Methods for producing modified bacteria for production of nitroaromatics
12319946 ยท 2025-06-03
Assignee
Inventors
Cpc classification
C12Y114/13039
CHEMISTRY; METALLURGY
C12Y106/02004
CHEMISTRY; METALLURGY
C12Y101/9901
CHEMISTRY; METALLURGY
International classification
C12P13/22
CHEMISTRY; METALLURGY
Abstract
The disclosure relates, in some aspects, to compositions and methods useful for production of nitrated aromatic molecules. The disclosure is based, in part, on whole cell systems expressing artificial fusion proteins comprising cytochrome P450 enzymes linked to reductase enzymes. In some aspects, the disclosure relates to methods of producing nitrated aromatic molecules in whole cell systems having artificial fusion proteins comprising cytochrome P450 enzymes linked to reductase enzymes.
Claims
1. A method of producing a recombinant bacterial cell comprising (i) transforming a bacterial cell with an isolated nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 8-13; and, (ii) culturing the bacterial cell in a bacterial culture media.
2. The method of claim 1, wherein the step of culturing the bacterial cell comprises introducing one or more antibiotic and/or one or more inducer into the bacterial cell culture media.
3. The method of claim 2, wherein the one or more antibiotic is selected from ampicillin and kanamycin.
4. The method of claim 2, wherein the one or more inducer is Isopropyl -D-1-thiogalactopyranoside (IPTG).
5. The method of claim 1, wherein the step of culturing the bacterial cell in a bacterial culture media is performed at a temperature below 37 C.
6. The method of claim 5, wherein the step of culturing the bacterial cell in a bacterial culture media is performed at a temperature between 10 to 30 C.
7. The method of claim 1, wherein the bacterial cell is cultured for up to 25 hours.
8. The method of claim 1, wherein the bacterial cell is genetically modified to lack expression of one or more of the following genes: traA, trpR, tyrA, and pheA.
9. The method of claim 1, wherein the bacterial cell is a Gram-negative bacterial cell.
10. The method of claim 6, wherein the step of culturing the bacterial cell in a bacterial culture media is performed at a temperature of 28 C.
11. The method of claim 9, wherein the Gram-negative bacterial cell is an E. coli cell.
12. The method of claim 8, wherein the bacterial cell comprises the genotype trpRtyrApheA.
13. The method of claim 1, wherein the bacterial culture media is selected from the group consisting of M9, Lysogeny Broth (LB), SOC media, and Terrific Broth (TB).
14. The method of claim 1, wherein the bacterial culture media further comprises one or more of the following: L-tryptophan (L-Trp), L-arginine (L-Arg), or an analogue of L-tryptophan.
15. The method of claim 14, wherein the analogue of L-tryptophan is selected from the group consisting of -Me-Trp, 4-F-Trp, 4-Me-Trp, 5-MeO-Trp, 5-Me-Trp, 5-F-Trp, 6-F-Trp, and 7-Me-Trp.
16. The method of claim 15, wherein the bacterial culture media further comprises one or more of the following: 4-NO.sub.2-L-Trp, 4-NO.sub.2--Me-Trp, 7-NO.sub.2-4-F-Trp, 5-NO.sub.2-4-Me-Trp, 7-NO.sub.2-4-Me-Trp, 4-NO.sub.2-5-MeO-Trp, 4-NO.sub.2-5-Me-Trp, 4-NO.sub.2-5-F-Trp, 4-NO.sub.2-6-F-Trp, or 4-NO.sub.2-7-Me-Trp.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION
(18) The disclosure relates, in some aspects, to compositions and methods useful for production of nitrated aromatic molecules. The disclosure is based, in part, on whole cell systems expressing artificial fusion proteins comprising cytochrome P450 enzymes linked to reductase enzymes. A significant advantage of whole cell nitration systems described by the disclosure compared to in vitro nitration reactions is the in situ production of NO from L-Arg, which enables recombinant bacterial cells to produce NO from L-Arg, which is synthesized by the bacterial cells from cheap carbon and nitrogen sources. Thus, it is believed that whole cell nitration systems described by the disclosure greatly lower the cost of biocatalytic nitration processes relative to currently utilized methods.
(19) Recombinant Bacterial Cells
(20) In some aspects, the disclosure relates to a recombinant bacterial cell comprising one or more isolated nucleic acids engineered to express: a fusion protein comprising a TxtE enzyme linked to a catalytic domain of a CYP102A1 (P450BM3) reductase enzyme via an amino acid linker sequence that is between 14 and 27 amino acids in length; and a nitric oxide synthase (NOS) enzyme.
(21) As used herein nucleic acid refers to a DNA or RNA molecule. An isolated nucleic acid refers to a nucleic acid (e.g., DNA or RNA) that has been prepared in vitro, for example by recombinant technology. Nucleic acids are polymeric macromolecules comprising a plurality of nucleotides. In some embodiments, the nucleotides are deoxyribonucleotides or ribonucleotides. In some embodiments, the nucleotides comprising the nucleic acid are selected from the group consisting of adenine, guanine, cytosine, thymine, uracil and inosine. In some embodiments, the nucleotides comprising the nucleic acid are modified nucleotides. Non-limiting examples of natural nucleic acids include genomic DNA and plasmid DNA. In some embodiments, the nucleic acids of the instant disclosure are synthetic. As used herein, the term synthetic nucleic acid refers to a nucleic acid molecule that is constructed via joining nucleotides by a synthetic or non-natural method. One non-limiting example of a synthetic method is solid-phase oligonucleotide synthesis. In some embodiments, the nucleic acids of the instant disclosure are isolated.
(22) In some aspects, the disclosure relates to bacterial cells (e.g., populations of bacterial cells) that have been genetically engineered to express biocatalysts useful for aromatic nitration in situ (e.g., aromatic nitration inside the bacterial cell(s)). Generally, a bacterial cell of the disclosure may be any Gram-negative bacterial cell, including but not limited to bacteria of the genus Eschereria sp, (e.g., E. coli), Pseudomonas sp., Xanthomonas sp., Rhizobium sp., Azotobacter sp., Acetobacter sp., Gluconobacter sp., Methylococcus sp., Klebsiella sp., Bacteroides sp., Yersinia sp., Vibrio sp., Bacillus sp., Clostridium sp., Lactococcus sp., Lactobacillus sp., Staphylococcus sp., and Streptococcus sp. In some embodiments, a bacterial cell is an E. coli cell. Examples of E. coli bacterial strains include E. coli Dh5, E. coli BL21, E. coli DE3, E. coli Lemo21, E. coli NiCo21, E. coli Rosetta, etc. In some embodiments, a bacterial cell is an E. coli BL21-Gold cell.
(23) In some embodiments, bacterial cells are genetically engineered to express certain biocatalysts (e.g., proteins, such as enzymes) capable of aromatic nitration. Typically, the biocatalyst comprises a self-sufficient cytochrome P450 enzyme, or a portion thereof. Previously described self-sufficient cytochrome P450 enzymes typically comprise (i) a cytochrome P450 enzyme which catalyzes transfer of a nitro functional group to aromatic moieties (e.g., indole); (ii) an amino acid linker; and, (iii) a catalytic domain of a reductase enzyme. For example, TxtE-P450BM3 (also referred to as TB13-Q) is described in PCT 2.5 Publication WO 2016/134145, the entire contents of which are incorporated by reference herein. In another example a TxtE-450BM3 variant having a 14-amino acid linker (also referred to herein as TB14) is described in PCT International Application Number PCT/US2017/058579, the entire contents of which are incorporated herein by reference. In some embodiments, a fusion protein expressed by a recombinant bacterial cell described by the disclosure is & TB14 fusion protein having the sequence set forth in SEQ ID NO: 1.
(24) As used herein, the term TxtE enzyme refers to a (1) polypeptide comprising the entire amino acid sequence of TxtE, (ii) a portion of TxtE which maintains the function of catalyzing transfer of a nitro functional group to aromatic moieties (e.g., indole), or (iii) an enzyme which catalyzes transfer of a nitro functional group to aromatic moieties (e.g., indole) and is at least 95% homologous to the amino acid sequence of TxtE. For example, in some embodiments, a TxtE enzyme comprises or consists of a sequence set forth in Genbank Accession No. CBG70284.1 or a portion thereof (e.g., SEQ ID NO: 14).
(25) The skilled artisan recognizes that for a portion of TxtE to maintain the nitration function, the portion must include active site residues of TxtE, for example Arg59, Asn293, Thr296 and Glu394. However, genetic modification of residues at a location of the TXIE polypeptide remote from the active site may maintain the activity of the enzyme. As used herein, the term genetic modification refers to amino acid substitution (conservative, missense and/or non-sense), deletion and/or insertion. Thus in some embodiments, a portion of TxtE comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, or at least 100 genetic modifications relative to wild-type TxtE. In some embodiments a portion of TxtE is truncated relative to wild-type TxtE. Truncations may occur at the N-terminus or C-terminus of the portion of TxtE. For example, a portion of TxtE may be truncated by 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 75, 100 or 200 amino acids at it N-terminus or C-terminus relative to wild-type TxtE.
(26) In some embodiments, the disclosure provides a TxtE enzyme in which the loop region corresponding to residues A274 to V279 of GenBank Accession No. CBG70284.1 are replaced by the heme domain (e.g. loops j and k) of CYP102A1 (e.g., P450BM3, PDB ID; 1BVY). In some embodiments, a TxtE enzyme (e.g., TxtE-P450BM3) comprises the sequence set forth in SEQ ID NO: 14 or 15.
(27) Methods of genetically modifying TxtE or portions thereof and screening for retention of functional activity are known in the art and available to the skilled artisan. For example, TxtE may be modified by directed evolution or random mutagenesis and biochemically assayed for the capability to transfer a nitro group to aromatic moieties (e.g., indole). In some embodiments, a TxtE enzyme may be an enzyme which catalyzes transfer of a nitro functional group to aromatic moieties (e.g., indole) and has less than 95% homologous to the amino acid sequence of TxtE. In some embodiments, the enzyme has about 90%, about 80%, about 70%, about 60% or about 50% homology to the amino acid sequence of TxtE.
(28) In some aspects, the disclosure provides fusion proteins comprising a catalytic domain of a reductase enzyme. As used herein, the term reductase enzyme refers to an enzyme that catalyzes a reduction reaction. Non-limiting examples of reductase enzymes include thioredoxin reductase, cytochrome P450 reductase and flavin adenine dinucleotide (FAD) reductase. In some embodiments, the reductase enzyme is a prokaryotic reductase enzyme. In some embodiments, the reductase enzyme is a bacterial reductase enzyme. In some embodiments, the bacterial reductase enzyme naturally occurs in a self-sufficient cytochrome P450, for example CYP102A1 (P450BM3) reductase or a P450RhF reductase. In some embodiments, the catalytic domain of a reductase enzyme comprises or consists of the sequence set forth in SEQ ID NO: 15.
