Method for selecting aerobic denitrifying fungus and method for remediating water body with low carbon-to-nitrogen ratio using aerobic denitrifying fungus

Abstract

A method for isolating and selecting Trichoderma Virens with an aerobic denitrification function and a method for remediating a water body with a low carbon-to-nitrogen ratio using the Trichoderma Virens are provided. Compared with the prior art, the biological treatment adopted by the present disclosure can allow the relatively-complete removal of nitrates without producing a residue, and exhibits advantages such as low cost, efficiency, and eco-friendliness. Further, the biological treatment adopted by the present disclosure can enhance the resistance of the fungus to toxic compounds and harsh environments, significantly promote the removal of nitrogen and organic matters in a water body, improve a decontamination ability of a water body, and increase the diversity of microorganisms in a water body, thereby accelerating the promotion of remediation of a water quality of a water body with a low carbon-to-nitrogen ratio. Therefore, the present disclosure has an extensive application potential.

Claims

1. A method for selecting an aerobic denitrifying fungus, comprising: treating sediments in a reservoir by an ultrasonic shaking technology, comprising subjecting a mud/water mixture collected from a drinking water reservoir to an ultrasonic treatment to obtain a suspension; isolating and purifying fungal strains and diluting the suspension to obtain a diluted suspension; coating the diluted suspension on a first fungal solid medium to produce first fungal colonies; picking fungal colonies with different shapes, colors, and characteristics from the first fungal solid medium; streaking picked fungal colonies on a second fungal solid medium, incubating a streaked fungal solid medium in a biochemical incubator to produce second colonies; and repeating a streaking process a plurality of times until pure colonies are obtained; selecting a fungus with an aerobic denitrification function using a denitrification medium; screening the pure colonies obtained after a separation and a purification in the denitrification medium selecting a fungus with an aerobic denitrification ability; and identifying a selected fungal strain by a gene sequencing technology, and naming an identified fungal strain as Trichoderma Virens D4.

2. The method for selecting the aerobic denitrifying fungus according to claim 1, wherein the first fungal solid medium comprises a dichloran rose-bengal chloramphenicol (DRBC) agar: 5.0 g/L of proteose peptone No. 3, 10.0 g/L of glucose, 1.0 g/L of monopotassium phosphate, 0.002 g/L of dicloran, 0.5 g/L of magnesium sulfate, 0.025 g/L of rose Bengal, 0.1 g/L of chloramphenicol, and 15.0 g/L of agar, and has a pH of 5.60.2.

3. The method for selecting the aerobic denitrifying fungus according to claim 1, wherein the pure colonies are screened as follows: picking and inoculating the pure colonies by an inoculation needle into the denitrification medium, or washing colonies growing on a plate with a phosphate buffer and then allowing a screening in the denitrification medium.

4. The method for selecting the aerobic denitrifying fungus according to claim 1, wherein the selected fungal strain is identified by an internal transcribed spacer (ITS) gene sequencing technology.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a growth and development tree pattern of the aerobic denitrifying fungus Trichoderma Virens D4 in the present disclosure;

(2) FIG. 2 shows a growth curve and a decarburization characteristic curve of the aerobic denitrifying fungus Trichoderma Virens D4 in the present disclosure;

(3) FIG. 3 shows denitrification characteristic curves of the aerobic denitrifying fungus Trichoderma Virens D4 in the present disclosure; and

(4) FIG. 4 shows denitrification and decarburization effects of the aerobic denitrifying fungus Trichoderma Virens D4 in the present disclosure for a lake in a city.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(5) The technical solutions of the present disclosure are further described in detail below in conjunction with specific embodiments, but the protection scope of the present disclosure is not limited to the following description.

(6) A method for selecting an aerobic denitrifying fungus is provided, including: sediments in a reservoir are treated by an ultrasonic shaking technology, fungal strains are isolated and purified, and a fungus with an efficient aerobic denitrification function is selected using a denitrification medium.

(7) Further, the method includes the following steps:

(8) S1, A mud/water mixture is collected from a drinking water reservoir through sediment screening and separation and treated for 10 s by an ultrasonic machine KQ-500DE with a power 40% of a rated power to obtain a suspension, where the rated power is 500 w.

(9) S2, 5 mL of the suspension is taken and diluted by a 10-fold serial dilution method to 10.sup.1, 10.sup.2, and 10.sup.31 3.

