FILAMENTOUS FUNGUS AND USE THEREOF IN GAS METABOLISM

20250163360 ยท 2025-05-22

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a filamentous fungus and use thereof in gas metabolism, which belongs to the technical field of microorganisms. The filamentous fungus is an Aspergillus cejpii strain S8 deposited in the China General Microbiological Culture Collection Center (CGMCC), No. 3, No. 1, West Beichen Road, Chaoyang District, Beijing on Sep. 20, 2023, with a deposit number of CGMCC NO. 40828.

    Claims

    1. A filamentous fungus, wherein the filamentous fungus is an Aspergillus cejpii strain S8 deposited in the China General Microbiological Culture Collection Center (CGMCC), No. 3, No. 1, West Beichen Road, Chaoyang District, Beijing on Sep. 20, 2023, with a deposit number of CGMCC NO. 40828.

    2. The filamentous fungus according to claim 1, wherein the 18S rDNA sequence of the Aspergillus cejpii strain S8 is set forth in SEQ ID NO: 1.

    3. The filamentous fungus according to claim 1, wherein the culture conditions of the filamentous fungus are: an inorganic salt medium at 28 C. and 170 rpm for 3 days with constant-temperature shaking; and the inorganic salt medium comprises: 0.5 g/L of KH.sub.2PO.sub.4, 0.5 g/L of Na.sub.2HPO.sub.4, 0.4 g/L of NaCl, 1.0 g/L of KNO.sub.3, 0.5 g/L of NH.sub.4Cl, 1.0 g/L of MgSO.sub.4.Math.7H.sub.2O, 0.2 g/L of CaCl.sub.2, 0.004 g/L of FeSO.sub.4.Math.7H.sub.2O, 0.004 g/L of CuSO.sub.4.Math.5H.sub.2O, 0.004 g/L of MnSO.sub.4.Math.H.sub.2O, 0.004 g/L of ZnSO.sub.4.Math.7H.sub.2O, and 0.00024 g/L of NaMoO.sub.4.Math.2H.sub.2O.

    4. The filamentous fungus according to claim 1, wherein an energy to allow growth and reproduction of the filamentous fungus is a greenhouse gas; and wherein the greenhouse gas comprises CH.sub.4 and/or CO.sub.2.

    5. A microbial inoculant, wherein the microbial inoculant comprises the Aspergillus cejpii strain S8 according to claim 1.

    6. The microbial inoculant according to claim 5, wherein the Aspergillus cejpii strain S8 is used in absorption and metabolism of a gas, and the gas comprises CH.sub.4 and/or CO.sub.2.

    7. A method for absorbing and metabolizing a gas, wherein comprising absorbing and metabolizing of the gas with the Aspergillus cejpii strain S8 according to claim 1, and wherein the gas comprises CH.sub.4 and/or CO.sub.2.

    8. The method according to claim 7, wherein the Aspergillus cejpii strain S8 according to claim 1 is prepared into a microbial inoculant to allow absorption and metabolism of the gas.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0026] In order to illustrate the examples of the present disclosure or the technical solutions in the prior art more clearly, a brief introduction of the accompanying drawings needed in the description of the examples or the prior art will be provided below. Obviously, the accompanying drawings in the following description are merely some examples of the present disclosure.

    [0027] FIG. 1 shows a plate culture image of the Aspergillus cejpii strain S8 and a microscopic image of hyphae with spores; where FIG. 1A is the front side of the plate culture image of Aspergillus cejpii strain S8; FIG. 1B is the back side of the plate culture image of Aspergillus cejpii strain S8; and FIG. 1C is the microscope image of the hyphae with spores of Aspergillus cejpii strain S8; and

    [0028] FIG. 2 shows the phylogenetic tree of the Aspergillus cejpii strain S8.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0029] The technical solutions of the present disclosure will be described in detail below in conjunction with specific examples, but the protection scope of the present disclosure is not limited to the examples. The experimental methods described in the following examples are conventional methods unless otherwise specified; and the reagents and materials can be obtained from commercial sources unless otherwise specified.

    [0030] The inorganic salt medium includes: 0.5 g/L of KH.sub.2PO.sub.4, 0.5 g/L of Na.sub.2HPO.sub.4, 0.4 g/L of NaCl, 1.0 g/L of KNO.sub.3, 0.5 g/L of NH.sub.4Cl, 1.0 g/L of MgSO.sub.4.Math.7H.sub.2O, 0.2 g/L of CaCl.sub.2, 0.004 g/L of FeSO.sub.4.Math.7H.sub.2O, 0.004 g/L of CuSO.sub.4.Math.5H.sub.2O, 0.004 g/L of MnSO.sub.4.Math.H.sub.2O, 0.004 g/L of ZnSO.sub.4.Math.7H.sub.2O, and 0.00024 g/L of NaMoO.sub.4.Math.2H.sub.2O.

