Methods for producing designer esters and assessing alcohol acyltransferase specificity for ester biosynthesis

Abstract

Methods of microbial screening for identifying alcohol acyltransferases for ester biosynthesis and submodules for ester pathways to produce butyryl-coenzyme A derived esters are disclosed. The method includes the introduction preselected plasmids into a respective host strain to form engineered microbes, in situ fermentation thereof followed by a colorimetric assay for quantification of production of the target ester. In situ fermentation includes inoculating each well of a microplate that have a culture media for producing target esters with one of the engineered microbes, adding an overlay of a solvent to each, and incubating the same. The colorimetric assay includes transfer of a quantity of the overlay from each well to respective clean wells of a new microplate, treatment of each well to form an iron-hydroxamic acid complex aqueous phase, centrifugation of the microplate, and measurement of the absorbance at 520 nm and comparison to a standard curve for the target ester.

Claims

1. A method of selectively synthesizing a butyryl-coenzyme A (CoA) derived ester via microbial biosynthesis, the method comprising: selecting a target ester to be synthesized by microbial biosynthesis from the group consisting of butyl acetate, butyl butyrate, and ethyl butyrate; providing a first expression vector, the first expression vector encoding a first plurality of enzymes that convert acetyl-CoA to butyryl-CoA selected from Escherichia coli atoB (atoB.sub.Ec), Clostridium acetobutylicum Hbd (hbd.sub.Ca), Clostridium acetobutylicum crt (crt.sub.Ca), and Treponema denticola ter (terra); providing a second expression vector that encodes a second plurality of enzymes selected from Zymomonas mobilis pdc (pdc.sub.Zm) and Zymomonas mobilis adhB (adhB.sub.Zm) or Clostridium acetobutylicum adhE2 (adhE2.sub.Ca) for alcohol synthesis and Candida boidinii fdh (fdh.sub.Cb) for facilitating the NADH production, wherein (i) at least one of the second plurality of enzymes facilitates production of nicotinamide adenine dinucleotide and hydrogen (NADH), (ii) at least one of the enzymes is an alcohol acetyltransferase selected from Saccharomyces cerevisiae ATF1 (ATF1.sub.Sc) when an acetate ester is the target ester or Fragaria ananassa (cultivated strawberry) SAAT (SAAT.sub.Fa) when an acylate ester is the target ester, and wherein (iii) at least one of the second plurality of enzymes selectively determines a pathway for either butanol or ethanol synthesis; and inserting the first expression vector and the second expression vector into a microbial host cell selected from the group consisting of EcJWBA2, EcJWEB2, EcJWBB2, EcJWBA15, EcJWEB7, and EcJWBB8, contacting the microbial cells with carbon source in culture media; and culturing the microbial host to produce butyryl-coenzyme A derived esters; wherein expression of the first and second expression vectors in the microbial host cell produces the target ester.

2. The method of claim 1, wherein the first expression vector and the second expression vector each comprise a predetermined copy number of genes encoding the respective first plurality of enzymes and second plurality of enzymes, and the method includes determining a predetermined copy number of genes that produces the highest concentration of the target ester in a culture comprising the microbial host cell.

3. The method of claim 1, wherein the first expression vector and the second expression vector each comprise a predetermined copy number of genes encoding the respective first plurality of enzymes and second plurality of enzymes, wherein the copy number of genes encoding the first plurality of enzymes is lower than the copy number of genes encoding the second plurality of enzymes.

4. The method of claim 2, wherein the first expression vector has a copy number in a range of 5 to 15 and the second expression vector has a copy number in a range of 80 to 120.

5. The method of claim 1, further comprising introducing a codon, fusion tag, co-expression of a chaperone or combinations thereof to improve the solubility of the alcohol acetyltransferase or Clostridium acetobutylicum adhE2.

6. The method of claim 5, wherein the alcohol acetyltransferase is ATF1.sub.Sc and introducing comprises a fusion tag.

7. The method of claim 5, wherein the alcohol acetyltransferase is SAAT.sub.Fa and introducing comprises a co-expression of a chaperone.

8. The method of claim 5, wherein the alcohol acetyltransferase is ATF1.sub.Sc, the second expression vector is AdhE2.sub.Ca, introducing comprises codon configuration and a fusion tag of thioredoxin 1 (TrxA) to both thereof, and inserting comprises induction conditions of 0.1 mM isopropyl--D-thiogalactopyranoside (IPTG) at 28 C., and optionally, an adhE-deficient chassis, or an adhE-deficient chassis and an anaerobic condition/pH adjustment.

9. The method of claim 5, wherein the microbial host cell is EcJWBA15.

10. The method of claim 5, wherein the alcohol acetyltransferase is SAAT.sub.Fa, introducing comprises coexpression of the chaperone Gro ES/EL, and inserting comprising induction conditions of 0.1 mM isopropyl--D-thiogalactopyranoside (IPTG) at 28 C., an arabinose concentration of at least 1 mg/ml, and optionally, an anaerobic condition/pH adjustment.

11. The method of claim 10, wherein the microbial host cell is EcJWEB2 or EcJWEB7.

12. The method of claim 5, wherein the alcohol acetyltransferase is SAAT.sub.Fa, the second expression vector is AdhE2.sub.Ca, introducing comprises codon configuration and a fusion tag of thioredoxin 1 (TrxA) to AdhE2.sub.Ca, and inserting comprises induction conditions of 0.1 mM isopropyl--D-thiogalactopyranoside (IPTG) at 37 C., and optionally, an anaerobic condition/pH adjustment.

13. The method of claim 12, wherein the microbial host cell is EcJWBB2 or EcJWBB8.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 (prior art) is schematic representation of the production of esters from an engineered microbe harboring a modified chloramphenicol acetyltransferase (CAT) having a Y20F mutation.

(2) FIG. 2 is a schematic workflow of the high-throughput microbial screening method for screening beneficial AAT variants for improved selected target ester production.

(3) | FIG. 3 is a bar graph of relative fold change in ester production for determining alcohol substrate preference of an AAT, such as ATF1.sub.Sc P348 variants as compared to its wildtype (WT).

(4) FIG. 4 is a photograph of a microplate colorimetric assay of n-hexadecane overlays from cultures of an E. coli strain carrying ATF1.sub.Sc variants (vertical rows 1 to 9), ATF1.sub.Sc wildtype (row 10), and SAAT.sub.Fa wildtype (row 11). From row 1 to 9, the ATF1.sub.Sc variants are P348W, P348R, P348M, P348H, P348K, P348N, P3481, P348S, and P348D.

(5) FIG. 5 is a photograph of a microplate colorimetric assay of n-hexadecane overlay samples and a series of isobutyl acetate (IBA) standards at different concentrations.

(6) FIG. 6 is an isobutyl acetate standard colorimetric curve.

(7) FIG. 7 is a comparison of the IBA titers measured by the high-throughput microbial screening against GC/MS methods.

(8) FIG. 8 is a bar graph of relative fold change in ester production of CAT.sub.Sa F97 variants with respect to the wildtype.

(9) FIG. 9 is a bar graph of ester production by the E. coli strain carrying SAAT.sub.Fa alone and then as a comparison against in vitro activity thereof from literature.

(10) FIG. 10 is a compilation of standard colorimetric curves for various esters at varying (increasing) concentration ranges.

(11) FIG. 11 is a schematic representation of a method of selectively synthesizing a butyryl-CoA derived ester via microbial biosynthesis.

(12) FIG. 12 is a Table of strains and plasmids used in the method of synthesizing esters from butyryl-CoA.

(13) FIG. 13 is a Table of those strains that had three plasmids, the third plasmid being a chaperone used in the method of synthesizing esters.

(14) FIG. 14 is a reaction scheme of the ester synthesis pathways within the submodules of FIG. 11.

(15) FIG. 15A is a chart of the pCore and pDerivatization combinations based on differing copy numbers for butyl acetate synthesis.

(16) FIG. 15B is a chart of the pCore and pDerivatization combinations based on differing copy numbers for ethyl butyrate synthesis.

(17) FIG. 15C is a chart of the pCore and pDerivatization combinations based on differing copy numbers for butyl butyrate synthesis.

(18) FIG. 16A is a bar graph and chart of the concentration of butyl acetate and ester selectivity according to the pathways set forth in FIG. 15A.

(19) FIG. 16B is a bar graph and chart of the concentration of ethyl butyrate and ester selectivity according to the pathways set forth in FIG. 15B.

(20) FIG. 16C is a bar graph and chart of the concentration of butyl butyrate and ester selectivity according to the pathways set forth in FIG. 15C.

(21) FIG. 17A is data in the form of a bar graph, chart and line graph for biosynthesis of butyl acetate from glucose in the strains identified in the chart.

(22) FIG. 17B is data in the form of a bar graph, chart and line graph for biosynthesis of ethyl butyrate from glucose in the strains identified in the chart.

(23) FIG. 17C is data in the form of a bar graph, chart and line graph for biosynthesis of butyl butyrate from glucose in the strains identified in the chart.

(24) FIG. 18 is a schematic representation of protein solubilization strategies applied herein.

(25) FIG. 19 is the pathway for ethyl acetate and butyl acetate production by ATF1.sub.Sc in E. coli and the ester conversion percentages for each strain relative to the solubilization strategy tested.

(26) FIG. 20 is the pathway for ethyl butyrate and butyl butyrate production by SAAT.sub.Fa in E. coli and the ester conversion percentages for each strain relative to the solubilization strategy tested.

DETAILED DESCRIPTION

(27) The following detailed description will illustrate the general principles of the invention, examples of which are additionally illustrated in the accompanying drawings. In the drawings, like reference numbers indicate identical or functionally similar elements.

(28) Except in the working examples, or where otherwise explicitly indicated, all numbers in this description indicating amounts, parts, percentages, ratios, and proportions of material, physical properties of material, and conditions of reaction are to be understood as modified by the word about. About as used herein means that a value is preferably +/5% or more preferably +/2%. Percentages for concentrations are typically % by wt. For pH values, about means+/0.2.

(29) In one aspect, a high-throughput microbial screening platform to probe specificities of AATs/CATs for designer ester biosynthesis is disclosed. This platform integrates microplate culturing with a modified colorimetric assay. This method provides useful information about AAT expression and activity, microbial health, and ester production. The high-throughput microbial screening platform not only probed the alcohol substrate specificity of both native and engineered AATs but also identified the beneficial mutations in engineered AATs for enhanced ester synthesis. As such, rapid profiling of the alcohol substrate preference of AATs for production of designer esters is now possible. This method is scalable and compatible with automated microplate handling systems to increase its screening capacity.

(30) Turning to FIG. 1, a schematic illustration is provided showing an alcohol acyltransferase or a mutated CAT that can function like an alcohol acyltransferase, which is then introduced into a microbe, such as a bacterium, yeast, or fungus to form an engineered microbe that can be fed sugars and/or volatile organic acids (acetate, butyrate) and optionally an alcohol to produce an ester. The alcohol may be produced by the system via acetyl-CoA or butyryl-CoA for straight chain esters or an Ehrlich pathway for branched esters. FIG. 2 is a flowchart of one example of a method 100 of microbial screening for identifying alcohol acyltransferases (AATs) for such ester biosynthesis. The method 100 begins by providing preselected plasmids 102, which may include computer model-guided rational protein engineering but is not limited thereto. Each of the preselected plasmids is introduced into a respective host strain to form engineered microbes 104. This can be accomplished by site-direct mutagenesis, or natural variants from genome mining. Next, in situ fermentation 106 is performed on the engineered microbes, which is optionally followed by measuring the optical density of each well at a wavelength of 600 nm as a measurement of growth of cells expressing the preselected plasmid. Lastly, a colorimetric assay 108 is performed for quantification of production of the target esters.

(31) The in situ fermentation 106 includes providing a first microplate having a culture media in a plurality of wells thereof, inoculating each well of the plurality of wells with one of the engineered microbes to form an inoculated microplate, adding an overlay of a solvent, which can extract the target ester while not being toxic to the cells, to each well of the inoculated microplate before incubating, and incubating the inoculated microplate for a preselected incubation period. The culture media has a composition therein from which each of the engineered microbes can produce a target ester. Typically, the composition includes a sugar and may optionally include an alcohol and/or a buffer. The buffer can be a salt solution such as M9 buffer (NaCl, NaCl, KH.sub.2PO.sub.4, Na.sub.2HPO.sub.4, and/or NH.sub.4Cl). The solvent overlay also minimizes medium evaporation, which causes water condensation, generates reproducible growth measurement, eliminates the ester extraction step (simplifies sample preparation), thereby lending compatibility with a high-throughput workflow, and reduces or eliminates product toxicity during fermentation (esters are known to be inhibitory to microbial health).

(32) The solvent in the examples herein was n-hexadecane. Other suitable solvents like n-hexadecane are suitable herein, such as n-dodecane, n-tridecane, n-tetradecane, n-pentadecane, n-heptadecane, and n-octadecane. These solvents can extract short-chain esters, are not miscible with the fermentation broth, and do not inhibit cells.

(33) The colorimetric assay 108 includes providing a second microplate to which, post-incubation, a quantity of the overlay from each well of the first microplate is transferred on a well-by-well basis, treating each well of the second microplate to form an iron-hydroxamic acid complex aqueous phase, centrifuging the second microplate after formation of the iron-hydroxamic acid complex aqueous phase, measuring the absorbance of the iron-hydroxamic acid complex aqueous phase at a wavelength of 520 nm, and comparing the absorbance values to a standard curve for the target ester.

(34) Treating each well of the second microplate includes mixing hydroxylamine stock solution to produce hydroxamic acid followed by addition of ferric ions to form the iron hydroxamic acid complex according to the reaction mechanism presented below. As shown in FIGS. 2, 4 and 5, the reactions of esters with hydroxylamine generate hydroxamic acids, a purple complex with ferric ion, thereby enabling colorimetric determinations of the ester concentration.

(35) ##STR00001##

(36) Previously, this colorimetric assay was adapted for high-throughput screening of ethyl acetate (EA) production from C5, C6, and C12 carbon sources in Kluyveromyces marxianus where cell culture samples were first collected followed by ester extraction with hexane. The problem with this is that hexane is toxic to the microbes/cells; thus, it cannot be used for in situ fermentation and extraction as set forth herein. Hexadecane, however, is not toxic to the microbes/cells. Thus, a standard curve to estimate isobutyl acetate (IBA) production by the colorimetric assay was prepared. Using pure IBA in hexadecane, as shown in FIG. 6, an almost perfect linear correlation (R.sup.2=0.999) was established between absorbance at 520 nm and IBA concentration within 0-200 mg/L. The results of trials were compared with this standard and with GC/MS results. As shown in FIG. 7, esters in hexadecane from the cell culture samples from the colorimetric assay disclosed herein were consistent with those measured by gas chromatography/mass spectroscopy (GC/MS). The method disclosed effectively eliminates the need to use GC/MS in AAT screening.

(37) When the host strain produces ethanol endogenously, an inevitable by-product, the observed concentration of the target ester needs a correction factor to correct for the overestimation. To avoid overestimation of the concentration, we used Ab.sub.520 wherein the Ab.sub.520=Ab.sub.520, AAT.sub.+.sub., ROH.sub.+-Ab.sub.520, AAT.sub.+.sub., ROH.sub.. This is the absorbance difference between culture samples with and without the target alcohol (ROH) availability. The target alcohol can be supplemented externally or produced by the cells. Another strategy, whereby correction is unnecessary, is to use a host strain void of an endogenous pathway causing the biosynthesis of unwanted alcohol byproduct(s) (e.g., ethanol).

