NOVEL BACTERIA AND USES THEREOF

Abstract

The present invention relates to a novel bacterium Yersinia entomophaga MH96 as deposited at DSMZ on 4 May 2006 and designated accession no. DSM 1823 8. The present invention also relates to substances obtained or derived from Yersinia entomophaga MH96, which retain biopesticide activity. Methods for protecting a plant from pest infestation which include applying to the plant or its environment an effective amount of Yersinia entomophaga MH96 or a product delivered from the bacterium are also described.

Claims

1. A method comprising applying, to a plant and/or its environment, a composition that comprises Yersinia entomophaga MH96 and/or a cellular extract of Yersinia entomophaga MH96.

2. The method of claim 1, wherein said composition comprises or is derived from a whole broth culture of Yersinia entomophaga MH96.

3. The method of claim 1, wherein said composition further comprises an insect attractant.

4. The method of claim 1, wherein said composition is a powder or granule.

5. The method of claim 1, wherein said composition is an aqueous suspension.

6. The method of claim 1, wherein said composition is a non-aqueous suspension.

7. The method of claim 1, wherein said composition is a slow-release prill.

8. The method of claim 1, wherein said composition is sprayed on said plant and/or its environment.

9. The method of claim 1, wherein said environment is a plant growth medium and wherein said composition is introduced into said plant growth medium.

10. The method of claim 9, wherein said plant growth medium is a soil.

11. A method comprising introducing a composition that comprises Yersinia entomophaga MH96 and/or a cellular extract of Yersinia entomophaga MH96 into a soil.

12. The method of claim 11, wherein said composition comprises or is derived from a whole broth culture of Yersinia entomophaga MH96.

13. The method of claim 11, wherein said composition is a powder or granule.

14. The method of claim 11, wherein said composition is an aqueous suspension.

15. The method of claim 11, wherein said composition is a non-aqueous suspension.

16. The method of claim 11, wherein said composition is a slow-release prill.

17. The method of claim 11, wherein said composition further comprises an insect attractant.

18. A method comprising spraying a plant with a composition that comprises Yersinia entomophaga MH96 and/or a cellular extract of Yersinia entomophaga MH96.

19. The method of claim 18, wherein said composition comprises or is derived from a whole broth culture of Yersinia entomophaga MH96.

20. The method of claim 18, wherein said composition is an aqueous suspension.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0112] Further aspects of the present invention will become apparent from the following description which is given by way of example only and with reference to the accompanying drawings in which:

[0113] FIG. 1 shows a phylogenetic comparison of 16s ribosomal DNA of species within the genus Yersinia, using the program DNAML (Phylip suite) with default values, and with randomised input order (data from Kotetishvili et al. 2005; except for Yersinia entomophaga MH96);

[0114] FIG. 2 shows. a phylogenetic comparison of 16s ribosomal DNA based on amplification of 190 bp from 16s ribosomal DNA; based on 190 bp region analysed using the programme DNAman, tree created using the Neighbor-Joining method (Saitou and Nei, 1987, Mol. Biol. Ecol. 4:406-425);

[0115] FIG. 3 shows a phylogenetic comparison based on data from 428 bp of Y-HSP60 amplification, analysed using the programme DNAman, tree created using the Neighbor-Joining method (Saitou and Nei; 1987, Mol. Biol. Ecol. 4:406-425) (data from Kotetlshvill et al. 2005; except for Yersinia entomophaga MH96);

[0116] FIG. 4 shows a phylogenetic comparison based on data from glyA amplification, analysed using the programme DNAman, tree created using the Neighbor-Joining method (Saitou and Nei, 1987, Mal. Biol. Ecol. 4:406-425) (data from Kotetishvili et al. 2005; except for Yersinia entomophaga MH96);

[0117] FIG. 5 shows a phylogenetic comparison based on data from amplification of 394 bp from recA, analysed using the programme DNAman, tree created using the Neighbor-Joining method (Saitou and Nei, 1987, Mol. Biol. Ecol. 4:406-425) (data from Kotetishvili et. al 2005; except for Yersinia entomophaga MH96);

[0118] FIG. 6 shows a phylogenetic comparison based on data from gyrB amplification, analysed using the programme DNAman, tree created using the Neighbor-Joining method (Saitou and Nei, 1987, Mol. Biol. Ecol. 4:406-425) (data from Kotetishvili et al. 2005; except for Yersinia entomophaga MH96);

[0119] FIG. 7 shows a phylogenetic comparison based on data from amplification of 1765 bp assembled fragments, using the programme MrBayes v3.1.2 and trees viewed using TreeView (data from Kotetishvili et. al 2005; except for Yersinia entomophaga MH96);

[0120] FIG. 8 shows a phylogenetic comparison based on data from amplification of GlnA, GyrB, RecA, Y-hsp60 (1,525 base) assembled fragments, analysed using a maximum likelihood tree using DNAML from the Phylip package (data from Kotetishvili et al. 2005; except for Yersinia entomophaga MH96);

[0121] FIG. 9 shows clover seedlings cut to approximately 10 mm, and Kibbled wheat baits can be seen on the surface of the potting mix;

[0122] FIG. 10 shows clover plants at day 12, container A had four plants destroyed by Wiseana spp. larvae feeding, while all the plants survived in the container B on the right; and

[0123] FIG. 11 shows Tunnel house temperature over the duration of the bioassay.

BEST MODES FOR CARRYING OUT THE INVENTION

Discovery

[0124] During routine prefeeding assays of grass grub larvae that had been collected from various field locations throughout the South Island of New Zealand, larvae that appeared diseased were put aside and assessed for the presence of a causative bacterial agent.

