PREPARATION METHOD AND APPLICATION OF FLEXIBLE PAPER-BASED SENSOR FOR DETECTING MEAT PRODUCTS
20250164455 ยท 2025-05-22
Inventors
- Huanhuan Li (Zhenjiang, CN)
- Qiyi BEI (Zhenjiang, CN)
- Jiayu GAO (Zhenjiang, CN)
- Wei SHENG (Zhenjiang, CN)
- Quansheng CHEN (Zhenjiang, CN)
- Wei ZHANG (Zhenjiang, CN)
- Yu WU (Zhenjiang, CN)
Cpc classification
International classification
Abstract
A flexible paper-based sensor for detecting meat products is provided, which is prepared through steps of mixing a UCNPs-cDNA signal probe with an Apt-MIL-53(Fe)@Cu.sup.2+ capture probe to prepare a detection probe; and dropwise adding the detection probe onto a central area of a paper-based substrate to obtain the flexible paper-based sensor. A method for detecting tetracycline residues in meat products using such sensor is also provided.
Claims
1. A flexible paper-based sensor for detecting tetracycline residues in meat products, wherein the flexible paper-based sensor is prepared through steps of: (1) dissolving yttrium chloride hexahydrate, ytterbium chloride hexahydrate and erbium chloride hexahydrate in a first solvent, followed by addition of oleic acid and 1-octadecene, a first reaction under heating and stirring, and cooling to obtain a first mixture, wherein the first solvent is methanol; dissolving ammonium fluoride and sodium hydroxide in a second solvent to produce a solution, wherein the second solvent is methanol; mixing the solution with the first mixture followed by a second reaction under heating and stirring, injection of nitrogen gas, a third reaction under heating and stirring in a nitrogen atmosphere, and cooling to obtain a second mixture; and subjecting the second mixture to washing, centrifugation and drying to obtain an upconversion fluorescent nanomaterial; and mixing the upconversion fluorescent nanomaterial with chloroform, toluene and a polyacrylic acid aqueous solution followed by a fourth reaction under stirring, centrifugation and drying to obtain a carboxylated upconversion nanomaterial; (2) adding a 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride aqueous solution and a N-hydroxysulfosuccinimide aqueous solution to the carboxylated upconversion nanomaterial to obtain an incubation system; incubating the incubation system under shaking, followed by addition of a solution of a complementary chain of a tetracycline aptamer under shaking to obtain a UCNPs-cDNA signal probe; (3) dissolving 2-aminoterephthalic acid and Fe(NO.sub.3).sub.3.Math.9H.sub.2O in N, N-dimethylformamide under stirring, followed by a fifth reaction in a reactor, centrifugal washing and drying to obtain NH.sub.2-MIL-53(Fe); dissolving NH.sub.2-MIL-53(Fe) and CuCl.sub.2 in deionized water followed by a sixth reaction under stirring to obtain NH.sub.2-MIL-53(Fe)@Cu.sup.2+; adding a glutaraldehyde solution and a phosphate-buffered saline (PBS) to NH.sub.2-MIL-53(Fe)@Cu.sup.2+ followed by shaking in the dark, and centrifugation to collect a precipitate; and adding the tetracycline aptamer to the precipitate followed by shaking overnight and centrifugation to obtain an Apt-MIL-53(Fe)@Cu.sup.2+ capture probe; (4) mixing the UCNPs-cDNA signal probe with the Apt-MIL-53(Fe)@Cu.sup.2+ capture probe to obtain a detection probe; and (5) dropwise adding the detection probe onto a central area of a paper-based substrate to obtain the flexible paper-based sensor; wherein in step (1), a ratio of the yttrium chloride hexahydrate to the ytterbium chloride hexahydrate to the erbium chloride hexahydrate to the first solvent to oleic acid to 1-octadecene is (220-250) mg: (70-80) mg: (5-10) mg: (6-10) mL: (6-10) mL: (15-20) mL; a ratio of ammonium fluoride to sodium hydroxide to the second solvent is (0.1-0.2) g: (0.1-0.15) g: 10 mL; a ratio of the upconversion fluorescent nanomaterial to chloroform to toluene to the polyacrylic acid aqueous solution is 25 mg: 2 mL: 3 mL: 10 mL; and the first reaction is carried out at 160-170 C. under stirring at 300-500 rpm for 25-40 min; the second reaction is carried out at 50-70 C. under stirring at 300-500 rpm for 70-100 min; and the third reaction is carried out at 290-300 C. under stirring at 300-500 rpm for 60-90 min.