(38) The addition of centrifugation avoids the interference of an emulsified layer of an immiscible ethanol-hexadecane mixture that causes interference with the measured absorbance. Ethanol can be produced by the host strain and is also present in the ferric ion solution used in the colorimetric assay (see the reaction mechanism presented above). This problem did not occur in the previous colorimetric assays because the hexane used for ester extraction is miscible in ethanol. Centrifugation creates an immiscible hexadecane-ethanol mixture within the transparent organic phase that is separate from the purple aqueous phase.

(39) The preselected plasmids are wildtype and/or engineered enzymes. In all aspects, the preselected plasmids can be engineered plasmids comprising an AAT. Some exemplary, non-limiting engineered plasmids include modified chloramphenicol acetyltransferase having a tyrosine residue 20 having a phenylalanine (Y20F) mutation, a modified chloramphenicol acetyltransferase comprising a phenylalanine residue 97 having a single amino acid mutation (F97-mutation) and/or an alanine residue 138 having a single amino acid mutation (A138-mutation), an alcohol acetyl transferase factor 1 of Saccharomyces cerevisiae (ATF1.sub.Sc) comprising a proline residue 348 having a single amino acid mutation (P348-mutation), and a strawberry alcohol acyltransferase of Fragaria ananassa (SAAT.sub.Fa) and mutations thereof.

(40) Microorganism strains harboring any of the AATs or modified proteins discussed herein can be yeast, fungi, or bacteria. Non-limiting examples of species that can harbor the ester pathways include species belonging to genera Bacillus, Pseudomonas, Erwinia, Caulobacter, Serratia, Arthrobacter, Micrococcus, Flavobacterium, Chromobacterium, Agrobacterium, Hyphomycrobium, Rhizobium, Bradyrhizobium, Sinorhizobium, Azorhizobium, Mesorhizobium and Allorhizobium, most likely useful for agricultural applications, Bacillus coagulans, Saccharomyces boulardii, Escherichia coli Nissle 1917, useful probiotics, and Acidothermus cellulolyticus, Acinetobacter baylyi, Aspergillus niger, Aspergillus pseudoterreus, Bacillus coagulans, Bacillus subtilis, Caldicellulosiruptor bescii, Clostridium acetobutylicum, Clostridium autoethanogenum, Clostridium beijerinckii, Clostridium butyricum (Cb), Clostridium carboxidivorans, Clostridium celluloyticum, Clostridium clariflavum, Clostridium kluyveri, Clostridium ljungdahlii, Cupriavidus necator, Clostridium propionicum, Cyanobacteria spirulina, Clostridium thermocellum, Clostridium tyrobutyricum, Corynebacterium glutamicum, Cupriavidus necator, Cyanobacteria spirulina, Escherichia coli (Ec), Geobacillus caldoxylosilyticus, Geobacillus galactosidasius, Geobacillus icigianus, Geobacillus jurassicus, Geobacillus kaustophilus, Geobacillus lituanicus, Geobacillus stearothermophilus, Geobacillus subterraneus, Geobacillus thermantarcticus, Geobacillus thermocatenulatus, Geobacillus thermodenitrificans, Geobacillus thermoglucosidasius, Geobacillus G. thermoleovorans, Geobacillus toebii, Geobacillus uzenensis, Geobacillus vulcani, Geobacillus LC300, Haemophilus influenzae (Ha), Klebsiella sp. (Kl), Lactococus lactis, Lysinibacillus boronitolerans (Lys), Pseudomonas putida, Pichia kudriavzevii, Pichia pastoris, Ralstonia eutropha, Rhodosporidium toruloides, Saccharomyces cerevisiae, Staphylococcus aureus (Sa), Thermoanaerobacterium thermosaccharolyticum, Yarrowia lipolytica, Zymomonas mobilis, and combinations thereof. The strain referenced in the example in FIG. 2 is Escherichia coli.

(41) These species can be useful for harnessing the pathways to convert sugars and/or volatile organic acids (acetate, butyrate) into esters. In agriculture, these species can harness the pathways to make esters beneficial for microbes and plants interaction that can potentially benefit plant growth.

(42) With respect to the preselected inoculation period is dependent upon the host strain selected, such as those expressly identified in the preceding paragraph and on the size of the inoculation. The preselected inoculation period typically being at least 1 hour. In some embodiments, the inoculation period is at least 3 hours, more preferably at least 6 hours. In some embodiments, the inoculation period is at least 12 hours, more preferably at least 24 hours.

(43) The above method provides the advantage of being able to measure both esters and cell growth, which helps not only screen relative AATs/CATs specificities and activities rapidly but also evaluate the effect of expressing these enzymes on microbial health. The high-throughput microbial screening method was validated by probing the alcohol substrate preferences of CAT.sub.Sa F97 variants, ATF1.sub.Sc P348 variants derived from ATF1.sub.Sc of Saccharomyces cerevisiae, and SAAT.sub.Fa of Fragaria ananassa. This method will be a useful tool to identify novel AATs that have important roles in nature and industrial biocatalysis for designer bioester production.

(44) Referring now to FIG. 11, in another aspect, a method 200 of selectively synthesizing a target ester 220, such as a butyryl-CoA derived ester, via microbial biosynthesis is disclosed. The method of high throughput assay disclosed above can be used first to identify suitable candidates for use in this biosynthesis method. The method includes selecting a target ester 220, such as butyl acetate, butyl butyrate, and ethyl butyrate, to be synthesized by microbial biosynthesis via a host cell 218. The host cell can be any of those disclosed herein with respect to the high throughput assay and those listed in FIG. 12, but is not limited thereto. The host cells listed in FIG. 12, except for EcJWBA15, were TCS083 fadE (DE3), the exception by TCS095 (DE3). The method includes providing a first expression vector, represented as pCore 202 in FIG. 11, providing a second expression vector, represented as pDerviatization 204 in FIG. 11, that encodes a second plurality of enzymes, and inserting the first expression vector and the second expression vector into a host cell 218. The expression of the first and second expression vectors in the host cell produces the target ester.

(45) The first expression vector 202 encodes a first plurality of enzymes 204 that convert acetyl-CoA to butyryl-CoA. The first plurality of enzymes comprises Escherichia coli acetyl-CoA acetyltransferase (atoB.sub.Ec), Clostridium acetobutylicum 3-hydroxybutyryl-CoA dehydrogenase (hbd.sub.Ca), Clostridium acetobutylicum 3-enoyl-CoA dehydratase (crt.sub.Ca), and Treponema denticola trans-2-enoyl-CoA reductase (ter.sub.Td).

(46) The second expression vector's plurality of enzymes has at least one enzyme thereof that selectively determines a pathway for either butanol or ethanol synthesis, represented as submodule 2 (SM2) 208 in FIG. 11, at least one enzyme that facilitates production of nicotinamide adenine dinucleotide and hydrogen (NADH), represented as submodule 3 (SM3) 210, and at least one enzyme that is an alcohol acetyltransferase selected for synthesis of the target ester, represented as submodule 4 (SM4) 212 in FIG. 11. Various enzymes can be selected for each of submodule 2, 3, and 4 and myriad combinations thereof can be created.

(47) FIG. 14 is a schematic of the reaction pathways 230 from the input of fermentable sugar(s) to the output of the target esters. With reference to FIG. 14, in one embodiment, the enzymes for SM2 208 comprise Zymomonas mobilis pyruvate decarboxylase (pdc.sub.Zm) and Zymomonas mobilis alcohol dehydrogenase (adhB.sub.Zm) for ethanol synthesis or Clostridium acetobutylicum aldehyde-alcohol dehydrogenase (adhE2.sub.Ca) for butanol synthesis. The enzyme for SM3 210 comprises Candida boidinii formate dehydrogenase (fdh.sub.Cb) for facilitating the NADH production. The enzyme for SM4 212 is an alcohol acetyltransferase. The alcohol acetyl transferase can be Saccharomyces cerevisiae alcohol acetyltransferase (ATF1.sub.Sc) when an acetate ester is the target ester or Fragaria ananassa (cultivated strawberry) alcohol acetyltransferase (SAAT.sub.Fa) when an acylate ester is the target ester. Myriad combinations of these enzymes based on the submodules in FIGS. 11 and 14 are provided in the table presented herein as FIG. 12.

(48) One advantage provided by this method is the ease of creating various pCore 202 and pDerviatization 206 expression vectors using plasmid backbones 214 and 216 to build numerous sources thereof having different copy numbers to determine the number of genes encoding the enzymes to produce the highest concentration of target ester via the biosynthesis. Copy number refers to the origins of replication, which changes based on the particular nucleotide sequence on the plasmid at which replication is initiated. Low copy number as used herein means a value of 20 or less. A high copy number as used herein means a value at or greater than 100. Medium copy number as used herein means those values between a low copy number and a high copy number. With reference to FIGS. 15A-15C, in certain examples the first expression vector includes a plasmid that has a low copy number, a medium copy number, or a high copy number of the genes encoding the enzymes described herein, and the second expression vector includes a plasmid having a low copy number, a medium copy number, or a high copy number, thereby providing the possibility of three sources of each expression vector for a total of six different variations for substitution into the submodules herein. The method comprises making each of a low copy number core plasmid, a medium copy number core plasmid, and a high copy number core plasmid and each of a low copy number derivatization plasmid, a medium copy number derivatization plasmid, and a high copy number derivatization plasmid, and introducing one each of all possible combinations thereof into the strains. FIG. 15A is a chart of the combinations for butyl acetate. FIG. 15B is a chart of the combinations for ethyl butyrate. FIG. 15C is a chart of the combinations for butyl butyrate. The method includes identifying the combination of copy numbers with the highest concentration of the target ester.

(49) While the engineered pathway module(s) can be introduced cells via plasmids, it can also be integrated into the chromosome of the host cell to achieve genetic stability.

(50) Referring now to FIGS. 16A-16C, bar graphs of the results for butyl acetate, ethyl butyrate, and butyl butyrate are provided. Surprisingly, all three esters had their highest concentration when pCore had a low copy number and pDerivatization had a high copy number. In other words, the first expression vector and the second expression vector each comprise a predetermined copy number of genes encoding the respective first plurality of enzymes and second plurality of enzymes, and the copy number of genes encoding the first plurality of enzymes is lower than the copy number of genes encoding the second plurality of enzymes. We found that EcJWBA2 (FIG. 16A), EcJWEB2 (FIG. 16B), and EcJWBB2 (FIG. 16C) carrying the pCore with low copy number and the pDerivatization with high copy number achieved the highest ester production among the six initial strains characterized for each compound, indicating that higher alcohol production and/or AAT expression are required for efficient ester synthesis. FIG. 16A evidences that EcJWBA2 produced 34.26.6 mg/L of BA with the selectivity of 74.3%. FIG. 16B evidences that EcJWEB2 produced 71.06.6 mg/L of EB with the selectivity of 92.0%. FIG. 16C evidences that EcJWBB2 produced 33.52.9 mg/L of BB with the selectivity of 20.8%.

(51) Using the method described above that uses the submodules, each ester production strain can be generated from an engineered modular (chassis) cell and an exchangeable ester production module in a plug-and-play fashion. Herein, the exchangeable ester production modules are compatible with the chassis cell for efficient biosynthesis of designer esters with controllable selectivity of the target ester. To build these modules, we arranged a set of 11 heterologous genes, derived from bacteria, yeasts, and plants, into the four submodules to facilitate rapid module construction via manipulation of gene replication, transcription, translation, post-translation, pathway enzymes, and even pathway induction conditions (which is discussed in detail in Working Examples 7-12). Furthermore, the highest production of esters (i.e., BA, EB, and BB) ever reported in E. coli with controllable selectivity was achieved using these methods.

(52) In controlling the selectivity problem of butyryl-CoA-derived ester biosynthesis, ATF1.sub.Sc specific for acetate ester biosynthesis (e.g., BA) and SAAT.sub.Fa specific for butyrate ester biosynthesis (e.g., EB and BB) were used as seen in FIGS. 11 and 14. Additionally, the pathway gene replication and transcription for sufficient supply of precursor metabolites was determined. However, the ester titer and selectivity were still lower than desired since the problem of proper expression of pathway enzymes remained, which is difficult to solve. Based on the Protein-Sol, a web tool for predicting protein solubility from sequence, AATs are predicted to have the lowest solubility among the engineered pathway enzymes followed by AdhE2.sub.Ca. The prediction is consistent with the SDS-PAGE analysis conducted by the Applicant and by others.

(53) As such the solubility problem of the AATs and ideally AdhE2.sub.Ca, when present in a selected pathway, must be solved. Herein, we used codons, fusion tags, co-expression of chaperones and combinations thereof to improve the solubility thereof. Remarkably, fusion tags improve ATF1.sub.Sc solubilization while chaperones enhance expression of SAAT.sub.Fa, which is not trivial to predict or explain. In general, solubilization with fusion tags are enzyme specific; however, use of chaperones alone can be very unspecific, especially when multiple enzymes are expressed simultaneously.

(54) The working examples 7-12, show the significance of modulating the translation and post-translation for multiple pathway enzymes, which cannot be effectively addressed by mere optimization of gene replication and transcription alone as commonly practiced in the fields of metabolic engineering and synthetic biology. In certain example embodiments, the genes of the first expression vector and/or the second expression vector are under the control of an inducible promoter. As those skilled in the art will appreciate, several inducible promoters are available to induce gene expression. These include, for example, any chemically inducible promoter or temperature inducible promoter that can be used to induce gene expression of the enzymes described herein. For example, the genes of the first expression vector and/or the second expression vector can be configured such that they are under the control of a lactose operon (lac operon), in which case the molecular reagent isopropyl--D-thiogalactopyranoside (IPTG) can be used to induce expression of the genes of the first expression vector and/or the second expression vector.

(55) Referring now to FIGS. 17A-17C, the additive effects of induction conditions, improved solubility of the AAT and/or AdhE2.sub.Ca, optionally an adhE-deficient chassis, and an anaerobic condition/pH adjustment is shown to greatly increase the concentration of the target ester. FIG. 17A shows the achievement of a 19-fold increase in BA production with 96% selectivity with induction conditions of 0.1 mM IPTG at 28 C., AAT and AdhE2.sub.Ca solubilization by codon configuration and fusion tag, an adhE-deficient chassis, and an anaerobic condition/pH adjustment. FIG. 17B shows the achievement of a 6-fold increase in EB production with 86% selectivity with induction conditions of 0.1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) at 28 C., AAT solubilization by coexpression of a chaperone Gro ES/EL, an arabinose concentration of 5 mg/ml, and an anaerobic condition/pH adjustment. FIG. 17C shows the achievement of a 13-fold increase in BB production with 54% selectivity, as compared to the initial strains, with induction conditions of 0.1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) at 37 C., AdhE2.sub.Ca solubilization by codon configuration and fusion tag, and an anaerobic condition/pH adjustment.

(56) Unlike the microbial biosynthesis of BA and EB, tuning the BB selectivity is intrinsically challenging due to the following reasons: i) the butanol biosynthesis is limiting due to low solubility of AdhE.sub.Ca and ii) AdhE.sub.Ca is promiscuous and can reduce both acetyl-CoA and butyryl-CoA. While our strategy to enhance co-solubilization of AdhE.sub.Ca together with SAAT.sub.Fa helped improve BB production and selectivity, EB is always produced as a significant byproduct. Should high selectivity be desirable for specific applications, two engineering strategies can be further exploited to overcome this problem: i) improving specificity of AdhE.sub.Ca towards butyryl-CoA and ii) decoupling butanol and butyl butyrate production using a microbial co-culture system. Furthermore, without external supply of butanol, production of BA and BB directly from glucose was much lower likely due to metabolic burden required for expressing multiple pathway enzymes.

