layers of tissue from the initial wound bed inoculum all the way to bone tissue (data not shown), and this was consistent with the tissue penetration observed in A. baumannii-infected patients (Eberle et al., 2010, Crit. Care Med. 38, 2133-2138), as well as the consideration of A. baumannii as a potential cause of osteomyelitis (Yun et al., 2008, J. Trauma 64, S163-S168).
(127) To ensure the infection should be attributed to AB5075 and not to other commensals or contaminant pathogens, 16S rRNA community profiling was conducted in parallel to the CFU enumerations. Nearly all samples taken from infected but untreated wounds showed a >95% dominance of Acinetobacter with only a minor fraction of communities composed of Enterobacter in two mice from this group (data not shown). While immunosuppression is required to establish an infection and it is agreed that A. baumannii is a mild pathogen compared to other bacterial species, it is evident from the microbiome evaluation in this study that A. baumannii can establish a wound infection without other bacterial species being major contributors. In pilot studies, we also found that higher inoculums (CFU of 10.sup.6) resulted in sepsis and severe animal morbidity (data not shown), which also suggests that increased A. baumannii numbers can lead to more severe sequelae that do not require other bacterial species.
(128) A final observation from this wound model of infection was the formation of robust biofilms within the wound bed (data not shown) and on the occlusive dressing above the wound bed (data not shown). While it is not surprising that A. baumannii formed biofilms in this model, given previous work showing the importance of biofilms (Brossard and Campagnari, 2012, Infect. Immun. 80, 228-233; Caddy et al, 2009, Infect. Immun. 77, 3150-3160), it was somewhat unexpected that AB5075 achieved the levels of biofilm formation observed, given that this strain does not form robust biofilms in vitro (unpublished data). Therefore, perhaps there are cues in the in vivo environment that trigger biofilm assembly, in particular with this strain, that have not been discovered. Regardless, biofilm formation in the model provides another metric for measuring antimicrobial efficacy. In fact, given that many laboratories are now developing antibiofilm strategies (Worthington, et al., 2012, Org. Biomol. Chem. 10, 7457-7474), the SEM data provided in the implementation of this model provide a qualitative assessment of an antibiofilm product.
(129) Overall, the wound infection model we have developed uses all of the endpoints described above to provide a robust data set for evaluating infection and antimicrobials used for treatment. We believe the model will be a powerful tool to evaluate new antimicrobials for not only A. baumannii but also for many difficult bacterial infections caused by the MDR ESKAPE pathogens. ESKAPE pathogens include A. baumannii, Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterobacter species. The antibiotic dosing that was used herein was similar to what has been utilized in other animal models (Montero et al., 2002, Antimicrob. Agents Chemother. 46, 1946-1952, Pachon-Ibanex et al., Antimicrob. Agents Chemother. 54, 1165-1172; Rodriguez-Hernandez et al., Antimicrob. Agents Chemother. 45, 493-501) and somewhat similar to what is used clinically (Fishbain and Peleg, 2010, Clin. Infect. Dis. 51, 79-84, Holloway et al., 2006, Ann. Pharmacother. 40, 1939-1945; Wood et al., 2003, Intensive Care Med. 29, 2072-2076).
Example 4
(130) Anti-Hcp Monoclonal Antibody 13F7
(131) Using a bioinformatics approach we have discovered that A. baumannii has all the components required to have a functional T6SS. Based on sequence data from a clinical isolate AB307-0294 that causes disease in animal models (Adams et al., 2008, J. Bacteriol. 190, 8053-8064; Russo et al., 2008, Infect. Immun. 76, 3577-3586), we found that there is an insertion of about 30 kilobases (kb) of DNA sequence, which harbors a T6SS (
(132) Hcp was PCR amplified from AB5075 with restriction sites at each end (Hicp Forward NcoIMT=55: AAAAAACCATGGCAAAAGATATATACGTTGAGTTTCGCGG (SEQ ID NO:12) and Hcp Reverse XhoI-MT-56:AAAAAACTCGAGCGCTGCGTAAGAAGCTGTATTATTAG (SEQ ID NO:13). Restriction SitesNcoI and XhoI are both non-cutters within the sequence). The full Hcp nucleic acid sequence is shown in SEQ ID N0:14, with the genomic context of the gene shown in SEQ ID NO:15, and the amino acid sequence shown in SEQ ID NO:16). Then, the gene was cloned into the pET22b vector (Novagen, Germany). After confirming a successful cloning, the protein was overexpressed in E. coli with the addition of IPTG. After 2 and 4 hours (hr), samples were taken to confirm expression (
(133) The individual fusions from hybridoma clones were screened for binding to Hcp (antigen) and compared to original fusion screening results. Positives are highlighted in green. 13F7 was selected for all future work as it bound the tightest to the protein.
