METHODS FOR GENERATING NEW GENES IN ORGANISM AND USE THEREOF
20230062179 · 2023-03-02
Inventors
- LINJIAN JIANG (Qingdao, CN)
- JIYAO WANG (Qingdao, CN)
- SUDONG MO (Qingdao, CN)
- Bo Chen (Qingdao, CN)
- QIANG HU (Qingdao, CN)
- DEHUI DING (Qingdao, CN)
- HUARONG LI (Qingdao, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A01H5/00
HUMAN NECESSITIES
C12N9/0069
CHEMISTRY; METALLURGY
A01H1/00
HUMAN NECESSITIES
C12N15/8213
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01H1/00
HUMAN NECESSITIES
Abstract
The present invention relates to the technical fields of genetic engineering and bioinformatics, in particular, to a method for creating a new gene in an organism in the absence of an artificial DNA template, and a use thereof. The method comprises simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different gene elements or different protein domains, and the DNA breaks are ligated to each other through non-homologous end joining (NHEJ) or homologous repair to generate a new combination of the different gene elements or different protein domains that is different from the original genome sequence, thereby creating a new gene. The new gene of the invention can change the growth, development, resistance, yield and other traits of the organism, and has great value in application.
Claims
1. A method for creating a new gene in an organism, characterized by comprising the following steps: simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, and the DNA breaks are ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination of the different genetic elements or different protein domains different from the original genomic sequence, thereby creating the new gene; or a method for in vivo creation of new genes that can be stably inherited in an organism, characterized by comprising the following steps: (1) simultaneously generating double-stranded DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are capable of separating different gene elements or different protein domains, and the DNA breaks are then ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination or assemble of the different gene elements or different protein domains derived from the original genomic sequence, thereby the new gene is generated; optionally, it also includes (2) designing primer pairs that can specifically detect the above-mentioned new combination or assemble, then cells or tissues containing the new genes can be screened out by PCR test, and the characteristic sequences of new combinations of gene elements can be determined by sequencing; and (3) cultivating the above-screened cells or tissues to obtain T0 generation organisms, and perform PCR tests and sequencing on the organisms for two consecutive generations including the T0 generation and its bred T1 or at least three consecutive generations to select the organisms containing the above-mentioned characteristic sequence of new combination of gene elements, namely, a new gene that can be stably inherited has been created in the organism; optionally, it also includes (4) testing the biological traits or phenotypes related to the function of the new gene, to determine the genotype that can bring beneficial traits to the organism, and to obtain a new functional gene that can be stably inherited.
2. The method according to claim 1, wherein in the step (1), DNA breaks are simultaneously generated at two different specific sites in the genome of the organism, wherein one site is the genomic locus between the promoter region and the coding region of a gene, meanwhile, the other site is between the promoter region and the coding region of another gene with different expression patterns, resulting in a new combination of the promoter of one gene and the coding region of the other gene that has a different expression pattern; or a combination of the strong promoter and the gene of interest is eventually produced.
3. The method according to claim 1, wherein in the step (1), DNA breaks are simultaneously generated at three different specific sites in the genome of the organism, the three specific sites include two genomic sites whose combination capable of cutting off the promoter region of a highly expressed gene and the third genomic site between the coding region and the promoter region of the gene of interest that has a different expression pattern; or a genomic site between the promoter region and the coding region of a highly expressed gene and another two genomic sites whose combination capable of cutting off the coding region fragment of the gene of interest that has a different expression pattern; then through gene editing at the above-mentioned sites, translocation editing events can be generated, in which the strong promoter fragment that is inserted upstream of the coding region of the gene of interest, or the coding region fragment of the gene of interest is inserted the downstream of the promoter of another highly expressed gene, finally, the combination of the promoter of one gene and the coding region of the other gene of interest with different expression patterns is generated.
4. The method according to claim 1, characterized in that said two or more different specific sites locate on the same chromosome or on different chromosomes; optionally, said two or more different specific sites may be specific sites on at least two different genes, or may be at least two different specific sites on the same gene; and said at least two different genes may have the same or different transcription directions.
5. The method according to claim 1, characterized in that said gene elements are selected from the group consisting of a promoter, a 5′ untranslated region, a coding region or non-coding RNA region, a 3′ untranslated region, a terminator of the gene, or any combination thereof.
6. The method according to claim 1, characterized in that the combination of different gene elements is a combination of the promoter of one of the two genes with different expression patterns and the coding region or the non-coding RNA region of the other gene, or the combination of different gene elements is a combination of the region from the promoter to 5′UTR of one of the two genes with different expression patterns and the CDS or non-coding RNA region of the other gene, or the combination of different gene elements is a combination of adjacent gene elements of the same gene.
7. The method according to any claim 1, characterized in that the protein domain is a DNA fragment corresponding to a specific functional domain of a protein including a nuclear localization signal, a chloroplast leading peptide, a mitochondrial leading peptide, a phosphorylation site, a methylation site, a transmembrane domain, a DNA binding domain, a transcription activation domain, a receptor activation domain, or an enzyme catalytic center.
8. The method according to claim 1, characterized in that the combination of different protein domains is a combination of the localization signal region of one of two proteins with different subcellular localizations and the mature protein coding region of the other gene, or a combination of two protein domains with different biological functions, or a combination of adjacent protein domains of the same gene; wherein the different subcellular locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, mitochondrial location, and endoplasmic reticulum membrane location; or the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to a protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof.
9. The method according to claim 1, characterized in that the combination of gene elements and protein domains are a combination of protein domains and adjacent promoters, 5′UTR, 3′UTR or terminators of the same gene.
10. The method according to claim 1, characterized in that the organism is a non-human animal, a plant or a fungus.
11. The method according to claim 1, characterized in that the combination of different gene elements is selected from any of the following: (1) one element is a plant endogenous strong promoter or the region from a strong promoter to 5′UTR, and the other is the HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclase gene coding region of the same plant; (2) one element is an endogenous strong promoter or the region from a strong promoter to 5′UTR of the organism, and the other is a gene coding region of any one of the P450 family in the same organism; (3) one element is a rice or maize endogenous strong promoter or the region from a strong promoter to 5′UTR, and the other is a gene coding region of OsCYP81A gene or ZmCYP81A9 gene in the same organism; (4) one element is a maize endogenous strong promoter or the region from a strong promoter to 5′UTR, and the other is the coding region of maize gene ZMM28 (Zm00001d022088), ZmKNR6 or ZmBAM1d; (5) one element is a rice endogenous strong promoter or the region from a strong promoter to 5′UTR, and the other is the coding region of rice gene COLD1 or OsCPK24; (6) one element is an endogenous strong promoter or the region from a strong promoter to 5′UTR of the organism, and the other is a gene coding region of any one of the ATP-binding cassette (ABC) transporter family in the same organism; (7) one element is a plant endogenous strong promoter or the region from a strong promoter to 5′UTR of the plant, and the other is a gene coding region of any one of the NAC transcription factor family (for example, OsNAC045, OsNAC67, ZmSNAC1, OsNAC006, OsNAC42, OsSNAC1 or OsSNAC2) in the same plant; (8) one element is a plant endogenous strong promoter or the region from a strong promoter to 5′UTR, and the other is the gene coding region of any one of MYB, MADS, DREB and bZIP transcription factor family in the same plant; (9) one element is the promoter of any one of overexpression or tissue-specific expression rice genes listed in Table A, and the other is the protein coding region or the non-coding RNA region of another gene that is different from the selected promoter corresponding to the rice gene; (10) one element is a protein coding region or non-coding RNA region selected from any one of the biological functional genes listed in Table B to K, and the other is the promoter region of another gene that is different from the selected functional gene of the biological genome corresponding to the selected gene; (11) one element is an endogenous strong promoter or the region from a strong promoter to 5′UTR of the organism, and the other is a gene coding region of any one of the GST (glutathione-s-transferases) family in the same organism; (12) one element is a wheat or maize endogenous strong promoter or the region from a strong promoter to 5′UTR of the organism, and the other is a gene coding region of wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat GST28E45 (AY479764.1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene in the same organism; (13) one element is a rice endogenous strong promoter or the region from a strong promoter to 5′UTR, and the other is the coding region of any one of gene protein in rice GIF1 (Os04g0413500), NOG1 (Os01g075220), LAIR (Os02g0154100), OSA1 (Os03g0689300), OsNRT1.1A (Os08g0155400), OsNRT2.3B (Os01g0704100), OsRac1 (Os01g0229400), OsNRT2.1 (Os02g0112100), OsGIF1 (Os03g0733600), OsNAC9 (Os03g0815100), CPB1/D11/GNS4 (Os04g0469800), miR1432 (Os04g0436100), OsNLP4 (Os09g0549450), RAG2 (Os07g0214300), LRK1 (Os02g0154200), OsNHX1 (Os07t0666900), GW6 (Os06g0623700), WG7 (Os07g0669800), D11/OsBZR1 (Os04g0469800, Os07g0580500), OsAAP6 (Os07g0134000), OsLSK1 (Os01g0669100), IPA1 (Os08g0509600), SMG11 (Os01g0197100), CYP72A31 (Os01g0602200), SNAC1 (Os03g0815100), ZBED (Os01g0547200), OsSta2 (Os02g0655200), OsASR5 (Os11g0167800), OsCPK4 (Os02g03410), OsDjA9 (Os06g0116800), EUI (Os05g0482400), JMJ705 (Os01g67970), WRKY45 (Os05t0322900), OsRSR1 (Os05g0121600), OsRLCK5 (Os01g0114100), APIP4 (Os01g0124200), OsPAL6 (Os04t0518400), OsPAL8 (Os11g0708900), TPS46 (Os08t0168000), OsERF3 (Os01g58420) and OsYSL15 (Os02g0650300); (14) one element is a fish endogenous strong promoter, and the other is a gene coding region of GH1 (growth hormone 1) in the selected fish; or the combination of different protein domains is selected from any of the following: (a) one element is a wheat endogenous protein chloroplast localization signal domain, and the other is a wheat mature protein coding region of cytoplasmic localization phosphoglucose isomerase (PGIc); (b) one element is a rice protein chloroplast localization signal domain (CTP), and the other is the mature protein coding region of OsGLO3, OsOXO3 or OsCATC.
12. A new gene created by the method according to claim 11, characterized in that the new genes formed by any one of the combinations of the different gene elements (1)-(14) respectively have the following characters: (1) the level of the new gene expression is up-regulated relative to the plant endogenous wild-type HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclase gene; (2) the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type P450 gene of the organism; (3) the level of the new gene expression is up-regulated relative to the rice endogenous OsCYP81A6 gene or maize endogenous ZmCYP81A9 gene, respectively; (4) the level of the new gene expression is up-regulated relative to the plant endogenous wild-type ZMM28 gene, ZmKNR6 gene or ZmBAM1d gene, respectively; (5) the level of the new gene expression is up-regulated relative to the rice endogenous wild-type COLD1 or OsCPK24 gene, respectively; (6) the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type ATP-binding cassette (ABC) transporter gene of the organism; (7) the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type NAC transcription factor family gene; (8) the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type MYB transcription factor gene, MADS transcription factor family gene, DREB transcription factor family gene coding region or bZIP transcription factor family gene, respectively; (9) the expression pattern of the new gene is changed relative to the selected protein coding region or the non-coding RNA region of the rice endogenous gene; (10) the expression pattern of the new gene is changed relative to the selected functional gene; (11) the level of the new gene expression is up-regulated relative to the corresponding endogenous GST (glutathione-s-transferases) family gene of the organism; (12) the level of the new gene expression is up-regulated relative to the endogenous wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat GST28E45 (AY479764.1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene, respectively; (13) the level of the new gene expression is up-regulated relative to the corresponding endogenous gene; (14) the new gene is a fish endogenous high expression GH1 gene; or the new genes formed by any one of the combinations of the different protein domains (a)-(b) respectively have the following characters: (a) the new gene locates the phosphoglucose isomerase gene relative to the coding cytoplasm and its mature protein is located in the chloroplast. (b) the mature protein of the new gene is located in chloroplast different from OsGLO3, OsOXO3 or OsCATC.
13.-17. (canceled)
18. A chloroplast localized protein OsCACT or OsGLO3, the nucleotide encoding the protein has a sequence selected from the group consisting of: (1) the nucleic acid sequence as shown in SEQ ID NO: 28 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition; and (2) the nucleic acid sequence as shown in SEQ ID NO: 29 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition.
19.-20. (canceled)
21. An editing method for regulating the gene expression level of a target endogenous gene in an organism, which is independent of an exogenous DNA donor fragment, which comprises the following steps: simultaneously generating DNA breaks separately at selected sites between the promoter and the coding region of each of the target endogenous gene and an optional endogenous inducible or tissue-specific expression gene with a desired expression pattern; ligating the DNA breaks to each other by means of non-homologous end joining (NHEJ) or homologous repair, thereby generating an in vivo fusion of the coding region of the target endogenous gene and the optional inducible or tissue-specific expression promoter to form a new gene with expected expression patterns, the target endogenous gene and the optional endogenous inducible or tissue-specific expression gene with a desired expression pattern are located on the same chromosome or on different chromosomes; optionally, the target endogenous gene is yeast ERG9 gene, the endogenous inducible expression gene is HXT1 gene, and the inducible expression promoter is HXT1 in response to glucose concentration.
22. A yeast endogenous inducible ERG9 gene obtainable by the editing method according to claim 21.
23. (canceled)
24. A highly-expressing rice endogenous HPPD gene, rice endogenous PPO2 gene, maize endogenous PPO2 gene, wheat endogenous PPO2 gene, or oilseed rape endogenous PPO2 gene, which has a sequence selected from the group consisting of: (1) the nucleic acid sequence as shown in SEQ ID NO: 27 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition; (2) the nucleic acid sequence as shown in SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition; (3) the nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 49 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition; (4) the nucleic acid sequence as shown in SEQ ID NO: 50, SEQ ID NO: 5, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition; and (5) the nucleic acid sequence as shown in SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 or SEQ ID NO: 61 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition.
25.-29. (canceled)
30. A plant or a progeny derived therefrom regenerated from the plant cell which comprises the gene (1), (3) or (12) set forth in claim 12.
31. A method for producing a plant with an increased resistance or tolerance to an herbicide, which comprises regenerating the plant cell which comprises the gene (1), (3) or (12) set forth in claim 12 into a plant or a progeny derived therefrom.
32.-33. (canceled)
34. A method for controlling a weed in a cultivation site of a plant, wherein the plant is selected from the group consisting of a plant prepared by the method according to claim 31, wherein the method comprises applying to the cultivation site one or more corresponding inhibitory herbicides in an amount for effectively controlling the weed; wherein the herbicide comprises one or a combination of two or more of inhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicides.
35. (canceled)
36. An editing method for knocking up the expression of an endogenous WAK gene or CNGC gene in a plant, characterized in that it comprises fusing the coding region of the WAK gene or CNGC gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous WAK gene or CNGC gene, respectively; or it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the WAK gene or CNGC gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the WAK gene or CNGC gene and the optional strong endogenous promoter to form a new highly-expressing WAK gene or CNGC gene.
37. A highly-expressing plant endogenous WAK gene or CNGC gene obtainable by the editing method according to claim 36, wherein the highly-expressing rice WAK gene or CNGC gene has a sequence selected from the group consisting of: (1) the nucleic acid sequence as shown in SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 68 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition; and (2) the nucleic acid sequence as shown in SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 or SEQ ID NO: 72 or a portion thereof or a complementary sequence thereof, a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% thereto, or a nucleic acid sequence capable of hybridizing to one of the foregoing sequences under a stringent condition.
38.-40. (canceled)
41. A rice resistant to rice blast, which comprises one or a combination of two or more of the highly-expressing rice WAK or CNGC gene according to claim 37.
42. An editing method for knocking up the expression of an endogenous GH1 gene in a fish, IGF2 (Insulin-like growth factor 2) gene in a pig, or IGF1 (Insulin-like growth factor 1) gene in a chicken embryo fibroblast, characterized in that it comprises fusing the coding region of the GH1, IGF2 or IGF1 gene with a strong endogenous promoter of a fish, pig or chicken in vivo to form a new highly-expressing fish endogenous GH1, pig endogenous IGF2 or chicken endogenous IGF1 gene, respectively; or it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the GH1, IGF2 or IGF1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the GH1, IGF2 or IGF1 gene and the optional strong endogenous promoter to form a new highly-expressing GH1, IGF2 or IGF1 gene, respectively; wherein the strong promoter of a fish is the corresponding fish Col1A1a (Collagen type I alpha 1a) gene promoter, RPS15A (ribosomal protein S15a) gene promoter, Actin promoter or DDX5 [DEAD (Asp-Glu-Ala-Asp) box helicase 5] gene promoter, the strong promoter of a pig is one of the pig TNNI2 and TNNT3 gene promoter, the strong promoter of a chicken is chicken MYBPC1 (myosin binding protein C) gene promoter.
43.-44. (canceled)
45. A highly-expressing fish endogenous GH1 gene, a highly-expressing pig endogenous IGF2 gene or a highly-expressing chicken endogenous IGF1 gene obtainable by the editing method according to claim 42.
46. (canceled)
47. An editing method for knocking up the expression of an endogenous EPO (Erythropoietin) or p53 gene in an animal cell, characterized in that it comprises fusing the coding region of the EPO or p53 gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressing endogenous EPO or p53 gene; or it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the EPO or p53 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the EPO or p53 gene and the optional strong endogenous promoter to form a new highly-expressing EPO or p53 gene.
48. A highly-expressing animal endogenous EPO or p53 gene obtainable by the editing method according to claim 47.
49. (canceled)
50. The method according to claim 1, characterized in that said DNA breaks are achieved by delivering a nuclease with targeting property into a cell of the organism to contact with the specific sites of the genomic DNA; wherein said nuclease with targeting property is selected from the group consisting of Meganuclease, Zinc finger nuclease, TALEN, and CRISPR/Cas system.
51. The method according to claim 50, characterized in that the nucleases with targeting property are delivered into the cell by: 1) a PEG-mediated cell transfection method; 2) a liposome-mediated cell transfection method; 3) an electric shock transformation method; 4) a microinjection; 5) a gene gun bombardment; 6) an Agrobacterium-mediated transformation method; 7) viral vector-mediated transformation method; or 8) nanomagnetic bead mediated transformation method.
52.-57. (canceled)
58. A composition, which comprises: (a) a promoter of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene; (b) a promoter to a 5′ untranslated region of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene; (c) a localization signal region of one of the two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene; (d) DNA regions coding two different functional domains that come from two different functional protein-coding genes; wherein, the combination of gene elements said is not naturally exist, but a joined chromosome segment as designed and stable inheritance; which is fused in vivo; and the different expression patterns are different levels of gene expression, different tissue-specific of gene expression, or different developmental stage-specificities of gene expression; or the different subcellular locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, a mitochondrial location, an endoplasmic reticulum membrane location, and any combination thereof; or the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365]
[0366]
[0367]
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375]
[0376]
[0377]
[0378]
[0379]
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394]
[0395]
[0396]
SPECIFIC MODELS FOR CARRYING OUT THE INVENTION
[0397] The present invention is further described in conjunction with the examples as follows. The following description is just illustrative, and the protection scope of the present invention should not be limited to this.
Example 1: An Editing Method for Knocking Up the Expression of the Endogenous HPPD Gene by Inducing Doubling of Chromosome Fragment in Plant—Rice Protoplast Test
[0398] HPPD was a key enzyme in the pathway of chlorophyll synthesis in plants, and the inhibition of the activity of the HPPD would eventually lead to albino chlorosis and death of plants. Many herbicides, such as mesotrione and topramezone, were inhibitors with the HPPD as the target protein, and thus increasing the expression level of the endogenous HPPD gene in plants could improve the tolerance of the plants to these herbicides. The rice HPPD gene (as shown in SEQ ID NO: 6, in which 1-1067 bp is the promoter, and the rest is the expression region) locates on rice chromosome 2. Through bioinformatic analysis, it was found that rice Ubiquitin2 (hereinafter referred to as UBI2) gene (as shown in SEQ ID NO: 5, in which 1-2107 bp was the promoter, and the rest was the expression region) locates about 338 kb downstream of HPPD gene, and the UBI2 gene and the HPPD gene were in the same direction on the chromosome. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the expression intensity of the UBI2 gene in rice leaves was 3 to 10 times higher than that of the HPPD gene, and the UBI2 gene promoter was a strong constitutively expressed promoter.
[0399] As shown in
[0400] 1. Firstly, the genomic DNA sequences of the rice HPPD and UBI2 genes were input into the CRISPOR online tool (http://crispor.tefor.net/) to search for available editing target sites. After online scoring, the following target sites between the promoters and the CDS regions of HPPD and UBI2 genes were selected for testing:
TABLE-US-00015 OsHPPD-guide RNA1 GTGCTGGTTGCCTTGGCTGC OsHPPD-guide RNA2 CACAAATTCACCAGCAGCCA OsHPPD-guide RNA3 TAAGAACTAGCACAAGATTA OsHPPD-guide RNA4 GAAATAATCACCAAACAGAT
[0401] The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the HPPD gene, close to the start codon of the HPPD protein, and the guide RNA3 and guide RNA4 located between the promoter and CDS region of the UBI2 gene, close to the UBI2 protein initiation codon.
[0402] pHUE411 vector (https://www.addgene.org/62203/) is used as the backbone, and the following primers were designed for the above-mentioned target sites to perform vector construction as described in “Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J. A CRISPR/Cas9 Toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov. 29; 14(1): 327”.
TABLE-US-00016 Primer No. DNA sequence (5′ to 3′) OsHPPD-sgRN ATATGGTCTCGGGCGGTGCTGGTTGCCTTGGCTGCGTTTTAGAGC A1-F TAGAAATAGCAAG OsHPPD-sgRN ATATGGTCTCGGGCGCACAAATTCACCAGCAGCCAGTTTTAGAG A2-F CTAGAAATAGCAAG OsHPPD-sgRN TATTGGTCTCTAAACTAATCTTGTGCTAGTTCTTAGCTTCTTGGT A3-R GCCGCGC OsHPPD-sgRN TATTGGTCTCTAAACATCTGTTTGGTGATTATTTCGCTTCTTGGTG A4-R CCGCGC
[0403] gene editing vectors for the following dual-target combination were constructed following the method provided in the above-mentioned literature. Specifically, with the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) as the template, sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 double target fragments were amplified respectively for constructing the sgRNA expression cassettes. The vectorbackbone of pHUE411 was digested with BsaI, and recovered from the gel, and the target fragment was digested and directly used for the ligation reaction. T4 DNA ligase was used to ligate the vector backbone and the target fragment, and the ligation product was transformed into Trans5α competent cells. Different monoclones were picked and sequenced The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids from the clones with correct sequences, thereby obtaining recombinant plasmids, respectively named as pQY002065, pQY002066, pQY002067, and pQY002068, as follows:
[0404] pQY002065 pHUE411-HPPD-sgRNA1+3 combination of OsHPPD-guide RNA1, guide RNA3
[0405] pQY002066 pHUE411-HPPD-sgRNA1+4 combination of OsHPPD-guide RNA1, guide RNA4
[0406] pQY002067 pHUE411-HPPD-sgRNA2+3 combination of OsHPPD-guide RNA2, guide RNA3
[0407] pQY002068 pHUE411-HPPD-sgRNA2+4 combination of OsHPPD-guide RNA2, guide RNA4
[0408] 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002065-002068 vectors as follows:
[0409] Plasmids were extracted with the Promega Medium Plasmid Extraction Kit (Midipreps DNA Purification System, Promega, A7640) according to the instructions. The specific steps were:
[0410] (1) Adding 5 ml of Escherichia coli to 300 ml of liquid LB medium containing kanamycin, and shaking at 200 rpm, 37° C. for 12 to 16 hours;
[0411] (2) Placing the above bacteria solution in a 500 ml centrifuge tube, and centrifuging at 5,000 g for 10 minutes, discarding the supernatant;
[0412] (3) Adding 3 ml of Cell Resuspension Solution (CRS) to resuspend the cell pellet and vortexing for thorough mixing;
[0413] (4) Adding 3 ml of Cell Lysis Solution (CLS) and mixing up and down slowly for no more than 5 minutes;
[0414] (5) Adding 3 ml of Neutralization Solution and mixed well by overturning until the color become clear and transparent;
[0415] (6) Centrifuging at 14,000 g for 15 minutes, and further centrifuging for 15 minutes if precipitate was not formed compact;
[0416] (7) Transferring the supernatant to a new 50 ml centrifuge tube, avoiding to suck in white precipitate into the centrifuge tube;
[0417] (8) Adding 10 ml of DNA purification resin (Purification Resin, shaken vigorously before use) and mixing well;
[0418] (9) Pouring the Resin/DNA mixture was poured into a filter column, and treating by the vacuum pump negative pressure method (0.05 MPa);
[0419] (10) Adding 15 ml of Column Wash Solution (CWS) to the filter column, and vacuuming.