(57) One distinct advantage of microbial production of esters is that they have low solubility in an aqueous phase and hence are very beneficial for fermentation. Even though the butyryl-CoA-derived esters are inhibitory to microbes, their toxicity is significantly alleviated by implementing in situ fermentation and extraction. Besides beneficial detoxification by extraction, we also found that maintaining anaerobic culture conditions at neutral pH control improves ester production. Anaerobic production of butyryl-CoA-derived esters from fermentable sugars are favorable because i) high product yields can be achieved due to higher reduction of esters than glucose and ii) scale-up for anaerobic processes is much simpler and more economical.

(58) In conclusion, we developed a generalizable framework to engineer a modular microbial platform for anaerobic production of butyryl-CoA-derived designer esters. Using the principles of modular design, we engineered the de novo modular fermentative pathways of biosynthesis of BA, EB, and BB from fermentable sugars in E. coli with controllable selectivity. In addition to the conventional strategies of replication and transcription manipulation, implementing various protein solubilization strategies on aggregate-prone pathway enzymes to control enzyme (post)-translation is important to enhance ester production and selectivity. We envision the modular microbial ester synthesis method will accelerate the biosynthesis of diverse natural esters with various industrial applications.

Working Example 1

(59) Strains and Primers: E. coli TOP10 was used for molecular cloning while BL21 (DE3) or EcDL002 was used as a host strain for ester production. The pETDuet-1 plasmids containing 20 F97 variants of CAT.sub.Sa were used to examine the role of the F97 residue on the alcohol substrate preference. F97 is present in the binding pocket of the CAT. The plasmid pATF1.sub.Sc was constructed by subcloning ATF1.sub.Sc gene from pDL004 into pET29 by the Gibson gene assembly method. The ATF1.sub.Sc variants were generated by the known technique of site-directed mutagenesis. The plasmid pSAAT.sub.Fa was constructed to harbor the codon optimized SAAT.sub.Fa gene for E. coli. All the constructed plasmids were verified by Sanger sequencing and introduced into the host strains by chemical transformation. The primers used in herein correspond to SEQ ID Nos. 1-28 and the codon optimized sequences of SAAT.sub.Fa for E. coli is SEQ ID No. 29. Mutations are defined using the standard one letter code for amino acids.

(60) Culture media: A lysogeny broth (LB) medium comprising 10 g/L peptone, 5 g/L yeast extract, and 5 g/L NaCl was used for molecular cloning and seed cultures. An M9 hybrid medium with 20 g/L glucose was used for ester production. Either 50 g/mL ampicillin (Amp) or 50 g/mL kanamycin (Kan) was added to the media for selection where applicable.

(61) Microplate-based microbial screening: Cell inoculum was prepared either from a bacterial glycerol stock or from a single colony on a LB agar plate. Specifically, 1% (v/v) of stock cells were grown overnight in 5 mL of LB at 37 C. and 200 rpm on a 75 angled platform in a New Brunswick Excella E25 (Eppendorf, CT, USA). Alternatively, single colonies from LB agar plates were inoculated in 100 L of LB in 96-well microplates using sterile pipette tips. Each colony picked by a sterile pipette tip was subsequently mixed with the media in the target well and was grown overnight at 37 C. and 400 rpm in an incubating microplate shaker (cat #02-217-757, Fisher Scientific, PA, USA).

(62) For the microplate-based screening assay, 5% (v/v) of overnight cultures were first inoculated in 100 L of the M9 hybrid media containing 20 g/L of glucose, 0.1 mM of isopropyl -D-1-thiogalactopyranoside (IPTG), and 2 g/L of alcohol (i.e., ethanol, n-butanol, isobutanol, isoamyl alcohol, hexanol, or 2-phenethyl alcohol) in 96-well microplates with hexadecane overlay in a 1:1 (v/v) ratio. The microplates were then sealed with a plastic adhesive sealing film, ScalPlate (cat #STR-SEAL-PLT, EXCEL Scientific, Inc., CA, USA), to avoid cross contamination and evaporation using a plate roller (cat #RLPLT01, Andwin Scientific, CA, USA). Finally, the microplates were incubated at 37 C. and 400 rpm for 24 hours (h) in an incubating microplate shaker.

(63) The optical density (OD) of cell culture was measured at 600 nm using a spectrophotometer (GENESYS 30, Thermo Scientific, IL, USA) or BioTek Synergy HT microplate reader (BioTek Instruments, Inc., VT, USA). A correlation between the OD.sub.600 and dry cell weight (DCW) (1 OD.sub.600=0.476 g DCW/L) was determined by centrifugation of a known volume of the culture broth, sediment drying, and posterior weighing. The dry cell mass (DCW) was obtained by multiplication of the optical density of culture broth with a conversion factor, 0.48 g/L/OD. The organic layers were collected for ester measurement either by gas chromatography coupled with mass spectroscopy (GC/MS) or colorimetric assay.

(64) Comparative gas chromatography coupled with mass spectroscopy (GC/MS): For comparison against the trial herein, microplates from the microbial screening of AATs were centrifuged at 4,800g for 5 min and the hexadecane overlays were used for quantification of esters. The samples were prepared by diluting hexadecane extracts from the cultures with hexadecane containing internal standard (isoamyl alcohol) in a 1:1 (v/v) ratio. Then, 1 L of samples were directly injected into a gas chromatograph (GC) HP 6890 equipped with the mass selective detector (MS) HP 5973. For the GC system, helium was used as the carrier gas at a flow rate of 0.5 mL/min and the analytes were separated on a Phenomenex ZB-5 capillary column (30 m0.25 mm0.25 m). The oven temperature was programmed with an initial temperature of 50 C. with a 1 C./min ramp to 58 C. Next a 25 C./min ramp was deployed to 235 C., then a 50 C./min ramp was deployed to 300 C., and finally the temperature at 300 C. was held for 2 minutes to elute any residual non-desired analytes. The injection was performed using the splitless mode with an initial injector temperature of 280 C. For the MS system, a selected ion monitoring (SIM) mode was deployed to detect analytes. The SIM parameters for detecting esters were as follows: i) for ethyl acetate, ions 45.00, and 61.00 detected from 4.15 to 5.70 min, ii) for isoamyl alcohol (internal standard), ions 45.00, and 88.00 detected from 5.70 to 7.20 min, iii) for isobutyl acetate, ions 61.00, and 101.00 detected from 6.60 to 7.75 min, iv) for butyl acetate, ions 61.00, and 116.00 detected from 7.75 to 13.70 min, v) for 2-phenethyl acetate, ions 104.00, and 121.00 detected from 13.70 to 13.95 min, vi) for ethyl butyrate, ions 47.00, and 116.00 detected from 7.20 to 7.75 min, and vii) for butyl butyrate, ions 101.00, and 116.00 detected from 11.25 to 12.50 min.

(65) Experimental colorimetric assay: The colorimetric assay for ester quantification was performed in a 96-well microplate. In each well, 40 L of hexadecane overlay from the culture was mixed with 40 L of hydroxylamine stock solution and incubated at room temperature for 10 minutes (min) to produce hydroxamic acid. Next, 120 L of the ferric working solution (1/20-diluted stock ferric iron (III) solution in ethanol) was added to the reaction solution and incubated for 5 min to form an iron-hydroxamic acid complex. The absorbance was measured at 520 nm (Ab.sub.520) using a BioTek Synergy HT microplate reader. Esters were quantified using a standard curve between the absorbances and known concentrations of a target ester.

(66) Results: IBA production in microplates followed the same trend of its production observed in high cell density cultures with a strong positive linear correlation (R.sup.20.965) in IBA production between the microplate-based and high cell density culturing methods. Thus, the microplate-based culturing method could validate that the CAT.sub.Sa F97W variant achieved the highest IBA production among a set of 20 characterized variants.

Working Example 2

(67) Our previous work discovered that the CAT.sub.Sa F97W mutant improved its catalytic efficiency towards isobutanol by about 2-fold. Using the microplate-based method disclosed herein, rapid profiling of the alcohol substrate preference of CAT.sub.Sa F97 variants was evaluated. We characterized the recombinant E. coli BL21 (DE3) strains carrying 20 CAT.sub.Sa F97 variants with exogenous supplementation of alcohols in the media including linear, short-chain alcohols (ethanol, butanol), a branched-chain alcohol (isobutanol), and an aromatic alcohol (2-phenethyl alcohol) in microplates with hexadecane overlay. Referring now to the graph provided as FIG. 8, the results show that mutations in the F97 residue changed the ester production profiles. FIG. 8 report the relative fold change in ester product as compared to the wildtype (WT) for n-butyl acetate (BA), isobutyl acetate (IBA), and 2-phenethyl acetate (PEA). Ethyl acetate is not included in FIG. 8 because each of the variants exhibited poor activity toward ethanol. Thus, the F97 residue plays an important role in determining the alcohol substrate preference of CAT.sub.Sa.

(68) Still referring to FIG. 8, among the four target acetate esters investigated, F97W produced PEA at the highest level of 194.6 mg/L followed by F97H (182.3 mg/L) and the wildtype F97 (149.4 mg/L). As compared to the wildtype, IBA production by F97W (91.2 mg/L) showed the highest improvement (6.4-fold), which was relatively consistent with a prior in vitro study showing that F97W variant achieved 2-fold increase in the catalytic efficiency towards isobutanol. Remarkably, F97T showed BA production (12.4 mg/L) with high specificity, demonstrating the feasibility of production of designer esters using selectively modified CATs. Different from F97W, F97C exhibited the highest BA production (18.3 mg/L).

Working Example 3: Rapid Search for the Engineered ATF1.SUB.Sc .Mutants for Enhanced n-Butyl Acetate Production and/or Selectivity Using the Disclosed Method

(69) A library of potential ATF1.sub.Sc candidates in silico were generated that might improve BA production, which involved creating a 3D structure of ATF1.sub.Sc using the homology model of 15-O-acetyltransferase (PDB: 3FP0) best predicted by SWISS-MODEL, and identifying a binding pocket of ATF1.sub.Sc for docking simulations of the BA co-substrates, including acetyl-CoA and butanol. Based on the homology model, the binding pocket of ATF1.sub.Sc consists of 24 residues including V32, Y36, H191, D195, G196, R197, T316, I347, P348, A349, D350, R352, N370, V371, I374, F376, Y399, I403, L407, K426, L448, S449, N450, V451, F471, and Q473, where H191 and D195 are the catalytic residues. By performing docking simulations, an acetyl-CoA-butanol-ATF1.sub.Sc complex was generated and the residues interacting with butanol including V32, Y36, D195, P348, V371, L447, S449, Q473, Q475, and S483 were identified. Lastly, a residue scan against these 10 residues was performed to select the top nine promising candidates including P348W, P348R, P348M, P348H, P348K, P348N, P3481, P348S, and P348D with low affinity values for experimental characterization.

(70) The high-throughput microbial screening method disclosed in working example 1 was implement for the top nine engineered ATF1.sub.Sc candidates. TCS083 fadE (DE3) was selected as a host strain. Since BA is being evaluated, a standard colorimetric curve was prepared. Like the colorimetric assay developed for IBA, the standard curve for BA measurement showed a strong linear correlation (R.sup.2=1.000) between the 520 nm absorbance and the standard BA concentrations in the range of 0-200 mg/L. Unfortunately, as shown in FIG. 3, no positive improvement in BA production was evidence by any of the variants for ATF1.sub.Sc P348 variants.

(71) Since the P348 residue of ATF1.sub.Sc is located on the opposite side of the catalytic residues (H191 and D195) and interacts with an alcohol substrate, it is believed that the P348 residue may have an important role in determining the alcohol substrate preference of ATF1.sub.Sc like the F97 residue of CAT.sub.Sa. To evaluate whether the mutations of the ATF1.sub.Sc P348 affected the alcohol substrate preference, we characterized the recombinant E. coli strains carrying the ATF1.sub.Sc P348 variants using our established high-throughput microbial screening platform with exogenous supplementation of various alcohols including linear, short-to-medium chain alcohols (ethanol, hexanol), a branched-chain alcohol (isoamyl alcohol), and an aromatic alcohol (2-phenethyl alcohol). The screening results of FIGS. 3 and 4 show that the mutations of the P348 residue changed the ester production profiles while the ATF1.sub.Sc P348 variants exhibited similar protein expression levels. Specifically, both P348K and P348N almost lost their activities towards butanol, isoamyl alcohol, hexanol, and 2-phenethyl alcohol but remained active towards ethanol. Unlike P348K and P348N, P348M maintained its activity towards 2-phenethyl alcohol while its activities towards ethanol, butanol, isoamyl alcohol, and hexanol were reduced. These results suggest that the P348 residue plays an important role in determining the alcohol substrate preferences of ATF1.sub.Sc.

(72) Still referring to FIG. 3, since P348K and P348N showed dramatic change in their alcohol substrate preference, we compared the 3D structure of ethanol-bound P348K or P348N against its wildtype. Interestingly, the results showed that both P348K and P348N form a hydrogen bond with ethanol residue. This interaction might help the binding of ethanol into the binding pocket of ATF1.sub.Sc while blocking the binding of the bigger alcohol substrates due to the steric hindrance. The results showed that ATF1.sub.Sc wildtype preferred bulky alcohol substrates such as IAA, HA, and PEA.

Working Example 4

(73) The activities of SAAT.sub.Fa against different alcohol substrates was characterized using the procedure of working example 1 and the method disclosed herein. A recombinant E. coli strain carrying the SAAT.sub.Fa was made and characterized using the high-throughput microbial screening method with exogenous supplementation of various alcohols including linear, short-to-medium chain alcohols (ethanol, butanol, hexanol), a branched-chain alcohol (isoamyl alcohol), and an aromatic alcohol (2-phenethyl alcohol). Referring to FIG. 9, the results show that the recombinant E. coli strains carrying the SAAT.sub.Fa produced 11.48.1 mg/L of ethyl acetate (EA), 18.84.6 mg/L of butyl acetate (BA), 17.98.2 mg/L of isoamyl acetate (IAA), 32.16.2 mg/L of hexyl acetate (HA), and 18.10.8 mg/L of PEA (2-phenethyl acetate). The in vivo activity (specific ester productivity, mg/gDCW/h) for each ester produced was calculated and compared to its respective in vitro activity from the literature. Interestingly, except for 2-phenethyl alcohol, the alcohol substrate preference of SAAT.sub.Fa showed a strong linear correlation (R.sup.2=0.996) between the in vivo and in vitro activity.

(74) For 2-phenethyl alcohol, we believe that its high toxicity led to the gap between the in vivo and in vitro experimental results. This demonstrates that the high-throughput microbial screening method disclosed herein enables not only probing the alcohol substrate preference of an AAT, but also examining the effect of the alcohol substrate toxicity on ester productivity which in vitro characterization cannot offer.