(134) In order to test the effect of 13F7 anti-Hcp monoclonal antibody on A. baumannii infections, BALB/c mice received an intraperitoneal (IP) injection on Day-1, prophylactically, of 25 g of 13F7 anti-Hcp monoclonal antibody (Hcp) diluted in sterile saline or of sterile saline alone (
(135) Dose-Dependent Study of 13F7.
(136) Mice were inoculated with 3.010.sup.6 CFU of wild-type AB5075. 13F7 Hcp was given either in (a) one dose of 50 ug at day 1; (b) two doses of 50 ug at day 1 and 25 ug at day 1 for a total of 75 ug; (c) three doses of 50 ug at day 1, 25 ug at day 1, and 25 ug at day 3 for a total of 100 ug; or (d) one dose of 100 ug at day 1. Negative controls did not receive 13F7. Results (
(137) Using the murine wound model, mice were injected IP with 100 g (Hcp (squares) or sterile saline (circles) on Day 1. Balb/C mice were then inoculated on Day 0 with AB5075, 5.010.sup.6 CFU. Wound size was measured every three days over the course of 18 days and CPU of the wound bed was measured in mice after three days. Results indicate that Hcp antibody treatment enhanced wound healing as wound size was reduced at day 6, 10, 12, and 15. Only a slight reduction in CFU was observed (about 0.5 log.sub.10); however, we believe the bacteria that are present are disarmed as the antibody, which binds to the amino terminus of the protein may prevent proper assembly into the functional, predicted hexamer structure.
(138) Epitope Study
(139) Twenty-three peptides of 15 amino acids in length of the Hcp protein were generated and adhered to an ELISA plate (Table 1). Also, as a negative control, just sterile saline was added to well 24, and as a positive control, full-length Hop protein was added to well #25. The 13F7 Hcp antibody was incubated with each peptide for one hour. Then, after extensive washing, secondary anti-mouse antibody with horseradish peroxidase (HRP) was incubated with each sample. Signal was analyzed with a spectrophotometer at OD.sub.450 to recognize the signal. Only the amino terminus, peptide #1 (shaded), had a signal equivalent to the positive full-length protein control. Therefore, the epitope of the antibody is found in the extreme N-terminus of the protein (MKDIYVEFRGKYKVDSEQ ID NO:9). Not to be bound by any theory, but it is likely that the monoclonal antibody, when bound to Hop at the N-terminus peptide, impedes assembly of the Hcp hexamer.
(140) TABLE-US-00001 TABLE1 PeptideSequences MKDIYVEFRGKYKVD-SEQIDNO:9 FRGKYKVDGESRDSE-SEQIDNO:17 DGESRDSEHKGWLEV-SEQIDNO:18 EHKGWLEVNSWSHN-SEQIDNO:19 VNSWSHNIRQPKSAT-SEQIDNO:20 IRQPKSATSSSVGGH-SEQIDNO:21 TSSSVGGHTAERVEH-SEQIDNO:22 HTAERVEHSDMVFVK-SEQIDNO:23 HSDMVFVKDLDATSP-SEQIDNO:24 KDLDATSPKLWEACS-SEQIDNO:25 PKLWEACSAGYTFDE-SEQIDNO:26 SAGYTEDEVQIDFYR-SEQIDNO:27 BVQIDFYRANGDKRI-SBQIDNO:28 RANGDKRIKYLQIKL-SEQIDNO:29 IKYLQIKLKHVLVSS-SEQIDNO:30 LKHVLVSSVTPTVNE-SEQIDNO:31 SVTPTVNBEGYPTEA-SEQIDNO:32 EEGYPTEAFGLKYAA-SEQIDNO:33 AFGLKYAAVEWTYNQ-SEQIDNO:34 AVEWTYNQQDINGTA-SEQIDNO:35 QQDINGTAKGVTKK-SEQIDNO:36 AKGAVTKKWSLSNNT-SEQIDNO:37 KWSLSNNTASYAA-SEQIDNO:38
Detection of Hcp in Human Serum.
(141) Serum was isolated from de-identified human patients that were infected with Acinetobacter baumannii (BR075, BR367, BR103, BR045), Staphylococcus epidermidis (SE610, SE339, SE1842, SE2337), or healthy, non-infected patients (HE05933, HE4176, HE7145, HE3481, HE371, HE083, HE3019, HE0821) (
(142) ELISA Capture in Biological Samples
(143) Blood was collected from two de-identified human patients (P1 and P2) at varying times (1-4) over the course of a two week Acinetobacter baumannii infection (