Use of extracellular vesicles of Rhizoma Drynariae in preparation of medicine for treating orthopedic diseases
12311001 ยท 2025-05-27
Assignee
Inventors
Cpc classification
A61K2236/31
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
International classification
A61K36/00
HUMAN NECESSITIES
Abstract
Use of extracellular vesicles of Rhizoma Drynariae in the preparation of a medicine for treating orthopedic diseases. The extracellular vesicles are extracted from the traditional Chinese medicine Rhizoma Drynariae, so that proliferation and differentiation of the bone marrow mesenchymal stem cells can be promoted, and the bone targeting property is achieved; in addition, various functional components which are the same as those of Rhizoma Drynariae are contained, so that the potential of treating orthopedic diseases is proved. Therefore, the extracellular vesicles of Rhizoma Drynariae can be applied to the preparation of a medicine for treating orthopedic diseases.
Claims
1. A method of making extracellular vesicles of Rhizoma Drynariae comprising the following steps: (1) juicing fresh Rhizoma Drynariae, filtering, collecting a filtrate, centrifuging to remove impurities and collecting a supernatant; wherein the centrifuging comprises three centrifugations, a first centrifugation performed at a speed of 100-500 g producing a first supernatant, a second centrifugation performed on said supernatant at a speed of 1000-3000 g producing a second supernatant, and a third centrifugation performed at a speed of 8000-12000 g producing a third supernatant; wherein the centrifugations are each independently performed for 5-30 min; (2) centrifuging the third supernatant at a speed of 100000-200000 g for 60-120 min, and collecting a precipitate to obtain the extracellular vesicles of Rhizoma Drynariae wherein the extracellular vesicles of Rhizoma Drynariae contains naringin, eriodictyol, cinnamic acid, naringenin, prunin, caffeic acid, sinapinic acid, afzelin, secoisolariciresinol, narirutin and kaempferol.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
(10) Technical solutions of the present application are further described below through embodiments. Those skilled in the art are to understand that the examples described herein are used for a better understanding of the present application and are not to be construed as specific limitations to the present application.
(11) Rhizoma Drynariae involved in the following examples is purchased from Zhaoqing, Guangdong Province, and identified as a root of Drynaria fortunei (Kunze) J.Sm. by the Traditional Chinese Medicine Pharmacy of the Third Affiliated Hospital of Guangzhou University of Chinese Medicine.
Example 1
(12) Extraction of DREVs
(13) This example provides a method for extracting DREVs. The method includes the steps described below.
(14) 500 g of fresh Rhizoma Drynariae was taken and thoroughly cleaned with sterile water, cut into small pieces and juiced. After filtration, the supernatant was collected in a clean 50 mL centrifuge tube and centrifuged at 300 g for 10 min at 4 C. to remove floating cells. The supernatant was collected in a 50 mL centrifuge tube and centrifuged at 2000 g for 20 min at 4 C. to remove dead cells and falling vesicles. The supernatant was collected in a 50 mL centrifuge tube and centrifuged at 10000 g for 30 min at 4 C. to remove dead cells, falling vesicles and apoptotic bodies. The supernatant was collected in a special centrifuge tube for a differential ultrahigh-speed centrifuge and centrifuged at 135000 g for 70 min at 4 C., and the supernatant was discarded. A precipitate was resuspended in a pre-cooled 1PBS buffer and filtered by using a 0.22 m disposable syringe filter. Finally, the DREVs was collected in a sterilized EP tube and stored in a refrigerator at 80 C. for later use.
Example 2
(15) Characterization of DREVs
(16) The morphology, particle size and content of the DREVs extracted in Example 1 were characterized.
(17) The morphology of the DREVs was observed under a transmission electron microscope. It can be observed that the DREVs are round or oval in shape, have a typical cup-shaped vesicle structure and a complete cell membrane structure and have a particle size of between 0-300 nm (see
(18) The particle size distribution of the DREVs was analyzed by using a nanoparticle tracking analyzer. It is found that the DREVs have a particle size distributed between 0-300 nm (the result is the same as that observed under the transmission electron microscopy) and a concentration of 1.0410.sup.9 particles/mL, which further proves the successful extraction of the EVs.
