Manganese-oxidizing fungus and uses thereof

Abstract

A fungus having manganese oxidation capacity is provided. The fungus can oxidize Mn.sup.2+ in a water body into a water-insoluble manganese oxide; and the Mn.sup.2+ oxidizing fungus is Cladosporium sp. XM01 strain with the accession number of CGMCC NO. 21083. The Cladosporium sp. XM01 strain is used to oxidize Mn.sup.2+ in a natural water body, and has stable operation within a range of room temperature (15-30 C.) and a range of neutral pH (6.0-7.5) and high Mn.sup.2+ oxidation efficiency; moreover, the XM01 strain may oxidize Mn.sup.2+ cyclically, thereby achieving the in-situ remediation of water bodies or soils polluted by heavy metals or trace organic substances. The manganese oxides generated through oxidization in the growth process of the strain have a good application potential in sewage treatment, water environment restoration, soils and other fields.

Claims

1. A method for removing Mn.sup.2+ from a water body or a solid matrix, the method comprising the following steps of: inoculating a manganese-oxidizing fungus or a microbial agent comprising the manganese-oxidizing fungus into the water body or the solid matrix; and culturing for a predetermined period of time under conditions of 25-30 C. and pH 7.0, so that the Mn.sup.2+ is transformed into a manganese oxide, wherein the manganese-oxidizing fungus is Cladosporium sp. XM01, which has been preserved in China General Microbiological Culture Collection Center (accession number: CGMCC NO. 21083).

2. The method for removing Mn.sup.2+ from the water body or the solid matrix according to claim 1, wherein the water body comprises industrial wastewater, domestic wastewater, underground water and tap water; and the solid matrix comprises a soil and a sediment.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a phylogenetic dendrogram of Cladosporium sp. XM01 in this present disclosure based on ITS rRNA genes.

(2) FIG. 2 shows electrophoretogram of Cladosporium sp. XM01 in this present disclosure (DL2000 band distribution: 2000, 1000, 750, 500, 250, and 100 bp).

(3) FIGS. 3a-3c shows a SEM graph (2kX) of biological manganese oxides produced by 10 Cladosporium sp. XM01 in this present disclosure and energy spectrum analysis corresponding to markers, where the box portion denotes the markers (FIGS. 3b and 3c, FIG. 3b denotes marker 1 and FIG. 3c denotes marker 2).

(4) FIG. 4 shows Mn.sup.2+ adsorption and oxidization properties (initial concentration is 200 M) of Cladosporium sp. XM01 in this present disclosure.

(5) FIG. 5 shows a Mn.sup.2+ oxidization curve of Cladosporium sp. XM01 in this present disclosure at different concentrations of manganese.

(6) FIG. 6 shows Mn.sup.2+ oxidation activity of Cladosporium sp. XM01 in this present disclosure at different temperature.

(7) FIG. 7 shows Mn.sup.2+ oxidation activity of Cladosporium sp. XM01 in this present disclosure at different pH values.

DESCRIPTION OF THE EMBODIMENTS

(8) The present disclosure will be further described in details with reference to detailed examples; and those skilled in the art should understand that the present disclosure is not limited to these detailed examples.

(9) Unless otherwise specified, methods in the following examples should be conventional methods; and the reagents used therein are conventional reagents available in the market.

Example 1

(10) Isolation and Purification of a Manganese-Oxidizing Fungus Cladosporium sp. XM01

(11) Cladosporium sp. XM01 was obtained by sampling, domesticating, separating and purifying the soil derived from the manganese ore stacked in Xiangtan Manganese Mine of Hunan Province. Specific steps were as follows:

(12) (1) Preliminary screening: black brown soil was collected from the nearby Xiangtan Manganese Mine of Hunan Province; and 2 g soil was taken and added to an HAY medium sterilized by high temperature (0.246 g/L sodium acetate; 0.15 g/L yeast powder; 0.05 g/L magnesium sulfate heptahydrate; 5 mg/L dipotassium phosphate; 2 mL/L mineral salts; where per liter of mineral salts included the ingredients below: 3.7 g calcium chloride dihydrate; 0.44 g zinc sulfate heptahydrate; 0.29 g sodium molybdate dihydrate; 2.5 g boric acid; 5 mg copper sulfate pentahydrate; and 1.0 g ferric chloride hexahydrate) in a laboratory to make the content of MnCl.sub.2 being 200 M; a buffer solution in the medium was HEPES having a final concentration of 20 mM and pH of 7.0; where the MnCl.sub.2 solution and HEPES buffer solution were filtered by a 0.22 m filter membrane and sterilized for addition. The above soil was domesticated for 7 d every time on a 170 rpm table in dark place at 25 C., after the domestication, 5 mL domesticated fungal solution was taken and added onto a freshly-prepared 45 mL HAY medium for continuous domestication for 4 times in total.

(13) (2) Secondary screening: after the domestication, the fungal solution was diluted 10.sup.1 to 10.sup.7 folds by sterilized tap water; 0.1 mL diluent was respectively taken and coated on a solid medium containing 100 M Mn.sup.2+ (prepared by adding 2% agar to the above liquid HAY culture medium) for isolation, and cultured in the dark at 25 C. After obvious colonies grew on the medium, a single colony forming brown substances thereon was picked and marked out for isolation and purification. A strain having stronger manganese oxidation capacity was determined by surveying the growth rate and Mn.sup.2+ oxidation rate of these fungi.

(14) (3) Liquid culture conditions of the Cladosporium sp. XM01 strain: a 150 mL HAY medium was added to a 250 mL conical flask, and an HEPES buffer solution having a final concentration of 20 mM and a pH value of 6.0-8.0 was added; and the table was configured at 170 rpm and 15-30 C. The strain cells were collected by centrifugation for 10 min at 3000-5000 r/min.

Example 2

(15) Molecular Biological Identification of Cladosporium sp. XM01

(16) Cladosporium sp. XM01 was extracted by a fungal genome kit (purchased from Omega, Code no. D3390-02), and subjected to PCR amplification by using universal primers ITS1(TCCGTAGGT GAACCTGCGG) and ITS4(TCCTCCGCTTATTGATATGC) for fungi ITS rRNA genes. PCR reaction system:

(17) TABLE-US-00001 10 Ex Taq buffer 2.0 l 5 u Ex Taq 0.2 l 2.5 mM dNTP Mix 1.6 l 5 p Primer 1 1 l 5 p Primer 2 1 l DNA 0.5 l ddH.sub.2O 13.7 l Total volume 20 l

(18) PCR experiments were performed using the following program: initial denaturation at 95 C. for 5 min, followed by 25 cycles of denaturation at 95 C. for 30 s, primer annealing at 56 C. for 30 s and extension at 72 C. for 30 s. A final long extension was at 72 C. for 10 min.

(19) Samples were sequenced via the amplified PCR product by Majorbio. Sequences obtained by sequencing were as shown in SEQ ID NO.1, and were compared to the sequences in database by BLAST on line; sequences having greater than 97% similarity were selected as reference sequences; and a phylogenetic tree of fungal system was constructed by Neighbor-Joining with Mega4.0 software (FIG. 1).

Example 3

(20) Scanning Electron Microscope (SEM) and Energy Dispersive X-Ray Detector (EDX) of Cladosporium sp. XM01

(21) The isolated Cladosporium sp. XM01 was inoculated into a Mn.sup.2-containing liquid HAY culture medium (inoculum size was 110.sup.5 conidia/mL); and cultured in the dark for 3 d at 25 C. and 170 rpm to collect biological manganese oxides; the biological manganese oxides were subjected to SEM and EDX. The results of SEM combined with EDX were as shown in FIG. 3 and table 1; marker 1 denoted an aggregate containing manganese oxides; marker 2 denoted manganese oxide-free mycelium surface; higher content of manganese oxides was detected in the marker 1 of the Cladosporium sp. XM01 strain cells, being up to 30.81%; compared with marker 2, the manganese content increased by 25.68%. Thus, it can be seen that the strain XM01 could form manganese oxide aggregates on the epispore, and may participate in the manganese oxidation process via protein factors distributed on the epispore.