(29) In some embodiments, the fusion protein comprises an amino acid linker. As used herein, the term linker refers to an amino acid sequence that joins two larger polypeptide domains to form a single fusion polypeptide. Amino acid linkers are well known to those skilled in the art and include flexible linkers (e.g. glycine rich linkers such as [GGGS].sub.n where n>2), rigid linkers (e.g. poly-proline rich linkers) and cleavable linkers (e.g. photocleavable and enzyme-sensitive linkers). In some embodiments, an amino acid linker is derived from a TxtE enzyme or a reductase enzyme (e.g., CYP102A1). For example, in some embodiments, an amino acid linker may comprise between about 3 and about 27 continuous (e.g., covalently linked) amino acids of a reductase enzyme (e.g., between about 3 and about 27 contiguous amino acids the sequence set forth in UniProtKB/Swiss-Prot Accession No. P14779.2. In some embodiments, an amino acid linker comprises between about 3 and about 27 contiguous amino acids, for example between about 3 and about 25 contiguous amino acids of SEQ ID NO: 16.
(30) In some embodiments, amino acid linker length affects the folding and orientation of fusion polypeptides. For example, a linker that is too long can prevent the interaction of a reductase domain with the cytochrome P450 enzyme to which it is linked. (It is also known that long linkers can fold and take on specific orientations that can be desirable.) Conversely, a linker that is too short can cause a reductase enzyme to sterically inhibit binding of substrate to the active site of the P450 enzyme to which it is linked. In some embodiments, TxtE-BM3 fusion proteins comprising linkers having a certain length (e.g., 11, 12, 14, 15, 16, 17, etc. amino acids in length) exhibit improved function (e.g., increased nitration activity, coupling efficiency, total turnover number (TTN), etc.) compared to previously described self-sufficient cytochrome p450 enzymes. Accordingly, in some embodiments, a fusion protein described by the disclosure comprises an amino acid linker between about 3 and about 27 amino acids in length. In some embodiments, an amino acid linker is between about 11 and about 17 amino acids in length. In some embodiments, an amino acid linker is between about 14 and 16 amino acids in length. In some embodiments, the length of the linker is 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 amino acids in length.
(31) In some embodiments, the amino acid linker joins a catalytic domain of a reductase enzyme to a terminus of a cytochrome P450 enzyme. As used herein, the term terminus refers to the ends of a polypeptide sequence relative to the start codon of said polypeptide. For example, the N-terminus of a polypeptide is the end of the polypeptide containing the start codon (AUG) of the polypeptide, whereas the C-terminus of the polypeptide is the end of the polypeptide opposite of the start codon. In some embodiments, the amino acid linker joins the catalytic domain of a reductase enzyme to the C-terminus of a cytochrome P450 enzyme. In some embodiments, the amino acid linker joins CYP102A1 (P450BM3) reductase or P450RhF reductase to the C-terminus of a TxtE enzyme.
(32) Generally, fusion proteins described by the disclosure can be produced by any suitable means known in the art. For example, in some embodiments, a fusion protein is produced by an overlap PCR method. As used herein, overlap PCR refers to the splicing (e.g., joining together) of two or more oligonucleotides by polymerase chain reaction employing primers that share complementarity with the terminus of each of the oligonucleotides, for example as described by Higuchi et al. (1988) Nucleic Acids Res. 16 (15): 7351-67. In some embodiments, fusion proteins described by the disclosure are not produced by overlap PCR. In some embodiments, fusion proteins described by the disclosure are produced by a restriction digest-based method (e.g., traditional cloning), for example as described in Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989.
(33) The disclosure relates, in some aspects, to recombinant bacterial cells comprising an isolated nucleic acid engineered to express a nitric oxide synthase (NOS) enzyme. Generally, nitric oxide synthase (NOS) is a protein that catalyzes production of nitric oxide (NO) from L-arginine. Without wishing to be bound by any particular theory, NO is an important co-substrate for TxtE-based nitration reactions, and thus in some embodiments it is desirable to increase NO production in recombinant bacterial cells for the purpose of increasing nitration reaction yields. Generally, a NOS enzyme can be a prokaryotic or eukaryotic NOS enzyme. In some embodiments, a NOS enzyme is a bacterial NOS enzyme. Bacterial NOS enzymes are described, for example in Crane et al. (2010) Annu Rev Biochem, 79:455-70. In some embodiments, a NOS enzyme is a Bacillus subtilis NOS enzyme. In some embodiments, a Bacillus subtilis NOS enzyme is encoded by the sequence set forth in SEQ ID NO: 3. In some embodiments, a Bacillus subtilis NOS enzyme comprises the amino acid sequence set forth in SEQ ID NO: 5. BsNOS enzymes are described, for example by Commichau et al. (2008) J Bacteriol 190(10):3557-3564.
(34) In some aspects, the disclosure relates to recombinant bacterial cells comprising an isolated nucleic acid engineered to express a glucose dehydrogenase (GHD) enzyme. Glucose dehydrogenase (GDH) is an enzyme that catalyzes the reversible conversion of D-glucose to D-glucono-1,5-lactone while reducing NAD(P)+ to NAD(P)H. Without wishing to be bound by any particular theory, overexpression of GDH in recombinant bacterial cells (e.g., as part of a whole cell nitration system) may, in some embodiments, increase yield of nitration reactions by providing a sufficient supply of NADPH to fuel NOS-mediated conversion of L-Arg to L-citrulline. In some embodiments, a GDH enzyme is a bacterial GDH enzyme. In some embodiments, a bacterial GDH enzyme is a Bacillus megaterium GDH enzyme.
(35) As used herein, the term engineered to express refers to an isolated nucleic acid that comprises a gene to be expressed (e.g., TB14, BsNOS, GDH, etc.) and, optionally, one or more expression control sequences. Examples of expression control sequences include but are not limited to promoter sequences, enhancer sequences, repressor sequences, poly A tail sequences, internal ribosomal entry sites, Kozak sequences, antibiotic resistance genes (e.g., ampR, kanR, a chloramphenicol resistance gene, a -lactamase resistance gene, etc.), an origin of replication (ori), etc.
(36) In some embodiments, one or more isolated nucleic acid is operably linked to a promoter sequence. A promoter can be a constitutive promoter or an inducible promoter. In some embodiments, a promoter is a constitutive promoter. Examples of constitutive promoters include but are not limited to constitutive E. coli .sup.70 promoters, constitutive E. coli .sup.s promoters, constitutive E. coli .sup.32 promoters, constitutive E. coli .sup.54 promoters, constitutive B. subtilis .sup.A promoters, constitutive B. subtilis .sup.B promoters, constitutive bacteriophage T7 promoters, constitutive bacteriophage SP6 promoters, constitutive yeast promoters, etc.
(37) In some embodiments, a promoter is an inducible promoter (e.g., induced in the presence of a small molecule, such as IPTG or tetracycline). Examples of inducible promoters include but are not limited to a promoter comprising a tetracycline responsive element (TRE), a pLac promoter, a pBad promoter, alcohol-regulated promoters (e.g., AlcA promoter), steroid-regulated promoters (e.g., LexA promoter), temperature-inducible promoters (e.g., Hsp70- or Hsp90-derived promoters, light-inducible promoters (e.g., YFI), etc.
(38) In some embodiments, an isolated nucleic acid engineered to express a fusion protein is operably linked to a first promoter, an isolated nucleic acid engineered to express a NOS enzyme is operably linked to a second promoter, and an isolated nucleic acid engineered to express a GDH enzyme is operably linked to a third promoter. In some embodiments, a first promoter, a second promoter, and/or a third promoter is a T7 promoter.
(39) In some embodiments, an isolated nucleic acid engineered to express a protein is a component of a vector. Examples of vectors include plasmids, viral vectors, cosmids, and artificial chromosomes. In some aspects, one or more isolated nucleic acids engineered to express a protein (e.g., TB14, NOS, GDH, etc.) are located (e.g., situated) on a plasmid, for example a bacterial plasmid. In some embodiments, the vector is a high-copy plasmid. In some embodiments, the vector is a low-copy plasmid. In some embodiments, a bacterial cell comprises one or more plasmids comprising the one or more isolated nucleic acids. For example, a plasmid may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 isolated nucleic acids. In some embodiments, a plasmid comprises 1, 2, or 3 isolated nucleic acids. In some embodiments, an isolated nucleic acid engineered to express the NOS enzyme and an isolated nucleic acid engineered to express the ODH enzyme are located on the same plasmid. In some embodiments, an isolated nucleic acid engineered to express the fusion protein is located on a plasmid that does not contain an isolated nucleic acid engineered to express the NOS enzyme and/or an isolated nucleic acid engineered to express the GDH enzyme. In some embodiments, a recombinant bacterial cell as described by the disclosure comprises a first plasmid comprising an isolated nucleic acid engineered to express a TxtE fusion protein (e.g. TB14), a second plasmid comprising an isolated nucleic acid engineered to express a NOS enzyme (e.g., BsNOS), and a third plasmid comprising an isolated nucleic acid engineered to express a GDH enzyme.
(40) In some embodiments, one or more isolated nucleic acids (e.g., one or more isolated nucleic acids encoding a fusion protein, a NOS enzyme, and/or a GDH enzyme) are integrated into a chromosome of a bacterial cell. Methods of integrating exogenous (e.g., foreign) DNA into a bacterial chromosome are known in the art and are described, for example, by Gu et al. (2015) Scientific Reports 5; Article number 9684.
(41) The disclosure is based, in part, on recombinant bacterial cells that are capable of producing nitrated aromatic compounds. In some embodiments, recombinant bacterial cells are produced from bacterial strains that have been metabolically modified. As used herein, metabolically modified refers to a bacterial cell (or strain) that has been manipulated using recombinant DNA technology or other genome engineering methodologies to lack one or more genes in a particular metabolic pathway. For example, in some embodiments, a recombinant bacterial cell may be produced using a bacterial strain that has been engineered to lack one or more genes relating to tryptophan metabolism, tryptophan biosynthesis, L-tyrosine biosynthesis, phenylalanine biosynthesis, or any combination of the foregoing. In some embodiments, a bacterial cell is genetically modified to lack expression of one or more of the following genes: traA (tryptophanase), trpR (tryptophan repressor), tyrA (T protein), and pheA (P protein). In some embodiments, a bacterial cell comprises the genotype trpRtyrApheA (e.g., is a triple deletion mutant for trpR, tyrA, and pheA). In some embodiments, a bacterial cell comprises a tnaA gene, or a gene product (e.g., protein, enzyme, etc.) expressed from a tnaA gene.