Working Example 5: Detectable Concentration Range Limits

(75) Referring to FIG. 10, the detectable concentration range of various esters including ethyl acetate (EA), butyl acetate (BA), isoamyl acetate (IAA), hexyl acetate (HA), and 1-phenethyl acetate (PEA) were examined by generating their standard curves at different concentrations (letter F-Z in the figure). The different concentrations being 0-200 mg/L, 0-500 mg/L, 0-1000 mg/L, and 0-2000 mg/L. The colorimetric assay results show that the standard curve for ester measurement had a strong linear correlation (R.sup.20.989) between the 520 nm absorbance and the standard concentrations in the range of 0200 mg/L. However, as the concentration range increased, the correlation decreased. The correlation was significantly reduced (R.sup.20.752) when the standard concentrations were tested in the range of 02000 mg/L.

(76) Still referring to FIG. 10, the esters showed different detectable concentration ranges (R.sup.20.95) based on their molecular structures. Among the ester standards examined, PEA (aromatic ester) showed the broadest detectable concentration range of 02000 mg/L, followed by BA, IAA, and HA (linear/branched medium-chain ester) with a range of 01000 mg/L. EA (linear short-chain ester) showed the narrowest detectable concentration range of 0500 mg/L. This suggests that the longer or aromatic esters have a broader detectable concentration range in the colorimetric assay than shorter or aliphatic esters. Thus, it is recommended to use the ester standard curves with the standard concentrations in the range of 0200 mg/L to measure the accurate ester concentrations in the samples using the colorimetric assay.

Working Example 6

(77) Strains and Primers: E. coli TOP10 was used for molecular cloning. Referring now to FIG. 12, TCS083 fadE was used as a host strain, except for EcJWBA15 for which TCS095 (DE3) was used. A set of duet vectors including pACYCDuet-1, pETDuet-1, and pRSFDuet-1 were used as plasmid backbones for constructing a library of BA, EB, and BB production modules. The codon-optimized S. cerevisiae ATF1 (ATF1.sub.Sc.sup.opt), cultivated strawberry (F. ananassa) SAAT (SAAT.sub.Fa.sup.opt), Candida boidinii fdh (fdh.sub.Cb.sup.opt), and C. acetobutylicum adhE2 (adhE2.sub.Ca.sup.opt). The list of codon optimized gene sequences are SEQ ID NOS: 30-33.

(78) Culture conditions: For molecular cloning and seed cultures, lysogeny broth (LB) was used. For ester production, TBD.sub.50 medium, terrific broth (TB) with 50 g/L glucose was used (without supplementation with glycerol). For all cultures, 30 g/mL chloramphenicol (Cm), 50 g/mL kanamycin (Kan), and/or 100 g/mL ampicillin (Amp) were added to the medium where applicable.

(79) For seed cultures, 1% (v/v) of stock cells were grown overnight in 5 mL of LB medium with appropriate antibiotics. For ester production in capped conical tubes, seed cultures were prepared as described in seed cultures. About 1% (v/v) of seed cultures were inoculated in 500 mL baffled flasks containing 50 ml of TBD.sub.50 medium with appropriate antibiotics. The cells were acrobically grown in shaking incubators at 28 C. or 37 C., 200 rpm and induced at an O.D..sub.600 of 0.60.8 with various concentrations of IPTG (0.01 mM, 0.1 mM, ands 1.0 mM), arabinose (if applicable), and/or 5 ng/ml of tetracycline (if applicable). After 2 hours of induction, the cultures in the baffled flasks were distributed into 15 mL conical centrifuge tubes (Cat. #339650, Thermo Scientific, MA, USA) with a working volume of 5 mL. Then, each tube was overlaid with 1 mL hexadecane (20% (v/v)) for in situ ester recovery and capped to generate anaerobic conditions. Finally, the tubes were grown for another 18 hours on a 75 angled platform in shaking incubators at 28 C. or 37 C., 200 rpm. The remained cultures in the baffled flasks were induced for further 2 hours and then the cells were harvested for SDS-PAGE analysis.

(80) Anaerobic/pH adjustment: For ester production in strict anaerobic bottles with pH-adjustment, the induced cultures were prepared as described in ester production in conical tubes with a working volume of 100 mL. To generate the anaerobic state, the induced cultures were transferred into anaerobic bottles. Then, each anaerobic bottle was overlaid with 20% (v/v) of hexadecane for in situ ester recovery and sealed with a rubber stopper inside the anaerobic chamber. The headspace of the anaerobic bottles was vacuumed and replaced by an anaerobic mix of 90% N.sub.2, 5% H.sub.2, and 5% CO.sub.2 inside the anaerobic chamber. Finally, the anaerobic bottles were grown for another 90 hours in shaking incubators at 28 C. or 37 C., 200 rpm. The culture medium and hexadecane overlay samples were taken through the rubber stopper via a syringe and needle by maintaining the ratio of 5:1. The culture pH was adjusted to 7 using 10 M NaOH every 24 hours.

(81) Protein expression and SDS-PAGE analysis. The cells were collected from the culture by centrifugation and resuspended in 1PBS (Phosphate Buffered Saline) buffer (pH 7.4) at the final OD.sub.600 of 10. Cell pellets were disrupted using the B-PER complete reagent (Cat. #89822, Thermo Scientific, MA, USA), according to the manufacturer's instruction. Total and soluble fractions were separated by centrifugation for 20 min at 4 C. The resulting samples were mixed with 6SDS (sodium dodecyl sulfate) sample buffer, heated at 95 C. for 5 min, and analyzed by SDS-PAGE (SDS-polyacrylamide gel electrophoresis) using Novex 14% Tris-Glycine protein gels (Cat. #XP00145BOX, Thermo Scientific, MA, USA). Protein bands were visualized with Coomassie Brilliant Blue staining.

(82) Optical density measurements and GC/MS were performed in accordance with working example 1. Metabolites and doped alcohols were quantified by using the Shimadzu high performance liquid chromatography (HPLC) system (Shimadzu Inc., MD, USA) equipped with the Aminex HPX-87H cation exchange column (BioRad Inc., CA, USA) heated at 50 C. A mobile phase of 10 mN H.sub.2SO.sub.4 was used at a flow rate of 0.6 mL/min. Detection was made with the reflective index detector (RID).

Working Example 7: Testing Induction Conditions with the Best Identified Ester Producers, EcJWBA2, EcJWEB2, and EcJWBB2

(83) Two temperatures (28 C. and 37 C.) and three concentrations of the inducer (0.01, 0.1, and 1.0 mM) isopropyl -D-1-thiogalactopyranoside (IPTG) were tested. The results show that the titer of BA, EB, and BB was improved by 1.4, 2.8, and 3.8-fold, respectively. Specifically, for BA production, EcJWBA2 produced 48.07.1 mg/L of BA with the selectivity of 83.1% when it was induced by 0.1 mM of IPTG at 28 C., which is the induction condition used in the trial represented in FIG. 17A. For EB production, EcJWEB2 produced 200.49.4 mg/L of EB with the selectivity of 89.6% when it was induced by 0.1 mM of IPTG at 28 C., which is the induction condition used in the trial represented in FIG. 17B. For BB production, EcJWBB2 produced 127.432.5 mg/L of BB with the selectivity of 34.0% when it was induced by 0.1 mM of IPTG at 37 C. C., which is the induction condition used in the trial represented in FIG. 17C.

Working Example 8: Protein Solubilization Strategies

(84) Since the protein bands of ATF1.sub.Sc and SAAT.sub.Fa are weaker than the other protein bands and these eukaryotic AATs are prone to poor expression in E. coli, Applicant believes that the AAT flux is one of the rate limiting steps and hence improving soluble expression of AATs would enhance the ester production. To examine the effect of AAT solubilization on ester production, we chose three strategies including i) codon optimization; ii) the use of fusion partners such as maltose binding protein without the N-terminus signal sequence, SEQ ID NO: 97 KIKTGARILALSALTTMMFSASALA (MBP), N-utilization substrate A (NusA), or thioredoxin 1 (TrxA); and iii) co-expression of molecular chaperones (DnaK/DnaJ/GrpE, GroES/GroEL, or Trigger factor (Tf)). A schematic representation of these effects on AATs is provided as FIG. 18, evidencing the end result of a properly folded protein.

(85) To test whether AAT is a rate limiting step in isolation, the chassis cell was engineered to harbor only the acyl-CoA and AAT submodules and the alcohols were externally doped into the system. Plasmids were generated that harbor wildtype AATs, codon optimized AATs, fusion partner tagged AATs. For BA production, the plasmids carrying wildtype ATF1.sub.Sc, codon optimized ATF1.sub.Sc (ATF1.sub.Sc.sup.opt), and N-terminus MBP-, NusA-, or TrxA-tagged ATF1.sub.Sc (malE_ATF1.sub.Sc, nusA_ATF1.sub.Sc, or trxA_ATF1.sub.Sc) were constructed and introduced into TCS083 fadE (DE3), resulting in strains EcJWATF1, EcJWATF1.sup.opt, EcJWATF1.sup.MBP, EcJWATF1.sup.NusA, EcJWATF1.sup.TrxA, respectively (FIG. 12, second page). For EB and BB production, the plasmids carrying wildtype SAAT (SAAT.sub.Fa), codon optimize SAAT.sub.Fa (SAAT.sub.Fa.sup.opt), and N-terminus MBP-, NusA-, or TrxA-tagged SAAT.sub.Fa (malE_SAAT.sub.Fa; nusA_SAAT.sub.Fa; or trxA_SAAT.sub.Fa) were constructed and introduced into TCS083 fadE (DE3) with the pACYCDuet-1 carrying the SM1 (butyryl-CoA pathway), resulting instrains EcJWSAAT, EcJWSAAT.sup.opt, EcJWSAAT.sup.MBP, EcJWSAAT.sup.NusA, EcJWSAAT.sup.TrxA, respectively (FIG. 12, second page). Then as shown in FIG. 13, to co-express chaperones with AATs, the chaperone plasmid set comprising of five different plasmids carrying various chaperones were introduced into EcJWATF1 and EcJWSAAT, resulting in EcJWATF1.sup.Chp1EcJWATF1.sup.Chp5 and EcJWSAAT.sup.Chp1EcJWSAAT.sup.Chp5.

(86) The above engineered strains were placed in conical tubes with 2 g/L of alcohol doping including ethanol and butanol to evaluate the conversion of an alcohol (ethanol/butanol) into an ester (EA/BA) by ATF1.sub.Sc (FIG. 19) or EB/BB by SAAT.sub.Fa (FIG. 20), respectively. The cultures were induced by 0.1 mM of IPTG, 0.5 mg/ml of L-arabinose (if applicable) and/or 5 ng/ml of tetracycline (if applicable), and the protein expressions were confirmed by SDS-PAGE analysis. Still referring to FIGS. 19 and 20, the characterization results show that the protein solubilization strategies enhanced the conversion of an alcohol into an ester. Interestingly, different protein solubilization strategies worked effectively for different AATs. In particular, the codon optimization and use of a fusion partner (i.e., MBP, NusA, or TrxA) for ATF1.sub.Sc improved the BA conversion while co-expression of chaperones (i.e., GroES/EL, GroES/EL/Tf, or DnaK/DnaJ/GrpE/GroES/EL) with SAAT.sub.Fa enhanced the EB/BB conversion.

(87) FIG. 19 shows that, for BA conversion, EcJWATF1.sup.opt, EcJWATF1.sup.MBP EcJWATF1.sup.NusA, EcJWATF1.sup.TrxA achieved 85.9%, 74.6%, 79.5%, and 86.6% of BA conversion, resulting in 7.1, 6.2, 6.6, and 7.2-fold improvement as compared to EcJWATF1 (12.0%), respectively. With 2 g/L butanol doping, the BA production could reach up to 2.260.22 g/L, and the selectivity of BA over other esters was as high as 98.1%.

(88) FIG. 20 shows that, for EB production, EB production was less prominent, only reaching up to 0.460.09 g/L with a selectivity of 86.3%. EcJWSAAT.sup.Chp2, EcJWSAAT.sup.Chp3, and EcJWSAAT.sup.Chp5 achieved 2.6%, 1.5%, and 2.0% of EB conversion, leading to 8.5, 4.7, and 6.4-fold improvement as compared to EcJWSAAT (0.3%), respectively.

(89) The metabolic burden in protein expressions and different catalytic efficiency between SAAT.sub.Fa and ATF1.sub.Sc likely contributed to the differences in strain performance. Still referring to FIG. 20, the BB production was reasonably high, reaching up to 1.710.26 g/L with a selectivity of 79.2%. EcJWSAAT.sup.Chp2, EcJWSAAT.sup.Chp3, and EcJWSAAT.sup.Chp5 achieved 36.8%, 19.1%, and 11.9% of BB conversion, resulting in 9.0, 4.7, and 2.9-fold improvement as compared to EcJWSAAT (4.1%), respectively. Even though ATF1.sub.Sc and SAAT.sub.Fa have specificity towards longer-chain alcohols and acyl-CoAs, respectively, EA appeared as a minor byproduct. Referring again to FIG. 20, for the EA conversion, EcJWATF1.sup.opt, EcJWATF1.sup.MBP, EcJWATF1.sup.NusA, EcJWATF1.sup.TrxA achieved 2.3%, 1.0%, 1.3%, and 1.3% of EA conversion, resulting in 20.5, 9.0, 11.7, and 11.8-fold improvement as compared to EcJWATF1 (0.1%), respectively. From the data, it can be concluded that AAT solubilization plays a critical role in controlling ester production and selectivity.

Working Example 9: AAT Solubilization and Ester Microbial Biosynthesis from Glucose

(90) Various BA, EB, and BB-producing strains were constructed and characterized using the techniques disclosed herein. For BA production, we first built four pRSFDuet-1 plasmids carrying SM2 (adhE2.sub.Ca)-SM3 (fdh.sup.opt)-SM4 (ATF1.sub.Sc.sup.opt, malE_ATF1.sub.Sc.sup.opt, nusA_ATF1.sub.Sc.sup.opt, or trxA_ATF1.sub.Sc.sup.opt), respectively, and then introduced them into the chassis cell TCS083 fadE (DE3) with the pACYCDuet-1 plasmid carrying the SM1 (butyryl-CoA pathway) to generate EcJWBA7EcJWBA10, respectively (FIG. 12). For EB/BB production, we additionally introduced the plasmid carrying groES and groEL into EcJWEB2 and EcJWBB2, resulting in EcJWEB7 and EcJWBB7, respectively (FIG. 12). We characterized the engineered ester production strains in conical tubes for the endogenous ester production from glucose. For the expression of chaperones in EcJWEB2 and EcJWBB2, we also tested three different concentrations of L-arabinose as an inducer.

(91) The characterization results show that the ATF1.sub.Sc solubilization indeed enhanced the endogenous BA production. Referring to FIG. 17A, EcJWBA7 to EcJWBA10 produced 51.77.1 mg/L, 79.39.8 mg/L, 76.16.2 mg/L, and 89.514.8 mg/L of BA, resulting in 1.1, 1.7, 1.6, and 1.9-fold improved BA production as compared to the EcJWBA2 (48.07.1 mg/L), respectively. Notably, because EcJWBA8 to 10 expressing ATF1.sub.Sc.sup.opt with N-terminus fusion partner such as MBP, NusA, and TrxA achieved higher BA production than that of EcJWBA7 expressing ATF1.sub.Sc.sup.opt alone, we could confirm that there is a synergistic effect between codon optimization and the use of a fusion partner in BA production with ATF1.sub.Sc. Also, chaperone expression negatively affected the endogenous BB production. Similarly, improvement in the endogenous EB production occurred too. Referring to FIG. 17B, when the cell cultures were induced by 0 mg/ml, 0.1 mg/ml, 0.5 mg/ml and 5.0 mg/ml of L-arabinose, respectively, EcJWEB7 produced 263.951.8 mg/L, 337.646.1 mg/L, 365.769.2 mg/L, and 346.259.8 mg/L of EB, resulting in 1.3, 1.7, 1.8, and 1.7-fold improved EB production as compared to EcJWEB2 (200.49.4 mg/L. Referring to FIG. 17C, when the cultures were induced by 0 mg/ml, 0.1 mg/ml, 0.5 mg/ml and 5.0 mg/ml of L-arabinose, respectively, EcJWBB7 produced 25.610.7 mg/L, 30.04.8 mg/L, 51.43.4 mg/L, and 42.14.1 mg/L of BB, achieving 0.2, 0.2, 0.4, and 0.3-fold decreased BB production as compared to EcJWBB2 (127.432.5 mg/L). Overall, the AAT solubilization plays an important role for the de novo microbial biosynthesis of designer esters.