[0125] Larvae were surface sterilized by submerging in 70% methanol. The larvae were then shaken in sterile DH.sub.2O, removed and blotted dry. A 10 l pipette tip was inserted through the back of the larvae breeching the haemocoelic cavity, an aliquot withdrawn and serial diluted in Luria Bertini broth. The diluent was plated on non-selective Luria Bertina media and incubated at 30 C. Morphologically different isolates were purified, and accessed for virulence by standard bioassay.

Example 1: Physiological and Metabolic Characterisation

Gram Negative Rod

[0126] Growth in LB media with subsequent plating, shows that two colony forms are apparent these are: [0127] i) convex circular [0128] ii) dimpled circular

[0129] However, if the colonies are allowed to grow to over 3-4 days all colonies have exhibit a convex circular form indicative that the dimpled circular form is growth stage dependant

[0130] The bacteria exhibits growth retardation if grown at 37 C.

[0131] The bacteria form large floes of bacterial cells in the RSYE culture grown at 37 C. just prior to 6 hours at 250 rpm.

[0132] Dilution plated samples taken at 48 and 72 hours required longer incubation at 30 C. before colonies were visible and able to be counted.

[0133] The colonies are positive on DNAase plates within 24 hours (O'Callaghan and Jackson 1993).

TABLE-US-00001 TABLE 1 ASSILMIATION TESTS AND RESULTS Test Result Gram stain negative Oxidase negative Glucose acid positive API 20E 1-307-160 No match DNAase weak positive

[0134] The strains were tested using a commercial bacterial identification system API, bio-Merieux. Results are shown in Table 2 below.

[0135] Carbon source utilisation tests were done by using API strips (API system, La Balme les Grottes, France)

TABLE-US-00002 TABLE 2 Testing results from API bacterial identification system API Y. entomophaga ONPG (beta-galactosidase) + ADH (arginine (weak) dehydrolase) LDC (lysine decarboxylase) ODC (orthinine + decarboxylase) CIT (citrate utilisation) + H.sub.2S (H.sub.2S production) URE (urease) TDA (tryptophane desaminase) IND (indole production) VP (acetoin production) + GEL (gelatinase) + GLU (glucose + fermentation) MAN (mannitol + fermentation) INO (inositol fermentation) SOR (sorbitol fermentation) RHA (rhamnose fermentation) SAC (sucrose + fermentation) MEL (melibiose + fermentation) AMY (amygdalin fermentation) ARA (arabinose fermentation) OX (oxidase) DNAse + glycerol + erythritol D-arabinose L-arabinose ribose + D-xylose L-xylose adonitol methyl-xyloside galactose + D-glucose + D-fructose + D-mannose + L-sorbose Rhamnose Dulcitol inositol mannitol + Sorbitol methyl-D-mannoside methyl-D-glucoside N acetyl glucosamine + amygdaline arbutine esculine salicine cellobiose ? maltose + lactose ? melibiose + saccharose + trehalose + inuline melezitose D-raffinose + amidon glycogene xylitol gentiobiose D-turanose D-lyxose D-tagatose D-fucose D-arabitol L-arabitol gluconate ? 2 ceto-gluconate 5 ceto-gluconate ? score api 50 = +24 hours (ATCC cultures > 48 hrs). ? denotes inconclusive result.

TABLE-US-00003 TABLE 3 AGAR phenotypes of Yersinia entomophaga MH96 grown on various commercially supplied agar (Fort Richards) bacteria grown for 24 hours at 30 C. Plate media Phenology Orientation agar purple XLD agar orange slight yellow halo Col sheep blood no lysis Col horse blood no lysis Violet red bile agar growth Brilliant green agar modified yellow PFA agar no growth Dermatophte test medium turquoise Chocolate sens matt rhizoid morphology Cetrimide agar no growth but very slight after 48 hours Bismuth sulphite agar dark green Macconkey agar w/d cv orangly matt rhizoid morphology Haemin agar no lysis Brilliant green agar light green tinge rhizoid growth Thayer martin agar no growth

Example 2: Genetic Identification

DNA-DNA Hybridization

[0136] DNA-DNA hybridization was determined at the Deutsche Sammlung von Mikroorganismen und. Zellkulturen, Braunschweig, Germany and carried out as described by De Ley et al. (1970) under consideration of the modifications described by Huss et al. (1983) using a model Cary 100 Bio UVNIS-spectrophotometer equipped with a Peltier-thermostatted 66 multicell changer arid a temperature controller with in-situ temperature probe (Varian). DNA-DNA relatedness was tested at 70 C. in 2SSC plus 10% (v/v) DMSO

TABLE-US-00004 TABLE 4 % DNA-DNA similarity (in 2 X SSC at 70 C.) Y. entomophaga MH96 DSM 18238 (ID 06-840) Yersinia pseudotuberculosis 23.0 (19.7) DSM 8992.sup.T (ID 06-841) Yersinia ruckeri DSM 18506.sup.T 45.6 (52.1) (ID 06-842) Yersinia intermedia DSM 18517.sup.T 0.82 (2.15) (ID 06-843)

[0137] Results derived indicate that Y. entomophaga MH96 DSM 18238 (ID 06-840) does neither belong to the species Y. pseudotuberculosis DSM8992.sup.T (ID 06-841) nor to the species Y. ruckeri DSM 18506.sup.T (ID 06-842) and nor to the species Y. intermedia DSM 18517T (ID 06-843) when the recommendations of a threshold value of 70% DNA-DNA similarity for the definition of bacterial species by the ad hoc committee (Wayne et al., 1987) are considered.