2. The flexible paper-based sensor of claim 1, wherein in step (2), a ratio of the carboxylated upconversion nanomaterial to the 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride aqueous solution to the N-hydroxysulfosuccinimide aqueous solution to the solution of the complementary chain is 20 mg: 1 mL: 1 mL: 60 L; and the complementary chain consists of a sequence shown as 5-GCATGCCTTAAGCGATCGGGGGGCCGTCCGGTGCCGAACCCAACCAGGGT GACGCGCACCTAGGCTCGAGGTGCAC-C.sub.6NH.sub.2-3 (SEQ ID NO:2).
3. The flexible paper-based sensor of claim 1, wherein in step (3), a ratio of 2-aminoterephthalic acid to Fe(NO.sub.3).sub.3.Math.9H.sub.2O to N,N-dimethylformamide is (0.9-1.0) g: (2.0-2.1) g: 50 mL; a ratio of the NH.sub.2-MIL-53(Fe) to CuCl.sub.2 to the deionized water is 50 mg: 1 g: 10 mL; a ratio of the NH.sub.2-MIL-53(Fe)@Cu.sup.2+ to the glutaraldehyde solution to the PBS to the tetracycline aptamer is 10 mg: 1.25 mL: 5 mL: 30 L; the tetracycline aptamer consists of a sequence shown as 5-NH.sub.2C.sub.6-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCAC TGCGCGTGGATCCGAGCTCCACGTG-3 (SEQ ID NO:1); and the fifth reaction is carried out in the reactor at 150-160 C. for 7-9 h, and the sixth reaction is carried out for 10-12 h.
4. The flexible paper-based sensor of claim 1, wherein in step (4), a volume ratio of the UCNPs-cDNA signal probe to the Apt-MIL-53(Fe)@Cu.sup.2+ capture probe is 1:1; a concentration of the UCNPs-cDNA signal probe is 2 mg/mL, and a concentration of the Apt-MIL-53(Fe)@Cu.sup.2+ capture probe is 1.2 mg/mL; and the mixing is carried out for 15 min.
5. The flexible paper-based sensor of claim 1, wherein in step (5), an addition amount of the detection probe is 3.5 L; and the paper-based substrate is prepared through steps of: ultrasonically mixing ethanol, ammonia water and tetraethyl orthosilicate to obtain a mixed solution, adding a cleaned filter paper to the mixed solution followed by shaking on a shaker, addition of 3-aminopropyltrimethoxysilane, reaction under shaking, washing and drying to obtain a silica-modified filter paper; and subjecting the silica-modified filter paper to hydrophobization to obtain the paper-based substrate.
6. A method for detecting tetracycline residues in a meat product, comprising: adding a test sample to the flexible paper-based sensor of claim 1, detecting a fluorescence intensity characteristic value of the test sample, and substituting the fluorescence intensity characteristic value into a tetracycline detection standard curve to calculate a tetracycline content in the test sample.
7. The method of claim 6, wherein a linear regression equation of the tetracycline detection standard curve is y=1873.01x425.34.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] In order to illustrate the technical solutions in the embodiments of the present disclosure or the prior art more clearly, the accompanying drawings needed in the description of the embodiments will be briefly described below. Obviously, presented in the accompanying drawings are only some embodiments of the present disclosure, and for those of ordinary skill in the art, other accompanying drawings can be obtained from the structures illustrated therein without making creative effort.
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION OF EMBODIMENTS
[0047] Various exemplary embodiments of the present disclosure will be described in detail herein. Such detailed descriptions should not be construed as a limitation on the present disclosure but rather as a more specific explanation of certain aspects, features and implementations thereof.
[0048] It should be understood that the terms described herein are provided solely for illustrating specific embodiments and are not intended to limit the present disclosure. Additionally, any numerical ranges disclosed herein are to be understood as explicitly including every intermediate value between their upper and lower limits. Furthermore, all smaller ranges defined by intermediate values within any stated value or range, or between other stated values, are also included. The upper and lower limits of these smaller ranges may independently be included or excluded.
[0049] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art relevant to the present disclosure. While preferred methods and materials are described, any similar or equivalent methods and materials may also be used in the implementation or testing of the present disclosure. All references cited herein are incorporated by reference to disclose and describe methods and/or materials related to those references. In case of any conflict, the content of this specification shall prevail.