(42) Compositions Comprising Recombinant Bacterial Cells
(43) In some aspects, the disclosure relates to a composition comprising one or more of a recombinant bacterial cell as described by the disclosure, and a bacterial culture media.
(44) As used herein, a bacterial culture media is a nutrient rich composition that supports growth and reproduction of bacterial cells. Generally, bacterial culture media can be liquid or solid (e.g., culture media mixed with agar to form a gel). In some embodiments, bacterial culture media is a liquid. Examples of bacterial culture media include but are not limited to M9. Lysogeny Broth (LB). SOC media, Terrific Broth (TB), etc.
(45) The volume of bacterial culture media in a composition comprising a recombinant bacterial cell can vary depending upon several factors including but not limited to the desired amount of nitrated aromatic compounds to be produced, the concentration (density) of bacterial cells desired in the composition, the volume of the container housing the composition, etc. In some embodiments, a composition comprises between about 10 l and 1 L bacterial culture media. In some embodiments, a composition comprises between about 10 l and about 1 mL bacterial culture media, for example about 10 l, about 50 l, about 100 l, about 500 l, about 750 l, or about 1 mL (e.g., any volume between 10 l and 1 mL, inclusive). In some embodiments, a composition comprises between about 750 l and 5 mL (e.g., any volume between 750 l and 5 ml, inclusive). In some embodiments, a composition comprises between about 2 mL and about 20 mL bacterial culture media (e.g., any volume between 2 mL and 20 mL, inclusive). In some embodiments, a composition comprises between about 10 mL and about 200 mL bacterial culture media (e.g., any volume between 10 mL and 200 mL, inclusive). In some embodiments, a composition comprises between about 100 mL and about 500 mL bacterial culture media (e.g., any volume between 100 mL and 500 mL, inclusive). In some embodiments, a composition comprises between about 250 mL and about 1 L bacterial culture media (e.g., any volume between 250 mL and 1 L, inclusive). In some embodiments, a composition comprises more than IL (e.g., 5 L, 10 L, 100 L, 200 L, 1000 L, 10,000 L, 50,000 L, etc.) bacterial culture media.
(46) In some embodiments, a composition further comprises one or more antibiotic agents. In some embodiments, one or more antibiotic agent is ampicillin or kanamycin. A composition may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more antibiotic agents. The concentration of an antibiotic agent can vary. In some embodiments, the concentration of an antibiotic agent ranges from about 0 (e.g., lacking antibiotic) to about 125 g/ml.
(47) Aspects of the disclosure relate to uptake and subsequent nitration of L-tryptophan (and L-tryptophan analogues) by recombinant bacterial cells described herein. Without wishing to be bound by any particular theory, compositions comprising recombinant bacterial cells described herein and bacterial culture media may be fed with exogenous L-tryptophan or analogues thereof, which are internalized by the bacteria (e.g., via permease transport across the bacterial cell membrane) and subsequently nitrated by a fusion protein (e.g., a TxtE fusion protein, such as TB14). Thus, in some embodiments, a composition further comprises one or more of the following: L-tryptophan (L-Trp), L-arginine (L-Arg), or an analogue of L-tryptophan. In some embodiments, a composition further comprises one or more compounds of Formula Ia or IVa. In some embodiments, an analogue of L-tryptophan is selected from the group consisting of -Me-Trp, 4-F-Trp, 4-Me-Trp, S-MeO-Trp, 5-Me-Trp, 5-F-Trp, 6-F-Trp, and 7-Me-Trp.
(48) In some embodiments, a composition further comprises one or more compounds of Formulae I-VI. In some embodiments, a composition further comprises one or more of the following: 4-NO.sub.2-L-Trp, -Me-4-NO.sub.2-Trp, 4-F-7-NO.sub.2-Trp, 4-Me-7-NO.sub.2-Trp, 5-MeO-4-NO.sub.2-Trp, S-Me-4-NO.sub.2-Trp, 5-F-4-NO.sub.2-Trp, 6-F-4-NO.sub.2-Trp, or 7-Me-4-NO.sub.2-Trp. In some embodiments, the compound of Formulae I-VI is selected from: (S)-2-amino-3-(4-methyl-5-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-methyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-methyl-4-nitro-1H indol 3-yl)propanoic acid; (S)-2-amino-3-(7-methyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-methyl-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-fluoro-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-fluoro-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-fluoro-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-fluoro-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-chloro-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-chloro-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-chloro-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-chloro-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-bromo-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-bromo-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-bromo-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-bromo-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-methoxy-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-methoxy-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-methoxy-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-methoxy-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-amino-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-amino-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-amino-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-amino-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-hydroxy-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-hydroxy-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-hydroxy-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-hydroxy-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-5-phenyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-6-phenyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-7-phenyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-nitro-4-phenyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-cyclopropyl-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-5-vinyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-6-vinyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-7-vinyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-nitro-4-vinyl-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-ethynyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-ethynyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-ethynyl-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-ethynyl-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-morpholino-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; (S)-2-amino-3-(7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-methyl-5-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-fluoro-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-fluoro-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-fluoro-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-chloro-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-chloro-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-chloro-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-chloro-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-bromo-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-bromo-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-bromo-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-bromo-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-methoxy-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-methoxy-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-methoxy-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-methoxy-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-amino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-amino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-amino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-amino-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-hydroxy-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-hydroxy-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-hydroxy-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-hydroxy-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-5-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-6-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-7-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-nitro-4-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-cyclopropyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-5-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-6-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-7-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-nitro-4-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-ethynyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-ethynyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-ethynyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-ethynyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-morpholino-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-nitro-4(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,5-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,6-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,7-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,4-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-fluoro-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-fluoro-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-fluoro-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-chloro-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-chloro-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-chloro-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-chloro-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-bromo-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-bromo-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-bromo-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-bromo-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-methoxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-methoxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-methoxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-methoxy-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-amino-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-amino-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-amino-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-amino-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-hydroxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-hydroxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-hydroxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-hydroxy-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-5-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-6-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-7-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-7-nitro-4-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-cyclopropyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-cyclopropyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-cyclopropyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-cyclopropyl-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-5-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-6-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-7-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-7-nitro-4-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-ethynyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-ethynyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-ethynyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-ethynyl-1-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-5-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-6-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-7-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-morpholino-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1-methyl-7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(2,5-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2,6-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2,7-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2,4-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-fluoro-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-fluoro-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-fluoro-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-chloro-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-chloro-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-chloro-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-chloro-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-bromo-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-bromo-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-bromo-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-bromo-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-methoxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-methoxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-methoxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-methoxy-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-amino-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-amino-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-amino-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-amino-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-hydroxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-hydroxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-hydroxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-hydroxy-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-5-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-6-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-7-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-7-nitro-4-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-cyclopropyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-cyclopropyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-cyclopropyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-cyclopropyl-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-5-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-6-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-7-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-7-nitro-4-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-ethynyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-ethynyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-ethynyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-ethynyl-2-methyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-5-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-6-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-7-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-morpholino-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(2-methyl-7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2,5-trimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2,6-trimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2,7-trimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2,4-trimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-fluoro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-fluoro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-fluoro-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-chloro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-chloro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-chloro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-chloro-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-bromo-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-bromo-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-bromo-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-bromo-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-methoxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-methoxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-methoxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-methoxy-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-amino-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-amino-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-amino-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-amino-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-hydroxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-hydroxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-hydroxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-hydroxy-1,2-dimethyl-7-nitro-TH-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-5-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-6-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-7-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-7-nitro-4-phenyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-cyclopropyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-cyclopropyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-cyclopropyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-cyclopropyl-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-5-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-6-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-7-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-7-nitro-4-vinyl-1H-indol-3-yl)propanoic acid; 2-amino-3-(5-ethynyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(6-ethynyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(7-ethynyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(4-ethynyl-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-5-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-6-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-7-morpholino-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-morpholino-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; 2-amino-3-(1,2-dimethyl-4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; or 2-amino-3-(1,2-dimethyl-7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic acid; and a pharmaceutically acceptable salt, prodrug, hydrate, or solvate thereof.
(49) The skilled artisan recognizes that the conditions under which a composition as described herein is maintained may affect the production and/or stability of nitrated aromatic compounds by the recombinant bacterial cell(s). The disclosure is based, in part, on the recognition that production of nitrated aromatic compounds is reduced or absent at temperatures at which bacterial cells are generally cultured (e.g., 37) C., In some embodiments, a composition has a temperature below 37 C. (e.g., the temperature of the bacterial culture media of a composition is below 37 C.). The disclosure is based, in part, on the recognition that production of nitrated aromatic compounds is increased at temperatures between 10 to 30 C. (e.g., 10 C., 11 C., 12 C., 13 C., 14 C., 15 C., 16 C., 17 C., 18 C., 19 C., 20 C., 21 C., 22 C., 23 C., 24 C., 25 C., 26 C., 27 C., 28 C., 29 C.), or 30 C.). In some embodiments, a composition has a temperature of 28 C. (e.g., the temperature of the bacterial culture media of a composition is 28 C.).
(50) In some embodiments, a composition as described by the disclosure comprises additional components, for example one or more cryopreservatives (e.g., glycol, DMSO, PEG, glycerol, etc.), antifungals, etc.
(51) Methods of Producing Recombinant Bacterial Cells
(52) In some embodiments, the disclosure relates to methods of producing a recombinant bacterial cell as described by the disclosure. Typically, the methods comprise the steps of: transforming a bacterial cell with an isolated nucleic acid engineered to express a fusion protein comprising a TxtE enzyme linked to a catalytic domain of a CYP102A1 (P450BM3) reductase enzyme via an amino acid linker sequence that is between 14 and 27 amino acids in length; and an isolated nucleic acid engineered to express a nitric oxide synthase (NOS) enzyme; and culturing (e.g., growing) the bacterial cell.
(53) Methods of introducing vectors into bacteria are well known in the art and described, for example, in Current Protocols in Molecular Biology, Ausubel et al. (Eds), John Wiley and Sons, New York, 2007.
(54) In some embodiments of methods described by the disclosure, a bacterial cell is transformed with one or more an isolated nucleic acids comprising the sequence set forth in any one of SEQ ID NOs: 8-13.