[0420] (11) Adding 15 ml of CWS, and repeating vacuuming once; vacuuming was extended for 30 s after the whole solution passed through the filter column;
[0421] (12) Cutting off the filter column, transferring to a 1.5 ml centrifuge tube, centrifuging at 12,000 g for 2 minutes, removing residual liquid, and transferring the filter column to a new 1.5 ml centrifuge tube;
[0422] (13) Adding 200 μL of sterilized water preheated to 70° C., and keeping rest for 2 minutes;
[0423] (14) Centrifuging at 12,000 g for 2 minutes to elute the plasmid DNA; and the concentration was generally about 1 μg/μL.
[0424] 3. Preparing Rice Protoplasts and Performing PEG-Mediated Transformation:
[0425] First, rice seedlings for protoplasts were prepared, which is of the variety Nipponbare. The seeds were provided by the Weeds Department of the School of Plant Protection, China Agricultural University, and expanded in house. The rice seeds were hulled first, and the hulled seeds were rinsed with 75% ethanol for 1 minute, treated with 5% (v/v) sodium hypochlorite for 20 minutes, then washed with sterile water for more than 5 times. After blow-drying in an ultra-clean table, they were placed in a tissue culture bottle containing ½ MS medium, 20 seeds for each bottle. Protoplasts were prepared by incubating at 26° C. for about 10 days with 12 hours light.
[0426] The methods for rice protoplast preparation and PEG-mediated transformation were conducted according to “Lin et al., 2018 Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnology Journal https://doi.org/10.1111/pbi.12870”. The steps were as follows:
[0427] (1) the leaf sheath of the seedlings was selected, cut into pieces of about 1 mm with a sharp Geely razor blade, and placed in 0.6 M mannitol and MES culture medium (formulation: 0.6 M mannitol, 0.4 M MES, pH 5.7) for later use. All materials were cut and transferred to 20 ml of enzymatic hydrolysis solution (formulation: 1.5% Cellulase R10/RS (YaKult Honsha), 0.5% Mecerozyme R10 (YaKult Honsha), 0.5M mannitol, 20 mM KCl, 20 mM MES, pH 5.7, 10 mM CaCl.sub.2), 0.1% BSA, 5 mM β-mercaptoethanol), wrapped in tin foil and placed in a 28° C. shaker, enzymatically hydrolyzed at 50 rpm in the dark for about 4 hours, and the speed was increased to 100 rpm in the last 2 minutes;
[0428] (2) after the enzymatic lysis, an equal volume of W5 solution (formulation: 154 mM NaCl, 125 mM CaCl.sub.2), 5 mM KCl, 15 mM MES) was added, shaken horizontally for 10 seconds to release the protoplasts. The cells after enzymatic lysis were filtered through a 300-mesh sieve and centrifuged at 150 g for 5 minutes to collect protoplasts;
[0429] (3) the cells were rinsed twice with the W5 solution, and the protoplasts were collected by centrifugation at 150 g for 5 minutes;
[0430] (4) the protoplasts were resuspended with an appropriate amount of MMG solution (formulation: 3.05 g/L MgCl.sub.2, 1 g/L MES, 91.2 g/L mannitol), and the concentration of the protoplasts was about 2×10.sup.6 cells/mL.
[0431] The transformation of protoplasts was carried out as follows:
[0432] (1) to 200 μL of the aforementioned MMG resuspended protoplasts, endotoxin-free plasmid DNA of high quality (10-20 μg) was added and tapped to mix well;
[0433] (2) an equal volume of 40% (w/v) PEG solution (formulation: 40% (w/v) PEG, 0.5M mannitol, 100 mM CaCl.sub.2)) was added, tapped to mix well, and kept rest at 28° C. in the dark for 15 minutes;
[0434] (3) after the induction of transformation, 1.5 ml of W5 solution was added slowly, tapped to mix the cells well. The cells were collected by centrifugation at 150 g for 3 minutes. This step was repeated once;
[0435] (4) 1.5 ml of W5 solution was added to resuspend the cells, and placed in a 28° C. incubator and cultured in the dark for 12-16 hours. For extracting protoplast genomic DNA, the cultivation should be carried out for 48-60 hours.
[0436] 4. Genome Targeting and Detecting New Gene:
[0437] (1) First, protoplast DNAs were extracted by the CTAB method with some modifications. The specific method was as follows: the protoplasts were centrifuged, then the supernatant was discarded. 500 μL of DNA extracting solution (formulation: CTAB 20 g/L, NaCl 81.82 g/L, 100 mM Tris-HCl (pH 8.0), 20 mM EDTA, 0.2% β-mercaptoethanol) was added, shaken to mix well, and incubated in a 65° C. water bath for 1 hour; when the incubated sample was cooled, 500 μL of chloroform was added and mixed upside down and centrifuged at 10,000 rpm for 10 minutes; 400 μL of the supernatant was transferred to a new 1.5 ml centrifuge tube, 1 ml of 70% (v/v) ethanol was added and the mixture was kept at −20° C. for precipitating for 20 minutes; the mixture was centrifuged at 12,000 rpm for 15 minutes to precipitate the DNA; after the precipitate was air dried, 50 μL of ultrapure water was added and stored at −20° C. for later use.
[0438] (2) The detection primers in the following table were used to amplify the fragments containing the target sites on both sides or the predicted fragments resulting from the fusion of the UBI2 promoter and the HPPD coding region. The lengths of the PCR products were between 300-1000 bp, in which the primer8-F+primer6-R combination was used to detect the fusion fragment at the middle joint after the doubling of the chromosome fragment, and the product length was expected to be 630 bp.
TABLE-US-00017 Primer Sequence (5′ to 3′) OsHPPDduplicated- CACTACCATCCATCCATTTGC primer1-F OsHPPDduplicated- GAGTTCCCCGTGGAGAGGT primer6-R OsHPPDduplicated- TCCATTACTACTCTCCCCGATT primer3-F OsHPPDduplicated- GTGTGGGGGAGTGGATGAC primer7-R OsHPPDduplicated- TGTAGCTTGTGCGTTTCGAT primer5-F OsHPPDduplicated- GGGATGCCCTCTTTGTCC primer2-R OsHPPDduplicated- TCTGTGTGAAGATTATTGCCACT primer8-F OsHPPDduplicated- GGGATGCCCTCCTTATCTTG primer4-R
[0439] The PCR reaction system was as follows:
TABLE-US-00018 Components Volume 2 × 15 buffer solution 5 μL Forward primer (10 μM) 2 μL Reverse primer (10 μM) 2 μL Template DNA 2 μL Ultrapure water Added to 50 μL
[0440] (3) A PCR Reaction was Conducted Under the Following General Reaction Conditions:
TABLE-US-00019 Step Temperature Time Denaturation 98° C. 30 s 98° C. 15 s Amplification for 58° C. 15 s 30-35 cycles 72° C. 30 s Final extension 72° C. 3 min Finished 16° C. 5 min
[0441] (4) The PCR reaction products were detected by 1% agarose gel electrophoresis. The results showed that the 630 bp positive band for the predicted fusion fragment of the UBI2 promoter and the HPPD coding region could be detected in the pQY002066 and pQY002068 transformed samples.
[0442] 5. The positive samples of the fusion fragment of the UBI2 promoter and the HPPD coding region were sequenced for verification, and the OsHPPDduplicated-primer8-F and OsHPPDduplicated-primer6-R primers were used to sequence from both ends. As shown in
Example 2: Creation of Herbicide-Resistant Rice with Knock-Up Expression of Endogenous HPPD Gene by Chromosome Fragment Doubling Through Agrobacterium-Mediated Transformation
[0443] 1. Construction of knock-up editing vector: Based on the results of the protoplast test in Example 1, the dual-target combination OsHPPD-guide RNA1: 5′GTGCTGGTTGCCTTGGCTGC3′ and OsHPPD-guide RNA4: 5′GAAATAATCACCAAACAGAT3′ with a high editing efficiency was selected. The Agrobacterium transformation vector pQY2091 was constructed according to Example 1. pHUE411 was used as the vector backbone and subjected to rice codon optimization. The map of the vector was shown in
[0444] 2. Agrobacterium Transformation of Rice Callus:
[0445] 1) Agrobacterium transformation: 1 μg of the rice knock-up editing vector pQY2091 plasmid was added to 10 μl of Agrobacterium EHA105 heat-shock competent cells (Angyu Biotech, Catalog No. G6040), placed on ice for 5 minutes, immersed in liquid nitrogen for quick freezing for 5 minutes, then removed and heated at 37° C. for 5 minutes, and finally placed on ice for 5 minutes. 500 μl of YEB liquid medium (formulation: yeast extract 1 g/L, peptone 5 g/L, beef extract 5 g/L, sucrose 5 g/L, magnesium sulfate 0.5 g/L) was added. The mixture was placed in a shaker and incubated at 28° C., 200 rpm for 2˜3 hours; the bacteria were collected by centrifugation at 3500 rpm for 30 seconds, the collected bacteria were spread on YEB (kanamycin 50 mg/L+rifampicin 25 mg/L) plate, and incubated for 2 days in an incubator at 28° C.; the single colonies were picked and placed into liquid culture medium, and the bacteria were stored at −80° C.
[0446] 2) Cultivation of Agrobacterium: The single colonies of the transformed Agrobacterium on the YEB plate was picked, added into 20 ml of YEB liquid medium (kanamycin 50 mg/L+rifampicin 25 mg/L), and cultured while stirring at 28° C. until the OD600 was 0.5, then the bacteria cells were collected by centrifugation at 5000 rpm for 10 minutes, 20-40 ml of AAM (Solarbio, lot number LA8580) liquid medium was added to resuspend the bacterial cells to reach OD600 of 0.2-0.3, and then acetosyringone (Solarbio, article number A8110) was added to reach the final concentration of 200 μM for infecting the callus.
[0447] 3) Induction of rice callus: The varieties of the transformation recipient rice were Huaidao 5 and Jinjing 818, purchased from the seed market in Huai'an, Jiangsu, and expanded in house. 800-2000 clean rice seeds were hulled, then washed with sterile water until the water was clear after washing. Then the seeds were disinfected with 70% alcohol for 30 seconds, then 30 ml of 5% sodium hypochlorite was added and the mixture was placed on a horizontal shaker and shaken at 50 rpm for 20 minutes, then washed with sterile water for 5 times. The seeds were placed on sterile absorbent paper, air-dried to remove the water on the surface of the seeds, inoculated on an induction medium and cultivated at 28° C. to obtain callus.
[0448] The formulation of the induction medium: 4.1 g/L N6 powder+0.3 g/L hydrolyzed casein+2.878 g/L proline+2 mg/L 2,4-D+3% sucrose+0.1 g/L inositol+0.5 g glutamine+0.45% phytagel, pH 5.8.
[0449] 4) Infection of rice callus with Agrobacterium: The callus of Huaidao No. 5 or Jinjing 818 subcultured for 10 days with a diameter of 3 mm was selected and collected into a 50 ml centrifuge tube; the resuspension solution of the Agrobacterium AAM with the OD600 adjusted to 0.2-0.3 was poured into the centrifuge tube containing the callus, placed in a shaker at 28° C. at a speed of 200 rpm to perform infection for 20 minutes; when the infection was completed, the bacteria solution was discarded, the callus was placed on sterile filter paper and air-dried for about 20 minutes, then placed on a plate containing co-cultivation medium to perform co-cultivation, on which the plate was covered with a sterile filter paper soaked with AAM liquid medium containing 100 μM acetosyringone; after 3 days of co-cultivation, the Agrobacterium was removed by washing (firstly washing with sterile water for 5 times, then washing with 500 mg/L cephalosporin antibiotic for 20 minutes), and selective cultured on 50 mg/L hygromycin selection medium.
[0450] The formulation of the co-cultivation medium: 4.1 g/L N6 powder+0.3 g/L hydrolyzed casein+0.5 g/L proline+2 mg/L 2,4-D+200 μM AS+10 g/L glucose+3% Sucrose+0.45% phytagel, pH 5.5.
[0451] 3. Molecular Identification and Differentiation into Seedlings of Hygromycin Resistant Callus:
[0452] Different from the selection process of conventional rice transformation, with specific primers of the fusion fragments generated after the chromosome fragment doubling, hygromycin resistant callus could be molecularly identified during the callus selection and culture stage in the present invention, positive doubling events could be determined, and callus containing new genes resulting from fusion of different gene elements was selected for differentiation cultivation and induced to emerge seedlings. The specific steps were as follows:
[0453] 1) The co-cultured callus was transferred to the selection medium for the first round of selection (2 weeks). The formulation of the selection medium is: 4.1 g/L N6 powder+0.3 g/L hydrolyzed casein+2.878 g/L proline+2 mg/L 2,4-D+3% sucrose+0.5 g glutamine+30 mg/L hygromycin (HYG)+500 mg/L cephalosporin (cef)+0.1 g/L inositol+0.45% phytagel, pH 5.8.
[0454] 2) After the first round of selection was completed, the newly grown callus was transferred into a new selection medium for the second round of selection (2 weeks). At this stage, the newly grown callus with a diameter greater than 3 mm was clamped by tweezers to take a small amount of sample, the DNA thereof was extracted with the CTAB method described in Example 1 for the first round of molecular identification. In this example, the primer pair of OsHPPDduplicated-primer8-F (8F) and OsHPPD duplicated-primer6-R (6R) was selected to perform PCR identification for the callus transformed with the pQY2091 vector, in which the reaction system and reaction conditions were similar to those of Example 1. Among the total of 350 calli tested, no positive sample was detected in the calliof Huaidao 5, while 28 positive samples were detected in the calli of Jinjing 818. The PCR detection results of some calli were shown in
[0455] 3) The calli identified as positive by PCR were transferred to a new selection medium for the third round of selection and expanding cultivation; after the diameter of the calli was greater than 5 mm, the callus in the expanding cultivation was subjected to the second round of molecular identification using 8F+6R primer pair, the yellow-white callus at good growth status that was identified as positive in the second round was transferred to a differentiation medium to perform differentiation, and the seedlings of about 1 cm could be obtained after 3 to 4 weeks; the differentiated seedlings were transferred to a rooting medium for rooting cultivation; after the seedlings of the rooting cultivation were subjected to hardening off, they were transferred to a flowerpot with soil and placed in a greenhouse for cultivation. The formulation of the differentiation medium is: 4.42 g/L MS powder+0.5 g/L hydrolyzed casein+0.2 mg/L NAA+2 mg/L KT+3% sucrose+3% sorbitol+30 mg/L hygromycin+0.1 g/L inositol+0.45% phytagel, pH 5.8. The formulation of the rooting medium is: 2.3 g/L MS powder+3% sucrose+0.45% phytagel.
[0456] 4. Molecular Detection of HPPD Doubling Seedlings (T0 Generation):
[0457] After the second round of molecular identification, 29 doubling event-positive calli were co-differentiated to obtain 403 seedlings of T0 generation, and the 8F+6R primer pair was used for the third round of molecular identification of the 403 seedlings, among which 56 had positive bands. The positive seedlings were moved into a greenhouse for cultivation. The PCR detection results of some T0 seedlings were shown in
[0458] 5. HPPD Inhibitory Herbicide Resistance Test for HPPD Doubled Seedlings (T0 Generation):
[0459] The transformation seedlings of T0 generation identified as doubling event positive were transplanted into large plastic buckets in the greenhouse for expanding propagation to obtain seeds of T1 generation. After the seedlings began to tiller, the tillers were taken from vigorously growing strains, and planted in the same pots with the tillers of the wild-type control varieties at the same growth period. After the plant height reached about 20 cm, the herbicide resistance test was conducted. The herbicide used was Bipyrazone (CAS No. 1622908-18-2) produced by our company, and its field dosage was usually 4 grams of active ingredients per mu (4 g a.i./mu). In this experiment, Bipyrazone was applied at a dosage gradient of 2 g a.i./mu, 4 g a.i./mu, 8 g a.i./mu and 32 g a.i./mu with a walk-in spray tower.
[0460] The resistance test results were shown in
[0461] 6. Quantitative Detection of the Relative Expression of the HPPD Gene in the HPPD Doubled Seedlings (T0 Generation):
[0462] It was speculated that the improved resistance of the HPPD gene doubled strain to Bipyrazone was due to the fusion of the strong promoter of UBI2 and the HPPD gene CDS that increased the expression of HPPD, so the T0 generation strains QY2091-13 and QY2091-20 were used to take samples from the primary tillers and the secondary tillers used for herbicide resistance test to detect the expression levels of the HPPD and UBI2 genes, respectively, with the wild-type Jinjing 818 as the control. The specific steps were as follows:
[0463] 1) Extraction of Total RNA (Trizol Method):
[0464] 0.1-0.3 g of fresh leaves were taken and ground into powder in liquid nitrogen. 1 ml of Trizol reagent was added for every 50-100 mg of tissue for lysis; the Trizol lysate of the above tissue was transferred into a 1.5 ml centrifuge tube, stood at room temperature (15-30° C.) for 5 minutes; chloroform was added in an amount of 0.2 ml per 1 ml of Trizol; the centrifuge tube was capped, shaken vigorously in hand for 15 seconds, stood at room temperature (15-30° C.) for 2-3 minutes, then centrifuged at 12000 g (4° C.) for 15 minutes; the upper aqueous phase was removed and placed in anew centrifuge tube, isopropanol was added in an amount of 0.5 ml per 1 ml of Trizol, the mixture was kept at room temperature (15-30° C.) for 10 minutes, then centrifuged at 12000 g (2-8° C.) for 10 minutes; the supernatant was discarded, and 75% ethanol was added to the pellet in an amount of 1 ml per 1 ml of Trizol for washing. The mixture was vortexed, and centrifuged at 7500 g (2-8° C.) for 5 minutes. The supernatant was discarded; the precipitated RNA was dried naturally at room temperature for 30 minutes; the RNA precipitate was dissolved by 50 μl of RNase-free water, and stored in the refrigerator at −80° C. after electrophoresis analysis and concentration determination.
[0465] 2) RNA Electrophoresis Analysis:
[0466] An agarose gel at a concentration of 1% was prepared, then 1 μl of the RNA was taken and mixed with 1 μl of 2× Loading Buffer. The mixture was loaded on the gel. The voltage was set to 180V and the time for electrophoresis was 12 minutes. After the electrophoresis was completed, the agarose gel was taken out, and the locations and brightness of fragments were observed with a UV gel imaging system.
[0467] 3) RNA Purity Detection:
[0468] The RNA concentration was measured with a microprotein nucleic acid analyzer. RNA with a good purity had an OD260/OD280 value between 1.8-2.1. The value lower than 1.8 indicated serious protein contamination, and higher than 2.1 indicated serious RNA degradation.
[0469] 4) Real-Time Fluorescence Quantitative PCR
[0470] The extracted total RNA was reverse transcribed into cDNA with a special reverse transcription kit. The main procedure comprised: first determining the concentration of the extracted total RNA, and a portion of 1-4 μg of RNA was used for synthesizing cDNA by reverse transcriptase synthesis. The resulting cDNA was stored at −20° C.
[0471] {circle around (1)} A solution of the RNA template was prepared on ice as set forth in the following table and subjected to denaturation and annealing reaction in a PCR instrument. This process was conducive to the denaturation of the RNA template and the specific annealing of primers and templates, thereby improving the efficiency of reverse transcription.
TABLE-US-00020 TABLE 1 Reverse transcription, denaturation and annealing reaction system Component Amounts (μl) Oligo dT primer (50 μM) 1 μl dNTP mixture (10 mM each) 1 μl RNA Template l-4 μg RNase free water Added to 10 μL Reaction conditions for denaturation and annealing: 65° C. 5 min 4° C. 5 min
[0472] {circle around (2)} The reverse transcription reaction system was prepared as set forth in Table 2 for synthesizing cDNA:
TABLE-US-00021 TABLE 2 Reverse transcription reaction system Component Amount (μl) Reaction solution after the above 10 μl denaturation and annealing 5× RTase Plus Reaction Buffer 4 μl RNase Inhibitor 0.5 μl Evo M-MLV Plus RTase (200 U/μl) 1 μl RNase free water Added to 20 μL Reaction conditions for cDNA synthesis: 42° C. 60 min 95° C. 5 min
[0473] {circle around (3)} The UBQ5 gene of rice was selected as the internal reference gene, and the synthesized cDNA was used as the template to perform fluorescence quantitative PCR. The primers listed in Table 3 were used to prepare the reaction solution according to Table 4.
TABLE-US-00022 TABLE 3 Sequence (5′ to 3′) of the primer for Fluorescence quantitative PCR UBQ5-F ACCACTTCGACCGCCACTACT UBQ5-R ACGCCTAAGCCTGCTGGTT RT-OsHPPD-F CAGATCTTCACCAAGCCAGTAG RT-OsHPPD-R GAGAAGTTGCCCTTCCCAAA RT-OsUbi2-F CCTCCGTGGTGGTCAGTAAT RT-OsUbi2-R GAACAGAGGCTCGGGACG
TABLE-US-00023 TABLE 4 Reaction solution for real-time quantitative PCR (Real Time PCR) Component of mixture Amount (μl) SYBR Premix ExTaq II 5 μl Forward primer (10 μM) 0.2 μl Reverse primer (10 μM) 0.2 μl cDNA 1 μl Rox II 0.2 μl Ultrapure water 3.4 μl In total 10 μl
[0474] {circle around (4)} The reaction was performed following the real-time quantitative PCR reaction steps in Table 5. The reaction was conducted for 40 cycles.
TABLE-US-00024 TABLE 5 Real-time quantitative PCR reaction steps Temperature (° C.) Time 50° C. 2 min 95° C. 10 min 95° C. 15 s 60° C. 20 s 95° C. 15 s 60° C. 20 s 95° C. 15 s
[0475] 5) Data Processing and Experimental Results
[0476] As shown in Table 6, UBQ5 was used as an internal reference, ΔCt was calculated by subtracting the Ct value of UBQ5 from the Ct value of the target gene, and then 2.sup.−ΔCt was calculated, which represented the relative expression level of the target gene. The 818CK1 and 818CK3 were two wild-type Jinjing 818 control plants; 13M and 20M represented the primary tiller leaf samples of QY2091-13 and QY2091-20 T0 plants; 13 L and 20 L represented the secondary tiller leaf samples of QY2091-13 and QY2091-20 T0 plants used for herbicide resistance testing.