(19) Different concentrations of surfactants Triton X-100 (TX100) which impair the integrity of membranes were used for dissolving membranes of the DREVs, respectively. Then, a change in the number of particles of DREVs was tested by using a nanoflow detector. The results show that the number of particles of DREVs gradually decreases as the concentration of Triton X-100 increases. Compared with a group not using Triton X-100, the number of particles of DREVs in a group using 0.1% Triton X-100 is significantly decreased, and a difference has a statistical significance (in
(20) RNA, proteins and lipids in the DREVs were detected through methods of agarose gel electrophoresis, Coomassie brilliant blue staining and TLC (thin-layer chromatography), respectively. The results are shown in
Example 3
(21) Exploring Promotion Effects of DREVs on Proliferation and Differentiation of h-BMSCs
(22) To understand the biological activity of the DREVs, an effect of the DREVs on the proliferation of the h-BMSCs was detected through a CCK8 method.
(23) Experimental method: the h-BMSCs were cultured by using DMEM-F12 medium+10% fetal bovine serum (FBS)+1% anti-penicillin-streptomycin under 5% CO.sub.2 (standard atmospheric pressure) at 37 C. When a density of adherent cells reached 80%-90%, the cells were digested by trypsin, and the cells were collected and counted. The cells were inoculated in a 96-well plate according to a cell density of 310.sup.3 cells/cm.sup.2. A protein content of the DREVs was detected by using BCA kit. Different concentrations of DREVs were co-cultured with the h-BMSCs, and the concentration of each group was marked. The concentrations may be divided into four groups: 15 g/mL DREVs, 20 g/mL DREVs, 30 g/mL DREVs and a control group where no DREV was added, respectively. An absorbance at 450 nm was measured after 12 h, 24 h and 48 h of culture according to an operation in a specification of a CCK-8 kit.
(24) The results are shown in
(25) An effect of the DREVs on the osteogenic differentiation of the h-BMSCs was detected through qRT-PCR.
(26) An experimental method is described below.
(27) The h-BMSCs were purified, cultured, grown to an appropriate density and digested by trypsin, and the cells were collected and counted. The cells were inoculated in a six-well plate according to a cell density of 210.sup.5 cells/m.sup.2, and the six-well plate was placed in an incubator for culture. When the cell density was increased to 80%, liquids in the wells were completely drawn and replaced with osteogenic differentiation inducing mediums of corresponding groups. The cells were divided into two groups: a control group and an experimental group. In the control group, an osteogenic differentiation inducing liquid was added to h-BMSCs to induce differentiation, and in the experimental group, 20 g/mL DREVs stimulate h-BMSCs, and an osteogenic differentiation inducing liquid was added to the h-BMSCs to induce differentiation. After this, the osteogenic differentiation inducing mediums of the corresponding groups were replaced once every three days. On days 0, 1, 3, 6 and 9 of inducing osteogenic differentiation, the cells were collected by using a TRIzol lysate, placed in sterilized EP tubes and marked, and qRT-PCR was performed to detect the expression of osteogenic differentiation-related genes (ALP and BMP2).
(28) Primer sequences of the related genes are as follows:
(29) Alp Sequences:
(30) TABLE-US-00001 SEQIDNO.1: ACCACCACGAGAGTGAACCA(5>3) SEQIDNO.2: CCCTGACCATGAGTCTGTTGC(5>3)
Bmp2 Sequences:
(31) TABLE-US-00002 SEQIDNO.3: ACTACCAGAAACGAGTGGGAA(5>3) SEQIDNO.4: TCCAAAAGGCTCTTGTCTACG(5>3)
Gapdh Sequences:
(32) TABLE-US-00003 SEQIDNO.5: ACAACTTTGGTATCGTGGAAGG(5>3) SEQIDNO.6: CTTTGACACCGCACTACCG(5>3)
(33) A procedure for an amplification reaction: for 10 min at 95 C. (pre-denaturation), for 10 s at 95 C. (denaturation), for 15 s at 60 C. (annealing and fluorescence collection) and for 20 s at 72 C. (extension), a total of 40 cycles; a melting curve: for 15 s at 95 C., for 1 min at 60 C., for 15 s at 95 C. and for 15 s at 60 C.