DNA G+C Content

[0138] The DNA G+C content of Yersinia entomophaga MH96 DSM 18238 (ID 06-840): was determined at the Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany according to the method of Mesbah et al. (1989) and as three independent measurements. Cells were disrupted using a French pressure cell and the DNA was purified according to the procedure of Cashion et al. (1977) and degraded as described by Mesbah et al. (1989) and assessed by HPLC system (Shimadzu Corp. Japan). Using this method the The DNA G+C content of Y. entomophaga MH96 DSM 18238 (ID 06-840): was at 49.3 mol % G+C These estimates are within the accepted limits for the genus Yersinia of 46-50 mol % (Bercovier & Mollaret, 1984+).

Plasmid Visualisation

[0139] Plasmid visualisation by method of Kado and Lui (1981) showed that no extrachromosomal elements such as plasmids weref.presenl.

Purification of Genomic DNA

[0140] Genomic DNA for rRNA sequencing was isolated by a modified method of Cathala G et al, (1983). A 1.5 ml O/N culture was pelletted, and resuspended in 500 l of lysis solution (5M guanidine isothiocyanate, 10 mM EDTA, 50 mM Tris-HCl (pH 7.5), 8% mercaptoethanol). An equal volume of phenol:chloroform was added, the tube inverted several times and centrifuged at 13000 g for 15 minutes. The upper layer removed to a new eppendorf and ethanol precipitated. To remove residual Guandium and other inhibitory compounds, the resultant pellet was air dried and resuspended in 500 l of DH.sub.2O, placed in a 37 C. water bath, and intermittently agitated for 1-2 hours. The solution was then re-ethanol precipitated and resuspended in 50 l DH20

rRNA PCR

[0141] Closely related strains identified by API were obtained from the American Type Culture Collection, Md., and included the Enterobacter sakazakii strains ATCC29004 and ATCC51329.

[0142] The 16S gene was amplified with primers as shown in Table 5.

TABLE-US-00005 TABLE5 Primersusedtoamplify16srRNA U16a AGAGTTTGATCCTGGCTC U16b TACGGYTACCTTGTTACGACTT UB16A2 GCCGCGGTAATACGGAGG U16B2 AGGATAAGGGTTTGCGCTCCG [0143] 94 C. 15 s 60 C.(30 s) 62 C.(2)5 cycles [0144] 94 C. 15 s 57 C.(30 s) 62 C.(2)40 cycles

[0145] PCR template was sequenced using automated sequencing and an Applied Biosystem 373A or 377 autosequencer. Sequence data was assembled using SEQMAN. The database at the National Centre for Biotechnology Information was searched using BLASTN and the WWW. Nucleotide sequence accession numbers. The sequences determined in this study have been assigned the Genflank accession numbers DQ400713-DQ400845.

rDNA Sequence Comparison

[0146] Table 6 below shows 16s comparison based on 1428 bp and compared with Genflank sequences:

TABLE-US-00006 TABLE 6 16s comparison based on 1428 bp and compared with GenBank sequences. Genbank accession Genus, species Accession number and strain Reference/author date AF366385 Yersinia ruckeri Kim, W., Song, M.-O., Song, W., 8 May 2001 Chung, S.-I., Choi, C.-S. and Park, Y.-H. AB004746 Enterobacter Harada, H. 25 Jul. 1997 sakazakii (strain: JCM1233) RAU90757 Rahnella aquatilis Brenner, D. J., Muller, H. E., 15 Apr. 1998 Steigerwalt, A. G., Whitney, A. M., O'Hara, C. M. and Kampfer, P. (1998) Two new Rahnella genomospecies that cannot be phenotypically differentiated from Rahnella aquatilis. Int. J. Syst. Bacteriol. 48 Pt 1, 141-149 YEN16SA Y. enterocolitica Harmsen, D. 27 Jun. 1996 (strain O:3 108 c) AF366384 Yersinia rohdei 16S Kim, W., Song, M.-O., Song, W., 8 May 2001 Chung, S.-I., Choi, C.-S. and Park, Y.-H. S000001663 Yersinia Harmsen, D. W., Schmelz, J. F. 30 Jul. 1996 pseudotuberculosis; and Heesemann, J. Serotype III 1B1 B28 (W.W.) S000001661 Yersinia Ibrahim, A., Goebel, B. M., 12 Jun. 1995 enterocolitica; ER- Liesack, W., Griffiths, M. and 26036-92; serotype Stackebrandt, E. O:3 (1993) The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiol. Lett. 114 (2), 173-177 S000004821 Yersinia Kim, W., Song, M.-O., Song, W., 17 May 2001 pseudotuberculosis Chung, S.-I., Choi, C.-S. and Park, Y.-H. S000004821 Yersinia Kim, W., Song, M.-O., Song, W., 17 May 2001 pseudotuberculosis Chung, S.-I., Choi, C.-S. and 83 Park, Y.-H. S000003234 Yersinia rohdei (T); Kim, W., Song, M.-O., Song, W., 8 May 2001 ATCC 43380 Chung, S.-I., Choi, C.-S. and Park, Y.-H, YS17B16S Yersinia sp. (isolate Ibrahlm, A., Liesack, W., 17 Feb. 1997 YEM17B) Steigerwalt, A. G., Brenner, D. J., Stackebrandt, E. and Robins- Browne, R. M. (1997) A cluster of atypical Yersinia strains with a distinctive 16S rRNA signature FEMS Microbiol. Lett. 146 (1), 73-78 YPD16SRN Yersinia pestis (D- Ibrahim, A., Goebel, B. M., 27 May 2000 28) Liesack, W., Griffiths, M. and Stackebrandt, E. (1993) The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiol. Lett. 114 (2), 173-177 AJ414156 Yersinia pestis CO9 YPE16SA Y. pestis (strain EV Harmsen, D. pst+ c) YEPRGD Yersinia pestis Wilson, K. H. and Hills, H. G. 19 Jan. 1995 AF365949 Yersinia Kim, W., Song, M.-O., Song, W., 17 May 2001 pseudotuberculosis Chung, S.-I., Choi, C.-S. and strain 6088 Park, Y.-H. YR16SRN Yersinia rohdei (ER- Ibrahim, A., Goebel, B. M., 27 May 2000 2935) Liesack, W., Griffiths, M. and Stackebrandt, E. (1993) The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiol. Lett. 114 (2), 173-177 YK16SRRN Yersinia kristensenii Ibrahim, A., Goebel, B. M., 27 May 2000 (ER-2812) Liesack, W., Griffiths, M. and kristensenii 2 Stackebrandt, E. (1993) The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiol. Lett. 114 (2), 173-177 AF366381 Yersinia kristensenii Kim, W., Song, M.-O., Song, W., 8 May 2001 Chung, S.-L, Choi, C.-S. and Park, Y.-H. AF366382 Yersinia mollaretii Kim, W., Song, M.-O., Song, W., 8 May 2001 Yersinia mollaretii2 Chung, S.-I., Choi, C.-S. and Park, Y.-H. YM16SRRN Yersinia mollaretii Ibrahim, A., Goebel, B. M., 27 May 2000 (ER-2975) Liesack, W., Griffiths, M. and Stackebrandt, E. (1993) The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiol. Lett. 114 (2), 173-177 AF366379 Yersinia Kim, W., Song, M.-O., Song, W., 8 May 2001 frederiksenii Chung, S.-L, Choi, C.-S. and Park, Y.-H. AF366380 Yersinia intermedia Kim, W., Song, M.-O., Song, W., 8 May 2001 Chung, S.-L, Choi, C.-S. and Park, Y.-H. AF366376 Yersinia aldovae Kim, W., Song, M.-O., Song, W., 8 May 2001 Chung, S.-I., Choi, C.-S. and Park, Y.-H, YB16SRRN Yersinia bercovieri Ibrahim, A., Goebel, B. M., 27 May 2000 Yersinia bercovieri Liesack, W., Griffiths, M. and 1 Stackebrandt, E. (1993) The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiol. Lett. 114 (2), 173-177 AF366377 Yersinia bercovieri Kim, W., Song, M.-O., Song, W., 8 May 2001 Chung, S.-I., Choi, C.-S. and Park, Y.-H.