(55) Whole Cell-Based Nitration of L-Tryptophan and L-Tryptophan Analogues
(56) In some aspects, the disclosure relates to methods for producing a nitrated L-tryptophan or nitrated L-tryptophan analogue, comprising the steps of: introducing into a bacterial cell culture comprising a one or more of a recombinant bacterial cell as described by the disclosure one or more L-Trp molecules and/or one or more L-Trp analogue molecules; and growing the bacterial cell culture under conditions under which a fusion protein expressed by the recombinant bacterial cell catalyzes a nitration reaction which produces one or more nitrated L-Trp molecules and/or one or more nitrated L-Trp analog molecules. In some embodiments, methods further comprise the step of isolating nitrated L-Trp molecules and/or nitrated L-Trp analog molecules from the bacterial cell culture.
(57) In some embodiments of methods described by the disclosure, one or more L-Trp analogue molecules are selected from the group consisting of -Me-Trp, 4-F-Trp, 4-Me-Trp, 5-MeO-Trp, 5-Me-Trp, 5-F-Trp, 6-F-Trp, and 7-Me-Trp. The concentration of L-Trp or L-Trp analog added (introduced into) to a bacterial cell culture can vary. In some embodiments. L-Trp or an L-Trp analogue is added to a bacterial cell culture in an amount such that the final concentration of L-Trp or L-Trp analogue in the bacterial cell culture ranges from about 1 M to a saturation concentration or above (e.g., 1 M, 10 M, 50 M, 100 M, 500 M, 750 M, 1 mM, 10 mM, 100 mM, etc.).
(58) In some embodiments, the order in which the proteins encoded by the isolated nucleic acids of the recombinant bacterial cell are expressed affects the production of nitrated aromatic compounds. In some embodiments, a TxtE fusion protein, NOS enzyme, and optionally GDH, are simultaneously expressed in a recombinant bacterial cell. In some embodiments, a TxtE fusion protein, NOS enzyme, and optionally GDH, are expressed sequentially in a recombinant bacterial cell. The order of sequential expression of the proteins can vary. For example a TxtE fusion protein may be expressed first prior to NOS and/or GDH. In some embodiments, a NOS enzyme is expressed prior to expression of a TxtE fusion protein. In some embodiments, a TxtE fusion protein. NOS enzyme, and optionally GDH, are expressed in a recombinant bacterial cell prior to addition of L-Trp or L-Trp analogue. In some embodiments, a TxtE fusion protein, NOS enzyme, and optionally GDH, are expressed in a recombinant bacterial cell after addition of L-Trp or L-Trp analogue.
(59) In some embodiments of methods described by the disclosure, the step of growing the bacterial cell culture comprises introducing one or more antibiotic and/or one or more inducer into the bacterial cell culture. In some embodiments, one or more antibiotic is selected from ampicillin and kanamycin. In some embodiments, one or more of the inducers is Isopropyl -D-1-thiogalactopyranoside (IPTG).
(60) The skilled artisan recognizes that the conditions under which a composition as described herein is maintained may affect the production and/or stability of nitrated aromatic compounds by the recombinant bacterial cell(s). The disclosure is based, in part, on the recognition that production of nitrated aromatic compounds is reduced or absent at temperatures at which bacterial cells are generally cultured (e.g., 37 C.). In some embodiments, a composition has a temperature below 37 C. (e.g., the temperature of the bacterial culture media of a composition is below 37 C.). The disclosure is based, in part, on the recognition that production of nitrated aromatic compounds is increased at temperatures between 10 to 30 C. (e.g., 10 C., 11 C., 12 C., 13 C., 14 C., 15 C., 16 C., 17 C., 18 C., 19 C., 20 C., 21 C., 22 C. 23 C., 24 C., 25 C., 26 C., 27 C., 28 C., 29 C., or 30 C.). In some embodiments, a composition has a temperature of 28 C. (e.g., the temperature of the bacterial culture media of a composition is 28 C.).
(61) The length of time a bacterial cell culture is grown after addition of L-Trp or a L-Trp analogue can vary. In some embodiments, a bacterial cell culture is grown for about 1 hour to about 30 hours (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hours) after the addition of L-Trp or L-Trp analogue. In some embodiments, a bacterial cell culture is grown for about 1 hour to about 30 hours (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hours) post-transformation with one or more isolated nucleic acids. In some embodiments, a bacterial cell culture is grown for up to 25 hours (e.g., up to 25 hours post-transformation with one or more isolated nucleic acids).
(62) In some embodiments, isolating nitrated L-Trp molecules and/or nitrated L-Trp analog molecules comprises lysing one or more recombinant bacterial cells. Lysis of bacterial cells is generally known in the art and may be achieved, for example, by incubating bacterial cells in a lysis buffer (e.g., a hypertonic solution, a solution containing lysozyme, a solution containing detergent, etc.) or by centrifugation.
(63) In some embodiments, nitrated L-Trp molecules and/or nitrated L-Trp analog molecules are isolated from a bacterial cell lysate by performing high-pressure liquid chromatography (HPLC) or other liquid extraction methods known in the art. Additional methods for purification and/or analysis of nitrated aromatic compounds (e.g., 4-NO.sub.2-L-Trp, etc.) include mass spectroscopy and nuclear magnetic resonance (NMR) analysis.
(64) The present invention is further illustrated by the following Examples, which in no way should be construed as further limiting.
EXAMPLES
Example 1: Materials and Methods
(65) General Chemicals, DNA Sub-Cloning, and Bacterial Strains
(66) Molecular biology reagents and enzymes were purchased from Fisher Scientific. Primers (Table 1) were ordered from Sigma-Aldrich, 4-Me-DLTrp was from MP Biomedical (Santa Ana, CA), while NOC-5 (3-(Aminopropyl)-1-hydroxy-3-isopropyl-2-oxo-1-triazene) was purchased from EMD Millipore. Other chemicals and solvents were purchased from Sigma-Aldrich and Fisher Scientific. Escherichia coli DH5 (Life Technologies) was used for cloning and plasmid harvesting. E. coli BL21-GOLD (DE3) (Agilent) was used for protein overexpression. E. coli strains were grown in Luria-Bertani broth or Terrific broth. DNA sequencing was performed at Eurofins. A Shimadzu Prominence UHPLC system (Kyoto, Japan) fitted with an Agilent Poroshell 120 EC-C18 column (2.7 m, 3.050 mm), coupled with a PDA detector was used for HPLC analysis.
(67) Construction of Plasmids for Whole Cell Transformation
(68) TB/4 gene was amplified from TB14/pET28b using a pair of TB14FN and TB14RH primers in PCR reactions (Table 1). The PCR product was analyzed by agarose gel and extracted with a GeneJET Gel Extraction Kit (Thermo). Purified PCR products, pACYCDuet and pETDuet were digested with the restriction enzymes NeoI and HindIII, and corresponding linear DNAs were ligated to generate expression constructs. GDH gene was amplified from GDH/pET21b using a pair of GDHFB and GDHRH primers in PCR reactions (Table 1). The PCR product was analyzed by agarose gel and extracted with a GeneJET Gel Extraction Kit (Thermo). Purified PCR products, pET28b, pACYCDuet and pETDuet were digested with the restriction enzymes BamHI and HindIII, and corresponding linear DNAs were ligated to generate expression constructs. BsNOS gene was amplified from BsNOS/pET15b using a pair of BsNOSEN and BsNOSRH primers in PCR reactions (Table 1). The PCR product was analyzed by agarose gel and extracted with a GeneJET Gel Extraction Kit (Thermo). Purified PCR products, pET28b, pACYCDuet and pETDuet were digested with the restriction enzymes NdeI and HindIII, and corresponding linear DNAs were ligated to generate expression constructs, SsTxID and StTxtD were amplified from genomic DNA of S. scabies 87.22 (NRRL B-24449) and S. turgidiscabies Car8 using a pair of SsTxtDEN/SsTxtDRH and StTxtDFN/StTxtDRH primers in PCR reactions (Table 1). The PCR product was analyzed by agarose gel and extracted with a GeneJET Gel Extraction Kit (Thermo). Purified PCR products and pET28b were digested with the restriction enzymes NdeI and HindIII, and corresponding linear DNAs were ligated to generate expression constructs. All inserts in the constructs were sequenced to exclude mutations introduced during PCR amplification and gene manipulation,
(69) Heterologous Expression and Purification of Recombinant Proteins
(70) Protein expression and purification followed established protocols. The purified proteins were exchanged into storage buffer (25 mM Tris-HCl, pH 8.0, 100 mM NaCl, 3 mM BME, and 10% glycerol) by PD-10 column, aliquoted and stored at 80 C. until needed. CO difference spectroscopy was used to measure the concentrations of functional P450s.
(71) Analytical HPLC Analysis
(72) For analytical analysis, an HPLC column was kept at 40 C., water with 0.1% formic acid was used as solvent A and acetonitrile with 0.1% formic acid was used as solvent B. The column was eluted first with 1% solvent B for 1 min and then with a linear gradient of 1-20% solvent B in 8 min, followed by another linear gradient of 20-99% solvent B in 2 min. The column was further cleaned with 99% solvent B for 2 min and then re-equilibrated with 1% solvent B for 2 min. The flow rate was set as 1 ml/min, and the products were detected at 211 am with a PDA detector.
(73) Whole-Cell Biotransformation
(74) E. coli BL21 Gold cells containing pETDuet and pET28b derived plasmids were grown from glycerol stock overnight in 5 mL Luria broth with 0.1 mg/mL ampicillin and 0.05 mg/mL kanamycin (37 C., 250 rpm). The pre-culture was used to inoculate 100 mL of Terrific broth medium (0.1 mg/mL ampicillin and 0.05 mg/mL kanamycin) in a 500 mL flask; this culture was incubated at 37 C., 250 rpm to OD.sub.600=0.6-0.8. The cultures were cooled on water-ice mixture and induced with 0.5 mM IPTG, Expression was conducted at 18 C., 250 rpm, for 20 h. For the culture of E. coli BL21 Gold cells containing pACYCDuet and pET28b derived plasmids, 0.05 mg/mL chloramphenicol was used instead of 0.05 mg/mL kanamycin. The cultures were then harvested and resuspended to OD.sub.600=30 in test medium, Aliquots of the cell suspension were used in the whole cell transformation. To a test tube was added 5 mL cell suspension, 25 L 100 mM L-Trp or L-Trp analogues, and 25 L 100 mM L-Arg when necessary. The mixture was then incubated at different conditions. The reactions were quenched by adding equal volume of methanol and the resulting mixture was aliquoted and transferred to a microcentrifuge tube and centrifuged at 14,000 rpm for 10 minutes. The supernatant was transferred to an HPLC vial and analyzed by LC-MS.