Working Example 10: Co-Solubilization of AdhE2.SUB.Ca .and AAT

(92) Due to the low residual butanol in our BA/BB production experiments, we hypothesized that the low availability of butanol, one of the intermediates for butyl esters synthesis, might have affected the endogenous production of BB and EB. The bi-functional aldehyde/alcohol dehydrogenase AdhE2.sub.Ca is known for its critical role in butanol production, and its low solubility can significantly reduce in vivo activities as compared to the in vitro activities. We tested whether the co-solubilization of AdhE2.sub.Ca and AAT improved the de novo microbial biosynthesis of BA/BB by alleviating the limitation of butanol.

(93) For BA production, we first constructed four pRSFDuet-1 plasmids carrying SM2 (adhE2.sub.Ca.sup.opt, malE_adhE2.sub.Ca.sup.opt, nusA_adhE2.sub.Ca.sup.opt, or trxA_adhE2.sub.Ca.sup.opt)-SM3 (fdh.sup.opt)-SM4 (trxA_ATF1.sub.Sc.sup.opt), respectively (FIG. 12) and introduced them into the chassis cell TCS083 fadE (DE3) with the pACYCDuet-1 plasmid carrying the SM1 (butyryl-CoA pathway) to generate EcJWBA11EcJWBA14, respectively (FIG. 12). Next, we characterized these strains in conical tubes for BA production. The expression of the pathway enzymes was confirmed by SDS-PAGE analysis. Referring to FIG. 17A, the results show EcJWBA11 to EcJWBA14 produced 80.39.0 mg/L, 54.24.9 mg/L, 82.815.5 mg/L, and 203.05.7 mg/L of BA, respectively. Remarkably, EcJWBA14 achieved 2.3-fold improved BA production (203.05.7 mg/L) as compared to EcJWBA10 (89.514.8 mg/L), indicating that solubilization of pathway enzymes using a fusion partner can be a simple, but useful in metabolic engineering.

(94) Nest, the use of TrxA fusion partner with AdhE2.sub.Ca.sup.opt was investigated with respect to improved BB production. We constructed the pRSFDuet-1 plasmid carrying SM2 (trxA_adhE2.sub.Ca.sup.opt)-SM3 (fdh.sup.opt)-SM4 (SAAT.sub.Fa) and introduced it into the chassis cell TCS083 fadE (DE3) with the pACYCDuet-1 plasmid carrying the SM1 (butyryl-CoA pathway) to generate EcJWBB8 (FIG. 12). By characterizing EcJWBB8 in conical tubes, the results show that EcJWBB8 achieved 1.3-fold improved BB production (167.318.2 mg/L) as compared to EcJWBB2 (127.432.5 mg/L) (FIG. 17C). Notably, EcJWBB8 achieved about 1.5-fold improved BB selectivity (50.6%) as compared to EcJWBB2 (34.0%), resulting in about 1.7-fold improved butanol/ethanol ratio (g/g of butanol to ethanol) (from 0.04 to 0.07) and about 0.6-fold reduced EB production (from 246.272.6 mg/L to 156.322.4 mg/L). This result suggests that there is a substrate competition between ethanol and butanol in the enzymatic reaction of ATF1.sub.Sc, which can be alleviated by either engineering AATs with alcohol substrate preference or tuning the selective alcohol production. Overall, the results highlight the combinational solubilization of multiple pathway enzymes (such as, AdhE and AAT enzymes) is feasible to alleviate the enzyme expression of a large, complex metabolic pathway.

Working Example 11: Anaerobic Conditions

(95) Although BA and BB production were improved via co-solubilization of AdhE2.sub.Ca and AAT, residual butanol titer was still lower than desired. Given that the abundant alcohol production is important for ester synthesis due to the high KM value of AATs, butanol production needs to be further improved for higher production of butyl esters. Because strict anaerobic conditions are important for alcohol production, we characterized the final strains, EcJWBA14, EcJWEB7, and EcJWBB8, in anaerobic bottles with pH adjustment to evaluate their performance in production of C4-dereived esters. The culture pH was adjusted to around 7 with 10 M NaOH every 24 hours to maintain the optimum growth pH of E. coli.

(96) With reference to FIGS. 17A-17C, the characterization results of EcJWBA14, EcJWEB7, EcJWBB8 showed 12.9, 5.8, and 13.4-fold improvement in titers, 4.8, 3.7, and 4.6-fold improvement in yields, and 6.5, 1.4, and 3.4-fold improvement in productivity as compared to the initial strains, EcJWBA2, EcJWEB2, and EcJWBB2, respectively. Specifically, EcJWBA14 produced 441.440.9 mg/L of BA (9.2% of maximum theoretical yield) with 91.7% of selectivity, EcJWEB7 produced 408.944.3 mg/L of EB (8.5% of maximum theoretical yield) with 85.5% of selectivity, and EcJWBB8 produced 449.643.0 mg/L of BB (10.0% of maximum theoretical yield) with 53.5% of selectivity. In comparison with the direct fermentative production of butyryl-CoA-derived esters by E. coli in previous studies, EcJWBA14 achieved 882.8, 1839.0, and 3937.0-fold improved titer, productivity, and yield (TRY) in BA production, EcJWEB7 achieved 3.1, 3.1, and 11.0-fold improved TRY in EB production, and EcJWBB8 achieved 12.2, 12.2, and 44.1-fold improved TRY in BB production.

Working Example 12: Endogenous AdhE-Deficient Chassis

(97) The modular cell TCS083 fadE (DE3) is designed to be auxotrophic and required to metabolically couple with a butyryl-CoA-derived ester module. The promiscuity of endogenous alcohol dehydrogenases might interfere with the butyryl-CoA-derived ester modules, competing for ester biosynthesis because the endogenous bifunctional aldehyde/alcohol dehydrogenase adhE favors the formation of ethanol over butanol. To remove the endogenous adhE, TCS083 fadE (DE3) was replaced with TCS095 (DE3), an adhE-deficient chassis cell, and generated EcJWBA15 (FIG. 12). With reference to FIG. 17A, the characterization results of EcJWBA15 in conical tubes showed that EcJWBA15 achieved higher BA production than EcJWBA14 by 1.28-fold with a titer of 259.511.6 mg/L and a selectivity of 94.8%. Still referring to FIG. 17A, in addition, by characterizing EcJWBA15 in anaerobic bottles with a pH of 7, 636.344.8 mg/L of BA (23.0% of maximum theoretical yield) with a high selectivity (95.7%) was produced.

(98) TABLE-US-00001 TABLE 1 Enzyme Accession Number (UniProt) AtoB.sub.Ec P76461 Hbd.sub.Ca P52041 Crt.sub.Ca P52046 Ter.sub.Td Q73Q47 AdhE2.sub.Ca Q9ANR5 Pdc.sub.Zm P06672 AdhB.sub.Zm P0DJA2 Fdh.sub.Cb.sup.opt O13437 ATF1.sub.Sc P40353 SAAT.sub.Fa Q9FVF1 MBP P0AEX9 NusA P0AFF6 TrxA P0AA25 Tf P0A850 DnaK P0A6Y8 DnaJ P08622 GrpE P09372 GroES P0A6F9 GroEL P0A6F5

(99) As used herein, amino acid or amino acid residue or residue refers to any naturally occurring amino acid, any non-naturally occurring amino acid, any modified including derivatized amino acid, or any amino acid mimetic known in the art. The amino acid may be referred by both their common three-letter abbreviation and single letter abbreviation. In certain example embodiments, the modified proteins can be about 80%, 85%, 90%, 95%, 98% or more sequence identity to any one of SEQ ID NOS in copending U.S. application Ser. No. 17/453,305 or SEQ ID NOS: 1-97 herein. That is, the modified protein, although having an amino acid sequence at least partially or fully identical to those previously referenced, retains a mutated amino acid substitution. In certain example embodiments, the modified CAT protein is a functional fragment of any one of SEQ ID NOS: in the '305 copending application, the sequence of the fragment corresponding to one or more regions of the otherwise full-length amino acid sequences while retaining any of the particular modifications described herein. In certain example embodiments, the functional fragment including the Y20F substitution has 80%, 85%, 90%, 95%, 98% or more sequence identity to one or more regions of the full-length sequence set forth as any one of SEQ ID NOS: in the '305 copending application.

(100) In certain example embodiments, one or more of the amino acids forming all or a part of the modified CAT proteins or functional fragments thereof can be stereoisomers. That is, any one or more of the amino acids of the modified CAT protein or functional fragments thereof can be a D- or L-amino acid. And in certain example embodiments, the modified CAT proteins or functional fragments thereof can also include one or more modified amino acids. The modified amino acid may be a derivatized amino acid or a modified and unusual amino acid. Examples of modified and unusual amino acids include but are not limited to, 2-Aminoadipic acid (Aad), 3-Aminoadipic acid (Baad), -Amino-propionic acid (Bala, -alanine), 2-Aminobutyric acid (Abu, piperidinic acid), 4-Aminobutyric acid (4Abu), 6-Aminocaproic acid (Acp), 2-Aminoheptanoic acid (Ahe), 2-Aminoisobutyric acid (Aib), 3-Aminoisobutyric acid (Baib), 2-Aminopimelic acid (Apm), 2,4-Diaminobutyric acid (Dbu), Desmosine (Des), 2,2-Diaminopimelic acid (Dpm), 2,3-Diaminopropionic acid (Dpr), N-Ethylglycine (EtGly), N-Ethylasparagine (EtAsn), Hydroxylysine (Hyl), allo-Hydroxylysine (Ahyl), 3-Hydroxyproline (3Hyp), 4-Hydroxyproline (4Hyp), Isodesmosine (Ide), allo-Isoleucine (Alle), N-Methylglycine (MeGly, sarcosine), N-Methylisoleucine (Melle), 6-N-Methyllysine (MeLys), N-Methylvaline (MeVal), Norvaline (Nva), Norleucine (Nle), and Ornithine (Orn). Other examples of modified and unusual amino acids are described generally in Synthetic Peptides: A User's Guide, Second Edition, April 2002, Edited Gregory A. Grant, Oxford University Press; Hruby V J, Al-obeidi F and Kazmierski W: Biochem J 268:249-262, 1990; and Toniolo C: Int J Peptide Protein Res 35:287-300, 1990; the teachings of all of which are expressly incorporated herein by reference. In certain example embodiments, the modified CAT protein or functional fragments thereof can be detectably labeled with a known label, such as a fluorescent or radioactive label.

(101) In one aspect, the modified CATs can be CATaa Y20F, CATaa Y20F F97W, CATsa Y20F A138T, CATsa Y20F F97W A138T, CATec3 Y20F, or CATec3 F97W Y20F.

(102) The feeding of any substance to a selected microorganism can include a mixture of sugars, a mixture of alcohols, a mixture of cellulosic materials, a mixture of carboxylic acids, and blends of any such mixtures to produce a plurality of esters. The mixtures, especially of the alcohols and/or carboxylic acids are preselected and have a preselected concentration for each alcohol or carboxylic acid to produce a preselected ester profile.

(103) It should be noted that the embodiments are not limited in their application or use to the details of construction and arrangement of parts and steps illustrated in the drawings and description. Features of the illustrative embodiments and variants may be implemented or incorporated in other embodiments, variants, and modifications, and may be practiced or carried out in various ways. Furthermore, unless otherwise indicated, the terms and expressions employed herein have been chosen for the purpose of describing the illustrative embodiments of the present invention for the convenience of the reader and are not for the purpose of limiting the invention. Having described the invention in detail and by reference to preferred embodiments thereof, it will be apparent that modifications and variations are possible without departing from the scope of the invention which is defined in the appended claims.