[0147] As shown in FIGS. 1 and 2, using 16s rRNA sequences Y. entomophaga aligns with atypical strains of Y. frederiksenii (FIG. 1) or Y. kristensenii (FIG. 2-190 bp).

TABLE-US-00007 TABLE7 Multilocussequencetagging(MLST)Primers usedforMLSToftheYersiniaspecies (DerivedfromKotetishvilietal.2005), Primers Accessionnumber Gene (5.fwdarw.3) andResults 16SrDNA AGTTTGATC DQ400782 ATGGCTCAG FIG.1and2 TTACCGCGG CTGCTGGCA GlnA CGATTGGTG DQ400780 GCTGGAAAG FIG.4 GCTTGGTCA TRGTRTTGA AGCG GyrB CGGCGGTTT DQ400781 GCAYGGYGT FIG.6 RGGCAGSGT RCGRGTCAT YGCCG recA GGGCCAAAT DQ400835 TGAAAARCA FIG.5 RTTCGGCGC CRATYTTCA TRCGRATYT GGT Y-HSP60 GACGTNGTA DQ400829 GAAGGTATG FIG.3 YAGCGCCGC CAGCCAGTT TAGC

[0148] MLST analysis, based on primer sequences as above in Table 7, in conjunction and analysis of random genomic sequence analysis (Results shown in FIGS. 3-8 of phylogenetic comparison of sequences from the above genes), indicates that Yersinia entomophaga MH96 is a new species residing within the genera Yersinia. A presumptive name foe the new species would be Yersinia entomophaga MH96 (as it eats insects) Random genomic sequencing of Yersinia entomophaga MH96

[0149] To further help define what species Yersinia entomophaga MH96 is, genomic DNA of Yersinia entomophaga MH96 was made and digested using the restriction enzymes HindIII; EcoRI and PstI in independent reactions. The digested DNA was then ligated to the vector DNA (pUC19) digested with the aforementioned enzymes. Using this method approximately 132 independent random HindIII; PstI; or EcoRI; clones were constructed. Using the pUC19 M13F and M13R based primers DNA from the clones was sequenced. The DNA sequence data has been deposited under the GenBank accession number (DQ400713-DQ400845). This data have enabled the generation of random snap shots of the Yersinia entomophaga MH96 genome and shown that many genes have greater than 90% DNA similarity to the DNA of Yersinia pestis. While other DNA remains at this point in time novel scoring no apparent similarity to DNA I the current database

[0150] The DNA nucleotide sequence of 132 random Y. entomophaga sequences have been submitted to GenBank and assigned the numbers DQ400713-DQ400845

Example 3: Culture Conditions

[0151] Yersinia entomophaga MH96 can be grown in LB broth or on LB agar (Sambrook and Russell, 2001) or any alternate common laboratory media as yet no defined media for the isolation of Yersinia entomophaga MH96 has been defined, optimum growth for Yersinia entomophaga MH96 is 25 C.-30 C. Cultures were incubated at 200 rpm in a Raytek orbital mixer incubator.