[0050] Various modifications and variations of the embodiments described herein can be made without departing from the scope or spirit of the present disclosure, which will be apparent to those skilled in the art. Other embodiments obtained from the present disclosure are also obvious to those skilled in the art. The description and embodiments provided herein are merely illustrative.
[0051] As used herein, terms such as comprise, include, have and contain are open-ended expressions, meaning including but not limited to.
Example 1
[0052] To further verify the detection effect of a flexible paper-based sensor (
[0053] (1) 236.6 mg of yttrium chloride hexahydrate, 77.5 mg of ytterbium chloride hexahydrate and 7.6 mg of erbium chloride hexahydrate were dissolved in 6 mL of methanol, to which 6 mL of oleic acid and 15 mL of 1-octadecene were added. Nitrogen gas was injected into the reaction mixture, followed by a first reaction under heating and stirring in a nitrogen atmosphere. The first reaction was carried out at 160 C. under stirring at 400 rpm for 30 min. After the reaction was completed, the reaction mixture was cooled to room temperature to produce a mixed solution A. 0.1482 g of ammonium fluoride and 0.1 g of sodium hydroxide were dissolved in 10 mL of methanol to obtain a solution. The solution was mixed with the mixed solution A, followed by a second reaction under heating and stirring, injection of nitrogen gas, a third reaction under heating and stirring in a nitrogen atmosphere, and cooling to obtain a mixed solution B. The second reaction was carried out at 70 C. under stirring for 90 min. The third reaction was carried out at 300 C. for 80 min. The mixed solution B was subjected to washing using a mixture of ethanol and cyclohexane, centrifugation and drying to yield an upconversion fluorescent nanomaterial (as shown in
[0054] 50.0 mg of the upconversion fluorescent nanomaterial was ultrasonically mixed with 6.0 mL of toluene and 4.0 mL of chloroform in a round-bottomed flask. The reaction mixture was reacted with 20.0 mL of a 15 mg/mL polyacrylic acid aqueous solution in the dark under stirring for 48 h, followed by centrifugation and washing to remove excess polyacrylic acid to yield a carboxylated upconversion nanomaterial.
[0055] (2) 10 mg of the carboxylated upconversion nanomaterial was dissolved in 10 mL of MES (2-morpholinoethanesulphonic acid) buffer, to which 0.5 mL of a 1 mg/mL N-hydroxysulfosuccinimide aqueous solution and 0.5 mL of a 2 mg/mL 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride aqueous solution were added to obtain an incubation system. Then the incubation system was incubated under shaking for 2 h, followed by addition of 30 L of a solution of a complementary chain of a tetracycline aptamer at 100 M under shaking for 12 h. The tetracycline aptamer and its complementary chain were purchased from Sangon Biotech (Shanghai) Co., Ltd.
[0056] The tetracycline aptamer consisted of a sequence shown as 5-NH.sub.2C.sub.6-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCAC TGCGCGTGGATCCGAGCTCCACGTG-3 (SEQ ID NO:1). The complementary chain consisted of a sequence shown as 5-GCATGCCTTAAGCGATCGGGGGGCCGTCCGGTGCCGAACCCAACCAGGGT GACGCGCACCTAGGCTCGAGGTGCAC-C.sub.6NH.sub.2-3 (SEQ ID NO:2). Then the reaction mixture was subjected to centrifugation and washing to remove surface impurities, and resuspended in 5 mL of phosphate-buffered saline (PBS) to yield UCNPs-cDNA as a signal probe. The signal probe provided herein exhibited excellent luminescent properties, effectively reducing background fluorescence interference and enhancing the detection accuracy (as shown in
[0057] (3) 0.905 g of 2-aminoterephthalic acid and 2.02 g of Fe(NO.sub.3).sub.3.Math.9H.sub.2O were dissolved in 50 mL of N,N-dimethylformamide under stirring for 10 min to ensure uniform dispersion. Then the reaction mixture was transferred to a high-pressure reactor, followed by a fourth reaction at 150 C. for 8 h, cooling to room temperature, centrifugation at 6,000 rpm for 5 min to collect a first precipitate. The first precipitate was subjected to washing with N,N-dimethylformamide and ethanol absolute and drying at 60 C. for 12 h to yield a brown product NH.sub.2-MIL-53(Fe) (as shown in
[0058] (4) A 2 mg/mL UCNPs-cDNA solution and a 1.2 mg/mL Apt-MIL-53(Fe)@Cu.sup.2+ solution were mixed at a volume ratio of 1:1 and incubated at 37 C. to obtain a detection probe.