(104) TABLE-US-00002 Primers Primersequence(5to3) PrimersforconstructingthepATF1.sub.ScbyGibsonassembly SEQIDNO:1 ATF1.sub.Sc_fwd ATAATTTTGTTTAACTTTAAGAAGGAGATATAGATATGAATGAAATCGATGAGAAAAAT SEQIDNO:2 ATF1.sub.Sc_rev TTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGATAGGGCCTAAAAGGAGAG SEQIDNO:3 BB_ATF1.sub.Sc_fwd ATCCACCACCACCACC SEQIDNO:4 BB_ATF1.sub.Sc_rev ATCTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAG PrimersforconstructingthepATF1.sub.Scvariantsbysite-directed mutagenesisusingtheQuickChangesite-directedmutagenesiskit SEQIDNO:5 P348Wfwd ATTTTTATCTGGGCAGATTGCCGCTCACAACTA SEQIDNO:6 P348Wrev GGCAATCTGCCCAGATAAAAATATCCGTAAGCC SEQIDNO:7 P348R_fwd ATTTTTATCCGTGCAGATTGCCGCTCACAACTA SEQIDNO:8 P348R_rev GGCAATCTGCACGGATAAAAATATCCGTAAGCC SEQIDNO:9 P348M_fwd ATTTTTATCATGGCAGATTGCCGCTCACAACTA SEQIDNO:10 P348M_rev GGCAATCTGCCATGATAAAAATATCCGTAAGCC SEQIDNO:11 P348H_fwd ATTTTTATCCATGCAGATTGCCGCTCACAACTA SEQIDNO:12 P348H_rev GGCAATCTGCATGGATAAAAATATCCGTAAGCC SEQIDNO:13 P348K_fwd ATTTTTATCAAAGCAGATTGCCGCTCACAACTA SEQIDNO:14 P348K_rev GGCAATCTGCTTTGATAAAAATATCCGTAAGCC SEQIDNO:15 P348N_fwd ATTTTTATCAATGCAGATTGCCGCTCACAACTA SEQIDNO:16 P348N_rev GGCAATCTGCATTGATAAAAATATCCGTAAGCC SEQIDNO:17 P348I_fwd ATTTTTATCATTGCAGATTGCCGCTCACAACTA SEQIDNO:18 P348I_rev GGCAATCTGCAATGATAAAAATATCCGTAAGCC SEQIDNO:19 P348S_fwd ATTTTTATCACAGCAGATTGCCGCTCACAACTA SEQIDNO:20 P348S_rev GGCAATCTGCTGTGATAAAAATATCCGTAAGCC SEQIDNO:21 P348D_fwd ATTTTTATCGATGCAGATTGCCGCTCACAACTA SEQIDNO:22 P348D_rev GGCAATCTGCATCGATAAAAATATCCGTAAGCC SEQIDNO:23 P348C_fwd ATTTTTATCTGCGCAGATTGCCGCTCACAACTA SEQIDNO:24 P348C_rev GGCAATCTGCGCAGATAAAAATATCCGTAAGCC SEQIDNO:25 P348A_fwd ATTTTTATCGCTGCAGATTGCCGCTCACAACTA SEQIDNO:26 P348A_rev GGCAATCTGCAGCGATAAAAATATCCGTAAGCC SEQIDNO:27 P348Q_fwd ATTTTTATCCAGGCAGATTGCCGCTCACAACTA SEQIDNO:28 P348Q_rev GGCAATCTGCCTGGATAAAAATATCCGTAAGCC GENE SEQUENCE SEQID SAAT.sub.Fa ATGGAAAAAATCGAAGTCTCAATTAACTCCAAGCATACCATCAAACCCTCTACCTCTAGTACCCCGCTACAACCCTATAA NO:29 ACTGACCTTACTGGATCAGCTGACGCCACCAGCCTATGTCCCGATCGTGTTTTTTTACCCGATCACCGATCACGATTTTA ATCTGCCGCAGACGCTGGCGGACTTACGTCAAGCTCTGTCGGAGACTCTCACGCTGTATTATCCCCTGAGCGGACGTGT TAAAAACAATTTGTATATTGATGACTTTGAGGAAGGCGTGCCGTACTTAGAAGCGCGTGTAAATTGCGATATGACCGA TTTTCTGCGTCTGCGCAAAATTGAGTGCCTGAACGAATTTGTACCGATTAAACCTTTCAGTATGGAAGCAATTAGCGAT GAACGTTACCCGTTGCTGGGCGTCCAGGTTAATGTTTTTGATTCGGGCATCGCGATCGGAGTGTCAGTCAGTCATAAAT TGATAGATGGTGGCACGGCAGATTGTTTCCTTAAATCTTGGGGCGCCGTGTTTCGTGGCTGCCGTGAAAATATTATCCA CCCGAGTCTGAGTGAGGCTGCGCTGTTGTTCCCCCCACGCGATGACCTGCCAGAAAAATACGTTGACCAAATGGAGGC CCTGTGGTTTGCGGGGAAAAAAGTCGCCACCCGACGCTTTGTTTTCGGTGTGAAAGCGATTAGCAGCATTCAAGACGA AGCAAAATCTGAGAGCGTCCCAAAACCGTCTCGCGTTCATGCCGTGACAGGCTTCTTATGGAAGCACCTGATAGCTGC GTCCCGCGCATTGACAAGTGGGACTACATCGACCCGTCTGTCAATTGCCGCGCAAGCAGTAAACCTGCGTACTCGCAT GAACATGGAAACCGTTTTAGATAACGCTACGGGTAACCTGTTCTGGTGGGCCCAGGCGATCCTAGAACTGTCGCATAC CACCCCGGAGATTTCTGACCTTAAACTGTGTGATCTGGTTAACTTGCTGAACGGATCCGTCAAGCAGTGCAATGGCGAC TATTTCGAGACCTTTAAAGGTAAAGAAGGCTATGGCCGGATGTGTGAATACTTGGATTTCCAGCGAACAATGTCGTCC ATGGAACCGGCTCCGGACATTTATCTGTTTTCATCCTGGACTAACTTTTTTAACCCGTTGGATTTCGGCTGGGGCCGCAC CTCCTGGATTGGAGTTGCAGGTAAAATTGAGAGTGCGTCCTGCAAATTTATAATCCTCGTGCCCACACAGTGCGGTTCG GGTATCGAGGCCTGGGTCAACTTGGAGGAAGAAAAAATGGCCATGCTCGAACAGGATCCGCATTTTCTAGCGCTGGC GTCACCTAAAACCCTGATC SEQID ATF1.sub.Sc.sup.opt ATGAACGAAATCGACGAAAAAAATCAGGCGCCAGTTCAGCAGGAGTGTCTGAAAGAAATGATTCAAAATGGTCATGCGCG NO:30 TAGAATGGGTTCAGTGGAGGATTTGTACGTTGCGCTGAATCGCCAAAACCTTTACCGTAACTTTTGCACGTATGGTGAGCT GTCAGATTACTGCACTCGTGATCAGTTGACGCTGGCGCTCCGTGAAATCTGCTTAAAAAACCCGACTCTTCTGCATATTGTG TTACCGACGCGCTGGCCGAACCACGAAAACTATTATAGAAGCAGTGAATATTACAGCCGTCCTCACCCTGTGCACGACTAC ATATCGGTCTTACAGGAATTAAAGCTGTCGGGCGTGGTGTTGAATGAACAACCTGAATACTCAGCGGTTATGAAACAGATT CTGGAAGAATTCAAAAATAGCAAGGGCAGCTATACGGCTAAGATCTTTAAACTTACCACCACCCTGACAATCCCATACTTCG GCCCCACAGGCCCATCTTGGCGCTTGATTTGTTTGCCCGAAGAGCACACTGAAAAATGGAAGAAATTCATATTTGTGAGCA ATCATTGCATGTCAGATGGCCGCTCCTCCATTCATTTCTTCCACGATCTGCGTGACGAACTTAACAATATTAAAACTCCGCCG AAGAAGCTAGATTACATCnCAAATACGAAGAAGACTACCAGCTGCTGCGTAAACTGCCGGAGCCGATCGAAAAAGTGATT GATTTTCGTCCGCCGTATCTTTTTATTCCTAAATCCCTCTTATCGGGATTTATATACAATCACCTTCGATTTTCATCAAAAGGG GTATGTATGCGCATGGATGATGTGGAAAAGACGGACGACGTCGTTACCGAAATCATTAATATTAGCCCGACTGAATTTCAA GCGATAAAAGCAAACATCAAATCGAACATCCAGGGCAAATGTACCATTACTCCCTTTCTCCATGTTTGTTGGTTCGTGTCTCT GCATAAATGGGGCAAGTTCTTTAAACCTCTGAACTTTGAATGGCTGACTGATATTTTCATCCCTGCGGACTGCCGCTCTCAG TTGCCTGATGACGATGAAATGCGCCAGATGTACCGGTATGGTGCGAATGTGGGCTTCATTGACTTCACTCCGTGGATCAGC GAATTTGACATGAATGATAACAAAGAAAATTTTTGGCCACTGATTGAGCACTATCATGAGGTGATCAGTGAGGCGCTTCGT AACAAAAAACATCTGCATGGTTTGGGTTTCAACATTCAGGGTTTCGTACAAAAGTACGTGAACATAGATAAAGTCATGTGT GACCGGGCTAHGGTAAACGTCGTGGCGGTACTCTACTCAGCAATGnGGTCTGTTCAATCAACTTGAAGAACCTGACGCC AAATATTCTATTTGCGACTTAGCTTTTGGCCAATTCCAGGGCAGCTGGCACCAGGCTTTTAGTCTCGGTGTGTGCTCTACGA ATGTTAAAGGTATGAATATCGTCGTCGCGTCGACAAAAAACGTCGTAGGTTCACAGGAGTCCCTGGAAGAGCTTTGTAGCA TATATAAAGCTTTGTTACTGGGTCCG SEQID SAAT.sub.Fa.sup.opt ATGGAAAAAATCGAAGTCTCAATTAACTCCAAGCATACCATCAACCCTCTACCTCTAGTACCCCGCTACAACCCTATAAACT NO:31 GACCTTACTGGATCAGCTGACGCCACCAGCCTATGTCCCGATCGTGTTTTTTTACCCGATCACCGATCACGATTTTAATCTGC CGCAGACGCTGGCGGACTTACGTCAAGCTCTGTCGGAGACTCTCACGCTGTATTATCCCCTGAGCGGACGTGTTAAAAACA ATTTGTATATTGATGACTTTGAGGAAGGCGTGCCGTACTTAGAAGCGCGTGTAAATTGCGATATGACCGATTTTCTGCGTCT GCGCAAAATTGAGTGCCTGAACGAATTTGTACCGATTAAACCTTTCAGTATGGAAGCAATTAGCGATGAACGTTACCCGTT GCTGGGCGTCCAGGTTAATGTTTTTGATTCGGGCATCGCGATCGGAGTGTCAGTCAGTCATAAATTGATAGATGGTGGCAC GGCAGATTGTTTCCTTAAATCTTGGGGCGCCGTGTTTCGTGGCTGCCGTGAAAATATTATCCACCCGAGTCTGAGTGAGGCT GCGCTGTTGTTCCCCCCACGCGATGACCTGCCAGAAAAATACGTTGACCAAATGGAGGCCCTGTGGTTTGCGGGGAAAAA AGTCGCCACCCGACGCTTTGTTTTCGGTGTGAAAGCGATTAGCAGCATTCAAGACGAAGCAAAATCTGAGAGCGTCCCAAA ACCGTCTCGCGTTCATGCCGTGACAGGCTTCTTATGGAAGCACCTGATAGCTGCGTCCCGCGCATTGACAAGTGGGACTAC ATCGACCCGTCTGTCAATTGCCGCGCAAGCAGTAAACCTGCGTACTCGCATGAACATGGAAACCGTTTTAGATAACGCTAC GGGTAACCTGTTCTGGTGGGCCCAGGCGATCCTAGAACTGTCGCATACCACCCCGGAGATTTCTGACCTTAAACTGTGTGA TCTGGTTAACTTGCTGAACGGATCCGTCAAGCAGTGCAATGGCGACTATTTCGAGACCTTTAAAGGTAAAGAAGGCTATGG CCGGATGTGTGAATACTTGGATTTCCAGCGAACAATGTCGTCCATGGAACCGGCTCCGGACATTTATCTGTTTTCATCCTGG ACTAACTTTTTTAACCCGTTGGATTTCGGCTGGGGCCGCACCTCCTGGATTGGAGTTGCAGGTAAAATTGAGAGTGCGTCCT GCAAATTTATAATCCTCGTGCCCACACAGTGCGGTTCGGGTATCGAGGCCTGGGTCAACTTGGAGGAAGAAAAAATGGCC ATGCTCGAACAGGATCCGCATTTTCTAGCGCTGGCGTCACCTAAAACCCTGATC SEQID adhE2.sub.Ca.sup.opt ATGAAAGTGACCAATCAAAAAGAGCTGAAACAGAAACTGAACGAACTTCGTGAAGCGCAAAAAAAATTCGCAACCTACAC NO:32 GCAGGAGCAGGTGGATAAAATTTTCAAGCAGTGTGCGATTGCGGCGGCGAAAGAGCGGATTAACCTGGCGAAGCTGGCG GTGGAAGAAACCGGGATTGGGCTGGTGGAGGACAAAATCATCAAGAACCATTTTGCCGCGGAATACATTTATAACAAGTA CAAAAACGAAAAGACGTGTGGTATTATTGATCACGATGACTCCCTGGGCATCACGAAGGTGGCAGAACCGATCGGTATCG TCGCTGCGATCGTTCCGACGACCAATCCCACGTCAACGGCGATCTTTAAAAGTTTGATTAGCCTGAAAACTCGTAACGCCAT CTTCTTTTCCCCCCACCCCCGTGCGAAAAAGAGCACCATCGCGGCCGCGAAACTTATCTTGGATGCTGCCGTGAAGGCGGG GGCCCCGAAGAACATCATTGGCTGGATCGACGAGCCGTCAATTGAGCTCAGCCAAGACCTGATGAGCGAAGCGGATATTA TTCTGGCGACAGGCGGTCCGAGCATGGTTAAAGCGGCCTACTCGTCTGGCAAACCAGCCATTGGTGTTGGAGCCGGCAAC ACTCCGGCAATTATTGATGAGAGCGCCGATATCGATATGGCGGTTAGTAGCATCATCCTGTCTAAAACCTACGACAATGGT GTGATCTGCGCGAGCGAACAAAGTATTCTCGTCATGAACTCTATCTATGAAAAGGTGAAAGAAGAGTTTGTGAAGCGTGG TAGCTATATCCTGAACCAGAACGAAATTGCCAAAATCAAAGAAACAATGTTTAAGAATGGAGCTATCAATGCCGATATCGT TGGTAAAAGTGCCTATATTATCGCGAAAATGGCTGGCATCGAAGTCCCGCAAACTACCAAAATTTTAATTGGTGAGGTTCA GAGCGTGGAAAAATCGGAGTTGTTTTCCCACGAAAAACTGTCGCCGGTATTAGCAATGTATAAAGTAAAAGATTTTGACGA AGCCCTGAAAAAGGCCCAGCGCTTAATTGAATTAGGCGGCTCTGGTCATACCTCATCGCTGTACATCGATAGCCAGAACAA TAAAGATAAAGTTAAAGAATTTGGCCTGGCCATGAAGACAAGTCGCACGTTTATCAATATGCCTTCAAGCCAGGGCGCCTC GGGTGATCTTTATAATTTTGCAATCGCGCCGAGCTTCACTCTGGGTTGTGGGACGTGGGGTGGCAATAGCGTCTCACAGAA TGTCGAACCGAAGCATnACTGAACATCAAATCAGTCGCGGAACGCCGTGAAAACATGCTGTGGHCAAAGTGCCGCAAAA AATCTATTTCAAGTATGGTTGCCTGCGATTCGCACTGAAGGAACTGAAAGATATGAACAAAAAACGTGCGTTTATTGTTACC GATAAGGACCTGTTTAAACTGGGCTATGTGAACAAAATTACTAAAGTTCTGGATGAAATTGATATTAAATACTCGATCTTCA CCGATATTAAAAGTGACCCTACGATCGATAGCGTGAAAAAAGGCGCGAAAGAAATGCTTAACTTTGAACCGGATACCATTA TCAGTATTGGGGGTGGTTCTCCGATGGATGCGGCCAAAGTTATGCATCTGTTGTATGAGTATCCGGAAGCCGAGATTGAGA ACCTGGCTATCAATTTTATGGACATCCGAAAGCGGATCTGCAACTTCCCAAAGirAGGTACGAAAGCCATTAGCGTAGCCAT TCCTACCACCGCGGGTACCGGTAGTGAGGCCACGCCGTTCGCGGTGATTACCAATGATGAGACCGGTATGAAATACCCGTT GACCAGCTATGAATTAACACCAAACATGGCAATTATCGATACGGAACTGATGCTGAACATGCCTCGTAAACTTACAGCGGC GACTGGGATTGATGCCCTGGTTCACGCGATTGAAGCATACGTGAGTGTGATGGCAACCGATTATACCGATGAGCTGGCCCT GCGCGCTATCAAAATGATCTTCAAATATCTGCCGCGTGCCTACAAAAACGGCACCAATGATATCGAAGCTCGAGAAAAAAT GGCGCATGCCTCAAACATCGCAGGGATGGCATTCGCGAACGCGTTTCTGGGCGTGTGCCACTCTATGGCACACAAACTGG GTGCGATGCACCATGTGCCACACGGCATTGCATGTGCTGTGTTAATTGAAGAAGTTATTAAATATAATGCGACCGACTGCC CAACCAAACAAACCGCGTTTCCGCAATACAAAAGCCCGAATGCTAAGCGTAAATACGCTGAAATTGCGGAATATCTGAATC TGAAAGGCACCTCTGATACCGAGAAAGTGACCGCCCTGATTGAAGCTATCTCTAAGTTAAAAATTGATCTGAGCATCCCGC AGAACATCTCGGCAGCTGGGATCAATAAAAAAGATTTALAATACCTTGGATAAAATGTCTGAACTCGCGTTCGACGATC AATGCACAACCGCCAACCCACGCTATCCGCTGATCTCCGAACTCAAAGACATTTACATAAAGAGTTTC SEQID fdh.sub.Cb.sup.opt ATGAAAATTGTGCTGGTTTTGTATGATGCGGGAAAGCATGCGGCGGACGAAGAAAAGCTTTATGGGTGTACCGAAA NO:33 ACAAACTGGGCATTGCTAACTGGCTGAAAGACCAGGGTCATGAACTLATTACCACGAGCGATAAAGAAGGCAAACC TCCGAATTAGACAAGCATATTCCGGATGCGGACATTATTATCACCACTCCGTTTCACCCGGCATACATTACCAAAGAAC GTTTAGATAAAGCTAAAAACCTGAAACTGGTCGTCGTCGCCGGTGTCGGCAGTGATCACATTGATTTAGATTATATTA ACCAGACGGGCAAAAAAATCTCCGTGTTAGAGGTAACAGGTAGCAACGTCGTCTCAGTGGCGGAACACGTGGTAAT GACCATGCTAGTTTTGGTCCGTAACTTTGTTCCGGCACATGAACAAATTATCAATCATGACTGGGAGGTCGCGGCTAT CGCGAAAGATGCCTACGATATTGAGGGCAAAACCATTGCGACTATTGGTGCGGGGCGCATCGGTTATCGTGTACTTG AACGCCTTCTTCCGTTTAACCCGAAGGAGCTGTTGTACTACGACTACCAGGCGTTACCAAAAGAGGCTGAAGAAAAA GTGGGCGCGCGCCGTGTTGAGAATATTGAGGAACTCGTTGCACAGGCAGATATTGTTACCGTGAATGCGCCGCTGCA CGCGGGAACCAAAGGTTTGATCAACAAAGAACTACTGAGTAAATTTAAAAAAGGCGCCTGGCTCGTGAATACAGCTC GTGGTGCGATTTGCGTAGCTGAAGATGTGGCCGCAGCACTGGAGAGCGGTCAGCTGCGCGGCTATGGGGGCGACGT GTGGTTCCCCCAACCGGCACCTAAAGATCATCCCTGGCGTGATATGCGTAACAAATACGGCGCAGGCAATGCTATGA CCCCGCATTACTCCGGCACAACCTTGGACGCACAAACTCGCTACGCGGAAGGTACTAAGAACATTCTGGAGTCGTTTT TTACGGGCAAGTTTGATTACCGACCGCAGGATATAATTCTTCTGAACGGTGAATACGTGACCAAGGCGTATGGTAAAC ACGATAAAAAA