Crude Toxin Isolation Using Cell Lysis Such as Sonication

[0152] From a 3 ml overnight culture pellet by centrifugation (8,000 g 3 minutes) resuspended in 1.0 ml of 1.5 ml phosphate buffer (10 mM phosphate buffer, pH 7.4; 2.7 mM KCI; 137 mM NaCl), two 0.7 ml samples were transferred to an eppendorf and subjected to three 30 s rounds of sonication on wet ice using a Sanyo soniprep 150 sonicater (18). The sonicated samples were centrifuged (16,000 g) and the supernatant filter sterilised through a 0.2 m filter to a sterile eppendorf. The filtrate's were placed on wet ice and used immediately for bioassay analysis. The efficacy of the lysate was assessed by the oral injection of 5 l of filtrate sample through the larval mouth parts or the application of 5 l of filtrate sample to the surface of a 3 mm.sup.3 carrot from which the grass grub larvae would feed. Under these conditions toxins can be visualised on a standard Laemmli SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The toxins have activity only if the bacterium is subjected to sonication. Bioassays of Yersinia entomophaga MH96 culture supernatant show no effect (refer Table 8-12).

Crude Toxin Isolation Via Y. entomophaga MH96 Grown at 25 C.
Induction and Purification of Y. entomophaga MH96 Toxin

[0153] From an overnight culture grown at 25 C. Bacterial debris was removed by centrifugation (30 min; 12000 g; 4 C.) and the supernatant filter sterilised through a 0.2 m filter to a sterile eppendorf.

Standard Bioassay

[0154] Healthy feeding larvae, collected from the field, were individually fed squares of carrot which had been rolled in colonies of putative pathogenic bacteria that had grown overnight on solid media. Twelve second or third instar larvae were used for each treatment. Inoculated larvae were maintained at 15 C., in ice-cube trays. Larvae were left feeding on treated carrot for 3-4 days, then transferred to. fresh trays and re-fed with untreated carrot for up to 10-14 days and signs of disease noted.

Dose Response Assay

[0155] An overnight culture of bacteria was grown, and a dilution series set up in phosphate buffer. Five l of each dilution were inoculated onto pre air dried carrot cubes measuring approximately 3 mm.sup.3. Grass grub were placed into each of the trays cubicles, and results monitored as previously described under standard bioassay.

Experimental Protocols

Testing of Yersinia entomophaga MH96 on the Diamond Backed Moth (DBM).

[0156] The bioassay of efficacy of Yersinia entomophaga MH96 live cells and the toxic proteins from Yersinia entomophaga MH96 was tested on the Diamond Backed Moth (DBM).

[0157] Five fractions of the bacterial culture tested: [0158] 1. Live cell broth; 1 ml freshly cultured broth used. [0159] 2. Concentrated live cells. 10 ml of broth centrifuged at 8000 rpm for 8 min, the resulting pellet harvested, and resuspended in 1 ml of PB; [0160] 3. Resuspended live cells. 1 ml broth centrifuged at 8000 rpm for 8 min, the resulting pellet harvested and cells resuspended in equal volume of PB; [0161] 4. Heat killed broth. 1 ml broth subjected to boiling water for 10 min; broth plated out in LB plate to confirm if any live cells. [0162] 5. Sterile filtrate broth. 10 ml broth centrifuged at 8000 rpm for 8 min, the resulting pellet harvested, resuspended in 1 ml PB, then sonicated and centrifuged at 1300 rpm, 5 min; the supernatant harvested. Supernatant plated out in LB plate to confirm if any live cells.

[0163] All fractions mixed with 0.2% Tween 80 as emulsifier. LB broth and PB plus 0.2% Tween 80 used as controls.

Assessment: Leaf Disc Method.

[0164] 1. The 2.sup.nd to 4.sup.th instars collected from plants and place in a container supplied with cabbage leaves. If not enough for an experiment, larvae stored in fridge for an extended 2 to 3 day period until further collections. [0165] 2. Larvae transferred to clean or sterile Petri dishes containing no cabbage leaves by a sterile fine art brush at least 4 h prior to being exposed to treatments to ensure sufficient uptake of bacteria and the fractions tested. [0166] 3. Leaf discs (1.0 cm in diameter) punctured from tender leaves of cabbage seedlings, and stored in a Petri dish containing a small piece of wet tissue [0167] 4. Using freshly flame sterilized soft tweezers transfer the leaf discs individually into the wells of plates, with the upper surface of the leaves upward. [0168] 5. 5 l of test suspension pipetted onto the upper surface of the leaf disc and spread with a sterile glass rob or homogenizer. [0169] 6. Larvae transferred individually onto a leaf disc with alcohol sterilized fine art brushes carefully. All larvae used for a treatment pooled in a plate covered by parafilm to prevent larval escaping from wells. [0170] 7. Recode the developmental stage of each larva. [0171] 8. Plates sealed in plastic bags and held at 15 C under 14:10 (L:D) h photoperiod. [0172] 9. Leaf discs renewed daily using the method above. Mortality monitored within 5 d post-inoculation.

[0173] 8-12 larvae tested for each treatment, Experiments carried out three replications.

SUMMARY

Pathogenicity of Bacteria Yersinia entomophaga MH196 to Diamond Back Moth, Piutella Xylostella (L.)
Laboratory Bioassay of Yersinia entomophaga MH196 Toxicity to DBM Larvae

Determination of Active Fractions

TABLE-US-00008 TABLE 8 Effect of the culture broth fractions of Yersinia entomophaga MH96 on the mortality of diamond back moth larvae. No. larvae No. dead Mortality Fraction Rep* tested larvae (%) Mean (%) Live cell broth 1 10 10 100.0 2 12 12 100.0 3 12 12 100.0 4 12 12 100.0 100.0 Resuspended live 1 10 10 100.0 cells 2 12 11 91.7 3 12 12 100.0 4 12 11 91.7 95.8 Heat killed broth 1 10 2 20.0 2 12 0 0.0 3 12 0 0.0 4 12 1 8.3 7.1 Sonicated cell 1 10 10 100.0 filtrate 2 12 12 100.0 3 12 11 91.7 4 12 11 91.7 95.8 Broth supernatant 1 10 0 0.0 2 12 0 0.0 3 12 0 0.0 4 12 0 0.0 0.0 Control 1 (PBS) 1 10 2 20.0 2 12 0 0.0 3 12 0 0.0 4 12 0 0.0 5.0 Control 2 (LB 1 10 1 10.0 broth) 2 12 0 0.0 3 12 0 0.0 4 12 0 0.0 2.5