TABLE-US-00025 TABLE 6 Ct values and relative expressionfolds of different genes UBQ5 Mean UBI2 ΔCt 2.sup.−ΔCt Mean HPPD ΔCt 2.sup.−ΔCt Mean 23.27 17.56 −5.88 58.95 20.81 −2.63 6.20 23.55 17.71 −5.73 53.09 21.01 −2.43 5.40 818CK1 23.51 23.44 17.66 −5.78 55.06 55.70 20.98 −2.47 5.52 5.71 23.45 17.88 −5.50 45.20 20.93 −2.44 5.43 23.19 17.94 −5.44 43.41 21.13 −2.24 4.74 818CK3 23.49 23.37 17.72 −5.65 50.26 46.29 21.14 −2.24 4.72 4.96 24.61 19.56 −4.92 30.32 20.23 −4.25 19.07 24.27 19.52 −4.96 31.05 20.29 −4.19 18.28 13M 24.56 24.48 19.16 −5.32 39.97 33.78 20.48 −4.00 15.99 17.78 23.98 18.76 −5.20 36.70 19.02 −4.94 30.64 23.89 18.52 −5.43 43.19 19.07 −4.89 29.56 13L 24.00 23.96 18.81 −5.14 35.34 38.41 19.07 −4.88 29.45 29.88 24.34 19.01 −5.40 42.30 19.37 −5.04 32.98 24.41 19.07 −5.34 40.64 19.33 −5.09 34.05 20M 24.49 24.41 19.29 −5.13 35.00 39.32 19.26 −5.16 35.65 34.22 24.63 19.46 −5.11 34.52 19.88 −4.69 25.83 24.67 19.38 −5.19 36.48 19.91 −4.66 25.31 20L 24.41 24.57 19.42 −5.15 35.61 35.54 19.86 −4.71 26.16 25.77
[0477] The results were shown in
[0478] The above results proved that, following the effective chromosome fragment doubling program as tested in protoplasts, calli and transformed seedlings with doubling events could be selected by multiple rounds of molecular identification during the Agrobacterium transformation and tissue culturing, and the UBI2 strong promoter in the new HPPD gene fusion generated in the transformed seedlings did increase the expression level of HPPD gene, rendering the plants to get resistance to HPPD inhibitory herbicide Bipyrazone, up to 8 times the field dose, and thus a herbicide-resistant rice with knock-up endogenous HPPD gene was created. Taking this as an example, using the chromosome fragment doubling technical solution of Example 1 and Example 2, a desired promoter could also be introduced into an endogenous gene which gene expression pattern should be changed to create a new gene, and a new variety of plants with desired gene expression pattern could be created through Agrobacterium-mediated transformation.
Example 3: Molecular Detection and Herbicide Resistance Test of T1 Generation of Herbicide-Resistant Rice Strain with Knock-Up Expression of the Endogenous HPPD Gene Caused by Chromosome Fragment Doubling
[0479] The physical distance between the HPPD gene and the UBI2 gene in the wild-type rice genome was 338 kb, as shown in Scheme 1 in
[0480] First of all, it was observed that the doubling event had no significant effect on the fertility of T0 generation plants, as all positive T0 strains were able to produce normal seeds. Planting test of T1 generation seedlings were further conducted for the QY2091-13 and QY2091-20 strains.
[0481] 1. Sample Preparation:
[0482] For QY2091-13, a total of 36 T1 seedlings were planted, among which 27 grew normally and 9 were albino. 32 were selected for DNA extraction and detection, where No. 1-24 were normal seedlings, and No. 25-32 were albino seedlings.
[0483] For QY2091-20, a total of 44 T1 seedlings were planted, among which 33 grew normally and 11 were albino. 40 were selected for DNA extraction and detection, where No. 1-32 were normal seedlings, and No. 33-40 were albino seedlings.
[0484] Albino seedlings were observed in the T1 generation plants. It was speculated that, since HPPD was a key enzyme in the chlorophyll synthesis pathway of plants, and the T0 generation plants resulting from the dual-target edition possibly could be chimeras of many genotypes such as doubling, deletion, inversion of chromosome fragments, or small fragment mutation at the edited target site. The albino phenotype could be generated in the plants where the HPPD gene was destroyed, for example, the HPPD CDS region was deleted. Different primer pairs were designed for PCR to determine possible genotypes.
[0485] 2. PCR Molecular Identification:
[0486] 1) Sequences of Detection Primers: Sequence 5′-3′
TABLE-US-00026 Primer 8F: TCTGTGTGAAGATTATTGCCACTAGTTC Primer 6R: GAGTTCCCCGTGGAGAGGT Test 141-F: CCCCTTCCCTCTAAAAATCAGAACAG Primer 4R: GGGATGCCCTCCTTATCTTGGATC Primer 3F: CCTCCATTACTACTCTCCCCGATTC Primer 7R: GTGTGGGGGAGTGGATGACAG pg-Hyg-R1: TCGTCCATCACAGTTTGCCA pg-35S-F: TGACGTAAGGGATGACGCAC
[0487] 2) The binding sites of the above primers were shown in
[0488] 3) PCR reaction system, reaction procedure and gel electrophoresis detection were performed according to Example 1.
[0489] 3. Molecular Detection Results:
[0490] The detection results of doubling and deletion events were shown in Table 7. It could be noted that the chromosome fragment doubling events and deletion events were observed in the T1 generation plants, with different rations among different lines. The doubling events in the QY2091-13 (29/32) were higher than that in the QY2091-20 (21/40), possibly due to the different chimeric ratios in the T0 generation plants. The test results indicated that the fusion gene generated by the doubling was heritable.
TABLE-US-00027 TABLE 7 Detection results of doubling and deletion events QY2091-20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Doubling + − − − + + + − − − + − − − − − + + + − Deletion − − − − − + − − + − − + − − − − − − − − 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Doubling − + − − + − + + + − + + + − + + + + + − Deletion − − + + − + − − − + + − + − + − − − − + QY2091-13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Doubling + − + + + + + − + + + + + + + + + + + + Deletion − + − + + + − + − − + − − − − − − − − + 21 22 23 24 25 26 27 28 29 30 31 32 Doubling − + + + + + + + + + + + Deletion − − + − − + − − + + − +
[0491] The pg-Hyg-R1+pg-35S-F primers were used to detect the T-DNA fragment of the editing vector for the above T1 seedlings. The electrophoresis results of the PCR products of QY2091-20-17 and QY2091-13-7 were negative for the T-DNA fragment, indicating that it was a homozygous doubling. It could be seen that doubling-homozygous non-transgenic strains could be segregated from the T1 generation of the doubling events.
[0492] 4. Detection of Editing Events by Sequencing:
[0493] The doubling fusion fragments were sequenced for the doubling-homozygous positive T1 generation samples 1, 5, 7, 11, 18 and 19 for QY2091-20 and for the doubling-homozygous positive T1 samples 1, 3, 7, 9, 10 and 12 for QY2091-13. The left target site of the HPPD gene and the right target site of the UBI2 were amplified at the same time for sequencing to detect the editing events at the target sites. Among them, the Primer 3F+Primer 7R were used to detect the editing event of the left HPPD target site, where the wild-type control product was 481 bp in length; the Primer 8F+Primer 4R were used to detect the editing event of the right UBI2 target site, where the wild-type control product was 329 bp in length.
[0494] 1) Genotype of the Doubling Events:
[0495] The sequencing result of the HPPD doubling in QY2091-13 was shown in SEQ ID NO: 18, and the sequencing result of the HPPD doubling in QY2091-20 was shown in SEQ ID NO: 19, see
[0496] 2) Editing Events at the Original HPPD and UBI2 Target Sites on Both Sides:
[0497] There were more types of editing events at the target sites on both sides. In two lines, three editing types occurred in the HPPD promoter region, namely insertion of single base, deletion of 17 bases, and deletion of 16 bases; and two editing types occurred in the UBI2 promoter region, namely insertion of 7 bases and deletion of 3 bases. The T1 plants used for testing and sampling were all green seedlings and grew normally, indicating that small-scale mutations in these promoter regions had no significant effect on gene function, and herbicide-resistant rice varieties could be selected from their offspring.
[0498] 5. Herbicide Resistance Test on Seedlings of T1 Generation:
[0499] The herbicide resistance of the T1 generation of the QY2091 HPPD doubled strain was tested at the seedling stage. After the T1 generation seeds were subjected to surface disinfection, they germinated on ½ MS medium containing 1.2 μM Bipyrazone, and cultivated at 28° C., 16 hours light/8 hours dark, in which wild-type Jinjing 818 was used as a control.
[0500] The test results of resistance were shown in
Example 4: An Editing Method for Knocking Up the Expression of the Endogenous PPO Gene by Inducing Chromosome Fragment Inversion—Rice Protoplast Test
[0501] The rice PPO1 (also known as PPOX1) gene (as shown in SEQ ID NO: 7, in which 1-1065 bp was the promoter, the rest was the coding region) was located on chromosome 1, and the calvin cycle protein CP12 gene (as shown in SEQ ID NO: ID NO: 8, in which 1-2088 bp was the promoter, and the rest was the coding region) was located 911 kb downstream of the PPO1 gene with opposite directions. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the expression intensity of the CP12 gene in rice leaves was 50 times that of the PPO1 gene, and the CP12 gene promoter was a strong promoter highly expressing in leaves.
[0502] As shown in Scheme 1 of
[0503] 1. First, the rice PPO1 and CP12 genomic DNA sequences were input into the CRISPOR online tool (http://crispor.tefor.net/) to search for available editing target sites. After online scoring, the following target sites were selected between the promoters and the CDS regions of the PPO1 and CP12 genes for testing:
TABLE-US-00028 Name of target sgRNA Sequence (5′ to 3) OsPPO-guide RNA1 CCATGTCCGTCGCTGACGAG OsPPO-guide RNA2 CCGCTCGTCAGCGACGGACA OsPPO-guide RNA3 GCCATGGCTGGCTGTTGATG OsPPO-guide RNA4 CGGATTTCTGCGTGTGATGT
[0504] The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the PPO1 gene, close to the PPO1 start codon, and the guide RNA3 and guide RNA4 located between the promoter and the CDS region of the CP12 gene, close to the CP12 start codon.
[0505] As described in Example 1, primers were designed for the above target sites to construct dual-tar et vectors, with HUE411 as the backbone:
TABLE-US-00029 Primer No. DNA sequence (5′ to 3′) OsPPO1- ATATGGTCTCGGGCGCCATGTCCGTCGCTGACGAGGT sgRNA1-F TTTAGAGCTAGAAATAGCAAG OsPPO1- ATATGGTCTCGGGCGCCGCTCGTCAGCGACGGACAGT sgRNA2-F TTTAGAGCTAGAAATAGCAAG OsPPO1- TATTGGTCTCTAAACCATCAACAGCCAGCCATGGCGC sgRNA3-R TTCTTGGTGCCGCGCCTC OsPPO1- TATTGGTCTCTAAACACATCACACGCAGAAATCCGGC sgRNA4-R TTCTTGGTGCCGCGCCTC
[0506] Specifically, the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) was used as the template to amplify the sgRNA1+3, sgRNA1+4, sgRNA2+3, sgRNA2+4 dual-target fragments and construct sgRNA expression cassettes, respectively. The pHUE411 vector backbone was digested with BsaI and recovered from gel, and the target fragment was directly used for the ligation reaction after digestion. T4 DNA ligase was used to ligate the vector backbone and the target fragment, the ligation product was transformed into Trans5α competent cells, different monoclones were selected and sequenced. The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids with correct sequencing results, thereby obtaining recombinant plasmids, respectively named as pQY002095, pQY002096, pQY002097, pQY002098, as shown below:
[0507] pQY002095 pHUE411-PPO-sgRNA1+3 containing OsPPO-guide RNA1, guide RNA3 combination
[0508] pQY002096 pHUE411-PPO-sgRNA2+3 containing OsPPO-guide RNA2, guide RNA3 combination
[0509] pQY002097 pHUE411-PPO-sgRNA1+4 containing OsPPO-guide RNA1, guide RNA4 combination
[0510] pQY002098 pHUE411-PPO-sgRNA2+4 containing OsPPO-guide RNA2, guide RNA4 combination
[0511] 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002095-002098 vectors as described in the step 2 of Example 1.
[0512] 3. Rice protoplasts were prepared and subjected to PEG-mediated transformation with the above-mentioned vectors as described in step 3 of Example 1.
[0513] 4. Genomic targeting and detection of new gene with the detection primers shown in the table below for the PCR detection as described in the step 4 of Example 1.
TABLE-US-00030 Primer Sequence (5′ to 3′) OsPPOinversion- GCTATGCCGTCGCTCTTTC checkF1(PPO-F1) TC OsPPOinversion- CGGACTTATTCCCACCAGA checkF2(PPO-F2) A OsPPOinversion- GAGAAGGGGAGCAAGAAGA checkR1(PPO-R1) CGT OsPPOinversion- AAGGCTGGAAGCTGTTGGG checkR2(PPO-R2) OsCPinversion- CATTCCACCAAACTCCCCT checkF1(CP-F1) CTG OsCPinversion- AGGTCTCCTTGAGCTTGTC checkF2(CP-F2) G OsCPinversion- GTCATCTGCTCATGTTTTC checkR1(CP-R1) ACGGTC OsCPinversion- CTGAGGAGGCGATAAGAAA checkR2(CP-R2) CGA
[0514] Among them, the combination of PPO-R2 and CP-R2 was used to amplify the CP12 promoter-driven PPO1 CDS new gene fragment that was generated on the right side after chromosome fragment inversion, and the combination of PPO-F2 and CP-F2 was used to amplify the PPO1 promoter-driven CP12 CDS new gene fragment that was generated on the left side after inversion. The possible genotypes resulting from the dual-target editing and the binding sites of the molecular detection primers were shown in
[0515] 5. The PCR and sequencing results showed that the expected new gene in which the CP12 promoter drove the expression of PPO1 was created from the transformation of rice protoplasts. The editing event where the rice CP12 gene promoter was fused to the PPO1 gene expression region could be detected in the genomic DNA of the transformed rice protoplasts. This indicated that the scheme to form a new PPO gene through chromosome fragment inversion was feasible, and a new PPO gene driven by a strong promoter could be created, which was defined as a PPO1 inversion event. The sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 15; the sequencing results for the chromosome fragment deletion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 16; and the sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002098 vector were shown in SEQ ID NO: 17.
Example 5: Creation of Herbicide-Resistant Rice with Knock-Up Expression of the Endogenous PPO Gene Caused by Chromosome Fragment Inversion Through Agrobacterium-Mediated Transformation
[0516] 1. Construction of knock-up editing vector: Based on the results of the protoplast testing, the dual-target combination of OsPPO-guide RNA1: 5′CCATGTCCGTCGCTGACGAG3′ and OsPPO-guide RNA4: 5′CGGATTTCTGCGT-GTGATGT3′ with high editing efficiency was selected to construct the Agrobacterium transformation vector pQY2234. pHUE411 was used as the vector backbone and the rice codon optimization was performed. The vector map was shown in
[0517] 2. Agrobacterium Transformed Rice Callus and Two Rounds of Molecular Identification:
[0518] The pQY2234 plasmid was used to transform rice callus according to the method described in step 2 of Example 2. The recipient varieties were Huaidao No. 5 and Jinjing 818. In the callus selection stage, two rounds of molecular identification were performed on hygromycin-resistant callus, and the calli positive in inversion event were differentiated. During the molecular detection of callus, the amplification of the CP12 promoter-driven PPO1 CDS new gene fragment generated on the right side after chromosome fragment inversion by the combination of PPO-R2 and CP-R2 was deemed as the positive standard for the inversion event, while the CP12 new gene generated on the left side after inversion was considered after differentiation and seedling emergence of the callus. A total of 734 calli from Huaidao No. 5 were tested, in which 24 calli were positive for the inversion event, and 259 calli from Jinjing 818 were tested, in which 29 calli were positive for the inversion event.
[0519] 3. A total of 53 inversion event-positive calli were subjected to two rounds of molecular identification and then co-differentiated, and 9 doubling event-positive calli were identified, which were subjected to two rounds of molecular identification and then co-differentiated to produce 1,875 T0 seedlings, in which 768 strains were from Huaidao No. 5 background, and 1107 strains were from Jinjing 818 background. These 1875 seedlings were further subjected to the third round of molecular identification with the PPO-R2 and CP-R2 primer pair, in which 184 lines from Huaidao No. 5 background showed inversion-positive bands, 350 strains from Jinjing 818 background showed inversion-positive bands. The positive seedlings were moved to the greenhouse for cultivation.
[0520] 4. PPO Inhibitory Herbicide Resistance Test of PPO1 Inversion Seedlings (T0 Generation):
[0521] Transformation seedlings of QY2234 T0 generation identified as inversion event-positive were transplanted into large plastic buckets in the greenhouse to grow seeds of T1 generation. There were a large number of positive seedlings, so some T0 seedlings and wild-type control lines with similar growth period and status were selected. When the plant height reached about 20 cm, the herbicide resistance test was directly carried out. The herbicide used was a high-efficiency PPO inhibitory herbicide produced by the company (“Compound A”). In this experiment, the herbicide was applied at the gradients of three levels, namely 0.18, 0.4, and 0.6 g ai/mu, by a walk-in type spray tower.
[0522] The resistance test results were shown in
[0523] 5. Quantitative Detection of Relative Expression Level of PPO1 Gene in PPO1 Inversion Seedlings (T0 Generation):
[0524] It was speculated that the increased resistance of the PPO1 gene inversion lines to Compound A was due to the fusion of the strong CP12 promoter and the CDS of the PPO1 gene which would increase the expression level of PPO1. Therefore, the lines of T0 generation QY2234-252, QY2234-304 and QY2234-329 from Huaidao No. 5 background were selected, their primary tillers and secondary tillers were sampled and subjected to the detection of expression levels of PPO1 and CP12 genes. The wild-type Huaidao No. 5 was used as the control. The specific protocols followed step 6 of Example 2, with the rice UBQ5 gene as the internal reference gene. the fluorescence quantitative primers were as follows: 5′-3′
TABLE-US-00031 UBQ5-F ACCACTTCGACCGCCACTACT UBQ5-R ACGCCTAAGCCTGCTGGTT RT-OsPPO1-F GCAGCAGATGCTCTGTCAATA RT-OsPPO1-R CTGGAGCTCTCCGTCAATTAAG RT-OsCP12-F1 CCGGACATCTCGGACAA RT-OsCP12-R1 CTCAGCTCCTCCACCTC
[0525] The UBQ5 was used as an internal reference. ΔCt was calculated by subtracting the Ct value of UBQ5 from the Ct value of the target gene. Then 2.sup.−ΔCt was calculated, which represented the relative expression level of the target gene. The H5CK1 and H5CK2 were two wild-type control plants of Huaidao No. 5, the 252M, 304M and 329M represented the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 T0 plants, and the 252 L, 304 L, and 329 L represented their secondary tiller leaf samples. The results were shown in Table 8 below:
TABLE-US-00032 TABLE 8 Ct values and relative expression folds of different genes UBQ5 Mean PPO1 ΔCt 2.sup.−ΔCt Mean CP12 ΔCt 2.sup.−ΔCt Mean 28.18 25.83 −2.43 5.39 22.28 −3.98 15.77 28.37 25.98 −2.28 4.85 22.06 −4.20 18.44 H5CK1 28.23 28.26 25.93 −2.33 5.03 5.09 22.11 −4.15 17.76 17.32 28.23 25.73 −2.36 5.15 21.63 −6.47 88.58 27.98 26.02 −2.07 4.20 21.53 −6.57 94.87 H5CK2 28.07 28.09 25.92 −2.18 4.52 4.62 21.54 −6.55 93.83 92.43 25.51 25.17 −0.54 1.45 22.26 −3.45 10.95 25.82 25.22 −0.49 1.41 22.36 −3.36 10.23 252M 25.80 25.71 25.22 −0.49 1.41 1.42 22.43 −3.29 9.76 10.31 26.41 23.36 −3.14 8.84 22.30 −4.21 18.49 26.64 23.41 −3.10 8.56 21.95 −4.56 23.55 252L 26.47 26.51 23.46 −3.05 8.28 8.56 21.78 −4.73 26.47 22.84 25.74 24.55 −1.29 2.44 22.51 −3.32 10.02 25.99 24.53 −1.31 2.48 22.45 −3.39 10.47 304M 25.78 25.84 24.48 −1.36 2.57 2.50 22.56 −3.28 9.71 10.07 25.97 23.63 −2.36 5.14 21.60 −4.39 20.97 26.00 23.75 −2.25 4.74 21.43 −4.56 23.55 304L 26.00 25.99 23.56 −2.43 5.39 5.09 22.32 −3.68 12.78 19.10 26.94 23.11 −3.89 14.84 22.23 −4.76 27.16 26.99 23.25 −3.75 13.42 21.85 −5.15 35.39 329M 27.07 27.00 23.22 −3.78 13.71 13.99 21.82 −5.18 36.29 32.95 26.50 23.64 −2.63 6.19 22.00 −4.27 19.30 26.52 23.74 −2.53 5.79 21.97 −4.30 19.71 329L 25.79 26.27 23.77 −2.50 5.65 5.87 22.15 −4.12 17.42 18.81
[0526] The relative expression levels of PPO1 and CP12 in different strains were shown in
[0527] The above results proved that, following the scheme of detecting effective chromosome fragment inversion in protoplasts, calli and transformed seedlings with inversion events could be selected through the multiple rounds of molecular identification during the Agrobacterium transformation and tissue culturing, and the CP12 strong promoter fused with the new PPO1 gene generated in the transformant seedlings could indeed increase the expression level of the PPO1 gene, which could confer the plants with resistance to the PPO inhibitory herbicide Compound A, thereby herbicide-resistant rice with knock-up endogenous PPO gene was created. Taking this as an example, the chromosome fragment inversion protocol of Example 4 and Example 5 also applied to other endogenous genes which gene expression pattern needed to be changed by introducing and fusing with a required promoter, thereby a new gene can be created, and new varieties with a desired gene expression pattern could be created through Agrobacterium-mediated transformation in plants.
Example 6: Molecular Detection and Herbicide Resistance Test of the T1 Generation Plants of the Herbicide-Resistant Rice Lines with Knock-Up Expression of the Endogenous PPO1 Gene Through Chromosome Fragment Inversion
[0528] The physical distance between the wild-type rice genome PPO1 gene and CP12 gene was 911 kb. As shown in
[0529] First of all, it was observed that the inversion event had no significant effect on the fertility of the T0 generation plants, as all positive T0 strains were able to produce seeds normally. The T1 generations of QY2234/H5-851 strains with the Huaidao No. 5 background were selected for detection.
[0530] 1. Sample Preparation:
[0531] For QY2234/H5-851, a total of 48 T1 seedlings were planted. All the plants grew normally.
[0532] 2. PCR molecular Identification:
[0533] 1) Detection Primer Sequence: 5′-3′
TABLE-US-00033 PPO-R2: AAGGCTGGAAGCTGTTGGG CP-R2: CTGAGGAGGCGATAAGAAACGA PPO-F2: CGGACTTATTTCCCACCAGAA CP-F2: AGGTCTCCTTGAGCTTGTCG pg-Hyg-R1: TCGTCCATCACAGTTTGCCA pg-35S-F: TGACGTAAGGGATGACGCAC
[0534] 2) The binding sites of the above primers were shown in
[0535] 3) PCR reaction system and reaction conditions:
[0536] Reaction System (10 μL System):
TABLE-US-00034 2*KOD buffer 5 μL 2 mM dNTPs 2 μL KOD enzyme 0.2 μL Primer F 0.2 μL Primer R 0.2 μL Water 2.1 μL Sample 0.3 μL
[0537] Reaction Conditions:
TABLE-US-00035 94° C. 2 minutes 98° C. 20 seconds 60° C. 20 seconds {close oversize brace} 40 cycles 68° C. 20 seconds 68° C. 2 minutes 12° C. 5 minutes
[0538] The PCR products were subjected to electrophoresis on a 1% agarose gel with a voltage of 180V for 10 minutes.