(22) TABLE-US-00002 TABLE 1 EDX results Mass percentage Atom percentage Element Marker 1 Marker 2 Marker 1 Marker 2 C K.sup.a 29.90 52.52 45.89 61.59 N K.sup.a 3.23 7.16 4.26 7.20 O K.sup.a 32.19 32.51 37.09 28.62 Na K.sup.a 0.39 0.19 0.31 0.12 Mg K.sup.a 0.41 0.22 0.31 0.13 Al K.sup.a 0.39 0.22 0.26 0.11 Si K.sup.a 0.25 0.13 0.16 0.06 P K.sup.a 1.57 1.32 0.93 0.60 S K.sup.a 0.45 0.37 0.26 0.16 K K.sup.a 0.41 0.23 0.19 0.08 Mn K.sup.a 30.81 5.13 10.34 1.31 Note: K.sup.a referred to energy excited by an atomic layer K.

Example 4

(23) Studies on Biological Oxidation Properties of the Cladosporium sp. XM01 Strain to Mn.sup.2+

(24) The Mn.sup.2+ oxidation and adsorption capacity of the manganese-oxidizing fungus (Cladosporium sp. XM01) were surveyed in the Mn.sup.2+-adding HAY medium; it was found that the fungus in this present disclosure had good oxidation and adsorption capacity to Mn.sup.2+ and could remove soluble Mn.sup.2+ in the matrix completely within a short time, so that most of the Mn.sup.2+ were transformed into water-insoluble manganese oxides.

(25) Specific steps were as follows:

(26) (1) Manganese Adsorption and Oxidation Properties of the Fungus in this Present Disclosure at Different Periods of Time

(27) The isolated Cladosporium sp. XM01 was inoculated into sterilized liquid HAY culture medium (inoculum size was 110.sup.5 conidia ml.sup.1) containing 200 M Mn.sup.2+, and cultured at 25 C. and 170 rpm for 3 days in the dark. Samples were taken at specific intervals to measure the concentration of Mn.sup.2+ remaining in a culture solution and to collect biological manganese oxides; and then adsorption and oxidation capacity of the biological manganese oxides to Mn.sup.2+ were measured by a two-step extraction method.

(28) Samples of the culture solution were filtered by a 0.45 m filter membrane, and then the concentration of Mn.sup.2+ remaining in the culture solution was measured by Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES) (Agilent, 5110 series).

(29) Two-step extraction method: a medium was centrifuged for 10 min at 3000 r/min to collect precipitates (including mycelia and solid-phase manganese oxides); afterwards, the precipitates were washed by deionized water and resuspended by 20 mM copper sulfate for 16 h to extract extracellularly adsorbed Mn.sup.2+; and then the precipitates were washed by deionized water to thoroughly disrupt cells in the precipitates by a cell disruption method (working for 3 s at 2 h interval for 15 acoustic wave cycles in total), and the disrupted samples were treated by an extracellular adsorption method to extract Mn.sup.2 absorbed intracellularly, and finally, treated by 50 mM hydroxylamine hydrochloride to extract the oxidized Mn. The concentration of manganese in the extractive was measured by ICP-AES (Agilent, 5110 series).