Screenings of LD50 of Active Fractions

Live Cell Broth

TABLE-US-00009 TABLE 9 Effect of Yersinia entomophaga MH96 dose on the mortality of diamond back moth larvae. Dilution No. No. No. series Dose larvae dead dead Mortality Mean tested Rep (cells/cm.sup.2) tested larvae pupae (%) (%) 10.sup.0 1 28000000 12 12 0 100.0 2 21000000 12 11 0 91.7 3 31000000 12 11 0 91.7 94.4 10.sup.1 1 2800000 12 8 2 83.3 2 2100000 12 10 0 83.3 3 3100000 12 12 0 100.0 88.9 10.sup.2 1 280000 12 9 0 75.0 2 210000 12 7 3 83.3 3 310000 12 9 2 91.7 83.3 10.sup.3 1 28000 12 7 0 58.3 2 21000 12 4 1 41.7 3 31000 12 6 3 75.0 58.3 10.sup.4 1 2800 12 5 3 66.7 2 2100 12 5 2 58.3 3 3100 12 2 2 33.3 52.8 10.sup.5 1 280 12 6 1 58.3 2 210 12 2 2 33.3 3 310 12 1 2 25.0 38.9 Control 1 0 12 0 0 0.0 2 0 12 0 0 0.0 3 0 12 0 0 0.0 0.0

Sonicated Cell Filtrate

TABLE-US-00010 TABLE 10 Effect of the sonicated cell filtrate concentration of Yersinia entomophaga MH96 on mortality of diamond back moth larvae. No No No larvae dead dead Mortality Mean Concentration Rep tested larvae pupae (%) (%) 100% 1 12 11 0 91.7 2 12 11 0 91.7 3 12 10 1 91.7 91.7 50% 1 12 6 1 58.3 2 12 11 0 91.7 3 12 11 0 91.7 80.6 20% 1 12 9 0 75.0 2 12 9 0 75.0 3 12 7 2 75.0 75.0 10% 1 12 5 0 41.7 2 12 7 0 58.3 3 12 8 1 75.0 58.3 2% 1 12 2 0 16.7 2 12 3 0 25.0 3 12 5 1 50.0 30.6 1% 1 12 0 0 0.0 2 12 0. 0 0.0 3 12 1 0 8.3 2.8 Control 1 12 0 0 0.0 2 12 0 0 0.0 3 12 0 0 0.0 0.0

Screenings of Stability of Active Fractions

Live Cell Broth

TABLE-US-00011 TABLE 11 Effect of ambient temperature and length of storage period on toxicity of Yersinia entomophaga MH96 live cells to DBM larvae No No larvae dead Mortality Mean Treatment Rep tested larvae (%) (%) 0 d (Fresh 1 12 11 91.7 culture) 2 12 10 83.3 3 12 9 75.0 83.3 1 d, 20 C. 1 12 12 100.0 2 12 10 83.3 3 12 9 75.0 86.1 7 d, 20 C. 1 12 10 83.3 2 12 11 91.7 3 12 7 58.3 77.8 1 d, 4 C. 1 12 8 66.7 2 12 7 58.3 3 12 8 66.7 63.9 7 d, 4 C. 1 12 10 83.3 2 12 11 91.7 3 12 11 91.7 88.9 Control 1 12 0 0.0 2 12 1 8.3 3 12 1 8.3 5.6

Sonicated Cell Filtrate

TABLE-US-00012 TABLE 12 Effect of temperature and length of storage period on toxicity of Yersinia entomophaga MH96 sonicated cell filtrate to DBM larvae No No larvae dead Mortality Mean Treatment Rep tested larvae (%) (%) 0 d (Fresh 1 12 12 100.0 culture) 2 12 9 75.0 3 12 11 91.7 88.9 1 d, 20 C. 1 12 11 91.7 2 12 9 75.0 3 12 11 91.7 86.1 7 d, 20 C. 1 12 12 100.0 2 12 10 83.3 3 12 11 91.7 91.7 1 d, 4 C. 1 12 8 66.7 2 12 9 75.0 3 12 7 58.3 66.7 7 d, 4 C. 1 12 11 91.7 2 12 8 66.7 3 12 9 75.0 77.8 Control 1 12 1 8.3 2 12 0 0.0 3 12 1 8.3 5.6
Bait Formulation of Yersinia entomophaga MH96 Against 7Th-8Th Instar Wiseana SP Larvae

Experiment 1

Method

[0174] Wiseana spp. larvae (most likely W copular is based on size and flight times of moths in January) were collected from pasture on Taieri Plain. The moths were housed in 60 ml specimen containers three quarters filled with ground pine bark(<2 mm) to which were added white clover (Trifolium repens var. Huia) leaves as food. This food was changed every 3-4 days and the larvae moved to fresh containers after three weeks and again one day prior to the commencement of the bioassay.

[0175] For the bioassay, ten larvae were randomly allocated to be given Yersinia entomophaga MH96 kibbled wheat baits and ten allocated as controls. Those larvae in the Yersinia entomophaga MH96 treatment were given approximately teaspoon of kibbled wheat (8-12 grains) while the control larvae continued to be given clover leaves. Larval survival and feeding was assessed after five days and again at ten days. Surviving larvae were fed again after five days according to treatment.

Results

[0176] After five days, six of the Wiseana spp. larvae given Yersinia entomophaga MH96 were dead while all the control larvae were alive and apparently healthy. After ten days all larvae given Yersinia entomophaga MH96 had died and all control larvae were alive. On both occasions the larvae given kibbled wheat had taken it into their burrows and signs of feeding were evident.