[0539] 3. Molecular Detection Results:
[0540] The detection results were shown in Table 9. A total of 48 plants were detected, of which 12 plants (2/7/11/16/26/36/37/40/41/44/46/47) were homozygous in inversion, 21 plants (1/3/4/5/6/8/9/15/17/20/22/23/24/27/30/31/33/34/39/42/43) were heterozygous in inversion, and 15 plants (10/12/13/14/18/19/21/25/28/29/32/35/38/45/48) were homozygous in non-inversion. The ratio of homozygous inversion: heterozygous inversion:homozygous non-inversion was 1:1.75:1.25, approximately 1:2:1. So the detection results met the Mendel's law of inheritance, indicating that the new PPO1 gene generated by inversion was heritable.
TABLE-US-00036 TABLE 9 Results of molecular detection QY2234-851 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Right side of + + + + + + + + + − + − − − + + + − − + inversion Left side of + + + + + + + + + − + − − − + + + − − + inversion PPO WT + − + + + + − + + + − + + + + − + + + + CP12 WT + − + + + + − + + + − + + + + − + + + + QY2234-851 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Right side of − + + + − + + − − + + − + + − + + − + + inversion Left side of − + + + − + + − − + + − + + − + + − + + inversion PPO WT + + + + + − + + + + + + + + + − − + + − CP12 WT + + + + + − + + + + + + + + + − − + + − QY2234-851 41 42 43 44 45 46 47 48 Right side of + + + + − + + − inversion Left side of + + + + − + + − inversion PPO WT − + + − + − − + CP12 WT − + + − + − − +
[0541] For the above T1 seedlings, the Pg-Hyg-R1+pg-35S-F primers were used to detect the T-DNA fragment of the editing vector. The electrophoresis results of 16 and 41 were negative for T-DNA fragment, indicating homozygous inversion. It could be seen that non-transgenic strains of homozygous inversion could be segregated from the T1 generation of the inversion event.
[0542] 4. Sequencing Detection of the Editing Events:
[0543] The genotype detection of the inversion events focused on the editing events of the new PPO gene on the right side. The mutation events with the complete protein coding frame of the PPO1 gene were retained. The CP12 site editing events on the left side that did not affect the normal growth of plants through the phenotype observation in the greenhouse and field were retained. The genotypes of the editing events detected in the inversion event-positive lines were listed below, in which seamless indicated identical to the predicted fusion fragment sequence after inversion. The genotypes of the successful QY2234 inversion events in Huaidao No. 5 background were as follows:
TABLE-US-00037 No. Genotype No. Genotype 2234/H5-295 Right side −1 bp; 2234/H5-650 Right side seamless; left side −32 bp left side +1 bp (G) 2234/H5-381 Right side +18 bp 2234/H5-263 Right side seamless; left side seamless 2234/H5-410 Right side −1 bp; 2234/H5-555 Right side −23 bp left side +1 bp 2234/H5-159 Right side −16 bp 2234/H5-645 Right side −5 bp, +20 bp, 2234/H5-232 Right side −4 bp
[0544] Some of the sequencing peak maps and sequence comparison results were shown in
[0545] The genotypes of the successful QY2234 inversion in the Jinjing818 background were as follows:
TABLE-US-00038 Right side PPO Right side PPO No. genotype No. genotype 2234/818-5 Right side seamless 2234/818-144 Right side +1 bp 2234/818-42 Right side −16 bp 2234/818-151 Sight side +2 bp, −26 bp, pure peak 2234/818-108 Right side −15 bp 2234/818-257 Sight side +1 bp 2234/818-134 Right side +5 bp, −15 bp
[0546] Some of the sequencing peak maps and sequence comparison results were shown in
[0547] The sequencing results of the above different new PPO1 genes with the CP12 promoter fused to the PPO1 coding region were shown in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.
[0548] 5. Herbicide Resistance Test of T1 Generation Seedlings:
[0549] The herbicide resistance test was performed on the T1 generation of the QY2234/H5-851 PPO1 inversion lines at seedling stage. The wild-type Huaidao No. 5 was used as a control, and planted simultaneously with the T1 generation seeds of the inversion lines. When the seedlings reached a plant height of 15 cm, Compound A was applied by spraying at four levels of 0.3, 0.6, 0.9 and 1.2 g a.i./mu. The culture conditions were 28° C., with 16 hours of light and 8 hours of darkness.
[0550] The resistance test results were shown in
Example 7: An Editing Method for Knocking Up the Expression of the Endogenous EPSPS Gene in Plant
[0551] EPSPS was a key enzyme in the pathway of aromatic amino acid synthesis in plants and the target site of the biocidal herbicide glyphosate. The high expression level of EPSPS gene could endow plants with resistance to glyphosate. The EPSPS gene (as shown in SEQ ID NO: 4, in which 1-1897 bp was the promoter, and the rest was the expression region) was located on chromosome 6 in rice. The gene upstream was transketolase (TKT, as shown in SEQ ID NO: 3, in which 1-2091 bp was the promoter, and the rest was the expression region) with an opposite direction. The expression intensity of TKT gene in leaves was 20-50 times that of the EPSPS gene. As shown in
TABLE-US-00039 TABLE 10 Distance between the EPSPS gene and the adjacent TKT gene in different plants Distance from CDS region Location start site Species (chromosome) (kb) Direction Rice 6 4 Reverse <TKT-EPSPS> Wheat 7A 35 Reverse <TKT-EPSPS> 7D 15 Reverse <TKT-EPSPS> 4A? 50 Reverse <TKT-EPSPS> Maize 9 22 Reverse <TKT-EPSPS> Brachypodium 1 5 Reverse <TKT-EPSPS> distachyon Sorghum 10 15 Reverse <TKT-EPSPS> Millet 4 5 Reverse <TKT-EPSPS> Soybean 3 6 Forward TKT>EPSPS> Tomato 5 6 Forward TKT>EPSPS> Peanut 2 6 Forward TKT>EPSPS> 12 5 Forward TKT>EPSPS> Cotton 9 22 Forward TKT>EPSPS> Alfalfa 4 8 Forward TKT>EPSPS> Arabidopsis 2 5 Forward TKT>EPSPS> Grape 15 17 Forward TKT>EPSPS>
[0552] To this end, pHUE411 was used as the backbone, and the following as targets:
TABLE-US-00040 Name of target sgRNA Sequence (5′ to 3′) OsEPSPS-guide RNA1 CCACACCACTCCTCTCGCCA OsEPSPS-guide RNA2 CCATGGCGAGAGGAGTGGTG OsEPSPS-guide RNA3 ATGGTCGCCGCCATTGCCGG OsEPSPS-guide RNA4 GACCTCCACGCCGCCGGCAA OsEPSPS-guide RNA5 TAGTCATGTGACCATCCCTG OsEPSPS-guide RNA6 TTGACTCTTTGGTTCATGCT
[0553] Several different dual-target vectors had been constructed: [0554] pQY002061 pHUE411-EPSPS-sgRNA1+3 [0555] pQY002062 pHUE411-EPSPS-sgRNA2+3 [0556] pQY002063 pHUE411-EPSPS-sgRNA1+4 [0557] pQY002064 pHUE411-EPSPS-sgRNA2+4 [0558] pQY002093 pHUE411-EPSPS-sgRNA2+5 [0559] pQY002094 pHUE411-EPSPS-sgRNA2+6
[0560] (2) With the relevant detection primers shown in the following table, the fragments containing the target sites on both sides or the predicated fragments generated by the fusion of the TKT promoter and the EPSPS coding region were amplified, and the length of the products is between 300-1000 bp.
TABLE-US-00041 Primer Sequence (5′ to 3′) EPSPSinversion checkF1 ATCCAAGTTACCCCCTCTGC EPSPSinversion checkR1 CACAAACACAGCCACCTCAC EPSPSinversion check-nestF2 ATGTCCACGTCCACACCATA EPSPSinversion check-nestR2 AATGGAATTCACGCAAGAGG EPSPSinversion checkF3 GTAGGGGTTCTTGGGGTTGT EPSPSinversion checkR3 CGCATGCTAACTTGAGACGA EPSPSinversion check-nestF4 GGATCGTGTTCACCGACTTC EPSPSinversion check-nestR4 CCGGTACAACGCACGAGTAT EPSPSinversion checkF5 GGCGTCATTCCATGGTTGAT TGT EPSPSinversion checknestF6 GATAGACCCAGATGGGCATA GAATC EPSPSinversion checkR5 TGCATGCATTGATGGTTGGT GC EPSPSinversion checknestR6 CCGGCCCTTAGAATAAAGGT AGTAG
[0561] After protoplast transformation, the detection results showed that the expected inversion events were obtained. As shown in
[0562] These vectors were transferred into Agrobacterium for transforming calli of rice. Plants containing the new EPSPS gene were obtained. The herbicide bioassay results showed that the plants had obvious resistance to glyphosate herbicide.
Example 8: An Editing Method for Knocking Up the Expression of the Endogenous PPO Gene in Arabidopsis
[0563] Protoporphyrinogen oxidase (PPO) was one of the main targets of herbicides. By highly expressing plant endogenous PPO, the resistance to PPO inhibitory herbicides could be significantly increased. The Arabidopsis PPO gene (as shown in SEQ ID NO: 1, in which 1-2058 bp was the promoter, and the rest was the expression region) located on chromosome 4, and the ubiquitin10 gene (as shown in SEQ ID NO: 2, in which 1-2078 bp was the promoter, and the rest was the expression region) located 1.9M downstream with the same direction as the PPO gene.
[0564] As shown in the Scheme as shown in
[0565] To this end, pHEE401E was used as the backbone (https://www.addgene.org/71287/), and the following locations were used as target sites:
TABLE-US-00042 Name of target sgRNA Sequence (5′ to 3′) AtPPO-guide RNA1 CAAACCAAAGAAAAAGTATA AtPPO-guide RNA2 GGTAATCTTCTTCAGAAGAA AtPPO-guide RNA3 ATCATCTTAATTCTCGATTA AtPPO-guide RNA4 TTGTGATTTCTATCTAGATC
[0566] The dual-target vectors were constructed following the method described by “Wang Z P, Xing H L, Dong L, Zhang H Y, Han C Y, Wang X C, Chen Q J. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul. 21; 16:144.”:
TABLE-US-00043 pQY002076 pHEE401E-AtPPO-sgRNA1 + 3 pQY002077 pHEE401E-AtPPO-sgRNA1 + 4 pQY002078 pHEE401E-AtPPO-sgRNA2 + 3 pQY002079 pHEE401E-AtPPO-sgRNA2 + 4
[0567] Arabidopsis was transformed according to the method as follows:
[0568] (1) Agrobacterium Transformation
[0569] Agrobacterium GV3101 competent cells were transformed with the recombinant plasmids to obtain recombinant Agrobacterium.
[0570] (2) Preparation of Agrobacterium Infection Solution
[0571] 1) Activated Agrobacterium was inoculated in 30 ml of YEP liquid medium (containing 25 mg/L Rif and 50 mg/L Kan), cultured at 28° C. under shaking at 200 rpm overnight until the OD600 value was about 1.0-1.5.
[0572] 2) The bacteria were collected by centrifugation at 6000 rpm for 10 minutes, and the supernatant was discarded.
[0573] 3) The bacteria were resuspended in the infection solution (no need to adjust the pH) to reach OD600=0.8 for later use.
[0574] (3) Transformation of Arabidopsis
[0575] 1) Before the plant transformation, the plants shouldgrow well with luxuriant inflorescence and no stress response. The first transformation could be carried out as long as the plant height reached 20 cm. When the soil was dry, watering was carried out as appropriate. On the day before the transformation, the grown siliques were cut with scissors.
[0576] 2) The inflorescence of the plant to be transformed was immersed in the above solution for 30 seconds to 1 minute with gentle stirring. The infiltrated plant should have a layer of liquid film thereon.
[0577] 3) After transformation, the plant was cultured in the dark for 24 hours, and then removed to a normal light environment for growth.
[0578] 4) After one week, the second transformation was carried out in the same way.
[0579] (4) Seed Harvest
[0580] Seeds were harvested when they were mature. The harvested seeds were dried in an oven at 37° C. for about one week.
[0581] (5) Selection of Transgenic Plants
[0582] The seeds were treated with disinfectant for 5 minutes, washed with ddH.sub.2O for 5 times, and then evenly spread on MS selection medium (containing 30 μg/ml Hyg, 100 μg/ml Cef). Then the medium was placed in a light incubator (at a temperature of 22° C., 16 hours of light and 8 hours of darkness, light intensity 100-150 μmol/m.sup.2/s, and a humidity of 75%) for cultivation. The positive seedlings were selected and transplanted to the soil after one week.
[0583] (6) Detection of T1 Mutant Plants
[0584] (6.1) Genomic DNA Extraction
[0585] 1) About 200 mg of Arabidopsis leaves was cut and placed into a 2 ml centrifuge tube. Steel balls were added, and the leaves were ground with a high-throughput tissue disruptor.
[0586] 2) After thorough grinding, 400 μL of SDS extraction buffer was added and mixed upside down. The mixture was incubated in 65° C. water bath for 15 minutes, and mixed upside down every 5 minutes during the period.
[0587] 3) The mixture was centrifuged at 13000 rpm for 5 minutes.
[0588] 4) 300 μL of supernatant was removed and transferred to a new 1.5 ml centrifuge tube, an equal volume of isopropanol pre-cooled at −20° C. was added into the centrifuge tube, and then the centrifuge tube was kept at −20° C. for 1 hour or overnight.
[0589] 5) The mixture was centrifuged at 13000 rpm for 10 minutes, and the supernatant was discarded.
[0590] 6) 500 μL of 70% ethanol was added to the centrifuge tube to wash the precipitate, the washing solution was discarded after centrifugation (carefully not discarding the precipitate). After the precipitate was dried at room temperature, 30 μL of ddH.sub.2O was added to dissolve the DNA, and then stored at −20° C.
[0591] (6.2) PCR Amplification
[0592] With the extracted genome of the T1 plant as template, the target fragment was amplified with the detection primers. 5 μL of the amplification product was taken and detected by 1% agarose gel electrophoresis, and then imaged by a gel imager. The remaining product was directly sequenced by a sequencing company.
[0593] The sequencing results showed that the AtPPO1 gene doubling was successfully achieved in Arabidopsis, and the herbicide resistance test showed that the doubling plant had resistance to PPO herbicides.
Example 9: Creation of GH1 Gene with New Expression Characteristics in Zebrafish
[0594] The growth hormone (GH) genes in fishes controlled their growth and development speed. At present, highly expressing the GH gene in Atlantic salmons through the transgenic technology could significantly increase their growth rates. The technique was of great economical value, but only approved for marketing after decades. The GH1 gene was the growth hormone gene in zebrafish. In the present invention, suitable promoters in zebrafish (suitable in terms of continuous expression, strength, and tissue specificity) were fused together with the CDS region of GH1 gene in vivo through deletion, inversion, doubling, inversion doubling, chromosome transfer, etc., to create a fast-growing fish variety.
[0595] The experiment procedure was as follows:
[0596] 1. Breeding of Zebra Fish:
[0597] 1) Preparation of paramecia: The mother liquor of paramecia was purchased online (https://item.taobao.com/item.htm?spm=a230r. 1.14.49.79f774c6C6elpL&id=573612042855 &ns=1&abbucket=18 #detail). A 2 L beaker was washed, sterilized and filled with 200 mL of paramecia mother liquor; two yeast pieces and two sterilized grains of wheat were added thereto; sterile water was added until the volume reaches 2 L; then the opening was covered and sealed with sterilized kraft paper; stationary culture was performed at 25-28° C. for 3-5 d; the mixture was used to feed the juvenile zebra fish when the usable concentration was reached. Each time the paramecia solution was taken, a dense filter screen was used to remove impurities.
[0598] 2) Incubation of brine shrimp: Brine shrimp, also known as fairy shrimp and artemia, was a marine plankton. Brine shrimp eggs were purchased and stored at 4° C. For the incubation, the mixture was prepared at a ratio of 1 L deionized water: 32 g NaCl:3.5 g brine shrimp eggs; oxygenation was performed at 28.5° C. for 25-30 h; the incubated brine shrimps were collected. The incubated brine shrimps were kept in a small amount of 3.2% NaCl solution, where they could be kept for 2-3 d at 4° C.
[0599] 3) The standardized large-scale breeding of zebra fish was realized with an independent zebrafish farming system manufactured by Shanghai Haisheng. The tap water treated with a water purifier was kept in a dosing barrel, where an appropriate amount of NaCl and NaHCO.sub.3 was added to maintain a specific conductivity of 500 μs/cm and a pH of 7.0. The water circulation system ensured all breeding tanks maintain a constant water level and flow state. A waste treatment system automatically filters the fish feces and remaining fish food; the fish culture water was reused after being sterilized by UV exposure and heated (28.5° C.); the fresh water was automatically replenished after the wastewater was discharged. The lighting was controlled with an automatic timer in fish house to maintain the “14 h-light+10 h-dark cycles”; an air conditioning system kept the indoor temperature at 28° C.; an exhaust fan removed indoor moisture at regular intervals to avoid excessively high humidity. Zebra fish embryos were subjected to stationary culture in a biochemical incubator at 28.5° C., and could be fed with paramecia 5 days after fertilization. Feeding was performed 3-4 times a day. Fresh brine shrimp started to be supplemented gradually after about 13 days. When the bodies of all juveniles became red, it means the zebra fish can completely eat brine shrimp. The juvenile zebra fish was then transferred to the breeding tank. A moderate amount of fresh brine shrimp was fed 3 times a day.
[0600] AB varieties of zebra fish were transferred into an incubation box on a 2-female: 2-male basis on the afternoon of the day before reproduction of zebra fish; they were separated by a baffle. The baffle was removed the next morning; the zebra fish generally began to lay eggs in about 10 minutes; embryos were collected within 30 minutes after egg laying and rinsed with E3 culture medium (mass ratio 29.3% NaCl, 3.7% CaCl.sub.2), 4% MgSO.sub.4, 1.3% KCl, pH7.2) to remove dead eggs.
[0601] 4) Preparation of injection dish: 1.5% agarose was prepared; 30-40 ml of agarose melt was poured into each plastic culture dish. The surface of agarose was gently covered with the mold to avoid bubbles. The mold was removed after the gel got completely solidified to attain a “V-shaped” groove; a small amount of E3 culture medium was added into the prepared culture dish; it was sealed and kept at 4° C.
[0602] 2. Preparation of RNP Sample:
[0603] For zebrafish GH1 gene initiation codon upstream 100 bp DNA sequence designed sgRNA-GH1 target: 5′aagaacgagtttgtctatct3′, for zebrafish col1a1a gene termination codon designed sgRNA-col1a1a target: 5′atgtagactctttgaggcga3′, and for zebrafish ddx5 gene initiation codon upstream designed sgRNA-ddx5 target: 5′gcaccatcactgcgcgtaca3′. Genscript was entrusted to synthesize the EasyEdit sgRNA. The synthetic sgRNA and the purified Cas9 were mixed at a ratio of 1:3; 10×Cas9 buffer solution (200 mM HEPES, 100 mM MgCl.sub.2, 5 mM DTT, 1.5 M KCl) was added and RNase-free ultra-pure water was used to dilute it to 1× so that the Cas9 protein concentration was 600 ng/uL, and the sgRNA concentration was 200 ng/uL; after 10 minutes of incubation at 25° C., a small amount of phenol red was added to dye the injection sample for convenient observation during injection; the volume of phenol red was normally less than 10% of the total volume. In the experiment, sgRNA-GH1 combined with sgRNA-col1a1a and sgRNA-ddx5, respectively and the RNP complex was prepared at equal ratio, and the mixture was injected into fish eggs.
[0604] 3. Microinjection:
[0605] Under a stereomicroscope, the tip of injection needle was fractured slightly in a beveled manner using medical pointed toothless forceps for convenient injection. 4 μL of sample containing phenol red was taken by a micro loading tip; the pipette tip inserts into the needle from the end of needle to the tip reaching the point of injection needle; the tip was gently pushed to inject the sample into the needle while the tip was gently pulled out so that the front end of injection needle was filled with the red RNP sample; the injection needle with sample was then inserted into the holder for fixation. The quantitative capillary was 33 mm in length and 1 μL in total volume. The injection pressure was adjusted to increase the length of the liquid column in the capillary by 1 mm after 15 injections; then, each sample injection volume was 1 nL. The injection dish was taken out of the refrigerator in advance, and set aside until the room temperature was reached. The collected one-cell stage fertilized eggs were arranged in the groove of dish; a small amount of E3 culture medium was added so that the liquid level was just over the fertilized eggs. Under a stereomicroscope, the tip of the injection needle was gently penetrated into the membrane of the fertilized egg and reaches the yolk close to the animal pole; RNP sample was injected by stepping on the pedal. Due to the small amount of phenol red in the RNP sample, the light red sample liquid can be clearly observed during the injection. The injected embryos were placed in a disposable plate containing E3 culture medium and cultured in a constant temperature incubator at 28.5° C. The culture medium needs to be replaced every 24 hours to ensure the ion concentration and oxygen content.
[0606] 4. DNA Extraction:
[0607] After each set of injections, the tail fin of survived zebrafish at about 2-3 months old were treated with cell lysate buffer (10 mmol/L Tris, 10 mmol/L EDTA, 200 mmol/L NaCl, 0.5% SDS, 200 μg/mL Proteinase K, pH 8.2). Each tube was filled with 200 μL of lysate and held overnight at 50° C.; they were violently shaken 2-3 times during this period. The tube was centrifuged at 1200 r/min for 5 min at room temperature, and then 200 μL of supernatant was taken. Equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added and violently shaken. The tube was centrifuged at 12000 r/min at room temperature for 10 min; the supernatant taken was mixed with equal volume of chloroform, and then the tube was violently shaken. The tube was centrifuged at 12000 r/min at room temperature for 10 min; the supernatant was mixed with 1/20-volume 3 mol/L NaCl and 2.5-time volume pre-cooled anhydrous ethanol; the mixture was blended well and should not be made upside down; it's kept on ice for 30 min. The tube was centrifuged at 12000 r/min at 4° C. for 10 min, and the supernatant was abandoned swiftly. 1 mL 70% alcohol was added for rinsing. The tube was centrifuged at 12000 r/min at 4° C. for 10 min. The supernatant was abandoned swiftly, and vacuum drying was performed. Finally, 30 μL of deionized water was added in the end to dissolve the DNA. The solution was kept at −20° C. for future use. After the 0.8% agarose electrophoresis detection, the PCR test was performed with the corresponding primer, and the positive strip was subjected to sequencing verification. Wherein, gh1-R: tgctacaaataaagtgcactacaca and col1a1a-F:gggtctggattggagtcaca were double treated between the amplified col1a1a gene and gh1; gh1-R:tgctacaaataaagtgcactacaca and ddx5-F:acgcgttacgtacgtcagaa, as well as GH1-F:aaatgaccggaatcacaaca and ddx5-R:acgaccatccttaccctctg were inversely treated between the amplified ddx5 gene and gh1.