(34) At the end of the amplification reaction experiment, whether an amplification curve and a dissolution curve were normal curves was observed, and under the normal curves, the specificity of different products was detected through a melting curve analysis. An internal reference gene was a GAPDH gene, and each sample was repeatedly detected three times to reduce a systematic error, and a relative quantification (RQ) of each sample gene was determined through a comparative Ct method. A Ct value of each sample gene was analyzed, the result was represented by a relative level of the comparison between the each sample gene and the internal reference GAPDH gene, and finally, a relative expression level of the each sample gene was calculated by using a 2.sup.-CT formula.
(35) The results show that compared with the control group, the 20 g/mL DREVs can upregulate the expression of the osteogenic phenotype gene ALP during the osteogenic differentiation of the h-BMSCs and the difference results on days 1, 3 and 6 have statistical significances, respectively (in
(36) To exert the effect, the EVs need to be taken up by target cells first and then affect a related function of the target cells. Therefore, to prove that the DREVs can be internalized and absorbed by the h-BMSCs, the DREVs were marked with a lipophilic fluorescent dye Dil dye (red), and the marked DREVs were co-cultured with the h-BMSCs. After six hours, cell nuclei of the h-BMSCs were stained by using a cell nucleus dye Hoechst 33342 (blue) to observe a specific localization of the Dil-DREVs after the Dil-DREVs were internalized and absorbed. The results show that under a fluorescence microscope, the cell nuclei show blue fluorescence, and the Dil-DREVs show red fluorescence and mostly located in cytoplasm of the h-BMSCs (
Example 4
(37) Exploring Bone Targeting Property of DREVs in Animal
(38) The preparation of a solution of DiR-DREVs: 200 L DREVs were taken, placed in a sterilized EP tube and marked, according to a requirement of a manufacturer's specification, 5 L DiR staining solution was added, and finally, a phosphate-buffered saline (PBS) buffer was added to dilute to 1000 L, uniformly mixed and stained for 20 minutes in the dark. After 20 minutes, the mixture was centrifuged at 135000g for 70 min at 4 C., and the supernatant was discarded. After a precipitate was resuspended in a PBS buffer, centrifugation was repeated twice to three times to wash an excess staining solution. After the last centrifugation, a precipitate was resuspended in 100 L PBS buffer to obtain the solution of DiR-DREVs, which was stored in a refrigerator at 80 C. for later use.
(39) A 100 L solution of DiR-DREVs was injected into female C57BL/6J mice through different administration routes (tail vein injection and intraperitoneal injection). 100 L 1PBS was administered as a blank control group, and 100 L DiR staining solution diluted with PBS (the DiR staining solution had a concentration of 20 L/mL) was administered as a positive control group. Fluorescence imaging was performed at 6 hours, 24 hours, 48 hours and 72 hours after the administration.
(40) The results show that in the group of tail vein injection, no signal can be detected at any time point in mice administered PBS, most fluorescence signals detected in mice administered the DiR staining solution are located in livers, spleens and lungs while no signal can be detected in bones, hearts and kidneys, most fluorescence signals detected in mice administered the DiR-DREVs are also located in livers, spleens and lungs while no signal can be detected in hearts and kidneys, but in mice at 6, 24, 48 and 72 hours, corresponding signals can be clearly detected in bones (figure A in
(41) Then, fluorescence regions of each organ in each group of mice were quantified by using Living Imaging software to obtain corresponding values (the specific data are shown in Table 1 and Table 2).
(42) TABLE-US-00004 TABLE 1 Amounts of fluorescence (10.sup.10) of organs in vivo after tail vein injection of DiR-DREVs Liver Spleen Lung Bone 6 h 15.28 1.268 3.808 0.4428 24 h 18.67 2.695 3.091 0.7871 48 h 17.82 0.213 1.297 1.0692 72 h 20.85 2.719 2.282 0.8407
(43) TABLE-US-00005 TABLE 2 Amounts of fluorescence (10.sup.10) of organs in vivo after intraperitoneal injection of DiR-DREVs Liver Spleen Lung Bone 6 h 2.817 0.2267 0.8914 0.07309 24 h 4.241 0.5766 / 0.13959 48 h 3.024 0.1236 0.1615 0.14998 72 h 3.688 0.5083 / 0.11238
(44) The results show that in the group of tail vein DiR-DREVs, the liver is a position distributed with most DiR-DREVs at any time point and the amount of fluorescence in the bone after the tail vein injection of DiR-DREVs shows a trend of gradually increasing and then decreasing with a largest amount of fluorescence at 48 hours (figure C in
(45) The above results indicate that the DREVs have the bone targeting property in vivo and the mode of administration has a certain effect on the bone targeting property of the DREVs.