Conclusion

[0177] Yersinia entomophaga MH96 treated kibbled wheat was associated with the deaths of Wiseana spp. larvae.

Experiment 2

Introduction

[0178] The earlier laboratory bioassay in Experiment 1 above showed that the Yersinia entomophaga MH96 treatment caused mortality of large and small Wiseana spp larvae. However these bioassays were carried out using treated kibbled wheat where no alternative food source for the larvae was available, as the larvae were exposed to the baits and in small 60 ml specimen containers. Therefore, the current experiment was aimed to test the effectiveness of Yersinia entomophaga MH96 treatment under a more realistic situation where the larvae had an alternative food supply and could more easily avoid contact with the baits.

Method

[0179] Ten containers with transparent acrylic sides and measuring 500(l)300(w)300(h) mm (FIG. 9) were filled to a depth of 150 mm with fine (<3 mm) pine bark. A 30-40 mm layer of Yates potting mix was applied over the bark surface. Twelve Trifolium repens seedlings were planted into each of the ten containers and allowed to establish. The seedlings were held in a white shade-cloth covered tunnel house at ambient air temperature which was measured by two Tiny Tag temperature data loggers. Five days after planting, ten final instar stage Wiseana spp. larvae collected and placed in each container.

[0180] At 14 days after planting, the seedlings were cut to approximately 10 mm high (FIG. 9). Yersinia entomophaga MH96 broadcast kibbled wheat baits where applied to the surface of five of the containers at a rate equivalent to 50 kg baits/ha (0.83 g/container). The remaining five containers were untreated (controls).

[0181] The clover plants were assessed for survival 12 days after the application of Yersinia entomophaga MH96 broadcast kibbled wheat baits. A second application of bait was made 13 days after the first application and plant survival assessed again 25 days after the initial application. The plants were harvested (cut to ground level) two days later and dried at 80 C. overnight to assess dry matter production over the duration of the experiment. The containers were also broken down at this time and the potting mix/bark searched for Wiseana spp. larvae. The data were analysed by one way analyses of variance with no blocking (Genstat version 8).

Results

[0182] Although Wiseana spp. larvae destroyed some plants (Table 13, and FIG. 10) overall there were few differences in plant survival between treatments or assessment times. Plant survival was higher on both occasions in the containers treated with the bait, but this difference was not significant (Table 13 (P<0.13, P<0.08, first and second assessments respectively)).

[0183] There was no difference in clover production between the baited treatment and the control treatments (Table 13 (P<0.54)). Although survival of larvae was significantly higher in the control containers compared to those treated with the bait. (Table 13 (P<0.001)) it is probable that the warm temperatures and high nutrient status of the potting mix allowed the clover plants in those containers with high numbers of larvae to outgrow and compensate for the affects of larvae feeding.

[0184] The Wiseana spp larvae survival in the control containers was approximately 46%, and is considered to be satisfactory for field collected larvae and average density in these containers equated to 31 larvae/m.sup.2. This would be a moderate field density but the vegetation within the containers was sparse relative to pasture. The reduction in larvae numbers associated with the Yersinia entomophaga MH96 application was approximately 78%.

TABLE-US-00013 TABLE 13 Plant survival and production and Wiseana spp larvae survival (mean) over the duration of the bioassay. No plants No plants Dry Matter (g) Live Larvae Day 12 Day 25 Day 27 Day 27 Bait 11.6 11.6 11.2 1.0 Treatment Control 10.2 10.2 10.3 4.6 SED 0.8 0.7 1.3 0.5

[0185] The average temperature within the tunnel house during the bioassay was 10 C. but ranged from 0 to 32 C. (see FIG. 11). This was higher than usual outside air temperatures for this time of year and may have affected larvae activity and plant growth.

Examples of Other Susceptible Invertebrate Species

[0186] Table 14 below summaries a list of various other invertebrate species, including the DBM and Wiseana spp tested for susceptibility to whole Yersinia entomophaga MH96 cells

TABLE-US-00014 TABLE 14 Summary of the susceptibility of invertebrates to Yersinia entomophaga MH96. Develop- Patho- Insect Class: Family mental stage genic? Lepidoptera Lepidoptera: 1.sup.st-4.sup.th instar yes Diamondback moth larvae Plutella xylostella Porina Lepidoptera: larvae yes Wiseana copularis Heplidae Cotton bollworm Lepidoptera: larvae yes Helicoyerpa amigera Greater wax moth Lepidoptera: larvae yes Galleria mellonella Galleriidae Painted apple moth Lepidoptera: larvae yes Teia anartoides Lymantrlidae Greenheaded leafroller Lepidoptera: larvae yes Planotortrix notophaea Tortricidae Greenheaded leafroller Lepidoptera: larvae yes Planotortrix excessana Tortricidae Lightbrown apple moth Lepidoptera: larvae yes Epiphyas postvittana Tortricidae Brownheaded leafroller Lepidoptera: larvae yes Ctenoptusis spp. Tortricidae Pieris rapae Lepidoptera: larvae yes white butterfly ?Pieridae Coleoptera Coleoptera: larvae yes New Zealand grass grub Scarabaeidae Costelytra zealandica Red headed cockchafer Coleoptera: larvae yes Adoryphorus couloni Scarabaeidae Tasmania grass grub Coleoptera: larvae yes Acrossidius tasmaniae Scarabaeidae Pericoptus truncatus Coleoptera: larvae (yes) Sand scarab Scarabaeidae Chafer beetles? Coleoptera: larvae (yes) Odontria sp. Scarabaeidae Bark beetle Coleoptera: adults partial Hylastes ater Scolytidae Black vine weevil Coleoptera: larvae yes Otiorhynchus sulcatus Curculionidae Clover root weevil (CRW) Coleoptera: adult yes Sitona lepidus Curculionidae Argentine stem weevil (ASW) Coleoptera: adult adult- Listronotus bonariensis Curculionidae partial Hymenoptera Hymenoptera: nest yes Darwin's ant Formicidae Doleromyrma darwiniana Vespula vulgaris Hymenoptera: larvae yes Common wasps Vespidae Orthoptera Orthoptera: neonates yes Locusts older instar yes Locusta migratoria Diptera Nematoda slight root lesion nematode Pratylenchus penetrans

[0187] It would be appreciated that the present Invention provides a new biopesticide or method for controlling insects which has a broad efficacy across a range of insects, and providing a new biopesticide in a range of different forms.