(75) TABLE-US-00001 TABLE1 Primersforconstructionofwholecelltransformationplasmids. Name Sequence(5.fwdarw.3) Function TB14FN ATACCATGGTGACCGTCCCCTCGCCG(SEQIDNO:17) TB14cloning TB14RH ATCAAGCTTCCCAGCCCACACGTCTTTTGC(SEQIDNO:18) TB14cloning GDHFB CAGGATCCGATGTATAAAGATCTGGAAGGTAAAGTGGTG GDHcloning (SEQIDNO:19) GDHRH CAAAGCTTTTAGCCACGACCTGCCTGAAAG(SEQIDNO:20) GDHcloning BsNOSFN ACTCATATGATGGAAGAAAAAGAAATC(SEQIDNO:21) BsNOScloning BsNOSRH ACTAAGCTTCTATTCATACGGTTTGTC(SEQIDNO:22) BsNOScloning SsTxtDFN CTACATATGGTGACTTTCGAAGTCGC(SEQIDNO:23) SsTxtDcloning SsTxtDRH CTCAAGCTTCTGATGAGGGTAAAAGTTG(SEQIDNO:24) SsTxtDcloning StTxtDFN ACTCATATGGTGACTTTCGAAGTCGCCCTG(SEQIDNO:25) StTxtDcloning StTxtDRH ACTAAGCTTCTGATGAGGGTAAAAGTTGGGG(SEQIDNO:26) StTxtDcloning
Example 2: Whole Cell Nitration System
(76) This example describes an E. coli-based biotransformation system for the production of nitrated L-Trp was developed (
(77) The co-substrate NO is indispensable for a TxtE nitration reaction. In the in vitro assays. NO was derived from the NO precursor NOC-5 that is expensive, has a short-life, and is often incompatible with bacterial cells (e.g., NO at high concentration is toxic to bacterial cells). The thaxtomin biosynthetic gene cluster in Streptomyces scabies contains a TxtD gene encoding a 1.5 nitric oxide synthase that converts L-Arg into L-citrulline and NO along with the consumption of NADPH. The expression of the NOS gene in E. coli can, in some embodiments, provide a sustainable and environment-friendly approach to eliminate the dependence of the high-cost and unstable NO precursors in whole cell nitration biotransformation.
(78) It was observed that expression of the TxtD gene from two thaxtomin-producing Streptomyces strains (Streptomyces scabies and Streptomyces turgidiscabies) and yielded only insoluble proteins after optimizing expression conditions. However, expression of a codon-optimized NOS gene from Bacillus subtilis resulted in production of soluble NOS protein in E. coli and was used in the subsequent experiments.
(79) The reaction of NOS requires redox partners for transferring electrons from NADPH. It was observed that non-specific redox partners of E. coli effectively support the BsNOS reaction, making BsNOS containing E. coli strain a viable biosystem to supply NO for the nitration reaction. In some embodiments, insufficient supply of NADPH limits the productivity of biotransformation. Thus, in some embodiments of whole cell nitration systems described in this example, the GDH gene from Bacillus megaterium was also engineered into E. coli to regenerate NADPH that is consumed in both TB14 and BsNOS reactions. GDH catalyzes the oxidation of -D-glucose to -D-glucono-1,5-lactone with simultaneous reduction of the cofactor NADP.sup.+ to NADPH, and may be applied in biocatalysis procedures to regenerate NADPH.
(80) In some experiments. TB14 and BsNOS genes were co-expressed using vector pETDuet, while the GDH gene was separately expressed in the vector pET28b. Both vectors have the same, medium copy numbers (15 to 60) in the host and drive the expression of each gene with a strong inducible promoter T7. In addition, the different antibiotic resistant markers (ampicillin R and kanamycin R) in these two vectors make them suitable for simultaneous expression of three genes in the same host. The two constructs described above were transformed into E. coli BL21-GOLD strain. The overexpression of the three enzymes was induced by IPTG. SDS-PAGE analysis of the soluble crude extract (
(81) Optimization of Heterologous Enzyme Expression
(82) Next, the copy numbers of the three genes (e.g., TB14, BsNOS, GDH) were varied in order to improve TB14 expression and to improve plasmid stability. Plasmid pACYCDuet was used for the co-expression of two target genes. The pACYCDuet plasmid includes two T7 promoters to drive the proteins expression carries the P15A replicon instead of pBR322-derived ColE1 replicon as in pETDuet and pET28b, which can provide higher plasmid stability when two plasmids are used. Three new pairs of expression constructs were created, pETDuet-GDH-BsNOS+pET28b-TB14, pACYCDuet-TB14-BsNOS+pET28b-GDH, and pACYCDuet-GDH-BsNOS+pET28b-TB14, and the corresponding engineered E. coli strains (
(83) Optimization of Fermentation Conditions
(84) Fermentation conditions, including medium, temperature, substrate supplement, and harvesting time were then investigated. Minimal medium M9 was used in previously described experiments. As M9 medium is nutritiously poor, it was investigated whether nutrition availability could influence the whole cell nitration efficiency. Three nutrition rich media, including LB medium, SOC medium and TB medium, were tested along with the M9 medium in a whole cell nitration system. As shown in (
(85) The time profile of the product formation (
(86) In TB14 reactions, the co-substrate NO is generated from L-arginine by BsNOS. The effect of increasing the concentration of L-Arg was then tested (
(87) The temperature effects on the whole cell nitration were also investigated. In vitro studies indicated TB14 was active at temperatures between 10 to 30 C. All previous experiments were performed at 20 C. Productivity of the whole cell system at four different fermentation temperatures (15 C., 20 C., 28 C. and 37 C.) at different time points was investigated (
(88) Production of Nitrated Tryptophan Analogues by Whole Cell Nitration System
(89) A series of tryptophan analogues that can be nitrated by TxtE and its variants in vitro have been identified. In this example, the substrate scope of whole cell systems was investigated using these tryptophan analogues. These unnatural analogues generally compete with the native substrate L-Trp abundant in the TB medium in the whole cell transformation. However, data indicate that -Me-Trp, 4-F-Trp, 4-Me-Trp, 5-MeO-Trp, 5-Me-Trp, 5-F-Trp, 6-F-Trp, and 7-Me-Trp all were successfully nitrated using the whole cell nitration system. Similar to observations in the in vitro enzymatic reactions, whole cell-based nitration demonstrated the highest conversion rates with 4-Me-Trp, S-Me-Trp and 5-F-Trp (
Example 3: Preparation of (S)-2-amino-3-(5-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (3)
(90) ##STR00009##
(91) Example 3 can be prepared from 5-methylindole as shown above.
Example 4: Preparation of (S)-2-amino-3-(6-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (4)
(92) ##STR00010##
(93) Example 4 can be prepared from 6-methylindole as shown above.
Example 5: Preparation of (S)-2-amino-3-(7-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (5)
(94) ##STR00011##
(95) Example 5 can be prepared from 7-methylindole as shown above.
Example 6: Preparation of (S)-2-amino-3-(5-fluoro-4-nitro-1H-indol-3-yl)propanoic Acid (6)
(96) ##STR00012##
(97) Example 6 can be prepared from 5-fluoroindole as shown above.
Example 7: Preparation of (S)-2-amino-3-(6-fluoro-4-nitro-1H-indol-3-yl)propanoic Acid (7)
(98) ##STR00013##
(99) Example 7 can be prepared from 6-fluoroindole.
Example 8: Preparation of (S)-2-amino-3-(7-fluoro-4-nitro-1H-indol-3-yl)propanoic Acid (8)
(100) ##STR00014##
(101) Example 8 can be prepared from 7-fluoroindole as shown above.
Example 9: Preparation of (S)-2-amino-3 (4-fluoro-7-nitro-1H-indol-3-yl)propanoic Acid (9)
(102) ##STR00015##
(103) Example 9 can be prepared from 4-fluoroindole as shown above.
Example 10: Preparation of (S)-2-amino 3-(5-chloro-4-nitro-1H-3-yl)propanoic Acid (10)
(104) ##STR00016##
(105) Example 10 can be prepared from 5-chloroindole as shown above.
Example 11: Preparation of (S)-2-amino-3-(6-chloro 4-nitro-1H-indol-3-yl)propanoic Acid (11)
(106) ##STR00017##
(107) Example 11 can be prepared from 6-chloroindole as shown above.
Example 12: Preparation of (S)-2-amino-3-(7-chloro-4-nitro-1H-indol-3-yl)propanoic Acid (12)
(108) ##STR00018##
(109) Example 12 can be prepared from 7-chloroindole as shown above.
Example 13: Preparation of (S)-2-amino-3(4-chloro-7-nitro-1H-indol-3-yl)propanoic Acid (13)
(110) ##STR00019##
(111) Example 13 can be prepared from 4-chloroindole as shown above,
Example 14: Preparation of (S)-2-amino-3-(5-bromo-4-nitro-1H-indol-3-yl)propanoic Acid (14)
(112) ##STR00020##
(113) Example 14 can be prepared from 5-bromoindole as shown above.
Example 15: Preparation of (S)-2-amino-3-(6-bromo-4-nitro-11 propanoic Acid (15)
(114) ##STR00021##
(115) Example 15 can be prepared from 6-bromoindole as shown.
Example 16: Preparation of (S)-2-amino-3-(7-bromo-4-nitro-1H-indol-3-yl)propanoic Acid (16)
(116) ##STR00022##
(117) Example 16 can be prepared from 7-bromoindole as shown above.
Example 17: Preparation of (S)-2-amino-3-(4-bromo-7-nitro-1H-indol-3-yl)propanoic Acid (17)
(118) ##STR00023##
(119) Example 17 can be prepared from 4-bromoindole as shown above.
Example 18: Preparation of (S)-2-amino-3-(5-methoxy-4-nitro-1H-indol-3-yl)propanoic Acid (18)
(120) ##STR00024##
(121) Example 18 can be prepared from 5-methoxyindole as shown above.
Example 19: Preparation of (S)-2-amino-3-(6-methoxy-4-nitro-1H-indol-3-yl)propanoic Acid (19)
(122) ##STR00025##
(123) Example 19 can be prepared from 6-methoxyindole as shown above.
Example 20: Preparation of (S)-2-amino-3-(7-methoxy-4-nitro-1H-indol-3-ylpropanoic Acid (20)
(124) ##STR00026##
(125) Example 20 can be prepared from 7-methoxyindole as shown above.
Example 21: Preparation of (S)-2-amino-3-(4-methoxy-7-nitro-1H-indol-3-yl)propanoic Acid (21)
(126) ##STR00027##
(127) Example 21 can be prepared from 4-methoxyindole as shown above.
Example 22: Preparation of (S)-2-amino-3-(5-amino-4-nitro-1H-indol-3-yl)propanoic Acid (22)
(128) ##STR00028##
(129) Example 22 can be prepared from 5-aminoindole as shown above.