(105) TABLE-US-00003 Thecopynumberofduetvectorsareasfollows:pACYCDuet-1, .sup.~10;.sup.~40;pRSFDuet-1,100.sup.4. Plasmid Primers(5.fwdarw.3) Cloningstrategies Submodule1(SM1):Butyryl-CoAsynthesis pACYCDuet-1 CrCoA_F: Biosynthesispathway P.sub.T7lac::atoB.sub.Ec::hbd.sub.Ca:: CAGCAGCCATCACCATCATCACCACAGC ofButyryl-CoAinpDL2.sup.5 crt.sub.Ca-P.sub.T7lac::ter.sub.Td CAGGATCCGATGAAAAATTGTGTCATCG wassubclonedintothe pETDuet-1 TCAG(SEQIDNO:34) plasmidswithvarious P.sub.T7lac::atoB.sub.Ec::hbd.sub.Ca:: CrCoA_R: copynumbersby crt.sub.Ca-P.sub.T7lac::ter.sub.Td CTATCTATTTTTGAAGCCTTCAATTT GibsonAssembly pRSFDuet-1 (SEQIDNO:35) method.sup.6.Specifically, P.sub.T7lac::atoB.sub.Ec::hbd.sub.Ca:: MCS1_MCS2linker_F: atoB.sub.Ec-hbd.sub.Ca-crt.sub.Caand crt.sub.Ca-P.sub.T7lac::ter.sub.Td GCTTTCATAGAGAAAAGAAAAATTGAAG Ter.sub.Tdweresubcloned GCTTCAAAAATAGATAGGAATTCGAGCT intotheMCSland CGGC(SEQIDNO:36) MCS2oftheduet MCS1_MCS2linker_R: vectors,respectively. ATTGTTCCTAACCATTGGTTTTACAATC ATCATATGTATATCTCCTTCTTATACTT AACT (SEQIDNO:37) ter.sub.Td_F: AGTTAAGTATAAGAAGGAGATATACATA TGATGATTGTAAAACCAATGGTTAGG (SEQIDNO:38) ter.sub.Td_R: TCAAATTTCGCAGCAGCGGTTTCTTTAC CAGACTCGAGTTAAATCCTGTCGAACCT TTCT(SEQIDNO:39) BB_Duet_F: CGGATCCTGGCTGTGG (SEQIDNO:40) BB_Duet_R: CTCGAGTCTGGTAAAGAAACC (SEQIDNO:41) Submodule2/3/4(SM2-SM3-SM4)forBAsynthesis:Butanol+NADH+ATF1 pACYCDuet-1 adhE2.sub.Ca_F: FivePCRfragments P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- GCCATCACCATCATCACCACAGCCAGGA includingi)adhE2.sub.Ca P.sub.T7lac::ATF1.sub.Sc TCCGATGAAAGTTACAAATCAAAAAGAA fromgDNAofC. pETDuet-1 CTAA(SEQIDNO:42) acetobutylicum,ii) P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- adhE2.sub.Ca_R: fdh.sub.Cb.sup.optfrompET29 P.sub.T7lac::ATF1.sub.Sc TATATCTCCTTTTAAAATGATTTTATAT P.sub.T7lac::fdh.sub.Cb.sup.opt,iii) pRSFDuet-1 AGATATCCTTAAGTTCAC MCS1_MCS2linker P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- (SEQIDNO:43) frompACYCDuet-1, P.sub.T7lac::ATF1.sub.Sc fdh.sub.Cb.sup.opt_F: iv)ATF1.sub.Scfrom,and AGGATATCTATATAAAATCATTTTAAAA v)plasmidbackbone GGAGATATAATGAAAATTGTGCTGGTTT withvariouscopy TGTA(SEQIDNO:44) numberswere fdh.sub.Cb.sup.opt_R: assembledbyGibson TTGTCGACCTGCAGGCGCGCCGAGCTCG Assemblymethod.sup.6. AATTCTTATTTTTTATCGTGTTTACCAT Specifically,adhE2ca- ACGC(SEQIDNO:45) fdhcbandATF1.sub.SC MCS1_MCS2linker_BA_F: weresubclonedinto TAAGAATTCGAGCTCGGC theMCS1andMCS2 (SEQIDNO:46) oftheduetvectors, MCS1_MCS2linker_BA_R: respectively. GATTTCATTCATCATATGTATATCTCCT TCTTATACTTAACT (SEQIDNO:47) ATF1.sub.Sc_F: ATATTAGTTAAGTATAAGAAGGAGATAT ACATATGATGAATGAAATCGATGAGAAA AATC(SEQIDNO:48) ATF1.sub.Sc_R: CGTTCAAATTTCGCAGCAGCGGTTTCTT TACCAGACTCGAGCTAAGGGCCTAAAAG GAGA(SEQIDNO:49) BB_Duet_F: CGGATCCTGGCTGTGG (SEQIDNO:40) BB_Duet_R: CTCGAGTCTGGTAAAGAAACC (SEQIDNO:41) pRSFDuet-1 ATF1.sub.Sc.sup.opt_F: ATF1.sub.ScinpRSFDuet-1 P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- ATGAACGAAATCGACGAAAAAAATCAG P.sub.T7::tadhE2.sub.Ca::fdh.sub.Cb.sup.opt_ P.sub.T7lac::ATF1.sub.Sc.sup.opt (SEQIDNO:50) P.sub.T7::ATF1.sub.Scwas ATF1.sub.Sc.sup.opt_R: replacedwith CGGACCCAGTAACAAAGCTTTATA ATF1.sub.Sc.sup.optfrompET29 (SEQIDNO:51) P.sub.T7::ATF1.sub.Sc.sup.optby BB_BA_ATF1.sub.Sc.sup.opt_F: GibsonAssembly GAGCTTTGTAGCATATATAAAGCTTTGT method.sup.6. TACTGGGTCCGCTCGAGTCTGGTAAAGA AAC(SEQIDNO:52) BB_BA_ATF1.sub.Sc.sup.opt_R: GCGCCTGATTTTTTTCGTCGATTTCGTT CATCATATGTATATCTCCTTCTTATACT TAAC(SEQIDNO:53) pRSFDuet-1 malE_ATF1.sub.Sc.sup.opt_F: Thestartcodonof P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- ATATTAGTTAAGTATAAGAAGGAGATAT ATF1.sub.Sc.sup.optin P.sub.T7lac::malE_ATF1.sub.Sc.sup.opt ACATATGATGAAAATCGAAGAAGGTAAA pRSFDuet-1 CTGG(SEQIDNO:54) P.sub.T7::tadhE2.sub.Ca::fdh.sub.Cb.sup.opt_ malE_ATF1.sub.Sc.sup.opt_R: P.sub.T7::ATF1.sub.Sc.sup.optwas CCTGCTGAACTGGCGCCTGATTTTTTTC replacedwiththe GTCGATTTCGTTCTTGGTGATACGAGTC malEfromgDNAofE. TGC(SEQIDNO:55) coliMG1655by BB_BA_FP_ATF1.sub.Sc.sup.opt_F: GibsonAssembly AACGAAATCGACGAAAAAAATCAG method.sup.6. (SEQIDNO:56) BB_BA_FP_ATF1.sub.Sc.sup.opt_R: CATATGTATATCTCCTTCTTATACTTAA CTAATATACT(SEQIDNO:57) pRSFDuet-1 nusA_ATF1.sub.Sc.sup.opt_F: Thestartcodonof P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- ATATTAGTTAAGTATAAGAAGGAGATAT ATF1.sub.Sc.sup.opin P.sub.T7lac::nusA_ATF1.sub.Sc.sup.opt ACATATGATGAACAAAGAAATTTTGGCT pRSFDuet-1 GTAG(SEQIDNO:58) P.sub.T7::adhE2.sub.Ca::fdh.sub.Cb.sup.opt_ nusA_ATF1.sub.Sc.sup.op_R: P.sub.T7::ATF1.sub.Sc.sup.optwas CACTCCTGCTGAACTGGCGCCTGATTTT replacedwiththe TTTCGTCGATTTCGTTCGCTTCGTCACC nusAfromgDNAofE. GAAC coliMG1655by (SEQIDNO:59) GibsonAssembly BB_BA_FP_ATF1.sub.Sc.sup.op_F: AACGAAATCGACGAAAAAAATCAG (SEQIDNO:56) BB_BA_FP_ATF1.sub.Sc.sup.op_R: CATATGTATATCTCCTTCTTATACTTAA CTAATATACT(SEQIDNO:57) pRSFDuet-1 trxA_ATF1.sub.Sc.sup.opt_F: Thestartcodonof P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- TATTAGTTAAGTATAAGAAGGAGATATA ATF1.sub.Sc.sup.optin P.sub.T7lac::trxA_ATF1.sub.Sc.sup.opt CATATGATGAGCGATAAAATTATTCACC pRSFDuet-1 TGAC(SEQIDNO:60) P.sub.T7::adhE2.sub.Ca::fdh.sub.Cb.sup.opt_ trxA_ATF1.sub.Sc.sup.opt_R: P.sub.T7::ATF1.sub.Sc.sup.optwas CTGCTGAACTGGCGCCTGATTTTTTTCG replacedwiththe TCGATTTCGTTCGCCAGGTTAGCGTC trxAfromgDNAofE. (SEQIDNO:61) coliMG1655by BB_BA_FP_ATF1.sub.Sc.sup.opt_F: GibsonAssembly AACGAAATCGACGAAAAAAATCAG method.sup.6. (SEQIDNO:56) BB_BA_FP_ATF1.sub.Sc.sup.opt_R: CATATGTATATCTCCTTCTTATACTTAA CTAATATACT(SEQIDNO:57) pRSFDuet-1 adhE2.sub.Ca.sup.opt_F: adhE2.sub.CainpRSFDuet-1 P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt_ ATGAAAGTGACCAATCAAAAAGAGC Prz:tadhE2ca::fdh.sub.Cb.sup.opt_ P.sub.T7lac::trxA_ATF1.sub.Sc.sup.opt (SEQIDNO:62) P.sub.T7::trxA_ATF1.sub.Scwas adhE2.sub.Ca.sup.opt_R: replacedwith TTAGAAACTCTTTATGTAAATGTCTTTG adhE2.sub.Ca.sup.optfrom AGTTCG(SEQIDNO:63) pET29P.sub.T7::adhE2.sub.Ca.sup.opt BB_BA_adhE2.sub.Ca.sup.opt_F: byGibsonAssembly CAAAGACATTTACATAAAGAGTTTCTAA method.sup.6. AAGGAGATATAATGAAAATTGTGCTGGT TTTG(SEQIDNO:64) BB_BA_adhE2.sub.Ca.sup.opt_R: GTTCAGTTTCTGTTTCAGCTCTTTTTGA TTGGTCACTTTCATCGGATCCTGGCTGT GG(SEQIDNO:65) pRSFDuet-1 malE_adhE2.sub.Ca.sup.opt_F: Thestartcodonof P.sub.T7lac::malE_adhE2.sub.Ca.sup.opt:: GCAGCCATCACCATCATCACCACAGCCA adhE2.sub.Ca.sup.optin fdh.sub.cb.sup.opt- GGATCCGATGAAAATCGAAGAAGGTAAA pRSFDuet-1 P.sub.T7lac::trxA_ATF1.sub.Sc.sup.opt CTGG(SEQIDNO:66) P.sub.T7lac::adhE2.sub.Ca.sup.opt::fdhC malE_adhE2.sub.Ca.sup.opt_R: b.sup.opt. CGTTCAGTTTCTGTTTCAGCTCTTTTTG P.sub.T7iac::trxA_ATF1sc.sup.opt ATTGGTCACTTTCTTGGTGATACGAGTC wasreplacedwith TGC(SEQIDNO:67) themalEfromgDNA BB_BA_FP_adhE2.sub.Ca.sup.opt_F: off.co//MG1655by CGGATCCTGGCTGTGG GibsonAssembly (SEQIDNO:40) method.sup.6. BB_BA_FP_adhE2.sub.Ca.sup.opt_R: AAAGTGACCAATCAAAAAGAGCTG (SEQIDNO:68) pRSFDuet-1 nusA_adhE2.sub.Ca.sup.opt_F: Thestartcodonof P.sub.T7lac::nusA_adhE2.sub.Ca.sup.opt:: GCAGCCATCACCATCATCACCACAGCCA adhE2.sub.Ca.sup.optin fdh.sub.cb.sup.opt- GGATCCGATGAACAAAGAAATTTTGGCT pRSFDuet-1 P.sub.T7lac::trxA_ATF1.sub.Sc.sup.opt GTAG(SEQIDNO:69) P.sub.T7iac::adhE2ca.sup.opt::fdhc nusA_adhE2.sub.Ca.sup.opt_R: b.sup.opt. CGTTCAGTTTCTGTTTCAGCTCTTTTTG P.sub.T7iac::trxA_ATF1sc.sup.opt ATTGGTCACTTTCGCTTCGTCACCGAAC wasreplacedwith (SEQIDNO:70) thenusAfromgDNA BB_BA_FP_adhE2.sub.Ca.sup.opt_F: off.co//MG1655by CGGATCCTGGCTGTGG GibsonAssembly (SEQIDNO:40) method.sup.6. BB_BA_FP_adhE2.sub.Ca.sup.opt_R: AAAGTGACCAATCAAAAAGAGCTG (SEQIDNO:68) pRSFDuet-1 trxA_adhE2.sub.Ca.sup.opt_F: Thestartcodonof R.sub.Tl1ac::trxA_adhE2.sub.Ca.sup.opt:: CAGCCATCACCATCATCACCACAGCCAG adhE2.sub.Ca.sup.optin fdh.sub.cb.sup.opt- GATCCGATGAGCGATAAAATTATTCACC pRSFDuet-1 P.sub.T7iac::trxA_ATF1.sub.Sc.sup.opt TGAC(SEQIDNO:71) P.sub.T7lac::adhE2ca.sup.opt::fdhc trxA_adhE2.sub.Ca.sup.opt_R: b.sup.opt. CGTTCAGTTTCTGTTTCAGCTCTTTTTG P.sub.T7iac::trxA_ATF1sc.sup.opt ATTGGTCACTTTCGCCAGGTTAGCGTC wasreplacedwith (SEQIDNO:72) thetrxAfromgDNA BB_BA_FP_adhE2.sub.Ca.sup.opt_F: off.co//MG1655by CGGATCCTGGCTGTGG GibsonAssembly (SEQIDNO:40) method.sup.6. BB_BA_FP_adhE2.sub.Ca.sup.opt_R: AAAGTGACCAATCAAAAAGAGCTG (SEQIDNO:68) Submodule2/3/4(SM2-SM3-SM4)forEBsynthesis:Ethanol+NADH+SAAT pACYCDuet-1 EtOH_F: P.sub.T7lac::pdc.sub.Zm::adhB.sub.Zm:: GGCAGCAGCCATCACCATCATCACCACAG FivePCRfragments fdh.sub.Cb.sup.opt-P.sub.T7lac::SAAT.sub.Fa CCAGGATCCGATGAGTTATACTGTCGGTA includingi)pdc.sub.Zm- CC(SEQIDNO:73) adhB.sub.ZmfrompCT224.sup.5, EtOH_R: ii)fdh.sub.Cb.sup.optfrom CGCATCATACAAAACCAGCACAATTTTCA pET29P.sub.T7lac::fdh.sub.Cb.sup.opt, TTATATCTCCTTTTAGAAAGCGCTCAGGA iii)MCS1_MCS2 AG(SEQIDNO:74) linkerfrom fdh.sub.Cb.sup.opt_F: pACYCDuet-1,iv) ATGAAAATTGTGCTGGTTTTGTAATGAAA SAAT.sub.FafrompDL1.sup.5, ATTGTGCTGGTTTTGTA(SEQIDNO: andv)plasmid 75) backbonewith fdh.sub.Cb.sup.opt_R: variouscopy TTGTCGACCTGCAGGCGCGCCGAGCTCGA numberswere ATTCTTATTTTTTATCGTGTTTACCATAC assembledby GC(SEQIDNO:45) GibsonAssembly MCS1_MCS2linker_F: method.sup.6. AAAATAAGAATTCGAGCTCGGC Specifically,pdc.sub.Zm- (SEQIDNO:98) adhB.sub.Zm-fdh.sub.Cband MCS1_MCS2linker_R: SAAT.sub.Fawere GGAATTTATACTGACCTCAATTTTCTCCA subclonedintothe TCATATGTATATCTCCTTCTTATACTTAA MCS1andMCS2of CT(SEQIDNO:76) theduetvectors, SAAT.sub.Fa_F: respectively. AGTTAAGTATAAGAAGGAGATATACATAT GATGGAGAAAATTGAGGTCAGTATA (SEQIDNO:77) SAAT.sub.Fa_R: AAATTTCGCAGCAGCGGTTTCTTTACCAG ACTCGAGTTAAATTAAGGTCTTTGGAGAT GC(SEQIDNO:78) BB_Duet_F: CGGATCCTGGCTGTGG(SEQIDNO:40) BB_Duet_R: CTCGAGTCTGGTAAAGAAACC (SEQIDNO:41) Submodule2/3/4(SM2-SM3-SM4)forBBsynthesis:Butanol+NADH+SAAT pACYCDuet-1 adhE2.sub.Ca_F: pdc.sub.Zm-adhB.sub.ZminEB P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- GCCATCACCATCATCACCACAGCCAGGAT productionmodules P.sub.T7lac::SAAT.sub.Fa CCGATGAAAGTTACAAATCAAAAAGAACT werereplacedwith pETDuet-1 AA(SEQIDNO:42) adhE2.sub.CafromgDNA P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- adhE2.sub.Ca_R: ofC.acetobutylicum P.sub.T7lac::SAAT.sub.Fa TATATCTCCTTTTAAAATGATTTTATATA byGibsonAssembly pRSFDuet-1 GATATCCTTAAGTTCAC method.sup.6. P.sub.T7lac::adhE2.sub.Ca::fdh.sub.Cb.sup.opt- (SEQIDNO:43) P.sub.T7lac::SAAT.sub.Fa BB_Duet_F: CGGATCCTGGCTGTGG (SEQIDNO:40) BB_BB_R: AGGATATCTATATAAAATCATTTTAAAAG GAGATATAATGAAAATTGTGCTGGTTTTG productionmodules TA(SEQIDNO:44) pRSFDuet-1 SAAT.sub.Fa_F: trxA_ATF1.sub.Sc.sup.optin P.sub.T7lac::trxA_adhE2.sub.Ca.sup.opt:: AGTTAAGTATAAGAAGGAGATATACATAT pRSFDuet-1 fdh.sub.Cb.sup.opt-P.sub.T7lac::SAAT.sub.Fa GATGGAGAAAATTGAGGTCAGTATA P.sub.T7lac::trxA_adhE2.sub.Ca.sup.opt:: (SEQIDNO:77) fdh.sub.Cb.sup.opt- SAAT.sub.Fa_R: P.sub.T7lac::trxA_ATF1.sub.Sc.sup.opt AAATTTCGCAGCAGCGGTTTCTTTACCAG wasreplacedwith ACTCGAGTTAAATTAAGGTCTTTGGAGAT theSAAT.sub.Fafrom GC(SEQIDNO:78) pET29P.sub.T7lac::SAAT.sub.Fa BB_trxA_adhE2.sub.Ca.sup.opt_F: byGibsonAssembly ATGTATATCTCCTTCTTATACTTAACTAA method.sup.6. TATACTAAGATGG(SEQIDNO:79) BB_Duet_R: CTCGAGTCTGGTAAAGAAACC (SEQIDNO:41) WildtypeAATs pET29P.sub.T7lac::ATF1.sub.Sc ATF1.sub.Sc_F: ATAATTTTGTTTAACTTTAAGAAGGAGAT ATF1.sub.ScinpDL004.sup.7 ATAGATATGAATGAAATCGATGAGAAAAA wassubclonedinto T(SEQIDNO:1) pET29byGibson ATF1.sub.Sc_R: Assemblymethod.sup.6. TTTGTTAGCAGCCGGATCTCAGTGGTGGT GGTGGTGGTGGATAGGGCCTAAAAGGAGA G(SEQIDNO:2) BB_pET29_F: ATCCACCACCACCACC (SEQIDNO:3) BB_pET29_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) pET29P.sub.T7lac::SAAT.sub.Fa SAAT.sub.Fa_F: SAAT.sub.FainpDL00l.sup.7 TAGAAATAATTTTGTTTAACTTTAAGAAG wassubclonedinto GAGATATAGATATGGAGAAAATTGAGGTC pET29byGibson AG(SEQIDNO:80) Assemblymethod.sup.6. SAAT.sub.Fa_R: GTTAGCAGCCGGATCTCAGTGGTGGTGGT GGTGGTGGATAATTAAGGTCTTTGGAGAT GC(SEQIDNO:81) BB_pET29_F: ATCCACCACCACCACC (SEQIDNO:3) BB_pET29_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) CodonoptimizedgenesbytheU.S.DepartmentofEnergy (DOE)JointGenomeInstitute(JGI) pET29P.sub.T7lac::ATF1.sub.Sc.sup.opt univ_F: Theplasmidswere pET29P.sub.T7lac::SAAT.sub.Fa.sup.opt CCTCTAGAAATAATTTTGTTTAACTTTAA constructedbyJGI.The pET29P.sub.T7lac::fdh.sub.Cb.sup.opt GAAGGAGA(SEQIDNO:82) synthesizedgeneswere pET29P.sub.T7lac::adhE2.sub.Ca.sup.opt univ_R: amplifiedandclonedinto CGGATCTCAGTGGTGGTGGT pET29plasmidusingthe (SEQIDNO:83) EcoRVrestrictionsite.The geneswerecodon optimizedtoE.coli. AATswithfusionpartners pET29 malE_ATF1.sub.Sc_F: ThestartcodonofATF1.sub.Sc P.sub.T7lac::malE_ATF1.sub.Sc TTTGTTTAACTTTAAGAAGGAGATATAGA inpET29P.sub.T7::ATF1.sub.Scwas TATGAAAATCGAAGAAGGTAAACTGGTAA replacedwithmalEfrom TC(SEQIDNO:84) gDNAofE.coliMG1655by malE_ATF1.sub.Sc_R: GibsonAssemblymethod.sup.6. CTTGTTGCACGGGGGCCTGATTTTTCTCA TCGATTTCATTCTTGGTGATACGAGTCTG CG(SEQIDNO:85) BB_pET29ATF1.sub.Sc_F: AATGAAATCGATGAGAAAAATCAGGC (SEQIDNO:86) BB_pET29ATF1.sub.Sc_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) pET29 nusA_ATF1.sub.Sc_F: P.sub.T7lac::nusA_ATF1.sub.Sc ATTTTGTTTAACTTTAAGAAGGAGATATA ThestartcodonofATF1.sub.Sc GATATGAACAAAGAAATTTTGGCTGTAGT inpET29P.sub.T7::ATF1.sub.Scwas TG(SEQIDNO:87) replacedwithnudAfrom nusA_ATF1.sub.Sc_R: gDNAofE.coliMG1655by ATTLTTGTTGCACGGGGGCCTGATTTTTC GibsonAssemblymethod.sup.6. TCATCGATTTCATTCGCTTCGTCACCGAA CC(SEQIDNO:88) BB_pET29ATF1.sub.Sc_F: AATGAAATCGATGAGAAAAATCAGGC (SEQIDNO:86) BB_pET29ATF1.sub.Sc_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) pET29P.sub.T7lac::trxA_ATF1.sub.Sc trxA_ATF1.sub.Sc_F: ThestartcodonofATF1.sub.Sc ATTTTGTTTAACTTTAAGAAGGAGATATA inpET29P.sub.T7::ATF1.sub.Scwas GATATGAGCGATAAAATTATTCACCTGAC replacedwithtrxAfrom TG(SEQIDNO:89) gDNAofE.coliMG1655by trxA_ATF1.sub.Sc_R: GibsonAssemblymethod.sup.6. CATTCTTGTTGCACGGGGGCCTGATTTTT CTCATCGATTTCATTCGCCAGGTTAGCGT CG(SEQIDNO:90) BB_pET29ATF1.sub.Sc_F: AATGAAATCGATGAGAAAAATCAGGC (SEQIDNO:86) BB_pET29ATF1.sub.Sc_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) pET29 malE_ATF1.sub.Sc_F: ThestartcodonofATF1.sub.Sc PT.sub.7lac::malE_SAAT.sub.Fa TTTGTTTAACTTTAAGAAGGAGATATAGA inpET29P.sub.T7::ATF1.sub.Scwas TATGAAAATCGAAGAAGGTAAACTGGTAA replacedwithmalEfrom TC(SEQIDNO:84) gDNAofE.coliMG1655by malE_ATF1.sub.Sc_R: GibsonAssemblymethod.sup.6. TGATGGTGTGTTTGGAATTTATACTGACC TCAATTTTCTCCTTGGTGATACGAGTCTG CG(SEQIDNO:91) BB_pET29SAAT.sub.Fa_F: GAGAAAATTGAGGTCAGTATAAATTCCAA AC(SEQIDNO:92) BB_pET29SAAT.sub.Fa_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) pET29 nusA_ATF1.sub.Sc_F: Thestartcodonof P.sub.T7lac::nusA_SAAT.sub.Fa ATTTTGTTTAACTTTAAGAAGGAGATATA SAAT.sub.FainpET29 GATATGAACAAAGAAATTTTGGCTGTAGT P.sub.T7::SAAT.sub.Fawas TG(SEQIDNO:87) replacedwithnusA nusA_ATF1.sub.Sc_R: fromgDNAofE. GTTTGATGGTGTGTTTGGAATTTATACTG coliMG1655by ACCTCAATTTTCTCCGCTTCGTCACCGAA GibsonAssembly CC(SEQIDNO:93) method.sup.6. BB_pET29SAAT.sub.Fa_F: GAGAAAATTGAGGTCAGTATAAATTCCAA AC(SEQIDNO:92) BB_pET29SAAT.sub.Fa_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) pET29 trxA_ATF1.sub.Sc_F: Thestartcodonof PT.sub.7lac::trxA_SAAT.sub.Fa ATTTTGTTTAACTTTAAGAAGGAGATATA SAAT.sub.FainpET29 GATATGAGCGATAAAATTATTCACCTGAC P.sub.T7::SAAT.sub.Fawas TG(SEQIDNO:89) replacedwithtrxA trxA_ATF1.sub.Sc_R: fromgDNAofE. GGTTTGATGGTGTGTTTGGAATTTATACT coliMG1655by GACCTCAATTTTCTCCGCCAGGTTAGCGT GibsonAssembly CG(SEQIDNO:94) method.sup.6. BB_pET29SAAT.sub.Fa_F: GAGAAAATTGAGGTCAGTATAAATTCCAA AC(SEQIDNO:92) BB_pET29SAATp.sub.a_R: ATCTATATCTCCTTCTTAAAGTTAAACAA AATTATTTCTAG(SEQIDNO:4) Co-expressionofchaperones pACYCP.sub.araB:tig Thechaperoneplasmid pACYC kitwaspurchasedfrom P.sub.araB:groES::groEL TaKaRaBioInc.(Cat. pACYCP.sub.pzt-1:: #3340). groES::groEL::tig pACYC P.sub.araB::dnaK::dnaJ::grpE pACYC P.sub.araB::dnaK::dnaJ::grpE- P.sub.pzt-1::groES::groEL pACYC Amp.sup.R_F: Thechloramphenicol P.sub.araB::groES::groEL ATTAGTTAAGTATAAGAAGGAGATATACA resistancemarkerof (Amp.sup.R) TATGATGAACGAAATCGACGAAAAAAATC pACYCP.sub.araB::groES:: AG(SEQIDNO:95) groELwasreplacedwith Amp.sup.R_R: theampicillinresistance TTTCGCAGCAGCGGTTTCTTTACCAGACT markerfrompETDuet-1 CGAGCGGACCCAGTAACAAAGCTTTATAT byGibsonAssembly AT(SEQIDNO:96) method.sup.6. BB_groES/EL_F: CTCGAGTCTGGTAAAGAAACC (SEQIDNO:41) BB_groES/EL_R: CATATGTATATCTCCTTCTTATACTTAA CTAATATACT(SEQIDNO:57) Abbreviations: F forward; R, reverse; BB, backbone; MSC, multiple cloning site.