[0188] Aspects of the present invention have been described by way of example only and it should be appreciated that modifications and additions may be made thereto without departing from the scope thereof as defined in the appended claims.

REFERENCES

[0189] Aroonrat Teera-Arunsiri, Manop Suphantharika and Uthai Kentunuti. 2003. Preparation of Spray-Dried Wettable Powder Formulations of Bacillus thuringiensis-Based Biopesticides. Biological and Microbial Corittol. 96 (2): 292-299. [0190] Bauce. E; Carisey, N.; Dupont, A.; van Frankenhuyzen, K (2004) Bacillus thuringiensis subsp. kurstaki Aerial Spray Prescriptions for Balsam Fir Stand Protection Against Spruce Budworm (Lepidoptera: Tortricidae) Journal of Economic Entomology, Volume 97, Number 5, October 2004, pp. 1624-1634(11) Entomological Society of America. [0191] Bercovier, H. & Mollaret, H. H. (1984). Genus XIV. Yersinia Van Loghem 1944, 15.sup.AL In Bergey's Manual of Systematic Bacteriology, vol. 1, pp. 498-506. Edited by N. R. Krieg & J. G. Holt. Baltimore: Williams & Wilkins. [0192] Burges, H. D. and Jones, K. A. (1998) Chapter 3 Formulation of bacteria, viruses and protozoa to control insects In Formulation of Microbial Biopesticides: Beneficial Microorganisms, Nematodes and Seed Treatments by H. Denis Burges: Kluwer Academic Publishers (October 1998) ISBN-1_0: 0412625202 ISBN-13: 978-0412625206. [0193] Cashion, P., Holder-Franklin, M. A., McCully, J. & Franklin, M. (1977). A rapid method for the base ratio determination of bacterial DNA. Anal Biochem 81, 461-466. [0194] Cathala G, Savourt J F, Mendez B, Karin M, Martial J M, Baxter J D, (1983). A method for isolation of intact translationally active ribonucleic acid. DNA 2, 239-335. [0195] Chiou A. L. and Wu W. S. 2003. Formulation of Bacillus amyfdlique faciens B190 for Control of Lily Grey Mould (Botrytis elliptica). J. Phytopathology 151, 13-18. [0196] De Ley, J., Cattoir, H. & Reynaerts, A. (1970). The quantitative measurement of DNA hybridization from renaturation rates. Eur J Biochem 12, 133-142. [0197] Doonan, Shawn. Protein Purification Protocols, Humana Press, 1 Mar. 1996, Science, ISBN 0-89603-336-8 [0198] Pitcher, D. G.; Saunders, N. A; and Owen, R. J (1989) Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Letters in Applied Microbiology 8: 151-156. [0199] Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbial. Rev. 53: 242-255. [0200] Hup. V. A. R., Festl, H. & Schleifer, K. H. (1983). Studies on the spectrometric determination of DNA hybridization from renaturation rates. Syst Appl Microbial 4, 184-192. [0201] Ibrahim, A., Liesack, W., Steigerwalt, A. G., Brenner, D. J., Stackebrandt, E. and Robins-Browne, R. M. (1997) A cluster of atypical Yersinia strains with a distinctive 16S rRNA signature. FEMS Microbiol. Lett. 146: 73-78. [0202] Kado, C. I., and S.-T. Liu. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365-1373. [0203] Kotetishvili M, Kreger A, Wauters G, Morris J G Jr, Sulakvelidze A, Stine O C. (2005) Multilocus sequence typing for studying genetic relationships among Yersinia species. J Clin Microbiol. 43:2674-2684. [0204] Lysenko. O (1985) Non-sporeforming bacteria pathogenic to insects: incidence and mechanisms. Ann Rev Microbiol 39:673-95. [0205] Maa, Y.-F. and Prestrelski, S. J. (2000) Biopharmaceutical Powders: Particle Formation and Formulation Considerations. Current Pharmaceutical Biotechnology, 2000, 1, 283-302 283 [0206] Mesbah, M., Premachandran, U. & Whitman, W. B. (1989). Precise measurement of the G+C content of deoxyribonucleic acid by high-performance liquid chromatography. Int J Syst Bacterial 39, 159-167. [0207] O'Callaghan M. And Jackson T. A. Isolation and enumeration of Serratia entomophila-a bacterial pathogen of the New Zealand grass grub, Costelytra zealandica. J. Appl. Bacterial., 1993, 75, 307-314. [0208] Sambrook J and Russell D W (2001) Molecular Cloning: A Laboratory Manual. Third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. [0209] Scopes, R. K. (1993). Protein Purification: Principles and Practice. Springer-Verlag ISBN 0-387-94072-3 [0210] Steven E. Lindow and Trevor V. Suslow. 2003. Temporal Dynamics of the Biocontrol Agent Pseudomonas fluorescens Strain. A506 in Flowers in Inoculated Pear Trees. Phytopathology 63 (6):727-737.