(10) S3, 100 L of each diluted suspension is taken and coated on a fungal solid medium with 3 replicates for each diluted suspension, and an inoculated fungal solid medium is incubated in a biochemical incubator at 30 C. for 5 d to 7 d until colonies are formed.

(11) S4, Fungal colonies with different shapes, colors, and characteristics are picked from the fungal solid medium and streaked on a fungal solid medium, and a streaked fungal solid medium is incubated in a biochemical incubator to produce colonies; and the above streaking process is repeated multiple times until pure colonies are obtained.

(12) S5, The pure colonies are screened in a denitrification medium. Preferably, The pure colonies are picked by an inoculation needle and inoculated into a 250 ml Erlenmeyer flask with 150 mL of a DM medium, or colonies growing on a plate are washed with phosphate buffer and then screened in a DM medium. The pure colonies are cultivated on a shaker (30 C., 120 r/min) for 2 d to obtain a seed solution for storage. At 24 h and 48 h, a sample is collected, tested for a fungal density (OD.sub.600), and then filtered through a 0.45 um filter membrane, and a resulting filtrate is tested for concentrations of nitrate nitrogen (NO.sub.3.sub.N) and total nitrogen (TN). After the 2 d cultivation, a resulting fungal solution (in a logarithmic phase) is mixed with a 50% glycerol solution in a ratio of 1:1, and a resulting mixed solution is placed in a sterilized 10 mL centrifuge tube in a sealed state and stored (80 C. freezer) for later use. Through the above screening, a fungus with an optimal aerobic denitrification ability can be obtained. A single fungus with a high NO.sub.3.sub.Nremoval efficiency is selected and cultivated in DM for further research.

(13) S6, A fungus with an optimal aerobic denitrification ability is selected.

(14) S7, The fungal strain is identified by a gene sequencing technology. Preferably, the fungal strain is identified by an ITS gene sequencing technology. DNA is extracted with a DNA isolation kit according to instructions of a manufacturer. An ITS gene is amplified with primers ITS1 and ITS4. A PCR product of the ITS gene is subjected to Sanger sequencing and purification with an ABI3730-XL sequencer (USA). The ITS sequence is stored in the National Center for Biotechnology Information (NCBI) database with an accession number OK560679. Sequence results of the strain are uploaded to the database through MEGA (version 5.05) and compared with the existing fungal ITS gene sequences in the database. A phylogenetic tree is constructed, the genetic characteristics of the strain are analyzed, and the species and genetic evolutionary status of the strain are determined. Results are shown in FIG. 1. The fungal strain identified is named Trichoderma Virens D4, and an ITS sequence for the fungal strain (SEQ ID NO: 1) is specifically as follows:

(15) TABLE-US-00002 ATCCGAGGTCACATTTCAGAAGTTTGGGGTGTTTAACGGCTGTGG ACGCCGCGCTCCCGATGCGAGTGTGC\AAACTACTGCGCAGGAGA GGCTGCGGCGAGACCGCCACTGTATTTCGGGGCCGGCCCCGTAAA GGGCCGATCC\CCAACGCCGACCCCCCGGAGGGGTTCCAGGGTTG AAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGC\GGGCG CAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTC ACATTACTTATCGCATTTCGCTGCG\TTCTTCATCGATGCCAGAA CCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAACGCC CACGAGGGGC\GCCGAGATGGCTCAGATAGTAAAAAACCCGCGAG GGGGTATACAATAAGAGTTTTGGTTGGTCCTCCGGCGGG\CGCCT TGGTCCGGGGCTGCGACGCACCCGGGGCAGAGATCCCGCCGAGGC AACAGTTTGGTAACGTTCAC.

(16) A fungus with an optimal aerobic denitrification ability can be selected and identified through the above steps of the present disclosure.

(17) Further, a method for selecting an aerobic denitrifying fungus is provided, including: the aerobic denitrifying fungus selected above is inoculated into a water body with a low carbon-to-nitrogen ratio such as an urban river or a lake or a reservoir to allow remediation of the water body with the low carbon-to-nitrogen ratio.

(18) The following experimental contents are intended to provide the verification and practical application of a denitrification ability of the aerobic denitrifying fungus Trichoderma Virens D4 in a water body with a low carbon-to-nitrogen ratio.