    [0031] PDA medium includes: 200 g/L of potato, 20 g/L of glucose, 5 g/L of peptone, 3 g/L of potassium dihydrogen phosphate, 1.5 g/L of magnesium sulfate, and 20 g/L of agar.

    [0032] The fermentation product after methanogenesis is provided by Northwest Agriculture & Forestry University, specifically a fermentation product after methanogenesis at 37 C. using wheat straw as a fermentation material.

    Example 1

    [0033] In this example, the screening and identification of Aspergillus cejpii strain S8 are provided.

    1. Strain Screening

    [0034] 50 mL of inorganic salt medium was added into a 250 mL sealed bottle, the headspace gas in the sealed bottle was replaced with nitrogen, pure CH.sub.4 was added into the sealed bottle, 0.5 g of methanogenic fermentation product was inoculated into each sealed bottle, and cultured at a constant temperature of 28 C. and 170 rpm with shaking, and an enriched culture was obtained after 3 days. 1 mL of the enriched culture was transferred to a new inorganic salt medium and the culture was continued at 28 C. and 170 rpm. 1 mL of the enriched culture was transferred to a new inorganic salt medium every 3 days and the culture was continued at 28 C. and 170 rpm. The transfer was repeated until the inorganic salt medium solution became turbid to obtain an enriched solution of efficient gas utilization strains. 2% agar powder was added to a inorganic salt medium to prepare an inorganic salt solid medium. The enriched solution of efficient gas utilization strains was serially diluted, spread on the inorganic salt solid medium and cultured in a 28 C. constant-temperature incubator. Single colonies with desirable growth were selected, purified, and stored in a 4 C. refrigerator for later use.

    2. Morphological Identification of Strain

    [0035] The purified strain was inoculated on PDA medium and cultured at 28 C. for 7 days, the morphological characteristics and growth of the colonies were observed to understand the size and morphology of the mycelium (FIG. 1A and FIG. 1B). 1 to 2 drops of lactophenol cotton blue staining solution were dripped on a clean glass slide, a limited number of hyphae with spores were picked up with a dissecting needle and placed in the staining solution, and the hyphae were spread out, covered with a coverslip, and observed under a 40 optical microscope (FIG. 1C).

    [0036] As shown in FIG. 1, the surface of the colony of the strain was white, widely spread in a cotton-like shape, and granular; the back of the colony was light yellow and spread radially to the surroundings. The spores of the strain are mainly produced by cell expansion and spore wall thickening, distributed at the top and side walls of aerial hyphae, and round in shape.

    2. Molecular Identification of Strain

    [0037] The PCR product of 18S rDNA was amplified using ITS1 and ITS4 regions, where the ITS1 primer had the sequence TCCGTAGGTGAACCTGCGG (SEQ ID NO: 2), and the ITS4 primer had the sequence TCCTCCGCTTATTGATATGC (SEQ ID NO: 3). 3 L of PCR product was analyzed using 1.0% agarose gel electrophoresis. After confirming the single target band, the PCR product was purified and then sent to BGI Group (Shenzhen) for sequencing analysis. The 18S rDNA sequence of Aspergillus cejpii strain S8 was obtained as shown in SEQ ID NO: 1, with a length of 533 bp. The sequencing results were subjected to NCBI-BLAST sequence alignment, and the gene sequences of strains with higher homology were downloaded using MEGA7.0 software. The phylogenetic tree of this strain was constructed by the NJ method (FIG. 2).

    [0038] As shown in FIG. 2, the strain had a homology of up to 99.81% with Aspergillus cejpii. The phylogenetic tree results showed that the strain was located in the same branch with a bootstrap value of 100%. All branches had bootstrap values higher than 50%. Combining the morphological and molecular biological results, the strain was identified as Aspergillus cejpii and named S8.

    Example 2

    [0039] In this example, a test on the utilization effect of Aspergillus cejpii strain S8 on methane gas was provided.

    [0040] 50 mL of inorganic salt medium was added into a sealed bottle of 250 mL, the headspace gas in the sealed bottle was replaced with nitrogen, pure CH.sub.4 was added into the sealed bottle, 2% of the isolated and purified fungal suspension of Aspergillus cejpii strain S8 was inoculated into each sealed bottle, while ambient air was added into a control group bottle as the control group. After 7 days of static culture at 28 C., the utilization rate of CH.sub.4 by Aspergillus cejpii strain S8 was determined using a gas chromatography-mass spectrometer (GC2014C, purchased from Shimadzu Corporation), and the results were shown in Table 1. The test conditions were: TCD detector, inlet temperature 100 C., detector temperature 100 C., furnace temperature 90 C., argon as carrier gas, and the flow rate of 30 mL/min.