Example 5
(46) Metabolomics Analysis of DREVs
(47) The metabolomics analysis was performed on the DREVs. An experimental method is described below.
(48) 1. Pretreatment of DREV Samples
(49) (1) The DREV samples were lyophilized. (2) 400 L methanol was added, vortexed by using a vortex oscillator for 30 s and sonicated for 3 min. Then, two small steel balls were added, placed at 20 C. for 2 min to be pre-cooled and added to a grinder to be ground for 2 min at 60 Hz. (3) The mixture was centrifuged at 13000 rpm for 10 min at 4 C. 350 L of the treated samples was taken, loaded into a liquid chromatography-mass spectrometry (LC-MS) injection vial and then dried by using a freeze-concentrated centrifugal dryer. (4) Redissolving was performed with 300 L methanol-water (volume ratio of methanol to water=1:4). The solution was vortexed for 30 s, sonicated for 3 min and then allowed to stand for 2 h at 20 C. (5) The solution was centrifuged at 13000 rpm for 10 min at 4 C. 100 L supernatant was drawn by using a syringe, filtered by using a 0.22 m organic phase pinhole filter, transferred to an LC injection vial and stored at 80 C. until an LC-MS analysis was performed. (6) Extracts from all samples were mixed in an equal volume to prepare into a quality control sample (QC), where a volume of the QC was the same as a volume of the samples.
2. On-Machine Detection of the DREV Samples
(50) The DREV samples were loaded on the machine, and non-targeted metabolomics data of the DREV samples were detected by using an LC-MS system composed of an ultrahigh-performance liquid tandem QE high-resolution mass spectrometer. Chromatographic conditions: a chromatography column was ACQUITY UPLC HSS T3 (100 mm2.1 mm, 1.8 m), and a mobile phase was A-water (containing 0.1% formic acid) and B-acetonitrile (containing 0.1% formic acid) with a flow rate of 0.35 mL/min and a volume of injection of 2 L. Mass spectrometry conditions: an ion source was ESI, and mass spectrum signals of the samples were acquired in positive and negative ion scan modes, respectively.
(51) 3. Data Processing and Analysis
(52) Based on the non-targeted metabolomics data of the ultrahigh-performance liquid tandem high-resolution mass spectrometer, qualitative and relative quantitative analyses were performed on the original data by using metabolomics data processing software Progenesis Q1 v2.3, standardized preprocessing was performed on the original data, and finally, an overall analysis was performed on the data. Effective ingredients of Rhizoma Drynariae were retrieved from Traditional Chinese Medicines Integrated Database (TCMID, http://19.3.41.228: 8000/tcmid/), Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP, https://icmspw.com/tcmsp.php) and Symptom Mapping (SymMap, http://www.ymmap.org), and the obtained metabolomics ingredients of the DREVs were intersected with the ingredients of Rhizoma Drynariae to obtain common ingredients of the DREVs and Rhizoma Drynariae.
(53) The experimental results are described below.
(54) A total of 3075 metabolites were identified in the DREVs, including a total of 86 flavone and isoflavone metabolites. The classification of Super Class was performed on the 3075 metabolites. The results show that the 3075 metabolites include lipids and lipoid molecules (29%), organic oxygen compounds (10%), organic acids and derivatives thereof (9%), organic heterocyclic compounds (9%), phenylpropanoids and polyketides (7%) and benzene ring-type compounds (7%). Then, the classification of Class was performed. The results show that the 3075 metabolites include fatty acyl group (15%), organic oxygen compounds (11%), carboxylic acids and derivatives (8%), isopentenol lipids (8%), glycerophospholipids (7%), benzene and substituted derivatives thereof (4%) and flavone (3%).