(30) As shown in FIG. 4, the strain was sensitive to the environment and had lower oxidation capacity to manganese after being cultured for 0-24 h; and Mn (II) was mainly removed by extracellular adsorption. After being cultured for 24-48 h, the strain was up to the increased logarithmic phase and achieved a rapid increase in quantity, which was beneficial to adsorption; the adsorption rate was 13.64% at 48 h; and the strain adapted to the environment and had an ability to oxidize manganese. After being cultured for 48-66 h, the adsorption rate increased slowly, and the cell adsorption rate was up to 21.18% at 66 h; while after being cultured for 72 h, Mn (II) in the solution was basically removed, and the adsorption capacity suffered a decrease; and the adsorption rate decreased to 18.63%; this was probably because the strain rapidly increased in the logarithmic phase in quantity, and accordingly the adsorption rate increased rapidly. In a stabilization stage, the adsorption capacity tended to be stable and even decline, resulting in the slow growth of the adsorption rate. After the grain was cultured for 24 h, Mn (II) oxidation enhanced rapidly, and the manganese oxidation rate was up to 81.18% at 72 h. This finding provided that the Cladosporium sp. XM01 strain had high manganese oxidation capacity. The adsorption capacity tended to decline at 72 h, while the oxidation capacity was tending to increase. This was the result of oxidizing the adsorbed manganese. In a word, Mn (II) oxidation of the manganese-oxidizing fungus played a leading role in the removal of soluble Mn (II).

EXISTING LITERATURE

(31) 1. Zhang Y, Tang Y K, et al. A novel manganese oxidizing bacterium-Aeromonas hydrophila strain DS02: Mn(II) oxidization and biogenic Mn oxides generation. Journal of Hazardous Materials, 2019, 367: 539-545. 2. Tang W W, Gong J M, Wu L J, et al. DGGE diversity of manganese mine samples and isolation of a Lysinibacillus sp. efficient in removal of high Mn (II) concentrations. Chemosphere, 2016, 165: 277-283.

(32) As shown in Table 2, compared with the manganese oxidizing bacterium reported in the above existing literature, the manganese-oxidizing fungus in this present patent has a manganese removal rate of 99.9%; and the manganese oxidation rate is up to 81.18%; therefore, the manganese-oxidizing fungus of this present disclosure has significant advantages.

(33) TABLE-US-00003 TABLE 2 Comparison in manganese removal effect and oxidation effect of different manganese-oxidizing bacteria Manga- Manga- nese nese Manganese-oxidizing removal oxidation No. bacteria rate rate Literature 1 Aeromonas sp. DS02 89.6% 49.6% Zhang et al., 2019 2 Lysinibacillus sp. 94.7% 55.9% Tang et al., 2016 3 Cladosporium sp. 99.9% 81.18% The present patent

(34) (2) Manganese Oxidation Properties of the Fungus in this Present Disclosure Under Different Concentrations of Mn.sup.2+

(35) The Mn.sup.2+ oxidation capacity of the manganese-oxidizing fungus (Cladosporium sp. XM01) in this present disclosure was surveyed in a Mn.sup.2+-adding medium. It was found that the fungus in this present disclosure had very good oxidation capacity to Mn.sup.2+, and could completely remove the soluble Mn.sup.2+ in the matrix within a short time; and most of the Mn.sup.2+ were transformed into water-insoluble manganese oxides. Through the culture experiments under different initial concentrations of Mn.sup.2+, it was found that the fungus in this present disclosure could completely remove 800 M Mn.sup.2+ and lower; moreover, with the increase of the Mn.sup.2+ initial concentration, the manganese oxidation activity of the fungus tended to be lower slightly. Specific steps were as follows:

(36) The isolated Cladosporium sp. XM01 was inoculated into sterilized liquid HAY culture medium (inoculum size was 110.sup.5 conidia/mL) containing different concentrations of Mn.sup.2+, and cultured at 25 C. and 170 rpm in the dark. Samples of the culture solution were taken at specific intervals, and filtered by a 0.45 m filter membrane, and then the concentration of Mn.sup.2+ remaining in the culture solution was measured by Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES) (Agilent, 5110 series).