Example 23: Preparation of (S)-2-amino-3-(6-amino-4-nitro-1H-indol-3-yl)propanoic Acid (23)
(130) ##STR00029##
(131) Example 23 can be prepared from 6-aminoindole as shown above.
Example 24 Preparation of (S)-2-amino-3-(7-amino-4-nitro-1H-indol-3-yl)propanoic Acid (24)
(132) ##STR00030##
(133) Example 24 can be prepared from 7-aminoindole as shown above.
Example 25: Preparation of (S)-2-amino-3-(4-amino-7-nitro-1H-indol-3-yl)propanoic Acid (25)
(134) ##STR00031##
(135) Example 25 can be prepared from 4-aminoindole as shown above,
Example 26: Preparation of (S)-2-amino-3-(5-hydroxy-4-nitro-1H-indol-3-yl)propanoic Acid (26)
(136) ##STR00032##
(137) Example 26 can be prepared from (S)-2-amino-3-(5-hydroxy-1H-indol-3-yl)propanoic acid as shown above.
Example 27: Preparation of (S)-2-amino-3-((6-hydroxy-4-nitro-1H-indol-3-yl)propanoic Acid (27)
(138) ##STR00033##
(139) Example 27 can be prepared from 6-hydroxyindole as shown above.
Example 28: Preparation of (S)-2-amino-3-(7-hydroxy-4-nitro-1H-indol-3-yl)propanoic Acid (28)
(140) ##STR00034##
(141) Example 28 can be prepared from 7-hydroxyindole as shown above.
Example 29: Preparation of (S)-2-amino-3-(4-hydroxy-7-nitro-1H-indol-3-yl)propanoic Acid (29)
(142) ##STR00035##
(143) Example 29 can be prepared from 4-hydroxyindole as shown above.
Example 30: Preparation of (S)-2-amino-3-(4-nitro-5-phenyl-1H-indol-3-yl)propanoic Acid (30)
(144) ##STR00036##
(145) Example 30 can be prepared from 5-phenylindole as shown above.
Example 31: Preparation of (S)-2-amino-3-(4-nitro-6-phenyl-1H-indol-3-yl)propanoic Acid (31)
(146) ##STR00037##
(147) Example 31 can be prepared from 6-phenylindole as shown above.
Example 32: Preparation of (S)-2-amino-3-(4-nitro-7-phenyl-1H-indol-3-yl)propanoic Acid (32)
(148) ##STR00038##
(149) Example 32 can be prepared from 7-phenylindole as shown above.
Example 33: Preparation of (S)-2-amino-3-(7-nitro-4-phenyl-1H-indol-3-yl)propanoic Acid (33)
(150) ##STR00039##
(151) Example 33 can be prepared from 4-phenylindole as shown above.
Example 34: Preparation of (S)-2-amino-3-(5-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic Acid (34)
(152) ##STR00040##
(153) Example 34 can be prepared from 5-cyclopropylindole as shown above.
Example 35: Preparation of (S)-2-amino-3-(6-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic Acid (35)
(154) ##STR00041##
(155) Example 35 can be prepared from 6-cyclopropylindole as shown above.
Example 36: Preparation of (S)-2-amino-3-(7-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic Acid (36)
(156) ##STR00042##
(157) Example 36 can be prepared from 7-cyclopropylindole as shown above.
Example 37: Preparation of (S)-2-amino-3-(4-cyclopropyl-7-nitro-1H-indol-3-yl)propanoic Acid (37)
(158) ##STR00043##
(159) Example 37 can be prepared from 4-cyclopropylindole as shown above.
Example 38: Preparation of (S)-2-amino-3-(4-nitro-5-vinyl-1H-indol-3-yl)propanoic Acid (38)
(160) ##STR00044##
(161) Example 38 can be prepared from 5-vinylindole as shown above.
Example 39: Preparation of (S)-2-amino-3-(4-nitro-6-vinyl-1H-indol-3-yl)propanoic Acid (39)
(162) ##STR00045##
(163) Example 39 can be prepared from 6-vinylindole as shown above.
Example 40: Preparation of (S)-2-amino-3-(4-nitro-7-vinyl-1H-indol-3-yl)propanoic Acid (40)
(164) ##STR00046##
(165) Example 40 can be prepared from 7-vinylindole as shown above.
Example 41: Preparation of (S)-2-amino-3-(7-nitro-4-vinyl-1H-indol-3-yl)propanoic Acid (41)
(166) ##STR00047##
(167) Example 41 can be prepared from 4-vinylindole as shown above.
Example 42: Preparation of (S)-2-amino-3-(5-ethynyl-4-nitro-1H-indol-3-yl)propanoic Acid (42)
(168) ##STR00048##
(169) Example 42 can be prepared from 5-ethynylindole as shown above.
Example 43: Preparation of (S)-2-amino-3-(6-ethynyl-4-nitro-1H-indol-3-yl)propanoic Acid (43)
(170) ##STR00049##
(171) Example 43 can be prepared from 6-ethynylindole as shown above.
Example 44: Preparation of (S)-2-amino-3-(7-ethynyl-4-nitro-1H-indol-3-yl)propanoic Acid (44)
(172) ##STR00050##
(173) Example 44 can be prepared from 7-ethynylindole as shown above.
Example 45: Preparation of (S)-2-amino-3-(4-ethynyl-7-nitro-1H-indol-3-yl)propanoic Acid (45)
(174) ##STR00051##
(175) Example 45 can be prepared from 4-ethynylindole as shown above.
Example 46: Preparation of (S)-2-amino-3-(5-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (4
(176) ##STR00052##
(177) Example 46 can be prepared from 5-morpholinoindole as shown above,
Example 47: Preparation of (S)-2-amino-3-(6-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (47)
(178) ##STR00053##
(179) Example 47 can be prepared from 6-morpholinoindole as shown above.
Example 48: Preparation of (S)-2-amino-3-(7-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (48)
(180) ##STR00054##
(181) Example 48 can be prepared from 7-morpholinoindole as shown above.
Example 49: Preparation of (S)-2-amino-3-(4-morpholino-7-nitro-1H-indol-3-yl)propanoic Acid (49)
(182) ##STR00055##
(183) Example 49 can be prepared from 4-morpholinoindole as shown above.
Example 50: Preparation of (S)-2-amino(5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (50)
(184) ##STR00056##
(185) Example 50 can be prepared from 5-(methylthio)indole as shown above.
Example 51: Preparation of (S)-2-amino-3-(6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (51)
(186) ##STR00057##
(187) Example 51 can be prepared from 6-(methylthio)indole as shown above.
Example 52: Preparation of (S)-2-amino-3-(7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (52)
(188) ##STR00058##
(189) Example 52 can be prepared from 7-(methylthio)indole as shown above.
Example 53: Preparation of (S)-2-amino-3-(4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic Acid (53)
(190) ##STR00059##
(191) Example 53 can be prepared from 4-(methylthio)indole as shown above.
Example 54: Preparation of (S)-2-amino-3-(4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (54)
(192) ##STR00060##
(193) Example 54 can be prepared from 5-(pyridin-4-yl)indole as shown above.
Example 55: Preparation of (S)-2-amino-3-(4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (55)
(194) ##STR00061##
(195) Example 55 can be prepared from 6-(pyridin-4-yl)indole as shown above.
Example 56: Preparation of (S)-2-amino-3-(4-nitro-7-(pyridin-4-yl)-1H-3-yl)propanoic Acid (56)
(196) ##STR00062##
(197) Example 56 can be prepared from 7-(pyridin-4-yl)indole as shown above,
Example 57: Preparation of (S)-2-amino-3-(7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (57)
(198) ##STR00063##
(199) Example 57 can be prepared from 4-(pyridin-4-yl)indole as shown above.
Example 58: Preparation of 2-amino-3-(5-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (58)
(200) ##STR00064##
(201) Example 58 can be prepared from 2-amino-3-(5-methyl-1H-indol-3-yl)propanoic acid a shown above.
Example 59: Preparation of 2-amino-3-(6-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (59)
(202) ##STR00065##
(203) Example 59 can be prepared from 6-methylindole as shown above.
Example 60: Preparation of 2-amino-3-(7-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (60)
(204) ##STR00066##
(205) Example 60 can be prepared from 2-amino-3-(7-methyl-1H-indol-3-yl)propanoic acid as shown above.
Example 61: Preparation of 2-amino-3-(4-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (61)
(206) ##STR00067##
(207) Example 61 was prepared from 2-amino-3-(4-methyl-1H-indol-3-yl)propanoic acid as shown above.
Example 62: Preparation of 2-amino-3-(6-fluoro-4-nitro-1H-indol-3-yl)propanoic Acid (62)
(208) ##STR00068##
(209) Example 62 can be prepared from 2-amino-3-(6-fluoro-1H-indol-3-yl)propanoic acid as shown above.
Example 63: Preparation of 2-amino-3-(7-fluoro-4-nitro-1H-indol-3-yl)propanoic Acid (63)
(210) ##STR00069##
(211) Example 63 can be prepared from 7-fluoroindole as shown above.
Example 64: Preparation of 2-amino-3-(4-fluoro-7-nitro-1H-indol-3-yl)propanoic Acid (64)
(212) ##STR00070##
(213) Example 64 can be prepared from 2-amino-3-(4-fluoro-1H-indol-3-yl)propanoic acid as shown above.
Example 65: Preparation of 2-amino-3-(5-chloro-4-nitro-1H-indol-3-yl)propanoic Acid (65)
(214) ##STR00071##
(215) Example 65 can be prepared from 5-chloroindole as shown above.
Example 66: Preparation of 2-amino-3-(6-chloro-4-nitro-1H-indol-3-yl)propanoic Acid (66)
(216) ##STR00072##
(217) Example 66 can be prepared from 6-chloroindole as shown above.
3. Example 67: Preparation of 2-amino-3-(7-chloro-4-nitro-1H-indol-3-yl)propanoic Acid (67)
(218) ##STR00073##
(219) Example 67 can be prepared from 7-chloroindole as shown above.
Example 68: Preparation of 2-amino-3-(4-chloro-7-nitro-1H-indol-3-yl)propanoic Acid (68)
(220) ##STR00074##
(221) Example 68 can be prepared from 4-chloroindole as shown above.
Example 69: Preparation of 2-amino-3-(5-bromo-4-nitro-1H-indol-3-yl)propanoic Acid (69)
(222) ##STR00075##
(223) Example 69 can be prepared from 5-bromoindole as shown above.
Example 70: Preparation of 2-amino-3-(6-bromo-4-nitro-1H-indol-3-yl)propanoic Acid (70)
(224) ##STR00076##
(225) Example 70 can be prepared from 6-bromoindole as shown above.