(19) The strain Trichoderma Virens D4 (10% v/v) is inoculated in a 250 ml Erlenmeyer flask with 150 mL of a DM medium and cultivated in a shaking incubator for 48 h (30 C. and 125 r/min), during which a sample is collected every 3 h and tested for a fungal density (OD.sub.600) and a concentration of dissolved organic carbon (DOC) to estimate characteristics of cell propagation and a reduction efficiency of DOC. A mixed culture is collected and tested for OD.sub.600 and DOC every 3 h until 72 h. These experiments are conducted three times (n=3).

(20) 10 mL of the culture of the strain is inoculated into a DM medium (150 mL) and cultivated in a dark incubator at 30 C. and 125 r/min. In order to investigate the aerobic denitrification ability of the strain, a shake flask test is conducted in a DM liquid medium with KNO.sub.3 as the only nitrogen source. During a cultivation process, a culture is collected periodically (every 3 h) using a sterilized pipette (Eppendorf, Germany), then centrifuged at 8,000 r/min for 10 min, and filtered through a 0.45 m filter membrane, and a resulting supernatant is collected and tested for concentrations of nitrate nitrogen (NO.sub.3.sub.N), nitrous nitrogen (NO.sub.2.sub.N), ammonia nitrogen (NH.sub.4.sub.+N), and TN. Three parallel samples are measured each time (n=3).

(21) Experiment 1: The strain (10 mL) was added to 140 mL of DM with 15 mg/L KNO.sub.3 as the only nitrogen source (C/N =10) and subjected to a 48 h shaker test. FIG. 2 shows the growth and DOC removal performance of the strain. During a 0 h to 9 h adaptation phase after the strain was inoculated, a concentration of the strain increased slowly from 0.01 to 0.031. At 12 h to 27 h, an OD value of the strain rapidly increased to 0.079 and the strain entered a logarithmic phase. At 27 h to 42 h, OD600 reached a maximum value of 0.401 and then tended to be stable, that is, a growth curve tended to be smooth and an OD600 value did not change significantly, indicating that the cultivation of the strain entered a quiescent state. With the further extension of a cultivation time (45 h to 48 h), an OD.sub.600 value was inversely proportional to the cultivation time, a death phase was reached, and a fungal density also decreased slightly.

(22) A polynomial equation for a proliferation curve of the strain is as follows: y=0.000007 x.sup.3+0.0002 x.sup.2+0.0143 x0.0392 (R.sup.2=0.9309)

(23) Organic matters are an important source for energy and electron donors to maintain the reproduction and denitrification processes of microorganisms. As shown in FIG. 2, there is a negative correlation between the fungal growth and the DOC concentration. During a proliferation process, a DOC concentration in DM decreases significantly under aerobic conditions, especially in a logarithmic phase of the strain. At 27 h, the DOC concentration decreases from 150 mg/L to 19.34 mg/L, indicating a removal rate of 87.11%. At 48 h, the DOC concentration is 16.34 mg/L, indicating a maximum removal rate of 89.11%. These results show that the aerobic denitrifying fungus Trichoderma Virens D4 can well utilize DOC during growth, indicating that it is feasible to remove the carbon pollution with the strain.

(24) Experiment 2: Denitrification performance of the aerobic denitrifying fungus Trichoderma Virens D4

(25) The strain Trichoderma Virens D4 was cultivated for 48 h with NO3-N as the only nitrogen source. During the cultivation, a change law of denitrification performance is shown in FIG. 3: At 6 h, the removal of NO.sub.3.sub.N starts, and an accumulated amount of NO.sub.3.sub.N decreases from the initial 15 mg/L to 12.74 mg/L, indicating a removal rate of 15.05%. In a logarithmic phase, concentrations of TN and NO3 -- N decrease extremely. At 27 h, a concentration of NO3 -- N decreases from 15.00 mg/L to 1.84 mg/L with a reduction efficiency of 87.76%, and a removal rate of TN reaches 87.47%. At 39 h, a concentration of NO3-N is 1.51 mg/L, indicating a removal efficiency of 89.92%, and a TN concentration is 1.59 mg/L, indicating a maximum removal rate of TN is 89.40%. In addition, a maximum accumulated concentration of NO.sub.2.sub.N occurs at 15th hour of strain culture, which is a logarithmic phase of the strain, and the concentration is 1.31 mg/L. With the further extension of a cultivation time, a concentration of NO.sub.2.sub.N gradually decreases until becoming zero at 21 h. There is no accumulation of NH.sub.4.sub.+N throughout the cultivation process. In summary, the strain can utilize NO.sub.3.sub.N and exhibit denitrification performance while growing, and allows a nitrogen removal rate of 89%, indicating that the strain has an excellent aerobic denitrification ability. The above analysis indicates that the aerobic denitrifying fungus has a huge potential in the degradation of nitrogen. These results show that the aerobic denitrifying fungus Trichoderma Virens D4 can make full use of nitrogen sources.