    [0041] The volume utilization rate was determined by the water displacement gas collection method, and the results were shown in Table 1. To determine the mycelium dry weight, a filter paper was first dried to a constant weight, and the filter paper was accurately weighed. After a fermentation broth of the Aspergillus cejpii strain S8 was fully mixed, 30 mL of the fermentation broth was accurately measured for suction filtration, and an obtained filter residue was fully washed several times with distilled water until the filtrate was colorless, and then placed in a 55 C. constant-temperature drying oven to dry to a constant weight, a total mass of the filter residue and filter paper was accurately weighed. The measurement results were shown in Table 1. The formula for calculating the mycelium dry weight was: mycelium dry weight (mg)=total mass of filter residue and filter paper (mg)mass of filter paper (mg).

    TABLE-US-00001 TABLE 1 Utilization effect of Aspergillus cejpii strain S8 on CH.sub.4 Gas utilization Volume utilization Mycelium dry Indicator rate (%) rate (%) weight (mg) Control group 2.156 2.776 30.512 Treatment group 81.437 41.110 36.433

    [0042] As shown in Table 1, after adding Aspergillus cejpii strain S8 to the sealed bottle, the gas utilization rate of the ambient air was 2.156%, the volume utilization rate was 2.776%, and the mycelium dry weight was 30.512 mg. When the Aspergillus cejpii strain S8 was added to pure methane gas, the CH.sub.4 gas utilization ability was relatively significant, and a large amount of CH.sub.4 could be consumed as a carbon source and an energy source to allow growth and reproduction. The CH.sub.4 gas utilization rate by the strain was 81.437%, the volume utilization rate was 41.110%, and the mycelium dry weight was 36.433 mg. The gas utilization rate by the Aspergillus cejpii strain S8 in pure methane gas was 37.772 times that of the control group, the volume utilization rate was 14.809 times that of the control group, and the mycelium dry weight was 1.194 times that of the control group. This indicated that the Aspergillus cejpii strain S8 had a desirable CH.sub.4 gas utilization effect, showed high CH.sub.4 gas utilization rate, and could use CH.sub.4 as the carbon source and the energy source to allow growth and reproduction.

    Example 3

    [0043] In this example, a test on the utilization effect of Aspergillus cejpii strain S8 on CO.sub.2 gas was provided.

    [0044] 50 mL of inorganic salt medium was added into a sealed bottle of 250 mL, the headspace gas in the sealed bottle was replaced with nitrogen, pure CO.sub.2 was added into the sealed bottle, 2% of the isolated and purified fungal suspension of Aspergillus cejpii strain S8 was inoculated into each sealed bottle, while ambient air was added into a control group bottle as the control group. After 7 days of static culture at 28 C., the utilization rate of CO.sub.2 by Aspergillus cejpii strain S8 was determined using a gas chromatography-mass spectrometer (GC2014C, purchased from Shimadzu Corporation), and the results were shown in Table 2. The test was carried out under the same conditions as in Example 2. The volume utilization rate was determined by the water displacement gas collection method, and the results were shown in Table 2. The mycelium dry weight was determined in the same manner as that in Example 2, and the results were shown in Table 2.

    TABLE-US-00002 TABLE 2 Utilization effect of Aspergillus cejpii strain S8 on CO.sub.2 Gas utilization Volume utilization Mycelium dry Indicator rate (%) rate (%) weight (mg) Control group 2.375 2.846 28.734 Treatment group 96.737 71.106 43.367

    [0045] As shown in Table 2, after adding Aspergillus cejpii strain S8 to the sealed bottle, the gas utilization rate of the ambient air was only 2.375%, the volume utilization rate was 2.846%, and the mycelium dry weight was 28.734 mg. When Aspergillus cejpii strain S8 was added to pure CO.sub.2, the CO.sub.2 utilization ability was significant. The strain could efficiently utilize CO.sub.2 as the carbon source and the energy source to allow growth and reproduction, with the CO.sub.2 gas utilization rate of 96.737%, the volume utilization rate of 71.106%, and the mycelium dry weight of 43.367 mg. The gas utilization rate by Aspergillus cejpii strain S8 in pure CO.sub.2 was 40.731 times that of the control group, the volume utilization rate was 24.984 times that of the control group, and the mycelium dry weight was 1.509 times that of the control group in pure CO.sub.2. This indicated that the Aspergillus cejpii strain S8 had a desirable CO.sub.2 gas utilization effect, showed high CO.sub.2 gas utilization rate, and could use CO.sub.2 as the carbon source and the energy source to allow growth and reproduction.

    [0046] The described examples are merely some rather than all of the examples of the present disclosure. The detailed description examples of the present disclosure are not intended to limit the protection scope of the present disclosure, but merely to indicate selected examples of the present disclosure. All other examples obtained by a person of ordinary skill in the art based on the examples of the present disclosure without creative efforts shall fall within the protection scope of the present disclosure.