Example 71: Preparation of 2-amino-3-(7-bromo-4-nitro-1H-indol-3-yl)propanoic Acid (71)
(226) ##STR00077##
(227) Example 71 can be prepared from 7-bromoindole as shown above.
Example 72: Preparation of 2-amino-3-(4-bromo-7-nitro-1H-indol-3-yl)propanoic Acid (72)
(228) ##STR00078##
(229) Example 72 can be prepared from 4-bromoindole as shown above.
Example 73: Preparation of 2-amino-3-(5-methoxy-4-nitro-1H-indol-3-yl)propanoic Acid (73)
(230) ##STR00079##
(231) Example 73 can be prepared from 5-methoxyindole as shown above.
Example 74: Preparation of 2-amino-3-(6-methoxy 4-nitro-1H-indol-3-yl)propanoic Acid (74)
(232) ##STR00080##
(233) Example 74 can be prepared from 6-methoxyindole as shown above.
Example 75: Preparation of 2-amino-3-(7-methoxy-4-nitro-1H-indol-3-yl)propanoic Acid (75)
(234) ##STR00081##
(235) Example 75 can be prepared from 7-methoxyindole as shown above.
Example 76: Preparation of 2-amino-3-(4-methoxy-7-nitro-1H-indol-3-yl)propanoic Acid (76)
(236) ##STR00082##
(237) Example 76 can be prepared from 4-methoxyindole as shown above.
Example 77: Preparation of 2-amino-3-(5-amino-4-nitro-1H-indol-3-yl)propanoic Acid (77)
(238) ##STR00083##
(239) Example 77 can be prepared from 5-aminoindole as shown above.
Example 78: Preparation of 2-amino-3-(6-amino-4-nitro-1H-indol-3-yl)propanoic Acid (78)
(240) ##STR00084##
(241) Example 78 can be prepared from 6-aminoindole as shown above.
Example 79: Preparation of 2-amino-3-(7-amino-4-nitro-1H-indol-3-yl)propanoic Acid (79)
(242) ##STR00085##
(243) Example 79 can be prepared from 7-aminoindole as shown above.
Example 80: Preparation of 2-amino-3-(4-amino-7-nitro-1H-indol-3-yl)propanoic Acid (80)
(244) ##STR00086##
(245) Example 80 can be prepared from 4-aminoindole as shown above.
Example 81: Preparation of 2-amino-3-(5-hydroxy-4-nitro-1H-indol-3-yl)propanoic Acid (81)
(246) ##STR00087##
(247) Example 81 can be prepared from 5-hydroxyindole as shown above.
Example 82: Preparation of 2-amino-3-(6-hydroxy-4-nitro-1H-indol-3-yl)propanoic Acid (82)
(248) ##STR00088##
(249) Example 82 can be prepared from 6-hydroxyindole as shown above.
Example 83: Preparation of 2-amino-3-(7-hydroxy-4-nitro-1H-indol-3-yl)propanoic Acid (83)
(250) ##STR00089##
(251) Example 83 can be prepared from 7-hydroxyindole as shown above.
Example 84: Preparation of 2-amino-3-(4-hydroxy-7-nitro-1H-indol-3-yl)propanoic Acid (84)
(252) ##STR00090##
(253) Example 84 can be prepared from 4-hydroxyindole as shown above.
Example 85: Preparation of 2-amino-3-(4-nitro-5-phenyl-1H-indol-3-yl)propanoic Acid (85)
(254) ##STR00091##
(255) Example 85 can be prepared from 5-phenylindole as shown above.
Example 86: Preparation of 2-amino-3-(4-nitro-6-phenyl-1H-indol-3-yl)propanoic Acid (86)
(256) ##STR00092##
(257) Example 86 can be prepared from 6-phenylindole as shown above.
Example 87: Preparation of 2-amino-3-(4-nitro-7-phenyl-1H-indol-3-yl)propanoic Acid (87)
(258) ##STR00093##
(259) Example 87 can be prepared from 7-phenylindole as shown above.
Example 88: Preparation of 2-amino-3-(7-nitro-4-phenyl-1H-indol-3-yl)propanoic Acid (88)
(260) ##STR00094##
(261) Example 88 can be prepared from 4-phenylindole as shown above.
Example 89: Preparation of 2-amino-3-(5-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic Acid (89)
(262) ##STR00095##
(263) Example 89 can be prepared from 5-cyclopropylindole as shown above.
Example 90: Preparation of 2-amino-3-(6-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic Acid (90)
(264) ##STR00096##
(265) Example 90 can be prepared from 6-cyclopropylindole as shown above.
Example 91: Preparation of 2-amino-3-(7-cyclopropyl-4-nitro-1H-indol-3-yl)propanoic Acid (91)
(266) ##STR00097##
(267) Example 91 can be prepared from 7-cyclopropylindole as shown above.
Example 92: Preparation of 2-amino-3-(4-cyclopropyl-7-nitro-1H-indol-3-yl) propanoic Acid (92)
(268) ##STR00098##
(269) Example 92 can be prepared from 4-cyclopropylindole as shown above.
Example 93: Preparation of 2-amino-3-(4-nitro-5-vinyl-1H-indol-3-yl)propanoic Acid (93)
(270) ##STR00099##
(271) Example 93 can be prepared from 5-vinylindole as shown above,
Example 94: Preparation of 2-amino-3-(4-nitro-6-vinyl-1H-indol-3-yl)propanoic Acid (94)
(272) ##STR00100##
(273) Example 94 can be prepared from 6-vinylindole as shown above.
Example 95: Preparation of 2-amino-3-(4-nitro-7-vinyl-1H-indol-3-yl)propanoic Acid (95)
(274) ##STR00101##
(275) Example 95 can be prepared from 7-vinylindole as shown above.
Example 96: Preparation of 2-amino-3-(7-nitro-4-vinyl-1H-indol-3-yl)propanoic Acid (96)
(276) ##STR00102##
(277) Example 96 can be prepared from 4-vinylindole as shown above.
Example 97: Preparation of 2-amino-3-(5-ethynyl-4-nitro-1H-indol-3-yl)propanoic Acid (97)
(278) ##STR00103##
(279) Example 97 can be prepared from 5-ethynylindole as shown above.
Example 98: Preparation of 2-amino-3-(6-ethynyl-4-nitro-1H-indol-3-yl)propanoic Acid (98)
(280) ##STR00104##
(281) Example 98 can be prepared from 6-ethynylindole as shown above.
Example 99: Preparation of 2-amino-3-(7-ethynyl-4-nitro-1H-indol-3-yl)propanoic Acid (99)
(282) ##STR00105##
(283) Example 99 can be prepared from 7-ethynylindole as shown above.
Example 100: Preparation of 2-amino-3-(4-ethynyl-7-nitro-1H-indol-3-yl)propanoic Acid (100)
(284) ##STR00106##
(285) Example 100 can be prepared from 4 ethynylindole as shown above.
Example 101: Preparation of 2-amino-3-(5-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (101)
(286) ##STR00107##
(287) Example 101 can be prepared from 5-morpholinoindole as shown above.
Example 102: Preparation of 2-amino-3-(6-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (102)
(288) ##STR00108##
(289) Example 102 can be prepared from 6-morpholinoindole as shown above.
Example 103: Preparation of 2-amino-3-(7-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (103)
(290) ##STR00109##
(291) Example 103 can be prepared from 7-morpholinoindole as shown above.
Example 104: Preparation of 2-amino-3-(4-morpholino-7-nitro-1H-indol-3-yl)propanoic Acid (104)
(292) ##STR00110##
(293) Example 104 can be prepared from 4-morpholinoindole as shown above.
Example 105: Preparation of 2-amino-3-(5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (105)
(294) ##STR00111##
(295) Example 105 can be prepared from 5-(methylthio)indole as shown above.
Example 106: Preparation of 2-amino-3-(6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (106)
(296) ##STR00112##
(297) Example 106 can be prepared from 6-(methylthio)indole as shown above,
Example 107: Preparation of 2-amino-3-(7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (107)
(298) ##STR00113##
(299) Example: 107 can be prepared from 7-(methylthio)indole as shown above;
Example 108: Preparation of 2-amino-3-(4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic Acid (108)
(300) ##STR00114##
(301) Example 108 can be prepared from 4-(methylthio)indole as shown above.
Example 109: Preparation of 2-amino-3-(4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (109)
(302) ##STR00115##
(303) Example 109 can be prepared from 5-(pyridin 4-yl)indole as shown above.
Example 110: Preparation of 2-amino-3-(4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (110)
(304) ##STR00116##
(305) Example 110 can be prepared from 6-(pyridin-4-yl)indole as shown above,
Example 111: Preparation of 2-amino-3-(4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (111)
(306) ##STR00117##
(307) Example 111 can be prepared from 7-(pyridin-4-yl)indole as shown above.
Example 112: Preparation of 2-amino-3-(7-nitro 4-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (112)
(308) ##STR00118##
(309) Example 112 can be prepared from 4-(pyridin-4-yl)indole as shown above;
Example 113: Preparation of 2-amino-3-(1,5-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (113)
(310) ##STR00119##
(311) Example 113 can be prepared from 1,5-dimethyl-1H-indole as shown above.
Example 114: Preparation of 2-amino-3-(1,6-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (114)
(312) ##STR00120##
(313) Example 114 can be prepared from 1,6-dimethyl-1H-indole as shown above.
Example 115: Preparation of 2-amino-3-(1,7-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (115)
(314) ##STR00121##
(315) Example 115 can be prepared from 1,7-dimethyl-1H-indole as shown above.
Example 116: Preparation of 2-amino-3-(1,4-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (116)
(316) ##STR00122##
(317) Example 116 can be prepared from 1,4-dimethyl-1H-indole as shown above;
Example 117: Preparation of 2-amino-3-(6-fluoro-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (117)
(318) ##STR00123##
(319) Example 117 can be prepared from 6-fluoro-1-methyl-1H-indole as shown above.
Example 118: Preparation of 2-amino-3-(7-fluoro-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (118)
(320) ##STR00124##
(321) Example 118 can be prepared from 7-fluoro-1-methyl-indole as shown above.
Example 119: Preparation of 2-amino-3-(4-fluoro-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (119)
(322) ##STR00125##
(323) Example 119 can be prepared from 4-fluoro-1-methyl-indole as shown above.
Example 120: Preparation of 2-amino-3-(5-chloro-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (120)
(324) ##STR00126##
(325) Example 120 can be prepared from 5-chloro-1-methyl-indole as shown above.
Example 121: Preparation of 2-amino-3-(6-chloro-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (121)
(326) ##STR00127##
(327) Example 121 can be prepared from 6-chloro-1-methyl-indole as shown above.