(26) Experiment 3: Use of the aerobic denitrifying fungus in raw water with a low carbon-to-nitrogen ratio

(27) The strain Trichoderma Virens D4 was inoculated into raw water of an urban river to evaluate the carbon and nitrogen removal performance of the strain Trichoderma Virens D4. The raw water has a TN concentration of 5.27 mg/L and belongs to a water body with a low carbon-to-nitrogen ratio. FIG. 4 shows the denitrification and organic matter degradation of the strain inoculated in the raw water. In the raw water, a concentration of NO.sub.3.sub.N is 3.99 mg/L, a concentration of NO.sub.2.sub.N is 0.15 mg/L, a concentration of NH.sub.4.sub.+N is 1.11 mg/L, a concentration of TN is 5.27 mg/L, and a concentration of chemical oxygen demand (COD) is 2.44 mg/L. After the strain is inoculated into the raw water, the nitrogen and COD concentrations in the raw water decrease significantly. A removal rate of NO.sub.3.sub.N reaches a maximum value of 86.56% and a concentration of NO.sub.3.sub.N decreases to 0.54 mg/L on day 7, NO2-N is completely removed on day 2, NH.sub.4.sub.+N is completely removed on day 3, and a removal rate of TN reaches a maximum value of 89.73% and a concentration of TN is 0.54 mg/L on day 7. After the strain is inoculated into the raw water, the COD concentration first increases slightly to 4.75 mg/L, and with the extension of an aeration time, the COD concentration gradually decreases and is stabilized at 1.7 mg/L on day 7, reaching a maximum removal rate of 30.33%.

(28) Further, in order to investigate a potential application of the strain Trichoderma Virens D4 in raw water, the strain was inoculated in a beaker filled with 2 L of raw water with a low carbon-to-nitrogen ratio, a dissolved oxygen concentration was maintained at 7.0 mg/L to 8.5 mg/L by an oxygenation pump, and then a denitrification ability of the strain was investigated. Raw water was collected from a drinking water reservoir in the Xi'an city and tested within 1 h. The strain was inoculated into natural water (v/v=1:9) in a 2 L beaker as a system 1. A dissolved oxygen concentration of this system was maintained at 7.5 mg/L for 9 d. A sample was collected every 24 h and tested by an ultraviolet-visible spectrophotometer to determine the concentrations of ammonia nitrogen (NH.sub.4.sub.+N), nitrate nitrogen (NO.sub.3.sub.N), nitrites (NO.sub.3.sub.N), total dissolved nitrogen (TDN), and COD.sub.Mn in the system.

(29) In the above experiment, the determination and analysis methods of NH.sub.4.sub.+N, NO.sub.3.sub.N, NO.sub.2.sub.N, and TN all refer to national standards, where a determination and analysis method of NH.sub.4.sub.N is based on the Water QualityAmmonia Nitrogen DeterminationNessler's Reagent Spectrophotometry, a determination and analysis method of NO.sub.3.sub.N is based on Water QualityNitrate Nitrogen DeterminationUltraviolet-Visible Spectrophotometry, a determination and analysis method of NO.sub.2.sub.N is based on Water QualityNitrite Nitrogen DeterminationUltraviolet-Visible Spectrophotometry, and a determination and analysis method of TN is based on Water QualityTotal Nitrogen (TN) DeterminationUltraviolet-Visible Spectrophotometry.

(30) In summary, the aerobic denitrifying fungus Trichoderma Virens D4 has a powerful carbon metabolism pathway and denitrification ability and is suitable for an in-situ treatment of a water body with a low carbon-to-nitrogen ratio, and the aerobic denitrifying fungus can play a powerful role in the degradation of nitrogen and carbon.