(55) To discuss whether the metabolites contained in the DREVs have certain ingredients of the traditional Chinese medicine, a total of 115 effective ingredients of Rhizoma Drynariae were retrieved from TCMSP, TCMID and SysMap database, and an intersection analysis was performed on the 115 effective ingredients of Rhizoma Drynariae and the metabolic ingredients of the DREVs to obtain eleven common ingredients. The eleven common ingredients were sorted from large to small according to relative contents of the ingredients in the DREVs, that is, naringin (flavone), eriodictyol (flavone), cinnamic acid (cinnamic acid and derivatives thereof), naringenin (flavone), prunin (polyketides), caffeic acid (cinnamic acid and derivatives thereof), sinapinic acid (cinnamic acid and derivatives thereof), afzelin (polyketides), secoisolariciresinol (diphenylbutane lignin), narirutin (flavone) and kaempferol (flavone). Among the common ingredients, an ingredient with a highest content is naringin. Naringin has a relative content of 6204781, which ranks first among flavone and isoflavone metabolic ingredients and twenty-third among all metabolic ingredients of the DREVs.
(56) The above results indicate that the DREVs contain some effective ingredients related to Rhizoma Drynariae. Therefore, the DREVs can exert a function similar to Rhizoma Drynariae and have the potential to treat diseases such as OP.
Example 6
(57) Exploring Regulation of ER Pathway by DREVs
(58) 20 g/mL DREVs were co-cultured with h-BMSCs, and changes in the mRNA expression of related genes (ER and ER) of the ER pathway were detected through qRT-PCR.
(59) An experimental method is described below.
(60) The h-BMSCs were purified, cultured, grown to an appropriate density and digested by trypsin, and the cells were collected and counted. The cells were inoculated in a six-well plate according to a cell density of 210.sup.5 cells/cm.sup.2, and the six-well plate was placed in an incubator for continuous culture. When the cell density was increased to 80%, the 20 g/mL DREVs were taken and co-cultured with the h-BMSCs, which was recorded as an experimental group. In addition, a blank group was set without adding DREVs. After stimulation for 24 h and 48 h, respectively, the cells were collected by using a TRI2ol lysate, placed in sterilized EP tubes and marked, and qRT-PCR was performed to detect the mRNA expression of the related genes (ER and ER) of the ER pathway.
(61) Primer sequences of the related genes are as follows:
(62) Gapdh Sequences:
(63) TABLE-US-00006 SEQIDNO.5: ACAACTTTGGTATCGTGGAAGG(5>3) SEQIDNO.6: CTTTGACACCGCACTACCG(5>3)
Er Sequences:
(64) TABLE-US-00007 SEQIDNO.7: GGGAAGTATGGCTATGGAATCTG(5>3) SEQIDNO.8: TTGCTGATATACACAGGTCGGT(5>3)
Er Sequences:
(65) TABLE-US-00008 SEQIDNO.9: TTCAAAGAGGGATGCTCACTTC(5>3) SEQIDNO.10: CCTCAGACCAGCACACTTCC(5>3)
(66) An amplification reaction method was the same as that in Example 3.
(67) The experimental results are shown in
(68) As shown in
(69) The above results indicate that the DREVs can upregulate the mRNA expression of the related genes (ER and ER) of the ER pathway, thereby regulating the ER pathway. Studies have shown that Rhizoma Drynariae can regulate the ER pathway. Therefore, this example further proves that the DREVs have a related function of Rhizoma Drynariae.
(70) The applicant has stated that although the use of the DREVs to the preparation of the medicine for treating the orthopedic disease in the present application are described through the preceding examples, the present application is not limited to the preceding examples, which means that the implementation of the present application does not necessarily depend on the preceding examples. It should be apparent to those skilled in the art that any improvements made to the present application, equivalent replacements of raw materials of the product of the present application, additions of adjuvant ingredients, selections of specific manners, etc., all fall within the protection scope and the disclosure scope of the present application.
(71) Although the preferred embodiments of the present application have been described above in detail, the present application is not limited to details of the above-described embodiments, and various simple modifications can be made to the technical solutions of the present application without departing from the technical concept of the present application. These simple modifications are all within the protection scope of the present application.
(72) In addition, it is to be noted that if not in collision, the specific technical features described in the preceding embodiments may be combined in any suitable manner. In order to avoid unnecessary repetition, the present application does not further specify any of various possible combination manners.