[0059] (5) Whatman No. 1 qualitative filter paper was cut into equal-sized pieces, soaked in 0.1 mol/L HCl for 30 min, washed with deionized water and dried in a drying oven at 50 C. to obtain a cleaned filter paper. Then, 20 mL of 80% ethanol, 500 L of ammonia water and 300 L of tetraethyl orthosilicate (TEOS) were ultrasonically mixed, followed by addition of the cleaned filter paper. The resulting mixture was reacted in a water bath under shaking at 40 C. for 8 h. Then, 300 L of 3-aminopropyltrimethoxysilane (APTES) was added, and the reaction was continued to perform under shaking for 2 h. After the reaction was completed, the resulting filter paper was washed three times with deionized water and ethanol absolute, respectively, followed by drying at 50 C. for 1 h to obtain a silica-modified filter paper. The edges of the silica-modified filter paper were subjected to hydrophobization. A pattern was designed on a computer and printed onto the silica-modified filter paper using an inkjet printer. The printed filter paper was processed in an oven at 200 C. for 6 h to allow the toner to permeate the filter paper fibers, forming hydrophobic regions on the surface. After natural cooling, a paper-based substrate was obtained and stored in a dry environment for later use.
[0060] (6) 3.5 L of the detection probe was dropwise added onto a central area of the paper-based substrate to prepare a flexible paper-based sensor. The sensor provided herein was compact, portable, easy to use and suitable for on-site detection applications.
[0061] (7) Tetracycline standard solutions of different concentrations (20, 50, 100, 500, 1000, 5000, 10000 g/L) were prepared. Different concentrations of the tetracycline standard solutions were added to the flexible paper-based sensor to detect the fluorescence intensity of the sensor. Based on the fluorescence intensity corresponding to different concentrations of the tetracycline standard solutions, a tetracycline detection standard curve was plotted with the logarithm of the tetracycline concentration as the x-axis and the fluorescence intensity signal characteristic values as the y-axis (shown in
[0062] (8) 5 g of fish meat sample was mixed with different concentrations of the tetracycline standard solutions and 20 mL of EDTA.Math.2Na-McIlvaine buffer, and vortexed for 10 min. The reaction mixture was added with 5 mL of a 18.5% H.sub.2SO.sub.4 solution and 5 mL of a 70 mg/mL sodium tungstate solution and vortexed for 1 min followed by centrifugation to collect a first supernatant and a fourth precipitate. The fourth precipitate was extracted twice with EDTA.Math.2Na-McIlvaine buffer to obtain a second supernatant and a third supernatant. Then the first, second and third supernatants were mixed followed by a first filtration through a filter paper to remove large particulate impurities and a second filtration through a 0.22 m micropore filter to obtain a sample solution. 3.5 L of the sample solution was then added to the flexible paper-based sensor to measure the fluorescence intensity signal characteristic value. The fluorescence intensity signal characteristic value was substituted into the tetracycline detection standard curve obtained above to calculate the tetracycline content in the fish meat sample.
[0063] Three fish meat samples were tested for tetracycline content using the method and steps described herein and the results were verified using the national standard method. The measurement results were shown in Table 1. It can be concluded that the method disclosed herein demonstrated good accuracy in actual samples, indicating a promising application prospect.
Table 1 Results of Detecting Tetracycline Content in Fish Meat Samples Using the Method Provided Herein and High-Performance Liquid Chromatography (HPLC)
TABLE-US-00001 HPLC Method provided herein Relative Relative Detected standard Detected standard concentration deviation concentration deviation Sample (g/kg) (%) (g/kg) (%) t-test Fish 3950.54 9.92 0.25 3957.92 235.14 5.94 P > 0.05 meat 891.73 6.44 0.72 871.36 6.83 0.78 423.88 3.11 0.74 414.74 8.36 2.02
[0064] Described above are merely preferred embodiments of the present disclosure, and are not intended to limit the scope of the present disclosure. It should be understood that various modifications, changes and replacements made by those skilled in the art without departing from the spirit of the disclosure shall fall within the scope of the present disclosure defined by the appended claims.