[0608] The experimental results were shown as follows: as shown in
Example 10: Field Herbicide Resistance Test on T1 Generation of Herbicide-Resistant Rice Lines QY2234
[0609] T1 generation of inversion lines QY2234/818-5 and QY2234/818-42 PPO1 were subjected to field herbicide resistance test with the wild-type Jinjing 818 rice variety as an herbicide-susceptible control. They were planted in sync with the inversion line T1 generation seeds in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan Province; the test was performed between Nov. 30, 2020 and Apr. 15, 2021. Seedlings were cultivated after 2 days of soaking rice seeds, and transplantation was performed after 3 weeks of seedling; 3 sets of replications were arranged; an herbicide called as compound A was applied in 3 weeks after transplantation, and the concentration was set to 0.3, 0.6 and 0.9 ga.i./mu (1 mu= 1/15 ha); the status of rice seedlings was investigated 10 days post application (DPA).
[0610] The result of the field herbicide resistance test was shown in
Example 11: Western Blot Test on T1-Generation PPO1 Protein Expression Level of the QY2234 Line Rice
[0611] The T1-generation seedling leaves of the four PPO1 inversion rice lines, i.e., QY2234/818-5, QY2234/818-42, QY2234/818-144 and QY2234/818-257, were selected to determine the PPO1 protein expression level. With the wild-type Jinjing 818 rice variety as a control, they were planted in the greenhouse in sync with the inversion line T1 generation seeds; when the seedlings grew to a height of 15 cm, leaf samples were taken with reference to Example 6 for molecular identification; the inversion-positive seedlings were selected for the Western Blot Test on protein expression.
[0612] A Western Blot test was performed as per the Molecular Cloning: A Laboratory Manual (Sambrook, J., Fritsch, E. F. and Maniatis, T, Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989). The PPO1 protein antibody was rice PPO1 polyclonal antibody prepared by Qingdao Jinmotang Biotechnology Co., Ltd. (Qingdao, China); a plant endogenous reference Actin protein antibody was purchased from Sangon Biotech (Shanghai, China) Co., Ltd. (Art. No. D195301); the secondary antibody was HRP-labeled goat anti-rabbit IgG (Sangon, Art. No. D110058); the test was performed according to the operating instructions using the Western Blot Kit (Boster, Art. No. AR0040).
[0613] To be more specific, 2 g of single-plant rice sample was taken and ground with liquid nitrogen into powder; an appropriate amount of protein extraction buffer (material: Protein extraction buffer=1:1.5); incubated on ice for 30 min; centrifuged at 4° C. with 27100 g for 15 min; the supernatant was mixed with 5× loading buffer (delivered with the kits); the mixture was boiled for 15 min and subjected to electrophoresis at 110 V for 30 min.
[0614] The protein extraction buffer was formulated as follows:
TABLE-US-00044 component concentration Tris-HCl (PH8.0) 100 mM glycerin 10% EDTA 1 mM AsA (ascorbic acid) 2 mM PVPP 0.5% PVP-40 0.5% DTT (Add at operation time) 20 mM PMSF (Add at operation time) 1 mM
[0615] After the electrophoresis was finished, the gel was removed, and the gel block in an appropriate size was taken depending on the size of target protein, and then the filter paper and PVDF film of approximately the same volume was taken; the gel block was cleaned with clear water and then soaked with transfer solution; the filter paper and PVDF film were also soaked and wetted with the transfer solution; the wet filter paper, PVDF film, SDS-PAGE gel block and filter paper were stacked from bottom to top to expel as many bubbles as possible; they could be flattened with a test tube, while the displacement between layers should be prevented during the flattening; the film was transferred under at 25 V and 1.3 A for 10-30 min; after the transfer, the PVDF film was cleaned with PBST buffer. Upon completion of the cleaning, they were transferred to the blocking buffer solution and blocked at room temperature for 1 h. After the confining, the PVDF film was cleaned with PBST buffer solution for 3 times to remove the blocking liquid, then the primary antibody was incubated at a dilution ratio of approx. 1:1000-1:3000; the incubation time of the primary antibody was 2 h at room temperature, or 12 h at 4° C. Upon completion of the primary antibody incubation, the PVDF film was cleaned with the PBST buffer solution for 3 times with each cycle lasting for 10 min. The secondary antibody was incubated at a dilution ratio of approx. 1:10000-1:20000 for 1 h at room temperature. Upon completion of the secondary antibody incubation, the PVDF film was cleaned with the PBST buffer solution for 3 times with each cycle lasting for 10 min. ECL luminescence: ECL solutions A and B were mixed well in equal volume (prepared when needed), and the liquid mixture was dropped onto the PVDF film evenly; the film was placed in the fluorescence imager for imaging.
[0616] The Western Blot test result was shown in
Example 12: Field Herbicide Resistance Test on T1 Generation of HPPD-Duplicated Rice Lines QY2091
[0617] Through germination test, the T1-generation of HPPD-gene duplicated lines QY2091-12 and QY2091-21 without albino seedling separation were selected for the field herbicide resistance test with the wild-type Jinjing 818 rice variety as a control. They were planted in sync with the T1 generation seeds of QY2091 lines in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan Province; the test was performed between Nov. 1, 2020 and Apr. 10, 2021. Seedlings were cultivated after 2 days of soaking rice seeds, and QY2091 seeds were soaked with 1/30000 herbicide compound Bipyrazone aqueous solution; albino seedlings were removed after emergence; transplantation was performed after 3 weeks of seedling, and 3 sets of repetitions were arranged; herbicide compound Bipyrazone was applied in 3 weeks after the transplantation at a concentration of 4, 8, 16, and 32 ga.i./mu; the seedling status was investigated 21 days after application.
[0618] The result of field herbicide resistance test was shown in
Example 13: New Gene Creation Activity of NLS-Free Cas9 and Separately Expressed crRNA and tracrRNA in Rice Protoplast
[0619] Targets were chosen from upstream and downstream of the PPO1 gene to test whether chromosome fragment duplication events could be produced; furthermore, tests were performed on whether the nuclear localization signal with Cas9 removed could produce duplication event, and on whether replacing sgRNA (single guide RNA) with separated expression of crRNA and tracrRNA could induce cell targeted site editing to produce chromosome fragment duplication events.
[0620] Dual-target editing vector pQY2648 was constructed by the method described in Example 1 for the selected target sequence design primers, i.e., OsPPO1-esgRNA3:5′ taggtctccaaacATG GCGTTTTCTGTCCGCGTgcttcttggtgccgcg3′ and OsPPO1-esgRNA2:5′ TaggtctccggcgCAGTT GGATTAGGGAATATGGTTTAAGAGCTATGCTGGAAACAGC3′. The NLS signal peptides at both ends of SpCas9 wereremoved on the basis of pQY2648 to construct the NLS-free rice PPO1 dual-target editing vector pQY2650; the sgRNA expression cassette was modified based on pQY2650 and pQY2648; the fused Scaffold sequence was removed, and the crRNA and tracrRNA sequences were separately expressed. To be more specific, the OsU3 promoter drove the expression of OsPPO1-sgRNA2:5′CAGTTGGATTAGGGAATATGGTTTAAGGCTATGCT3′ crRNA sequence; the TaU3 promoter drove the expression of the OsPPO1-sgRNA3:5′ ACGCGGACAGAAAACGCCATGTTTAAGGCTATGC3′ sequence; the OsU3 promoter drove the expression of the expression cassette of tracrRNA sequence 5′AGCATAGCAAGTTTAAATAAGGCTAGTC CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT3′; the NLS-free crRNA rice PPO1 dual-target editing vector pQY2651 and the crRNA rice PPO1 dual-target editing vector pQY2653 containing NLS were constructed; the primers used during the process were as follows:
TABLE-US-00045 2650F-BstBI: 5′gtacaaaaaagcaggcttcgaaATGgacaagaagtactcgatcggc3′ 2650R-SacI: 5′tgaacgatcggggaaattcgagctcCTAgtcgcccccgagctgag3′ OsU3-HindIII-For2651F: 5′GCAGGTCTCaagcttaaggaatctttaaacatacgaacag3′ CrRNA1-BsaI-R1: 5′GCAGGTCTCCAGGTAAAAAAAAAAAGCATAGCCTTAAACCATATTCCC TAATCCAACTG3′ TaU3-BsaI-F2: 5′GCAGGTCTCCACCcatgaatccaaaccacacggag3′ CrRNA2-BsaI-R2: 5′GCAGGTCTCGCTAGAAAAAAAAAAGCATAGCCTTAAACATGGCGTTTT CTGTCCGCGT3′ TraCrRNA-OsU3-BsaIF3: 5′GCAGGTCTCGCTAGaaggaatctttaaacatacgaac3′ TraCrRNA-KpnI-R3: 5′GgtaccAAAAAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTG ATAACGGACTAGCCTTATTTAAACTTGCTATGCTCGCCacggatcatctg cacaac3′,
[0621] For the above-mentioned 4 vectors, Example 1 was consulted to prepare the high-purity and high-concentration plasmids for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of edit duplication event; PCR primers to amplify the designed duplicated DNA at the junction regions were designed based the targeted cut sites on both sides, and then the PCR amplified fragments were sequenced; the primer sequences were as follows:
TABLE-US-00046 OsPPO1Dup-testF1: CCACTGCTGCCACTTCCAC OsPPOlDup-testF2: GGCGACTTAGCATAGCCAG OsPPO1Dup-testR1: GCTATTGCGGTGCGTATCC OsPPOlDup-testR2: TCCAAGCTAGGGGTGAGAGA
[0622] The test result was shown in
Example 14: Different Chromosome Fragment Translocation and Restructure to Create a New HPPD Gene in Rice
[0623] As mentioned in example 1 and example 4, rice HPPD gene is located on chromosome 2, CP12 gene is located on chromosome 1 but in opposite direction. Through CRISPR/Cas9-mediated chromosome cutting and naturally occurred inversion of CP12 and PPO1 gene protein coding regions-containing fragment and followed by the chromosomal fragments fusion, a new gene was generated in which CP12 promoter drives PPO1 expression, and as expected PPO1 expression was significantly enhanced, and conferred rice plant herbicide resistance. Taking advantage of the high expression characteristics of the CP12 promoter, a dual-target editing vector was designed and constructed, which cut the two regions upstream two start codons ATGs. After Agrobacterium-mediated transformation and followed by selection and plant-regeneration, a new HPPD gene in which CP12 promoter drives HPPD protein expression was identified through PCR and amplicon sequencing.
[0624] According to the analysis of rice gene expression profile data (http://rice.plantbiology.msu.edu/index.shtml) provided by the international rice genome sequencing project (International Rice Genome Sequencing Project), CP12 gene expression intensity is dozens to hundred times that of HPPD gene in rice leaf blade, CP12 gene promoter is strong in leaf blades and seedlings.
[0625] With reference to example 1 and example 2, the related genomic DNA sequences of rice HPPD and CP12 genes were input into CRISPOR online tool (http://crispor.tefor.net/) to find and assess available edit targets. After online scoring, the following targets (5′-3′) were selected between the promoters and protein coding regions of HPPD and CP12 genes for testing:
TABLE-US-00047 HPPD-guide RNA1 gtgctggttgccttggctgc HPPD-guide RNA2 cacaaattcaccagcagcca CP12-guide RNA1 gccatggctggctgttgatg CP12-guide RNA2 cggatttctgcgtgtgatgt
[0626] HPPD-guide RNA1 and HPPD-guide RNA2 are located between HPPD gene promoter and protein coding region and close to HPPD protein start codon ATG, while CP12-guide RNA1 and CP12-guide RNA2 are located between CP12 gene promoter and protein coding region and close to CP12 protein start codon ATG.
[0627] For the above-mentioned targets the following primers were designed and synthesized, the double-target editors pQY2257, pQY2258, pQY2259, pQY2260 were constructed with expectation of the editing events in which CP12 promoter driving HPPD protein coding region could be identified after transformation and selection with hyg, as shown in
TABLE-US-00048 DNA sequence (5′ to 3′) Primer ID target sequences are underlined HPPD-sgRNA1-F taggtctccggcggtgctggttgccttggctgcgt tttagagctagaaatagcaagttaaaataaggc HPPD-sgRNA2-F taggtctccggcgcacaaattcaccagcagccagt tttagagctagaaatagcaagttaaaataaggc CP12-sgRNA1-R taggtctccaaaccatcaacagccagccatggcgc ttcttggtgccgcg CP12-sgRNA2-R taggtctccaaacacatcacacgcagaaatccggc ttcttggtgccgeg
[0628] Wherein, guide RNA combinations in each editing vector:
[0629] pQY2257 contains the combination of HPPD-guide RNA1 and CP12-guide RNA1,
[0630] pQY2258 contains the combination of HPPD-guide RNA1 and CP12-guide RNA2 combination,
[0631] pQY2259 contains the combination of HPPD-guide RNA2 and CP12-guide RNA1 combination,
[0632] pQY2260 contains the combination of HPPD-guide RNA2 and CP12-guide RNA2 combination.
[0633] With reference to the example 1 for rice protoplast transformation method, the above pQY2257-2260 vectors with high purity and concentration of the plasmid DNA were prepared, and then the high-quality rice protoplast was prepared as well, PEG mediated transformation of the rice protoplast was carried out, and finally the genome editing and the designed new gene was expected to be detected where CP12 promoter drives HPPD gene expression.
[0634] The following detecting primers, OsCP12pro-detection-F and OsHPPDutr-detection-R, were used to amplify the predicted fragment generated by the fusion of CP12 promoter and HPPD coding region, and the length of PCR amplicon was expected to be 305 bp. Similarly, OsHPPDpro-detection-F and OsCP12cds-detection-R were used to detect the fragment produced by the fusion of HPPD promoter and CP12 coding region, and the length of PCR products was expected to be 445 bp.
TABLE-US-00049 Primer ID Sequence (5′ to 3′) OsCP12pro-detection-F ctgaggaggcgataagaaacga OsHPPDutr-detection-R gtgtgggggagtggatgac OsHPPDpro-detection-F caagagctttactccaagttacc OsCP12cds-detection-R acccgccctcggagttgg
[0635] The identification results showed that in pQY2257-transformed protoplast samples were detected to have the CP12 promoter fused with the HPPD coding region, as shown in
[0636] The above results show that, using the method described in this invention, can generate recombination between two chromosome fragments derived from two different chromosomes, which is expected to create the new genes as designed.
[0637] In this particular example, HPPD gene expression increases driven by the strong promoter of CP12 gene, meanwhile CP12 gene expression decreases driven by the weak promoter of HPPD gene. Therefore, the expression level of the new genes generated through this invention can be regulated as needed by choice of a strong or weak promoter.
Example 15: Creation of a New High-Expression HPPD Gene Caused by Chromosome Fragment Duplication Mediated by LbCpf1 Dual-Target Editing-Rice Protoplast Test
[0638] LbCpf1 belongs to the Cas12a type of nucleases, recognizes a TTTV PAM site, and thus is suitable to edit a high AT-content DNA sequence; while Cas9 recognizes a NGGPAM site and is suitable to edit a high GC-content DNA sequence. Therefore, the DNA scope of their editing ability is complementary to each other. In the rice protoplast system, the ability of LbCpf1 to cut and then induce the chromosome fragment to duplicate, i.e. to create a new HPPD gene was tested, as shown in the
[0639] With reference to Example 1, the pHUE411 vector (https://www.addgene.org/62203/) was used as the backbone, and the sgRNA expression cassette was removed by restriction enzyme digestion. The SV40 NLS-LbCpf1-nucleoplasmin NLS gene fragment synthesized in GenScript Biotechnology Company (Nanjing, China) replaced the Cas9 CDS of pHUE411. At 338 kb downstream of HPPD gene is a high-expression Ubi2 gene with a same expression orientation. Thus, a duplication strategy was used to increase the expression of HPPD, which confers resistance to HPPD inhibitor herbicides. To this end, acrRNA was designed in the upstream of the start codon of rice HPPD gene: 5′accccccaccaccaactcctccc3′, and the second crRNA was designed in the upstream of the start codon of rice UBI2 gene: 5′ctatctgtgtgaagattattgcc3′. A tandem crRNA sequence was synthesized with HH ribozyme and HDV ribozyme recognition sites at both ends, as shown below: 5′AAATTACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTAATTTCTACT AAGTGTAGATaccccccaccaccaactcctcccTAATTTCTACTAAGTGTAGATctatctgtgtgaagatt attgccTAATTTCTACTAAGTGTAGATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCG CCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC3′. It was connected to the end of LbCpf1 protein expression cassette in the vector according to the operating instructions of the Seamless Cloning Kit from HB-infusion Hanbio Biotechnology Co. Ltd. (Shanghai, China). The maize UBI1 promoter was used to drive both Lbcpf1 protein and crRNA in the same expression cassette. This vector was named pQY2658.
[0640] With reference to Example 1, plasmids with high-purity and high-concentration were prepared for PEG-mediated transformation of rice protoplasts. After 48-72 hr of transformation protoplast DNA was extracted for detecting duplication-editing events. The primers from both sides of the targets were designed to cover the duplicated area, and the target fragment was expected to be 494 bp. The primer sequences are:
TABLE-US-00050 Ubi2pro-Primer 5: gtagcttgtgcgtttcgatttg HPPDcds-Primer 10: tcgacgtggtggaacgcgag
[0641] The PCR amplification of the DNA extracted from the pQY2658 transformed rice protoplasts for the duplicated adapter fragments did produce bands with the expected size, and the sequencing result of the amplicon is consistent with the expected chromosome fragment duplicated adapter sequence. The sequencing result is shown in SEQ.No. 27.
[0642] The test results on protoplast transformed with pQY2658 proved that LbCpf1 nuclease can effectively cleave the target, generate the detectable duplication of chromosome fragments between the targeted cut sites. It shows that the present invention can be used to create new genes through the duplication, inversion, or translocation of chromosome fragments, which can also be realized on the nuclease system of Cas12a.
Example 16: OsCATC Gene Connected to the Chloroplast Signal Peptide Domain Through Deletion of a Chromosome Segment
[0643] Three genes of rice, namely glycolate oxidase OsGLO3, oxalate oxidase OsOXO3 and catalase OsCATC, form a photorespiratory branch, which was referred to as GOC branch. The glycolic acid produced by photorespiration could be directly catalyzed into oxalic acid in chloroplast and finally completely decomposed into CO.sub.2 by introducing the GOC branch into rice by transgene and locating it in the chloroplast, thereby creating a photosynthetic CO.sub.2 concentration mechanism similar to C4 plants, which helped improve the photosynthetic efficiency and yield of rice (Shen et al. Engineering a New Chloroplastic Photorespiratory Bypass to Increase Photosynthetic Efficiency and Productivity in Rice. Molecular Plant, 2019, 12(2): 199-214).
[0644] By using the method presented by the invention, the protein domains of different genes could be recombined by non-transgenic method to add chloroplast signal domains to genes that required chloroplast localization. Primer OsCATC-sgRNA1: 5′gtcctggaacaccgccgcgg3′ was designed at the end of the chloroplast signal peptide domain of LOC4331514 gene of upstream 28 Kb of OsCATC gene; OsCATC-sgRNA2:5′atcagccatggatccctaca3′ was designed in the first five amino acid coding regions of OsCATC gene. The chloroplast signal peptide domain of LOC4331514 gene was expected to fuse with the coding region of OsCATC gene to produce a new CATC gene located in chloroplast after the removal of inter-target fragment. Dual-target editing vector pQY2654 was constructed by the method stated in Example 1, and the primers used were
TABLE-US-00051 OsCATC-sgRNA1-For2654F: taggtctccggcggtcctggaacaccgccgcggGT TTAAGAGCTATGCTGGAAACAGC, and OsCATC-sgRNA2-For2654R: taggtctccaaactgtagggatccatggctgatgc ttcttggtgccgcg.
High-purity and high-concentration plasmids were prepared for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of deletion edit event; detection primers were designed to extend the linker segment after the middle 28 Kb chromosome segment deletion for the targets on both sides; sequencing was performed, and the primer sequences were shown below:
TABLE-US-00052 OsCATC-TestF: ccacaaaacgagtggctcag OsCATC-TestR: gtgagcgagttgttgttgttcc OsCATC-seqF: ctcttccctccactccactg
[0645] The test result was shown in
Example 17: OsGLO3 Gene Connected to the Chloroplast Signal Peptide Domain Through Inversion of a Chromosome Segment
[0646] As stated in Example 16, the OsGlO3 gene also needed to be heterotopically expressed in chloroplasts to improve the photosynthetic efficiency of rice. Hence, for the OsGLO3 gene, OsGLO3-gRNA1:5′gtcctggaacaccgccgcgg3′ was designed at the end of chloroplast signal peptide domain of the LOC4337056 gene of the upstream 69 Kb, and OsGLO3-sgRNA2:5′tgatgacttgagcagagaaa3′ was designed in the initiation codon region of the OsCATC gene; the chloroplast signal peptide domain of the LOC4337056 gene was expected to fuse with the coding region of OsGLO3 gene to produce the new GLO gene located in chloroplast after the inversion of inter-target fragments. Dual-target editing vector pQY2655 was constructed as described in Example 1 using primers OsGLO3-sgRNA1-For2655F:taggtctccggcgcgatgcttggtggcaagtgcGTTTAAGAGCTATGCT GGAAACAGC and OsGLO3-sgRNA2-For2655R:taggtctccaaactttctctgctcaagtcatcagcttcttggtgccgcg. High-purity and high-concentration plasmids were prepared for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of inversion edit event; detection primers were designed to extend the linker segment after the middle 69 Kb chromosome segment inversion for the targets on both sides; sequencing was performed, and the primer sequences were shown below:
TABLE-US-00053 OsGLO3-TestF1: cctccttgttcgtgttctccg OsGLO3-TestF2: cggtcggttggttcatttcagg OsGLO3-TestR1: catccagcagtgtgctaccag OsGLO3-TestR2: cttgagaaggcctccctgttc
[0647] The test result was shown in
Example 18: Creation of Herbicide-Resistant Rice Through Knock-Up of Endogenous PPO2 Gene Expression
[0648] The rice PPO2 gene was located on rice chromosome 4; bioinformatics analysis indicated that the S-adenosylmethionine decarboxylase (hereinafter referred as “SAMDC”) gene was approx. 436 kb downstream the PPO2 gene; the PPO2 gene and SAMDC gene had the same transcription direction on the chromosome. According to the analysis performed with the rice gene expression profile data (http://rice.plantbiology.msu.edu/index.shtml) from the International Rice Genome Sequencing Project, the expression intensity of SAMDC gene in rice leaves was tens to hundreds of times that of PPO2 gene; the promoter of SAMDC gene was a strong and constitutive express promoter.
[0649] For the rice PPO2 gene, the genomic DNA sequence of rice PPO2 and SAMDC was entered into the CRISPOR online tool (http://crispor.tefor.net/) respectively, to seek available edit targets following the procedures stated in Examples 1 and 2. Based on the online scoring, the following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes:
TABLE-US-00054 PPO2-guide RNA1 gatttacttgttgtcttgtg PPO2-guide RNA2 ttggggctcttggatagcta SAMDC-guide RNA1 ggttggtcagaacactgtgc SAMDC-guide RNA2 actgtgccggagatggagga
[0650] PPO2-guide RNA1 and PPO2-guide RNA2 were close to the initiation codon ATG of PPO2 between the promoter and CDS region of PPO2 gene, (i.e. 5′UTR); SAMDC-guide RNA1 and SAMDC-guide RNA2 were also close to the SAMDC protein initiation codon between SAMDC gene promoter and CDS region (i.e. 5′UTR).