(37) As shown in FIG. 5, the fungus could thoroughly remove 800 M Mn.sup.2+ and lower; and with the increase of the Mn.sup.2+ concentration, the manganese oxidation activity of the fungus to Mn.sup.2+ tended to be lower slightly; but 800 M concentration of Mn.sup.2+ has been much greater than the concentration of Mn.sup.2+ in common rivers or underground water. The results indicate that the fungal flora can thoroughly oxidize the Mn.sup.2+ within a concentration range in a common water body.

(38) (3) Manganese Oxidation Properties of the Fungus in the Present Disclosure Under Different Temperature Conditions

(39) Based on the studies on the manganese oxidation properties of the fungus under different culture temperature, it was found that the fungus in the present disclosure had Mn.sup.2+ oxidation activity within a temperature range of 1530 C.; and from the angle of practical application, it was relatively appropriate to choose 20-30 C. Specific steps were as follows:

(40) The isolated Cladosporium sp. XM01 was inoculated into sterilized liquid HAY culture medium (inoculum size was 110.sup.5 conidia/mL), and Mn.sup.2+ having a final concentration of 200 M and a 20 mM HEPES buffer solution having a pH value of 7.0 were added in a filtering way; and then respectively placed onto tables in the dark at 170 rpm and 15 C., 20 C., 25 C., and 30 C. Samples of the culture solution were taken at specific intervals, and filtered by a 0.45 m filter membrane, and then the concentration of Mn.sup.2+ remaining in the culture solution was measured by Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES) (Agilent, 5110 series).

(41) As shown in FIG. 6, the manganese oxidation activity of the fungus decreased with the decrease of the culture temperature; and the oxidation rate was the slowest at 15 C., and faster slightly at 20 C., and up to the maximum at 25-30 C. It indicates that the most suitable oxidizing temperature of the fungus was in a range from 25 to 30 C. The fungus can exert manganese oxidation activity at a low temperature of 15 C., showing its stronger adaptability to the temperature.

(42) (4) Manganese Oxidation Properties of the Fungus in the Present Disclosure Under Different pH Conditions

(43) Through the oxidation experiments at different initial pH values, it was found that the most suitable pH for manganese oxidation of the fungus was 7; and the specific steps were as follows:

(44) The isolated Cladosporium sp. XM01 was inoculated into sterilized liquid HAY culture medium (inoculum size was 110.sup.5 conidia/mL), and Mn.sup.2+ having a final concentration of 200 M was added in a filtering way; and then pH was respectively adjusted to 6 and 6.5 by an MES buffer solution; then the pH was respectively adjusted to 7.0 and 7.5 by an HEPES buffer solution; and cultured on a table at 170 rpm in the dark. Samples of the culture solution were taken at specific intervals, and filtered by a 0.45 m filter membrane, and then the concentration of Mn.sup.2+ remaining in the culture solution was measured by Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES) (Agilent, 5110 series).

(45) As shown in FIG. 7, the manganese oxidation rate was up to the maximum at pH=7; the fungus could basically oxidize Mn.sup.2+ within a pH range of 6.0-7.5; moreover, the pH range is consistent with the pH of most of the water bodies in natural world, indicating that the fungus can exert manganese oxidation activity under pH conditions of the natural water body.

(46) To sum up, researchers found that the Cladosporium sp. XM01 had Mn.sup.2+ oxidation activity within a pH range of 6.0-7.5 and a temperature range of 1530 C., and had Mn.sup.2+ oxidation activity under the condition that Mn.sup.2 concentration was not higher than 800 M.

(47) The above description made to the examples is convenient for those skilled in the art to understand and use the present disclosure. Apparently, those skilled in the art can readily make various amendments to these examples, and apply the general principles described herein to other examples without any inventive labor. Therefore, the present disclosure is not limited to the above examples; based on the present disclosure, improvements and amendments made by those skilled in the art without departing from the spirit and scope of the present disclosure shall fall within the protection scope of the present disclosure.