[0651] The following primers were designed for above-noted targets; dual-target edit vectors pQY1386 and pQY1387 were constructed, and the edit event of chromosome fragment duplication between two targeted cuts was expected to be achieved; the novel gene expressed by PPO2 CDS driven by SAMDC promoter was produced at the duplication fragment linker, as shown in
TABLE-US-00055 DNA sequence Primer ID (5′ to 3′) PPO2- taggtctccggcggat esgRNA1-F ttacttgttgtcttgt gGTTTAAGAGCTATGC TGGAAACAGC PPO2- taggtctccggcgttg esgRNA2-F gggctcttggatagct aGTTTAAGAGCTATGC TGGAAACAGC SAMDC- taggtctccaaacgca esgRNA1-R cagtgttctgaccaac cgcttcttggtgccgc g SAMDC- taggtctccaaactcc esgRNA2-R tccatctccggcacag tgcttcttggtgccgc g
[0652] Wherein,
[0653] pQY1386 contains the combination of PPO2-guide RNA1 and SAMDC-guide RNA1
[0654] pQY1387 contains the combination of PPO2-guide RNA2 and SAMDC-guide RNA2.
[0655] Vector plasmids were extracted, and agrobacterium strain EHA105 was electrotransformed. Agrobacterium tumefaciens-mediated transformation was performed with rice variety Jinjing 818 as the receptor by the method stated in Example 2. Several rounds of callus identification were conducted during the transformation and selection, and positive calli of duplication events were selected for differentiation.
[0656] The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC promoter and PPO2 coding region; the length of PCR product was expected to be 300-1000 bp; the primer5-F+primer4-R combination was used to detect the fusion segment at the intermediate linker after chromosome fragment duplication; the predicted product length was 912 bp.
TABLE-US-00056 Sequence Primer ID (5′ to 3′) OsPPO2duplicated- tctcggacaaa primer1-F cagtgcaccc OsPPO2duplicated- caaattgtggg primer2-F ccgtatgcacg OsPPO2duplicated- gcttcctcagc primer3-R ctgtacgcc OsPPO2duplicated- acccgccctcg primer4-R gagttgg OsPPO2duplicated- gtgcagtaagt primer5-F ggatgtactaa tggagtc OsPPO2duplicated- gccggaggcgt primer6-F gaagaagttc ca OsPPO2duplicated- gacacaatggt primer7-R gcaccgtgc OsPPO2duplicated- ggactcagaga primer8-R ggacataggag tc
[0657] According to the final identification result, duplication edit events were detected in QY1386/818-28 # and QY1386/818-62 # calli; the sequencing result at the duplication fragment linker was shown in SEQ ID NO: 30 and SEQ ID NO: 31; The sequence alignment result was shown in
[0658] Five duplication edit events were detected in the calli of QY1837; the sequencing results at the duplication fragment linker were shown in SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; some sequence alignment results were shown in
[0659] Duplication events were detected in QY1837 differentiated seedlings; the results of the PCR amplified products and the sequencing at chromosome duplication linkers, PPO2 targets and SAMDC targets of some T0 seedlings were given below:
TABLE-US-00057 T0 seedling Genotype at No. duplication point PPO2 target SAMDC target 1387/818-2 Heterozygosis: +T, −11 bp −6 bp Seamless, −2 bp 1387/818-4/6/7 Heterozygosis: +T, −11 bp −2 bp Seamless, −2 bp 1387/818-36 No duplication Heterozygosis, Heterozygosis, detected doublet doublet 1387/818-38 Heterozygosis: Heterozygosis, Heterozygosis, Seamless, −2 bp doublet doublet
[0660] The result of comparison of 1387/818-2 with the sequencing peak diagram was shown in
[0661] Quantitative PCR detection of the relative expression of PPO2 gene was performed for TO-generation differentiated seedlings 1387/818-2, 1387/818-4 and 1387/818-6; the experiment operation was in line with Example 2; the quantitative PCR primer sequence was 5′-3′ as follows:
TABLE-US-00058 UBQ5-F ACCACTTCGACCGCCACTACT UBQ5-R ACGCCTAAGCCTGCTGGTT RT-OsPP02-F GTATGGCTCTGTCATTGCTGGTG RT-OsPPO2-R GTTTATTCCTTCCTTTCCCTGGC RT-OsSAMDC-F ACCTATGGTTACCCTTGAAATGTG RT-OsSAMDC-R CTGGGATAATGTCAGAGATGCC
[0662] With UBQ5 as the internal control, the result was shown in
[0663] The herbicide resistance of T0 seedlings of 1387/818-2 and 1387/818-4 was preliminarily determined as stated in Example 6; wild-type Jinjing 818 seedlings with similar plant heights were taken as the control, and compound A was applied to them and TO seedlings at the same time at a chemical concentration of 0.6 g a.i./mu; the culture temperature was kept at 28° C. on a 16 (light)+8 (dark) basis; pictures were taken to record the results 7 days after application, as shown in
Example 19: Creation of Herbicide-Resistant Rice Through Knock-Up Expression of the Endogenous OsPPO2 Gene Caused by CRISPR/Cas9 Targeted Chromosome Cutting and Inversion after Agrobacterium-Mediated Transformation
[0664] With reference to Example 4 to operate OsPPO2 gene, OsZFF (LOC_OS04G41560), a highly expressed gene at 170 kb downstream from OsPPO2 in the opposite direction, was selected to design two sgRNAs targeting in the regions close to the protein start codons ATGs, and a dual-target editing vector pQY2611 was constructed. Similarly, to increase the inversion probability, the downstream 40 kb from OsPPO2 and highly expressed gene OsNPP (LOC_OS04G41340) in the opposite direction of OsPPO2 was also selected to design another two sgRNAs targeting in the regions close to the protein start codons ATGs, and another dual-target editing vector pQY2612 was constructed. The three selected targets were shown as the following table. It was expected that the editing could produce double-strand DNA cut and then the inversion of chromosome fragments between the targets to form a new gene with high expression of PPO2, respectively, as shown in
TABLE-US-00059 OsPPO2-guide RNA2 ttggggctcttggatagcta 560-guide RNA3 agttagtttagtcgtctcga 340-guide RNA4 tccggtggegtctgtttggt
[0665] The following primers were used to construct the vectors:
TABLE-US-00060 Primer ID Sequence (5′ to 3′) OsPPO2- taggtctccggcgttggggctctt sgRNA2-F ggatagctaGTTTAAGAGCTATGC TGGAAACAGC 560-sgRNA3-R taggtctccaaactcgagacgact aaactaactgcttcttggtgccgc g 340-sgRNA4-R taggtctccaaacaccaaacagac gcaagacaagcttcttggtgccgc g
[0666] Wherein,
[0667] pQY2611 contains the combination of OsPPO2-guide RNA2 and 560-guide RNA3
[0668] pQY2612 contains the combination of OsPPO2-guide RNA2 and 340-guide RNA4
[0669] pQY2611 contains the combination of OsPO2-guide RNA2 and 560-guide RNA3
[0670] pQY2612 contains the combination of OsPO2-guide RNA2 and 340-guide RNA4
[0671] The vector plasmid was extracted and transformed into Agrobacterium tumefacien strain EHA105. The rice variety Jinjing 818 was used as the receptor for Agrobacterium-mediated transformation, and the transformation method was referred to Example 2. Several rounds of callus identification were carried out during the transformation-post selection process, and the callus with positive inversion events was selected for differentiation.
[0672] The detecting primers in the table below were used to amplify the fragments containing both target sites and the fused fragment between the predicted 560 promoter and the PPO2 coding region. The length of the PCR amplicon was expected 300-1000 bp. Primer2-F+Primer12-R and Primer3-F+Primer10-R were used to detect fused fragments at the junction of OsZFF after chromosome fragmentation and then inversion, and the expected amplicon lengths were 512 bp and 561 bp, respectively. Similarly, Primer2-F+Primer6-R and Primer3-F+Primer7-R were used to detect the fused fragments at the junction of OSNPP after chromosome fragmentation and then inversion, and the expected amplicon lengths were 383 bp and 666 bp, respectively.
TABLE-US-00061 Sequence Primer ID (5′ to 3′) OsPPO2 inverted- caaattgtgggc primer2-F cgtatgcacg OsPPO2 inverted- cacgtctccact primer12-R ctcccagcc OsPPO2 inverted- gcttcctcagc primer3-F ctgtacgcc OsPPO2 inverted- Gcccgtgcagc primer10-R ctagccatc OsPPO2inverted- ccacctccccg primer6-R gcggtactg OsPPO2inverted- gatatgccgga primer7-R ccggacatgt
[0673] The pQY2611-transformed calli were identified through PCR and amplicon sequencing. 292 samples were identified, 19 of which were positive for the inversion. The identified inversion event genotypes were shown as following table:
TABLE-US-00062 Junction sequence between Junction sequence between Positive inverted PPO2 coding region inverted ZFF coding region callus ID and ZFF promoter region and PPO2 promoter region 2611/818-3 −4 bp, homozygous +T, homozygous 2611/818-10 seamless, homozygous no identification 2611/818-13 −2 bp, homozygous −1 bp, homozygous 2611/818-21 seamless, homozygous +T, homozygous 2611/818-24 seamless, homozygous not detect 2611/818-53 −26 bp, not detect messychromatogrampeaks 2611/818-54 −30 bp, not detect messychromatogrampeaks 2611/818-55 −26 bp, not detect messychromatogrampeaks 2611/818-67 −30 bp, homozygous not detect 2611/818-83 seamless, homozygous +T, messychromatogrampeaks 2611/818-85 seamless, homozygous not detect 2611/818-90 +418 bp, homozygous not detect 2611/818-92 −2 bp, homozygous +T, messychromatogrampeaks 2611/818-102 seamless, homozygous +T, messychromatogrampeaks 2611/818-106 seamless, homozygous +T, messychromatogrampeaks 2611/818-107 −2 bp, homozygous +T, messychromatogrampeaks 2611/818-108 −2 bp, heterozygous not detect 2611/818-109 heterozygous not detect 2611/818-121 −22 bp, homozygous not detect
[0674] The sequencing results of the OsZFF promoter fused with OsPPe2 CDS region were shown in Seq No. 37, Seq No. 38, Seq No. 39, Seq No. 40, Seq No. 41, Seq No. 42, Seq No. 43. The alignment comparison results of 2611/818-10 and 2611/818-13 chromatogram peaks are shown in
[0675] Similarly, pQY2612-transformed calli were identified for inversion events. A total of 577 callus samples were identified, and 45 callus samples were detected to be positive for the inversion. The genotypes of inversion events detected were shown as following table:
TABLE-US-00063 Positive genotype of inverted callus ID genotype of inverted PPO2 NFF 2612/818-5 seamless, homozygous −1 A, homozygous 2612/818-29 seamless, homozygous not detect 2612/818-34 −3 bp, homozygous not detect 2612/818-62 seamless, homozygous not detect 2612/818-64 seamless, homozygous not detect 2612/818-66 +1 T, homozygous not detect 2612/818-129 seamless, homozygous Seamless, homozygous 2612/818-156 seamless, homozygous Seamless, homozygous 2612/818-157 seamless, homozygous Seamless, homozygous 2612/818-366 seamless, homozygous −5 bp 2612/818-377 −31 bp, the start codon is broken, not detect homozygous 2612/818-419 seamless, homozygous +1 bp T 2612/818-444 Seamless, homozygous Seamless, homozygous 2612/818-457 Seamless, homozygous Seamless, homozygous 2612/818-497 +1 T, homozygous −3 bp, homozygous
[0676] The sequencing results of the OsNPP promoter fused OSPPO2 CDS region were shown in Seq No. 44, Seq No. 45, Seq No. 46, and Seq No. 47. The sequencing results of events 2612/818-5 and 2611/818-34 and the chromatogram peaks are shown in
Example 20: Test on Creation of Novel PPO2 Gene with Maize Protoplasts
[0677] As shown in Example 7, the gene distribution on chromosomes was collinear among different plants; the method for successful creation of novel genes like EPSPS, PPO1, PPO2 and HPPD in new mode of expression was versatile among other plant species. According to Example 18, novel PPO2 gene was created through the PPO2 gene selection in maize and the duplication of chromosome fragments between maize SAMDC genes, and then dual-target edit vectors were constructed for maize protoplast test.
[0678] The following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes: ZmPPO2-sgRNA1:5′ggatttgcttgttgtcgtgg3′ was close to the initiation codon ATG of PPO2 protein between the promoter and CDS region of PPO2 gene (i.e. 5′UTR). ZmSAMDC-sgRNA2:5′gtcgattatcaggaagcagc3′ and ZmSAMDC-sgRNA3:5′acaatgctggagatggaggg3′ were close to the SAMDC protein initiation codon ATG between the promoter and CDS region of SAMDC gene (i.e. 5′UTR).
[0679] Dual-target edit vectors pQY1340 and pQY1341 were constructed using the following primers designed for above-noted targets.
TABLE-US-00064 Primer ID DNA sequence (5′ to 3′) ZmPP02-sgRNA1-F Taggtctccggcgggatttgctt gttgtcgtggGTTTAAGAGCTAT GCTGGAAACAGC ZmSAMDC-sgRNA2-R Taggtctccaaacgtcgattatc aggaagcagctgcaccagccggg aatcgaac ZmSAMDC-sgRNA3-R Taggtctccaaacacaatgctgg agatggagggtgcaccagccggg aatcgaac
[0680] Wherein, pQY1340 contained ZmPPO2-sgRNA1 and SAMDC-sgRNA2 targets combination, while pQY1341 contained ZmPPO2-sgRNA1 and SAMDC-sgRNA3 targets combination.
[0681] High-concentration plasmids were prepared for above-noted vectors and used for the protoplast transformation in maize following the procedures stated in Example 1 for preparation and transformation of rice protoplasts; it was slightly different from rice in that a vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis so that the enzymatic hydrolysate contacts the cells more adequately; the maize variety used was B73.
[0682] The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC promoter and PPO2 coding region; the length of PCR product was expected to be 300-1100 bp; the ZmSAMDC test-F1+ZmPPO2 test-R2 combination was used to detect the fusion segment at intermediate linker after chromosome fragment duplication; the expected product length was approx. 597 bp; inner primer ZmSAMDC test-F2 was used for sequencing.
TABLE-US-00065 Primer ID DNA sequence (5′ to 3′) ZmSAMDC test-F1 gggtggcaaaaagtctagcag ZmSAMDC test-R1 ggtgagcaggagcttggtag ZmSAMDC test-F2 cggaggcgtgaagaagttccag ZmSAMDC test-R2 ccgtgcaagatccagaacagag ZmPP02 test-F1 gccatcctgagacctgtagc ZmPP02 test-R1 gcacaagggcataaagcaccac ZmPP02 test-F2 gcagtccgaccatacccatacc ZmPP02 test-R2 cctcgaaggcacaaacacgtac
[0683] 1% agarose gel electrophoresis test was performed for the PCR reaction product, and the result indicated that the predicted positive band (approx. 597 bp) into which the ZmSAMDC promoter and ZmPPO2 coding region were fused was detected in all pQY1340 and pQY1341 transformed maize protoplast samples. Positive fragments were sequenced, and the PPO2 duplication event sequencing result of pQY1340 vector transformed protoplast test was shown in SEQ ID NO: 48; the PPO2 duplication event sequencing result of pQY1341 vector transformed protoplast test was shown in SEQ ID NO: 49. The result of comparison with the sequence at predicted chromosome segment duplication linker was shown in
Example 21: Creation of Novel PPO2 Gene in Wheat Protoplast Test
[0684] According to Example 18, in wheat the chromosome fragment region between PPO2 gene and SAMDC gene was selected for dual-target editing to create the novel gene expressed by PPO2 coding region driven by the SAMDC promoter. Wheat was hexaploid, so there were 3 sets of PPO2 genes and SAMDC genes in genomes A, B, and D. The TaPPO2-2A (TraesCS2A02G347900) gene was located at the wheat 2A chromosome, and the TaSAMDC-2A (TraesCS2A02G355400) gene was approx. 11.71 Mb downstream; since the TaSAMDC-2A and TaPPO2-2A gene transcriptions are in opposite directions on the same chromosome, it's necessary to choose inversion editing strategy, as shown in
[0685] The DNA sequence of wheat ABD gene group PPO2 and SAMDC gene was entered into the CRISPOR online tool (http://crispor.tefor.net/) respectively, to seek available edit targets. Based on the online scoring, the following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes:
TABLE-US-00066 Primer ID DNA sequence (5′ to 3′) 2A guide RNA1 GCGGAGTACTAGTAGGTACG 2A guide RNA2 TGTGAATTTGTTTCCTGCAG 2A guide RNA3 ATGACGCAGAGCACTCGTCG 2A guide RNA4 CTTCTCGTAGTTTAGGATTT 2B guide RNA1 CCCTCCTACCTACTACTCCG 2Bguide RNA2 TGTGACATTTTTTTCATCTT 2Bguide RNA3 CGAAGGCGACGACGGAGAGC 2Bguide RNA4 TCACTTCTGTTCAGACATTT 2Dguide RNA1 CCGCGGAGTAGTAGGTAGCA 2Dguide RNA2 GCTTCACGATAATCGACCAG 2Dguide RNA3 CGATGACGCCGACGCAGAGC 2Dguide RNA4 CCAATCTCTCTGGCCTGCTT
[0686] 2A guide RNA1 and 2A guide RNA2 were close to the initiation codon of PPO2 protein between the promoter and CDS region of PPO2 gene (i.e. 5′UTR); 2A guide RNA3 and 2A guide RNA4 were close to the SAMDC protein initiation codon between SAMDC gene promoter and CDS region (i.e. 5′UTR). 2B and 2D followed the same principle as above.
[0687] The following primers were designed for above-noted targets to construct the vector with pHUE411 vector (https://www.addgene.org/62203/) as the framework using the method presented in “Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov. 29; 14(1):327”.
TABLE-US-00067 Primer ID DNA sequence (5′ to 3′) TaPPO2A-T2 for taggtctccggcgGCGGAGTACTAGTAGGT 2626/2627BsaIF ACGGTTTAAGAGCTATGCTGGAAACAGC TaSAMDCA-for taggtctccaaacTGTGAATTTGTTTCCTG 2627/2629BsaIR CAGgcttcttggtgccgcg TaPPO2A-T2 for taggtctccggcgATGACGCAGAGCACTCG 2628/2629BsaIF TCGGTTTAAGAGCTATGCTGGAAACAGC TaSAMDCA-for taggtctccaaacCTTCTCGTAGTTTAGGA 2626/2628BsaIR TTTgcttcttggtgccgcg TaPPO2B-T2 for taggtctccggcgCCCTCCTACCTACTACT 2630/263 IBsaIF CCGGTTTAAGAGCTATGCTGGAAACAGC TaSAMDCB for taggtctccaaacTGTGACATTTTTTTCAT 2630/2632BsaIR CTTgcttcttggtgccgcg TaPPO2B for taggtctccggcgCGAAGGCGACGACGGAG 2632/2633BsaIF AGCGTTTAAGAGCTATGCTGGAAACAGC TaSAMDCB for taggtctccaaacTCACTTCTGTTCAGACA 2631/2633BsaIR TTTgcttcttggtgccgcg TaPP02D for taggtctccggcgCCGCGGAGTAGTAGGTA 2635/2636BsaIF GCAGTTTAAGAGCTATGCTGGAAACAGC TaSAMDCD for taggtctccaaacGCTTCACGATAATCGAC 2634/2636BsaIR CAGgcttcttggtgccgcg TaPP02D for taggtctccggcgCGATGACGCCGACGCAG 2636/2637BsaIF AGCGTTTAAGAGCTATGCTGGAAACAGC TaSAMDCD for taggtctccaaacCCAATCTCTCTGGCCTG 2635/2637BsaIR CTTgcttcttggtgccgcg
[0688] The following dual-target combined gene edit vectors were constructed using the method described in the literature above. To be more specific, pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) was used as template to amplify dual-target fragments sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 to construct the sgRNA expression cassettes. BsaI digests the pHUE411 vector framework, and the gel was recovered; the target fragment was used for ligation reaction directly after digestion. T4 DNA ligase was used to link up the vector framework and target fragment, and the ligation product was transformed to the Trans5α competent cell; different monoclonal sequences were selected; after the sequences were confirmed by sequencing to be correct, the Sigitech small-amount high-purity plasmid extraction kit was used to extract plasmids and attain recombinant plasmids, which were respectively named as pQY2626, pQY2627, pQY2628, pQY2629, pQY2630, pQY2631, pQY2632, pQY2633, pQY2634, pQY2635, pQY2636, and pQY2637 as follows:
[0689] pQY2626 contains the combination of 2A-guide RNA1 and 2A-guide RNA3
[0690] pQY2627 contains the combination of 2A-guide RNA1 and 2A-guide RNA4
[0691] pQY2628 contains the combination of 2A-guide RNA2 and 2A-guide RNA3
[0692] pQY2629 contains the combination of 2A-guide RNA2 and 2A-guide RNA4
[0693] pQY2630 contains the combination of 2B-guide RNA1 and 2B-guide RNA3
[0694] pQY2631 contains the combination of 2B-guide RNA1 and 2B-guide RNA4
[0695] pQY2632 contains the combination of 2B-guide RNA2 and 2B-guide RNA3
[0696] pQY2633 contains the combination of 2B-guide RNA2 and 2B-guide RNA4
[0697] pQY2634 contains the combination of 2D-guide RNA1 and 2D-guide RNA3
[0698] pQY2635 contains the combination of 2D-guide RNA1 and 2D-guide RNA4
[0699] pQY2636 contains the combination of 2D-guide RNA2 and 2D-guide RNA3
[0700] pQY2637 contains the combination of 2D-guide RNA2 and 2D-guide RNA4
[0701] High-concentration plasmids were prepared for above-noted vectors and used for the protoplast transformation in wheat following the procedures stated in Example 1 for preparation and transformation of rice protoplasts; it's slightly different from rice that a vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis so that the enzymatic hydrolysate contacts the cells more adequately. The variety of wheat used was KN199; the seeds were from the Teaching and Research Office on Weeds, School of Plant Protection, China Agricultural University, and were propagated at our lab; the wheat seeds were sown in small pots for dark culture at 26° C. for approx. 10 d-15 d; stems and leaves of the etiolated seedlings were used to prepare protoplasts.
[0702] The detection primers in the table below were used to PCR amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC promoter and PPO2 coding region; the length of PCR product was expected to be 300-1100 bp; the ZmSAMDC test-F1+ZmPPO2 test-R2 combination was used to detect the fusion segment at intermediate linker after chromosome fragment duplication; the PCR product length was expected to be 300-1100 bp; primer pair combinations TaSAMDCA-g600F&TaPPO2A+g480R, TaSAMDCB-g610F &TaPPO2B+g470R, and TaSAMDCD-g510F &TaPPO2D+g490R were respectively used to test the fusion segments at intermediate linker after the chromosome fragment duplication or inversion in the ABD genome; the product length was expected to be approx. 1 kb.
TABLE-US-00068 Primer ID DNA sequence (5′ to 3′) TaPPO2A-g330F TCACCAAAAATGTGTGCGCTCGTG TaPPO2A+g480R ACACAGGTCGCACCATTCGCTCCAACAC TaPPO2B-g360F CACATTCACCAAAAATGTGTGTGCTCGACTG TaPPO2B+g470R AGGTCGCACCATTCGCCACAATCC TaPPO2D-g340F TGGGTCCGTTTTTTATTGGGCGCTCAAG TaPPO2D+g490R CTCAATTCGCTCCAGCATTCGCCG TaSAMDCA+g670R CAGACCTCCATCTCGGGAATGATGTCG TaSAMDCA-g600F TCCGTATGGCGCTTGTTCGTTGTTCG TaSAMDCB+g620R AGCACAGGAGACATGGCCATCAGCAG TaSAMDCB-g610F GAATTTGCCGTGGCTTATGGCATCATG TaSAMDCD+g670R CCTCCATCTCAGGGATAATGTCAGAGATT TaSAMDCD-g510F TACAGCATTCCGTCCCTGCTGTGAC
[0703] 1% agarose gel electrophoresis test was performed for the PCR reaction product, and the result indicated that the predicted SAMDC promoter and the positive strip/band of approx. 1 kb in the PPO2 coding region fusion segment can be detected in the pQY2626 and PQY2627 transformed samples of the 2A genome, the pQY2630 and pQY2631 transformed samples of 2B genome, and the QY2634, pQY2635 and pQY2636 transformed samples of 2B genome.
[0704] PCR amplified positive fragments were sequenced, and the PPO2 inversion event sequencing result of pQY2626 vector transformed protoplast test was shown in SEQ ID NO: 50; the PPO2 inversion event sequencing result of PQY2627 vector transformed protoplast test was shown in SEQ ID NO: 51. The result of sequence comparison at inversion linker of predicted chromosome segment indicated that the TaSAMDC-2A gene promoter and the TaPPO2-2A gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression.
[0705] The PPO2 duplication event sequencing result of pQY2630 vector transformed protoplast test was shown in SEQ ID NO: 52; the PPO2 duplication event sequencing result of pQY2631 vector transformed protoplast test was shown in SEQ ID NO: 53. The result of sequence comparison at duplication linker of predicted chromosome segment indicated that the TaSAMDC-2B gene promoter and the TaPPO2-2B gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression; the result of pQY2631 sequencing peak diagram comparison was shown in
[0706] The PPO2 duplication event sequencing result of pQY2634 vector transformed protoplast test was shown in SEQ ID NO: 54; the PPO2 duplication event sequencing result of pQY2635 vector transformed protoplast test was shown in SEQ ID NO: 55. The PPO2 duplication event sequencing result of QY2636 vector transformed protoplast test was shown in SEQ ID NO: 56. The comparison with the predicted sequence at chromosome segment duplication linker indicated that TaSAMDC-2D gene promoter and TaPPO2-2D gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression; the result of pQY2635 sequencing peak diagram comparison was shown in
[0707] According to the results of these protoplast tests, novel PPO2 genes expressed by TaPPO2 driven by TaSAMDC promoter can also be created through chromosome segment inversion or duplication in wheat; therefore, it's obvious that the method presented in the present invention for creating new genes was also applicable to wheat.
Example 22: Creation of Herbicide-Resistant Rape with Knock-Up Endogenous PPO2 Gene Expression Through Agrobacterium Tumefaciens-Mediated Transformation
[0708] Brassica napus was tetraploid, where the chromosome set was AACC; the redundancy between the A and C genomes enables the creation of new genes with different combinations of gene elements through the deletion or rearrangement of chromosome segments. To create a rape germplasm resistant to PPO inhibitor herbicides, the up-regulation of endogenous PPO gene expression was a feasible technical route. The analysis of the genomic data of rape C9 chromosome shows that the 30S ribosomal protein S13 gene (hereinafter referred as 30SR) was located at approx. 23 kb upstream the BnC9.PPO2; both were in the same direction for transcription on the same chromosome; the expression levels of rape 30SR and BnC9.PPO2 in various tissues in rapeseed were analyzed with Brassica EDB database (https://brassica.biodb.org/); 30SR and BnC9.PPO2 were principally expressed in leaves, and the expression level of 30SR was significantly higher than that of BnC9.PPO2; the PPO2 protein expression level was expected to rise when the novel gene expressed by BnC9.PPO2 CDS driven by 30SR promoter was created by deleting the chromosome segment between 30SR promoter and BnC9.PPO2 CDS; in that way, rape gained herbicide tolerance.
[0709] Targets available were identified by finding the information on C9 chromosome of transformed receptor rape variety Westar at the rape database website (http://cbi.hzau.edu.cn/bnapus/) a total of 6 targets were selected:
TABLE-US-00069 BnC9.PPO2-guide RNA1 TTCCTGTATCCTTCTTCAG BnC9.PPO2 -guide RNA2 AAGATGAGAGCTACGGATA BnC9.PPO2 -guide RNA3 AACCCAACAGAAACGCGTC BnC9.PPO2 -guide RNA4 CGAAAGAGAAGTAGACCAG BnC9.PPO2 -guide RNA5 CTCCTGAAACGACAACAAA BnC9.PPO2 -guide RNA6 CTTAAGTTATGTTTCTAAC
[0710] Wherein, guide RNA1, guide RNA2 and guide RNA3 were close to the initiation codon ATG of 30SR protein between the promoter and CDS region of 30SR gene (i.e. 5′UTR region); guide RNA4, guide RNA5 and guide RNA6 were close to the BnC9.PPO2 protein initiation codon ATG between BnC9.PPO2 gene promoter and CDS region (i.e. 5′UTR region).
[0711] With reference to Example 1, the edit vectors of different target combinations, namely pQY2533, pQY2534, pQY2535 and pQY2536 were constructed with pHSE401 vector as the framework; where:
[0712] pQY2533 contains the combination of guide RNA1 and guide RNA4
[0713] pQY2534 contains the combination of guide RNA2 and guide RNA5
[0714] pQY2535 contains the combination of guide RNA3 and guide RNA6
[0715] pQY2536 contains the combination of guide RNA1 and guide RNA5
[0716] Vector plasmids were extracted, and agrobacterium strain GV3101 was electrotransformed. Agrobacterium tumefaciens-mediated transformation was performed with rape variety Westar as receptor using the method below:
[0717] {circle around (1)} Sowing: Seeds were soaked in 75% alcohol for 1 min, disinfected with 10% sodium hypochlorite solution for 9 min, washed 5 times with sterile water, sown into M0 medium, and cultured in darkness at 24° C. for 5-6 days.
[0718] {circle around (2)} Preparation of agrobacterium: 3 mL of liquid LB medium was transferred into the sterile tube; the solution with agrobacterium was subjected to shake culture in a 200-rpm shaker at 28° C. for 20-24 h. The solution with bacteria was incubated for 6-7 h in the LB culture medium. The cultured bacteria solution was poured into a 50 mL sterile centrifuge tube; the tube was centrifuged for 5 min at 6000 rpm; the supernatant was discarded, and a moderate amount of DM suspension was added; the solution was shaken well and the OD600 value of infecting bacteria solution was set to approx. 0.6-0.8.
[0719] {circle around (3)} Infection and co-cultivation of explants: The prepared infecting bacteria solution was activated on ice, while the hypocotyls of seedlings cultured in darkness were cut off vertically with sterile forceps and scalpel; the cut-off explant was infected for 12 minutes in a dish, which was shaken every 6 min during infection; the explants were transferred to sterile filter paper after infection, and the excess infection solution was sucked out; then, the explants were placed in M1 culture medium and co-cultured at 24° C. for 48 h.
[0720] {circle around (4)} Callus induction: After the co-culture, the explants were transferred to M2 culture medium, where callus was induced for 18-20 days; the culture conditions: Light culture at 22-24° C.; light for 16 hrs/dark for 8 hrs. The conditions for differentiation culture and rooting culture were the same as the present stage.
[0721] {circle around (5)} Induced germination: The callus was transferred to M3 culture medium for differentiation culture, and succession was performed every 14 days until germination.
[0722] {circle around (6)} Rooting culture and transplantation: After the buds were differentiated to see obvious growth points, the buds were carefully cut off from the callus with sterile forceps and scalpel; the excess callus was removed as much as possible, and then the buds were transferred to M4 medium for rootage. Rooted plants were transplanted into the culture soil; T1-generation seeds were achieved through bagged selfing of the TO-generation regenerated plants.
[0723] The formula of culture medium used during the process was as follows:
[0724] Sowing Culture Medium M0
TABLE-US-00070 Culture Chemical medium name Dosage Method of preparation M0 MS 2.22 g Dissolved in 1000 mL Agar 8 g of double distilled water; pH adjusted to 5.8-5.9; autoclaved
[0725] DM Transform Buffer Solution
TABLE-US-00071 Culture medium Chemical name Dosage Method of preparation DM MS 4.43 g Dissolved in 1000 mL Sucrose 30 g of double distilled 2,4-D 1 mL water; pH adjusted to Kinetin (KT) 1 mL 5.8-5.9; AS added Acetosyringone (AS) 1 mL after autoclaving
[0726] Co-Culture Medium M1
TABLE-US-00072 Culture medium Chemical name Dosage Method of preparation M1 MS 4.43 g Dissolved in 1000 mL Sucrose 30 g of double distilled Manitol 18 g water; pH adjusted to 2,4-D 1 mL 5.8-5.9; AS added Kinetin (KT) 1 mL after autoclaving Phytagel 4-5 g Acetosyringone (AS) 1 mL
[0727] Screening Medium M2
TABLE-US-00073 Culture medium Chemical name Dosage Method of preparation M2 MS 4.43 g Dissolved in 1000 mL Sucrose 30 g of double distilled Manitol 18 g water; pH adjusted to 2,4-D 1 mL 5.8-5.9; silver nitrate, Kinetin (KT) 1 mL timentin and Phytagel 4-5 g hygromycin added AgNO.sub.3 (silver nitrate) 0.2 mL after autoclaving Timentin 1 mL Hygromycin (Hyg) 0.2 mL Acetosyringone (AS) 1 mL
[0728] Differential Medium M3
TABLE-US-00074 Culture medium Chemical name Dosage Method of preparation M3 MS 4.43 g Dissolved in 1000 mL of Glucose 10 g double distilled water; pH Xylose 0.25 g adjusted to 5.8-5.9; ZT, MES 0.6 g IAA, timentin and Phytagel 4-5 g hygromycin added after Zeatin (ZT) 1 mL autoclaving Indoleacetic acid (IAA) 0.2 mL Timentin 1 mL Hygromycin (Hyg) 0.2 mL
[0729] Rooting Medium M4
TABLE-US-00075 Culture medium Chemical name Dosage Method of preparation M4 MS 2.2 g Dissolved in 1000 mL of Sucrose 10 g double distilled water; pH Indolebutyric acid 1 mL adjusted to 5.8-5.9; timentin (IBA) added after autoclaving Agar 10 g Timentin 0.5 mL
[0730] After the emergence of seedlings, leaves were taken from T0 seedlings for molecular identification. The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted 30SR promoter and BnC9.PPO2 coding region; where klenow fragment was removed, the PCR product length should be approx. 700 bp.
TABLE-US-00076 Primer ID Sequence (5′ to 3′) 30SR PRO-F: TGACTTTGCATCTCGCCACT PP02 PRO-R3: GCAGATGATGATGATGATAAGCTC
[0731] 363 T0 seedlings from the transformation of the four vectors were tested; Klenow fragment deletion event was observed in 18 plants; the probability of Klenow fragment deletion varied depending on target combination; even the same target combination may bring about different probabilities of Klenow fragment deletion; pQY2534 vector offered the highest probability (10.96%), while pQY2535 vector offered the lowest probability (2%); the average probability was on the order of 5.56%.
[0732] Analysis of the sequencing result of 18 individual plants with positive knocked out: The sequencing results of 10 individual plants showed seamless Klenow fragment deletion between two targets; homozygous seamless knockout occurred in QY2533/w-7, and heterozygous knockout occurred in the other 9 plants; compared with the expected sequence after deletion, the insertion or deletion of small fragments of base was observed in 8 individual plants; up to 32 bases were deleted in the 30SR promoter region, and this was not expected to affect the promoter activity; homozygous knockout was observed in QY2533/w-36, QY2533/w-42, QY2535/w-32 and QY2536/w-124; the details of result were as follows.
TABLE-US-00077 Plant No. PCR test result Sequencing result analysis QY2533/W-7 With strip/band Deletion; seamless; homozygous QY2533/W-36 With strip/band Deletion; −2 bp; homozygous QY2533/W-39 With strip/band Deletion; −13 bp; heterozygous QY2533/W-42 With strip/band Deletion; +1 bp; T; homozygous QY2534/W-32 With strip/band Deletion; seamless; miscellaneous peaks QY2534/W-36 With strip/band Deletion; seamless; miscellaneous peaks QY2534/W-40 With strip/band Deletion; seamless; miscellaneous peaks QY2534/W-44 With strip/band Deletion; −32 bp; miscellaneous peaks QY2534/W-53 With strip/band Deletion; seamless; miscellaneous peaks QY2534/W-55 With strip/band Deletion; seamless; miscellaneous peaks QY2534/W-56 With strip/band Deletion; seamless; miscellaneous peaks QY2534/W-59 With strip/band Deletion; seamless; miscellaneous peaks QY2535/W-32 With strip/band Deletion; +10 bp; homozygous QY2535/W-46 With strip/band Deletion; −1 bp; heterozygous QY2536/W-73 With strip/band Deletion; seamless; miscellaneous peaks QY2536/W-77 With strip/band Deletion; seamless; miscellaneous peaks QY2536/W-78 With strip/band Deletion; +1 bp; heterozygous QY2536/W-124 With strip/band Deletion; +A; homozygous
[0733] The sequencing result showed that the 30SR promoter can be directly connected with the BnC9.PPO2 CDS region to create novel PPO2 gene with strong promoter-driven expression after the deletion of inter-target sequence. The sequencing results of the 30SR promoter fused BnC9.PPO2 CDS region were shown in Seq No. 57, Seq No. 58, Seq No. 59, Seq No. 60, and Seq No. 61.
[0734] T0 seedling test result indicated that the method presented in the present invention enabled the creation of novel genes expressed by the BnC9.PPO2 CDS region driven by the 30SR promoter; so, it's obvious that the way presented in the present invention to create new genes was also applicable to rape. The results of test on rice, corn, wheat, Arabidopsis thaliana, and rape demonstrate that the method provided by the present invention was designed for purposeful precise creation of novel genes with combinations of different gene elements or different protein domains in both monocotyledons and dicotyledons.
Example 23: Creation of Rice Blast Resistance Through Knock-Up Expression of an Endogenous Gene OsWAK1
[0735] OsWAK1 is a novel functional protein kinase. It was reported that overexpression of the OsWAK1 gene can confer resistance to rice blast (Li et al. A novel wall-associated receptor-like protein kinase gene, OsWAK1, plays important roles in rice blast disease resistance. Plant Mol Biol, 2009, 69: 337-346). The OsWAK1 gene locates on rice chromosome 1. Through bioinformatics analysis, it was found that LOC_Os01g044350 (hereinafter referred to as 44350) gene, which is highly expressed in rice, locates about 26 kb upstream of OsWAK1 gene, and the 44350 gene and the OsWAK1 gene are in the opposite direction on the chromosome. The 44350 gene promoter can be used for inversion to increase the expression of OsWAK1 gene. Similarly, BBTI12 (MSU ID: LOC_Os01g04050), which is highly expressed in rice, locates about 206 kb upstream of OsWAK1 gene, and the BBTI12 gene and the OsWAK1 gene are in the same direction on the chromosome. The BBTI12 gene promoter can be used for duplication to increase the expression of OsWAK1 gene.
[0736] Similarly, the dual-target combination OsWAK1ts2:5′TTCAGCTAGCTGCTACACAA 3′ and 44350ts2: 5′ TAGAAGCTTTGATGCTTGGA 3′, was used to construct the duplication editing vector pQY1085. The construction primers used were bsaI-OsWAK1 5′UTR ts2-F:
TABLE-US-00078 5′AATGGTCTCAggcATTCagctagctgctacacaaGTTTAAGAGCTATG CTGGAAACAGCAT3′ and bsaI-44350 5′UTRts2-R: 5′AATGGTCTCAAAACTCCAAGCATCAAAGCTTCTAgcttcttggtgccg cgc 3′.
[0737] Similarly, the dual-target combination OsWAK1ts2: 5′ TTCAGCTAGCTGCTACACAA 3′ and BBTI12ts2: 5′ CAAGTAGAGGAAATAGCTCA 3′ was used to construct the duplication editing vector pQY1089. The construction primers used were bsaI-OsWAK1 5′UTR ts2-F:
TABLE-US-00079 5′AATGGTCTCAGGCATTCAGCTAGCTGCTACACAAGTTTAAGAGCTATG CTGGAAACAGCAT3′ and bsaI-BBTI12 5′UTRts2-R: 5′AATGGTCTCAAAACTGAGCTATTTCCTCTACTTGGCTTCTTGGTGCCG CGC3′.
[0738] The above two plasmids were extracted to transform Agrobacterium sp. EHA105. The recipient rice variety Jinjing 818 was transformed through Agrobacterium-mediated transformation and the transformation method was referenced to Example 2. During the transformation process, genotype identification at the junction regions was performed on the rice calli, and the inversion or duplication event-positive calli were selected to enter the differentiation stage for regeneration of seedlings.
[0739] For pQY1085 transformed rice calli, the primer44350tsdet-F+primerOsWAK1tsdet-F combination was used to detect the fusion fragment at the middle joint after the inversion of the chromosome fragment, and the PCR product length was expected to be 713 bp.
TABLE-US-00080 Primer ID Sequences(5′ to 3′) 44350tsdet-F CGATCGATTCATCGAGAGGGCT 44350tsdet-R ATCACCAGCACGTTCCCCTC OsWAK1TSDET-F TTTTGTGTGCCGCGACGAATGAG OsWAK1TSDET-R CATAACGCTGTCGACAATTGACCTG
[0740] For pQY1089 transformed rice calli, the primerOsWAK1tsdet-F+primerBBTI12tsdet-R combination was used to detect the fusion fragment at the middle joint after the duplication of the chromosome fragment, and the PCR product length was expected to be 837 bp.
TABLE-US-00081 Primer ID Sequences(5′ to 3′) BBTI12tsdet-F TTTTCTTTTGCAACAGCAGCAAAGATT BBTI12tsdet-R AGGGTACATCCTAGACGAGTCCAAG OsWAK1tsdet-F TTTTGTGTGCCGCGACGAATGAG OsWAK1tsdet-R CATAACGCTGTCGACAATTGACCTG
[0741] The above two vectors were referred to in Example 2 for Agrobacterium-mediated transformation of rice callus. After the callus was identified, the inversion or duplication event-positive calli were differentiated, and eventually positive edited seedlings were obtained. The results of molecular identification are shown in the
[0742] As shown in the
Example 24: Creation of Blast-Resistant Rice Through Knock-Up Expression of Endogenous OsCNGC9 Gene in Rice
[0743] The cyclic nucleotide-gated channels (CNGCs) gene family encodes a set of non-specific, Ca.sup.2+ permeable cation channels. It was reported that overexpression of the OsCNGC9 gene can confer resistance to rice blast (Wang et al. A cyclic nucleotide-gated channel mediates cytoplasmic calcium elevation and disease resistance in rice. Cell Research, 2019, epub). The OsCNGC9 gene locates on rice chromosome 9. Through bioinformatics analysis, it was found that LOC_Os09g39180 (hereinafter referred to as 39180) gene, which is highly expressed in rice, locates about 314 kb downstream of OsCNGC9 gene, and the 39180 gene and the OsCNGC9 gene were in the opposite direction on the same chromosome. The 39180 gene promoter can be used for inversion to increase the expression of OsCNGC9 gene. In addition, LOC_Os09g39390 (hereinafter referred to as 39390), which is highly expressed in rice, locates about 456 kb downstream of OsCNGC9 gene, and the 39390 gene and the OsCNGC9 gene were in the same direction on the same chromosome. The 39390 gene promoter can be used for duplication to increase the expression of OsCNGC9 gene.
[0744] The dual-target combination OsCNGC9ts1: 5′ ACAGCAAGATTTGGTCCGGG 3′ and 39180ts1: 5′ ATGGAATGGAAGAGAATCGA 3′ was used to construct the inversion editing vector pQY1090. The construction primers used were bsaI-OsCNGC9 5′UTR ts1-F:
TABLE-US-00082 5′ AATGGTCTCAGGCAACAGCA AGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3′ and bsaI-39180 5′UTRts1-R: 5′ AATGGTCTCAAAACTCGATTCTCTTCCATTCCATGCTTCTTG GTGCCGCGC 3′.
[0745] The dual-target combination OsCNGC9ts1: 5′ ACAGCAAGATTTGGTCCGGG 3′ and 39390ts1: 5′ CTACTGGCCTCGATTCGTCG 3′ was used to construct the duplication editing vector pQY1094. The construction primers used were bsaI-OsCNGC9 5′UTR ts1-F:
TABLE-US-00083 5′ AATGGTCTCAGGCAACAGCA AGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3′ and bsaI-39390 5′UTRts1-R: 5′ AATGGTCTCAAAACCGACGAATCGAGGCCAGTAGGCTTCT TGGTGCCGCGC 3′.
[0746] The above two plasmids were extracted to transform Agrobacterium sp. EHA105. The recipient rice variety Jinjing 818 was transformed through Agrobacterium-mediated transformation and the transformation method was referenced to Example 2. During the transformation process, molecular identification was performed on the rice calli, and the inversion or duplication event-positive calli were selected to enter the differentiation stage and regeneration of seedlings.
[0747] For pQY1090 transformed calli, the primer39180tsdet-R+primerOsCNGC9tsdet-R combination was used to detect the fusion fragment at the middle joint after the inversion of the chromosome fragment, and the PCR product length was expected to be 778 bp.
TABLE-US-00084 Primer ID Sequences(5′ to 3′) OsCNGC9tsdet-F ACATCTCATGTGCAAGATCCTAGCA OsCNGC9tsdet-R AAACTGGTCCTGTCTCTCATCAGGA 39180tsdet-F TGGCTCAGCGAAGTCGAGC 39180tsdet-R CATGGTTGAACTGTCATGCTAATCAGT
[0748] For pQY1094 transformed calli, the primer3390tsdet-F3+primerOsCNGC9tsdet-R combination was used to detect the fusion fragment at the middle joint after the duplication of the chromosome fragment, and the PCR product length was expected to be 895 bp.
TABLE-US-00085 Primer ID Sequences(5′ to 3′) OsCNGC9tsdet-F ACATCTCATGTGCAAGATCCTAGCA OsCNGC9tsdet-R AAACTGGTCCTGTCTCTCATCAGGA 39390tsdet-F3 TACTACAGCCTTTGCCTTTCACGGTTC 39390tsdet-R GTCTGCCACATGCCGTTGAG
[0749] The above two vectors were referred to in Example 2 for Agrobacterium-mediated transformation of rice callus. After the callus was identified, the inversion or duplication event-positive calli were differentiated, and finally positive edited seedlings were obtained. Sequencing results prove that the pQY1090 transformed seedlings were detected to identify the inversion edited events in which the LOC_Os09g39180 promoter drives the OsCNGC9 gene expression and thus a new OsCNGC9 gene was formed. The representative sequences of the sequenced inversion events QY1090/818-192, QY1090/818-554 and QY1090/818-541, are shown in SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71.
[0750] Sequencing results prove that the pQY1094 transformed seedlings were detected to identify duplication edited events in which the LOC_Os09g39390 promoter drives the OsCNGC9 gene expression and thus another new OsCNGC9 gene was also formed. The representative sequence of the sequenced duplicated event QY1094/818-202 are shown in SEQ ID NO: 72.
Example 25: Pig IGF2 Gene Expression Knock-Up
[0751] IGF-2 (Insulin-like growth factor 2) is one of three protein hormones that have similar structure with insulin. IGF2 is secreted by the liver and circulates in the blood. It has the activity of promoting mitosis and regulating growth.
[0752] TNNI2 and TNNT3 encode muscle troponin I and troponin T, respectively, and they are the core components of muscle fibers. These two protein coding genes are constitutively and highly expressed in muscle tissue. Therefore, using the promoters of these two genes to drive the expression of IGF2 gene is expected to significantly increase its expression in muscle cells and promote growth. Since the directions of these two genes are opposite to IGF2 on the same chromosome, knock-up of IGF2 could be achieved by promoters exchange through chromosome segments inversion.
[0753] The experiment procedure was as follows:
[0754] 1. CRISPR/Cas9 Target Site Selection and Vector Construction:
[0755] Using the CRISPR target online design tool (http://crispr.mit.edu/), we selected 20 bp sgRNA oligonucleotide sequences in the 5′UTR regions of pig IGF2, TNNI2, and TNNT3 genes respectively. The sgRNA oligos were synthesized by BGI, Qingdao.
TABLE-US-00086 IGF2-sgRNA: 5′ccgggtggaaccttcagcaa3′ TNNI2-sgRNA: 5′agtgctgctgcccagacggg3′ TNNT3-sgRNA: 5′acagtgggcacatccctgac3′
[0756] Diluting the synthesized sgRNA oligo with deionized water to 100 μmol/L in a reaction system (10 μL): positive strand oligo 1 μL, reverse strand oligo 1 μL, deionized water 8 μL. The annealing program of thermal cycler was set as follows: incubate at 37° C. for 30 min; incubate at 95° C. for 5 min, and then gradually reduce the temperature to 25° C. at a rate of 5° C./min. After annealing, the oligo was diluted by 250 volume using deionized water. pX459 plasmid was linearized with BbsI restriction endonuclease, the annealed product was ligated, and transformed into competent DH5α, a single colony was picked into a shaker tube, incubated at 37° C. for 12-16 h, 1 mL aliquot of bacterial solution was sent for sequencing. After sequencing verification, the bacterial solution was freezed and extracted for preparing the plasmid pX459-IGF2, pX459-TNNI2 and pX459-TNNT3. These plasmids were used for transfection in the following experiment.
[0757] 2. Cell Transfection:
[0758] Thawing and culturing the pig primary fibroblast cell, removal of the culture medium and added preheated PBS for washing before transfection, then removed PBS and added 2 ml of 37° C. prewarmed trypsin solution. Digesting for 3 minutes in room temperature before terminating digestion. Suspending the cells in nucleofection solution, and diluting the volume to 10.sup.6/100 μl, adding plasmid to 5 μg/100 μl final concentration, performing electro-transformation with optimized program on the electroporator, adding 500 μl of preheated culture medium, and culturing the cell in a concentration of 20% FBS DMEM medium, at 37° C., with 5% carbon dioxide, and saturated humidity.
[0759] 3. Cell Screening and Test:
[0760] When the cells reached 100% cell density, cells were lysed with NP40 buffer. Genomic DNA was extracted, and the target regions were amplified by PCR.
[0761] The result is shown in
[0762] As showed in the
[0763] The invention fused the pig TNNI2 promoter with the IGF2protein coding region in vivo through the inversion editing events of the chromosome segment, which forms a new IGF2 gene with continuously high expression. These editing events created new fast-growing pig cell lines. This example shows that the method of the present invention can be used to create new genes in mammalian organisms.
Example 26: Chicken IGF1 Expression Knock-Up
[0764] IGF1 (insulin like growth factor 1) is closely related to the growth and development of chickens. MYBPC1 (myosin binding protein C) is a highly expressed gene downstream of IGF1. A new gene with the MYBPC1 promoter driving IGF1 coding sequence was created through genome editing using a dual-target editing vector.
[0765] The experiment procedure was as follows:
[0766] 1. CRISPR/Cas9 Target Site Selection and Targeted Cutting Vector Construction:
[0767] Using the CRISPR target online design tool (http://crispr.mit.edu/), 20 bp sgRNA oligonucleotide sequences were designed in the 5′UTR regions of chicken IGF1 gene and MYBPC1 gene respectively. sgRNA oligoes were synthesized by BGI. Diluting the synthesized sgRNA oligoes with deionized water to 100 μmol/L in a reaction system (10 μL): positive strand oligo 1 μL, reverse strand oligo 1 μL, deionized water 8 μL; the annealing program of thermal cycler was set as follows: incubate at 37° C. for 30 min; Incubate at 95° C. for 5 min, and then gradually reduce the temperature to 25° C. at a rate of 5° C./min; after annealing, the oligo was diluted by 250 volumes of deionized water. pX459 plasmid was linearized with BbsI restriction endonuclease, the annealed product was ligated, and transformed into competent DH5α, a single colony was picked into a shaker tube, incubated at 37° C. for 12-16 h, aliquot 1 mL of bacterial solution was sent for sequencing. After sequencing verification, the bacterial solution was freezed and extracted for preparing the plasmid pX459-IGF1 and pX459-MYBPC1, Those dual-target editing plasmids were used for transfection of chicken DF-1 cells.
[0768] 2. Cell Culture and Passage of DF-1 Cells:
[0769] DF-1 (Douglas Foster-1) cell is chicken embryo fibroblast cell with vigorously proliferation ability, so DF-1 is the most popular cell line for in vitro study. DF-1 cells were thawed in a 37° C. water bath, and then inoculated in a petri dish and placed in a 37° C., 5% CO.sub.2 constant temperature incubator for cell culture. The culture medium is 90% DMEM/F12+10% FBS. When the cell density reached more than 90%, passaging cell at a ratio of 1:2 or 1:3.
[0770] 3. DF-1 Cell Transfection:
[0771] {circle around (1)} Preparing two 1.5 ml EP tubes and marked them as A tube and B tube respectively.
[0772] {circle around (2)} Placing 250 μl of Opti-MEM medium, 2.5 μg plasmid and 5 μl of P3000™ reagent in tube A.
[0773] {circle around (3)} Placing 250 μl of Opti-MEM medium and 3.75 μl of Lipofectamine® 3000 reagent in tube B.
[0774] {circle around (4)} Transferring the liquid from tube A to tube B with a pipette, and quickly mixing the liquid of tube A and tube B and vortexing for 10 seconds.
[0775] {circle around (5)} Vortexing AB tube mixture (liposome-DNA complex) and incubating at room temperature for 15 minutes.
[0776] {circle around (6)} Finally, slowly adding liposome-DNA complex to the DF-1 cell dish after the culture medium had been removed with pipette.
[0777] 4. DF-1 Cell Screening and Test:
[0778] {circle around (1)} Culturing DF-1/PGCs cells, and the transfection efficiency is best when the confluence reaches 60-70%;
[0779] {circle around (2)} After 2 days of transfection, add 1 μl g/ml puromycin for screening;
[0780] {circle around (3)} After 4 days of transfection, replace with the fresh cell culture medium to remove puromycin, and continue to culture until the 7th day after transfection to increase the number of cells.
[0781] {circle around (4)} Collecting the cells and extracting cell DNA with Tiangen's Genomic DNA Kit according to the operating instructions.
[0782] {circle around (5)} Designing primers to amplify new gene fragments that are expected to be doubled or inverted.
[0783] The invention fused the chicken MYBPC1 promoter with the IGF1CDS region in vivo through the double editing events of the chromosome segment, which forms a new IGF1 gene with continuously high expression. These editing events created new fast-growing avian cell lines. This example shows that the method of the present invention can be used to create new genes in avian organisms.
Example 27: Induced Gene Expression Through Chromosomal Segment Inversion in Yeast
[0784] FPP is a key precursor of many compounds in yeast. However, it can be degraded by many metabolic pathways in yeast, which affects the final yield of exogenous products such as terpenoids. The synthesis of squalene using FPP as substrate, is the first step of the ergosterol metabolic pathway, which is catalyzed by the squalene synthase encoded by the ERG9 gene. However, direct knockout of ERG9 gene would lead to the inability of yeast cells to grow, so the expression level of squalene synthase could only be regulated specifically, so that it could accumulate intracellular FPP concentration as well as maintaining its own growth. HXT promoter is a weakly glucose-responsive promoter, whose expression strength decreases with the decrease of glucose concentration in the external environment, which is consistent with the sugar metabolism process in the fermentation process, so it is an ideal inducible promoter.
[0785] As found in the Saccharomyces cerevisiae genome database website (https://www.yeastgenome.org/), both the HXT1 and ERG9 genes are located at the long arm end of chromosome VIII and are transcribed in the opposite direction, so the endogenous ERG9 gene promoter in yeast can be replaced by the HXT1 promoter, whose expression strength is responsive to glucose concentration, through the inversion editing events of the chromosome segment. It is expected that the specific induction of ERG9 gene expression will achieve the purpose of accumulation of FPP in yeast.
[0786] 1. Vector Design and Construction
[0787] Vector design includes Cas9 vector and gRNA vector, which are constructed into two different backbones. For the Cas9 vector, we used pUC19 backbone, driven by yeast TEFl promoter, Cas9 sequence is yeast codon-optimized; gRNA vector used pUC57 backbone, SNR52 promoter and SUP4 terminator. The sgRNA is designed using an online tool (http://crispor.tefor.net/) and selected the following targets between the promoter and coding regions of the HXT1 and ERG9 genes for testing: ERG9 sgRNA: GAAAAGAGAGAGGAAG; HXT1 sgRNA: CCCATAATCAATTCCATCTG. Once vectors are completed, they will be mixed together for transformation.
[0788] 2. Transformation of Yeast by Electroporation
[0789] 1) Picked up better-grown mono-clones from a fresh plate and inoculated it with 5 mL YPD medium, grew with vigorously shaking 220 rpm at 30° C. for overnight. 2) Transferred to 50 mL YPD medium so that the initial OD.sub.660 would be about 0.2, incubated with vigorously shaking 220 rpm at 30° C. to make OD.sub.660 about 1.2. 3) After placing the yeast on ice for 30 min, centrifuged at 5000 g for 5 min at 4° C. to collect the cells. 4) Discarded the supernatant, washed the cells with pre-cooled sterile water twice, and then centrifuged. 5) Discarded the supernatant, washed the cells three times with pre-cooled 1 mol/L sorbitol solution. 6) Centrifuged to collect the cells, washed the cells three times with pre-cooled 200 μL 1 mol/L sorbitol solution. 7) Added 20 μL (about 5 μg) plasmids or DNA fragments to the cell suspension, gently mixed and incubated at ice for 10 min. 8) Transferred the mix into a pre-cooled cup, shocked 5 ms with 1500V. 9) Re-suspended the cells in the cup with 1 mL YPD medium and incubated at 30° C. with vortex for 1-2 hours. 10) Washed the recovered cells with sterile water, and finally re-suspended with 1 mL sterile water, took 100 μL on the corresponding plate. 11) Incubated at 30° C. thermostatic incubator for 3-5 days to select the transformers.
[0790] 3. Extraction of Yeast Genome DNA
[0791] 1) Took 5 ml overnight cultured medium, centrifuged to collect cells, after washed with 1 mL PBS twice, centrifuged to collect cells at maximum speed for 1 min; 2) Added 500 μL sorbitol buffer to re-suspend the cells and then added 50 U Lyticase, incubated at 37° C. for 4 h; 3) Centrifuged at 12000 rpm for 1 min to collect cells; 4) Added 500 μL yeast genomic DNA extraction buffer and re-suspended, added 50 μL 10% SDS, and placed immediately at 65° C. water bath for 30 min; 5) Added 200 μL 5M KAc (pH8.9), and incubated at ice for 1 h; 6) Centrifuged at 12000 rpm for 5 min at 4° C., and transferred supernatant to a new EP tube; 7) Added isopropyl alcohol of equal volume, centrifuged at 12000 rpm for 10 s; 8) discarded the supernatant and added 500 μL 75% ethanol to wash DNA, centrifuged at 12000 rpm for 1 min; 9) After precipitation, added 50 μL TE buffer to dissolve; 10) Took 3 μL DNA for electrophoresis test, the remaining was reserved in −20° C. refrigerator.
[0792] 4. Detection of Inverted Events
[0793] PCR detection of transformed yeast cells using the following primers: HXT1pro-detF: TGCTGCGACATGATGATGGCTTT and ERG9cds-detR:TCGTGGAGAGTGACGACAAGT, respectively. The length of PCR product was expected to be 616 bp.
[0794] The invention replaces the yeast ERG9 gene promoter with the HXT1 promoter in vivo through the inversion editing event of the chromosome fragment between the target sites, which forms a new ERG9 gene regulated by glucose concentration. This example shows that the method of the present invention can be used to create new genes in fungal organisms.
Example 28: Knock-Up Expression of EPO Gene in 293T Cell Line
[0795] EPO (erythropoietin), is an important cytokine in human, PSMC2 (proteasome 26S subunit ATPase 2) is a regulated subunit of 26S protease complex, ubiquitously expressed in cells. By designing a dual-target editing vector to identify and screen new EPO gene which would driven by PSMC2 promoter in 293T cell lines.
[0796] 1. Target Design and Editing Vector Construction of CRISPR/Cas9
[0797] Using target design online tools of CRISPR (http://crispr.mit.edu/), sequence of 20 bp sgRNA oligos was designed in the 5′UTR region of the human EPO gene and PSMC2 gene, respectively. Oligos were synthesized by BGI Company (Qingdao, China. Diluted the synthetic sgRNA oligo to 100 μmol/L with deionized water. Reaction system (10 μL): for word oligo 1 μl, reverse oligo 1 μl, deionized water 8 μL; annealing program used for PCR: incubated 30 min at 37° C., incubated 5 min at 95° C., then gradually cool down to 25° C. at 5° C./min; diluted the oligo 250 times after annealing. The pX459 plasmid was firstly linearized with BbsI restriction enzyme, and then the annealing product was added, ligated product was transformed into DH5a competent cells. Single clones were selected into the centrifugal tube, incubated with shaking at 37° C. 12 to 16 hours, and then divided into 1 mL for sequencing. After sequence confirmation, plasmids were extracted. Preparation of the plasmid pX459-EPO and pX459-PSMC2 for transfection.
[0798] 2. Resuscitation of 293T cell: removed the frozen tube from liquid nitrogen or −80° C. refrigerator container, immersed directly into warm water bath at 37° C., and shook it at interval to melt it as soon as possible; removed the frozen tube from the water bath at 37° C., opened the lid in the ultra-clean table, and sucked out the cell suspension with the tips (3 ml of cell complete media has been pre-added in the centrifugal tube), flicked and mixed; centrifuged at 1000 rpm for 5 min; discarded the supernatant, re-suspended cells gently, added 10% FBS cell media, re-suspended cells gently, adjusted cell density, inoculated at petri dishes, and incubated at 37° C. Replaced the cell media once the next day.
[0799] 3. Transferred steps: removed cell petri dish (60 mm) from the carbon dioxide incubator, sucked out the medium in the bottle at the ultra-clean workbench, added 2 ml 1×PBS solution, gently rotated the petri dish to clean the cells, discarded the 1×PBS solution; added trypsin 0.5 ml and incubated for 3-5 minutes; during the incubation, observed the digested cells under an inverted microscope, and if the cells become round and no longer connected to each other, immediately added 2 volume complete medium (containing serum) in the ultra-clean workbench, added 1 mL of complete medium, blew and kept the cell suspended; the cell suspension was sucked out and placed in a 15 ml centrifugal tube, centrifuged at 1000 rpm for 5 min; discarded the digestive fluid and tapped the bottom of the centrifugal tube to make the cells re-suspended; added 2.5 ml complete medium into two new 60 mm petri dishes, the original digestive dish also added 2.5 ml of complete medium, and marked it; dropped the cell suspension in the centrifugal tube into three petri dishes at 0.5 ml/dish, blew cells with tips several times, and incubated in a carbon dioxide incubator.
[0800] 4. Trypsin digested the cells and counted in a 100 mm petri dish, making them 60%-70% denser on the day of transfection. Added plasmid DNA with a maximum capacity of 24.0 μg into cell petri dish with a bottom area of 100 mm, diluted with 1.5 mL serum-free medium, mixed and incubated at 5 min at room temperature.
[0801] 5. Cell transfection: (1) Diluted 80 μl LIPOFECTAMINE 2000 reagent with a 1.5 ml serum-free medium, and mixed diluted DNA within 5 minutes. (2) Mixed diluted plasmid DNA with diluted LIPOFECTAMINE 2000, incubated at room temperature for 20 minutes. (3) The above mixture was then added evenly to the cells. (4) Kept warm for 6 hours at 37° C., 5% CO.sub.2, 100% saturated humidity, and added 12 ml of fresh DMEM culture with 10% FBS to each petri dish. After 24 hours, replaced the old medium with a fresh DMEM medium containing 10% FBS and keep incubating.
[0802] 6. After 48 hours of transfection, centrifuged to collect cells. DNA from 293T cells was extracted using Tiangen's TIAN amp Genomic DNA Kit. The primers were also designed for PCR amplification of the target region.
Example 29: Creation of New Genes with Different Expression Patterns by Translocation of Gene Promoter or Coding Region Fragment
[0803] A dual-target combination was designed for cutting off the promoter region of OsUbi2 gene at chromosome 2, wherein target 1 was just before the OsUbi2 initiation codon and target 2 was at the upstream of the OsUbi2 promoter. Third target (Target 3) was designed to cut between the promoter and the initiation codon of OsPPO2 gene at chromosome 4. The sgRNA sequences designed for the three targets were as following:
TABLE-US-00087 Target 1: OsUbi2pro-7NGGsgRNA: 5′gaaataatcaccaaacagat3′ Target 2: OsUbi2pro-1960NGGsgRNA: 5′atggatatggtactatacta3′ Target 3: OsPPO2cds-6NGGsgRNA: 5′ttggggctcttggatagcta3′,
[0804] As shown in
[0805] The designed sgRNA sequences were ordered from GenScript Biotechnology Company (Nanjing, China). These sgRNAs were respectively assembled with SpCas9 forming RNP complexes, and three RNP complexes were mixed together in equal ratio. The mixture was subjected to biolistic transformation of rice calli (see WO2021088601A1 for specific experimental procedures).
[0806] The transformed calli were cultivated for 2 weeks and then sampled by using the following primer pair to test:
TABLE-US-00088 OsUBi2pro-1648F: 5′ggaatatgtttgctgtttgatccg3′ OsPPO2-gDNA-236R: 5′cagaactgaacccacggagag3′
[0807] PCR detection was preformed to detect whether new genes, which are OsUbi2 promoter driving OsPPO2, were generated. The translocation positive calli continued to be cultivated for 2 weeks, then followed by another round of PCR detection. After 3 rounds of detection, the positive calli were differentiated into seedlings, which were also sampled for PCR detection. The positive T0 seedlings were sequenced to identify the specific genotypes. A total of four different genotypes with OsUbi2 promoter driving OsPPO2 were obtained:
TABLE-US-00089 QY378-16: Ubi2pro + PPO2-CDS 5′CCCCCCTTTGGAATATGTTTGCTGTTTGATCCGTTGTTGTGTCCTTAA TCTTGTGCTAGTTCTTACCCTATCTCCAAGAGCCCCAAATCAGATGCTCT CTCCTGCCACCACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGC GCCCACGCTCGCGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCGC CGCACGGTTCCGCCCCGCGCGCGCCATGGCCGCCTCCGACGACCCCCGCG GCGGGAGGTCCGTCGCCGTCGTCGGCGCCGGCGTCAGT3′ QY378-18: Ubi2pro + PPO2-CDS 5′AATTGGAATATGTTTGCTGTTTGATCCGTTGTTGTGTCCTTAATCTTG TGTTGTGTCCTTAATCCAAGAGCCCCAAATCAGATGCTCTCTCCTGCCAC CACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTC GCGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTC CGCCCCGCGCGCGCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTC CGTCGCCGTCGTCGGCGCCGGCGTCAGTGG3′ QY378-41: Ubi2pro + PPO2-CDS 5′ATCTGTGCTAGTTCTTaCCCTATCTCCAGAGCCCCAAATCAGATGCTC TCTCCTGCCACCACCTTcTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCG CGCCCACGCTCGCGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCG CCGCACGGTTCCGCCCCGCGCGCGCCATGGCCGCCTCCGACGACCCCCGC GGCGGGAGGTCCGTCGCCGTCGTCGGCGCCGGCGTCAGGTGG3′ QY378-374: Ubi2pro + PPO2-CDS 5′GGTGGTCTATCTTGTGTTGTGTCCTTATCCAGAGCCCCAAATCAGATG CTCTCTCCTGCCACCACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTC GCGCGCCCACGCTCGCGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGC GCGCCGCACGGTTCCGCCCCGCGCGCGCCATGGCCGCCTCCGACGACCCC CGCGGCGGGAGGTCCGTCGCCGTCGTCGGCGCCGGCGTCAGGTG3′
[0808] The T1 generation seedlings were harvested from T0 plants, then tested using PCR. The results confirmed that the above genotypes could be inherited stably. The T1 generation of QY378-16 were selected and treated with compound A by foliar spray. As shown in
[0809] By referring to this technical route, different target combinations were designed for OsUBi2, OsPPO2 and OsPPO1 using SpCas9 protein as the editing agent:
TABLE-US-00090 1. OsUbi2pro- 5′atggatatggtactatacta3′ 1960NGGsgRNA: 2. OsUbi2pro-7NGGsgRNA: 5′atctttgtgaagacattgac3′ 3. OsPPO2cds-6NGGsgRNA: 5′ttggggctcttggatagcta3′ 4. OsPPO2cds-14NGGsgRNA: 5′gcaggagagagcatctgatt3′ 5. OsPPO1cds-4NGGsgRNA: 5′ccatgtccgtcgctgacgag3′
[0810] The combination of sgRNA 1+2+3 and sgRNA 1+2+4 with Cas9 protein was subjected to RNP transformation, new heritable genes with Ubi2pro+PPO2-CDS were identified after PCR screen selection. Similarly, the combination of sgRNA 1+2+5 with Cas9 protein was also subjected to RNP transformation, new heritable genes with Ubi2 promoter driving PPO1-CDS were also obtained.
[0811] Using MAD7 Protein as the Editing Agent:
TABLE-US-00091 1. OsUbi2pro- 5′gttggaggtcaaaataacagg3′ 1896MAD7crRNA: 2. OsUbi2pro- 5′tgaagacattgaccggcaaga3′ 14MAD7crRNA: 3. OsUbi2pro- 5′gtgattatttcttgcagatgc3′ 17MAD7crRNA: 4. OsPPO2cds- 5′gggctcttggatagctatgga3′ 9MAD7crRNA: 5. OsPPO1cds- 5′ccattccggtgggccattccg3′ 125MAD7crRNA:
[0812] The combination of crRNA 1+2+4 and crRNA 1+3+4 with MAD7 protein was subjected to RNP transformation, new heritable genes with Ubi2pro+PPO2-CDS were identified after PCR screen selection. Similarly, the combination of crRNA 1+2+5 and crRNA 1+3+5 added with MAD7 protein was subjected to RNP transformation, new heritable genes with Ubi2 promoter driving PPO1-CDS were also obtained.
[0813] In these examples, a new gene with different expression pattern was generated by inserting a translocated promoter upstream of the coding region of another gene. Likewisely, following the same technique idea, a new gene with different expression pattern could also be generated by inserting a translocated gene coding region into the downstream region of another promoter, which is covered by the technical solution scope of the present application.
[0814] All publications and patent applications mentioned in the description are incorporated herein by reference, as if each publication or patent application is individually and specifically incorporated herein by reference.
[0815] Although the foregoing invention has been described in more detail by way of examples and embodiments for clear understanding, it is obvious that certain changes and modifications can be implemented within the scope of the appended claims, such changes and modifications are all within the scope of the present invention.