Example 122: Preparation of 2-amino-3-(7-chloro-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (122)
(328) ##STR00128##
(329) Example 122 can be prepared from 7-chloro-1-methyl-indole as shown above.
Example 123: Preparation of 2-amino-3-(4-chloro-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (123)
(330) ##STR00129##
(331) Example 123 can be prepared from 4-chloro-1-methyl-indole as shown above.
Example 124: Preparation of 2-amino-3-(5-bromo-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (124)
(332) ##STR00130##
(333) Example 124 can be prepared from 5-bromo-1-methyl-indole as shown above.
Example 125: Preparation of 2-amino-3-(6-bromo-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (125)
(334) ##STR00131##
(335) Example 125 can be prepared from 6-bromo-1-methyl-indole as shown above.
Example 126: Preparation of 2-amino-3-(7-bromo-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (126)
(336) ##STR00132##
(337) Example 126 can be prepared from 7-bromo-1-methyl-indole as shown above.
Example 127: Preparation of 2-amino-3-(4-bromo-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (127)
(338) ##STR00133##
(339) Example 127 can be prepared from 4-bromo-1-methyl-indole as shown above.
Example 128: Preparation of 2-amino-3-(5-methoxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (128)
(340) ##STR00134##
(341) Example 128 can be prepared from 5-methoxy-1-methyl-indole as shown above.
Example 129: Preparation of 2-amino-3-(6-methoxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (129)
(342) ##STR00135##
(343) Example 129 can be prepared from 6-methoxy-1-methyl-indole as shown above.
Example 130: Preparation of 2-amino-3-(7-methoxy-1-methyl-4-nitro-1H-indol-yl)propanoic Acid (130)
(344) ##STR00136##
(345) Example 130 can be prepared from 7-methoxy-1-methyl-indole as shown above.
Example 131: Preparation of 2-amino-3-(4-methoxy-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (131)
(346) ##STR00137##
(347) Example 131 can be prepared from 4-methoxy-1-methyl-indole as shown above.
Example 132: Preparation of 2-amino-3-(5-amino-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (132)
(348) ##STR00138##
(349) Example 132 can be prepared from 5-amino-1-methyl-indole as shown above.
Example 133: Preparation of 2-amino-3-(6-amino-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (133)
(350) ##STR00139##
(351) Example 133 can be prepared from 6-amino-1-methyl-indole as shown above.
Example 134: Preparation of 2-amino-3-(7-amino-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (134)
(352) ##STR00140##
(353) Example 134 can be prepared from 7-amino-1-methyl-indole as shown above.
Example 135: Preparation of 2-amino-3-(4-amino-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (135)
(354) ##STR00141##
(355) Example 135 can be prepared from 4-amino-1-methyl-indole as shown above.
Example 136: Preparation of 2-amino-3-(5-hydroxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (136)
(356) ##STR00142##
(357) Example 136 can be prepared from 5-hydroxy-1-methyl-indole as shown above.
Example 137: Preparation of 2-amino-3-(6-hydroxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (137)
(358) ##STR00143##
(359) Example 137 can be prepared from 6-hydroxy-1-methyl-indole as shown above.
Example 138: Preparation of 2-amino-3-(7-hydroxy-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (138)
(360) ##STR00144##
(361) Example 138 can be prepared from 7-hydroxy-1-methyl-indole as shown above.
Example 139: Preparation of 2-amino-3-(4-hydroxy-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (139)
(362) ##STR00145##
(363) Example 139 can be prepared from 4-hydroxy-1-methyl-indole as shown above.
Example 140: Preparation of 2-amino-3-(1-methyl-4-nitro-5-phenyl-1H-indol-3-yl)propanoic Acid (140)
(364) ##STR00146##
(365) Example 140 can be prepared from 5-phenyl-1-methyl-indole as shown above.
Example 141: Preparation of 2-amino-3-(1-methyl-4-nitro-6-phenyl-1H-indol-3-yl)propanoic Acid (141)
(366) ##STR00147##
(367) Example 141 can be prepared from 6-phenyl-1-methyl-indole as shown above.
Example 142: Preparation of 2-amino-3-(1-methyl-4-nitro-7-phenyl-1H-indol-3-yl)propanoic Acid (142)
(368) ##STR00148##
(369) Example 142 can be prepared from 7-phenyl-1-methyl-indole as shown above.
Example 143: Preparation of 2-amino-3-(1-methyl-7-nitro-4-phenyl-1H-indol-3-yl)propanoic Acid (143)
(370) ##STR00149##
(371) Example 143 can be prepared from 4-phenyl-1-methyl-indole as shown above.
Example 144: Preparation of 2-amino-3-(5-cyclopropyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (144)
(372) ##STR00150##
(373) Example 144 can be prepared from 5-cyclopropyl-1-methyl-indole as shown above.
Example 145: Preparation of 2-amino-3-(6-cyclopropyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (145)
(374) ##STR00151##
(375) Example 145 can be prepared from 6-cyclopropyl-1-methyl-indole as shown above.
Example 146: Preparation of 2-amino-3-(7-cyclopropyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (146)
(376) ##STR00152##
(377) Example 146 can be prepared from 7-cyclopropyl-1-methyl-indole as shown above.
Example 147: Preparation of 2-amino-3-(4-cyclopropyl-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (147)
(378) ##STR00153##
(379) Example 147 can be prepared from 4-cyclopropyl-1-methyl-indole as shown above.
Example 148: Preparation of 2-amino-3-(1-methyl-4-nitro-5-vinyl-1H-indol-3-yl)propanoic Acid (148)
(380) ##STR00154##
(381) Example 148 can be prepared from 5-vinyl-1-methyl-indole as shown above.
Example 149: Preparation of 2-amino-3-(1-methyl-4-nitro-6-vinyl-1H-indol-3-yl)propanoic Acid (149)
(382) ##STR00155##
(383) Example 149 can be prepared from 6-vinyl-1-methyl-indole as shown above.
Example 150: Preparation of 2-amino-3-(1-methyl-4-nitro-7-vinyl-1H-indol-3-yl)propanoic Acid (150)
(384) ##STR00156##
(385) Example 150 can be prepared from 7-vinyl-1-methyl-indole as shown above.
Example 151: Preparation of 2-amino-3-(1-methyl-7-nitro-4-vinyl-1H-indol-3-yl)propanoic Acid (151)
(386) ##STR00157##
(387) Example 151 can be prepared from 4-vinyl-1-methyl-indole as shown above.
Example 152: Preparation of 2-amino-3-(5-ethynyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (152)
(388) ##STR00158##
(389) Example 152 can be prepared from 5-ethynyl-1-methyl-indole as shown above.
Example 153: Preparation of 2-amino-3-(6-ethynyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (153)
(390) ##STR00159##
(391) Example 153 can be prepared from 6-ethynyl-1-methyl-indole as shown above.
Example 154: Preparation of 2-amino-3-(7-ethynyl-1-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (154)
(392) ##STR00160##
(393) Example 154 can be prepared from 7-ethynyl-1-methyl-indole as shown above.
Example 155: Preparation of 2-amino-3-(4-ethynyl-1-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (155)
(394) ##STR00161##
(395) Example 155 can be prepared from 4-ethynyl-1-methyl-indole as shown above.
Example 156: Preparation of 2-amino-3-(1-methyl-5-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (156)
(396) ##STR00162##
(397) Example 156 can be prepared from 5-morpholino-1-methyl-indole as shown above.
Example 157: Preparation of 2-amino-3-(1-methyl-6-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (157)
(398) ##STR00163##
(399) Example 157 can be prepared from 6-morpholino-1-methyl-indole as shown above.
Example 158: Preparation of 2-amino-3-(1-methyl-7-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (158)
(400) ##STR00164##
(401) Example 158 can be prepared from 7-morpholino-1-methyl-indole as shown above.
Example 159: Preparation of 2-amino-3-(1-methyl-4-morpholino-7-nitro-1H-indol-3-yl)propanoic Acid (159)
(402) ##STR00165##
(403) Example 159 can be prepared from 4-morpholino-1-methyl-indole as shown above.
Example 160: Preparation of 2-amino-3-(1-methyl-5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (160)
(404) ##STR00166##
(405) Example 160 can be prepared from 5-(methylthio)-1-methyl-indole as shown above.
Example 161: Preparation of 2-amino-3-(1-methyl-6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (161)
(406) ##STR00167##
(407) Example 161 can be prepared from 6-(methylthio)-1-methyl-indole as shown above.
Example 162: Preparation of 2-amino-3-(1-methyl-7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (162)
(408) ##STR00168##
(409) Example 162 can be prepared from 7-(methylthio)-1-methyl-indole as shown above.
Example 163: Preparation of 2-amino-3-(1-methyl-4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic Acid (163)
(410) ##STR00169##
(411) Example 163 can be prepared from 4-(methylthio)-1-methyl-indole as shown above.
Example 164: Preparation of 2-amino-3-(1-methyl-4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (164)
(412) ##STR00170##
(413) Example 164 can be prepared from 5-(pyridin-4-yl)-1-methyl-indole as shown above.
Example 165: Preparation of 2-amino-3-(1-methyl-4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (165)
(414) ##STR00171##
(415) Example 165 can be prepared from 6-(pyridin-4-yl)-1-methyl-indole as shown above.
Example 166: Preparation of 2-amino-3-(1-methyl-4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (166)
(416) ##STR00172##
(417) Example 166 can be prepared from 7-(pyridin-4-yl)-1-methyl-indole as shown above,
Example 167: Preparation of 2-amino-3-(1-methyl-7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (167)
(418) ##STR00173##
(419) Example 167 can be prepared from 4-(pyridin-4-yl)-1-methyl-indole as shown above.
Example 168: Preparation of 2-amino-3-(2,5-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (168)
(420) ##STR00174##
(421) Example 168 can be prepared from 2,5-dimethyl-1H-indole as shown above.
Example 169: Preparation of 2-amino-3-(2,6-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (169)
(422) ##STR00175##
(423) Example 169 can be prepared from 2,6-dimethyl-1H-indole as shown above.
Example 170: Preparation of 2-amino-3-(2,7-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (170)
(424) ##STR00176##
(425) Example 170 can be prepared from 2,7-dimethyl-1H-indole as shown above.
Example 171: Preparation of 2-amino-3-(2,4-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (171)
(426) ##STR00177##
(427) Example 171 can be prepared from 2,4-dimethyl-1H-indole as shown above.
Example 172: Preparation of 2-amino-3-(6-fluoro-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (172)
(428) ##STR00178##
(429) Example 172 can be prepared from 6-fluoro-2-methyl-1H-indole as shown above.
Example 173: Preparation of 2-amino-3-(7-fluoro-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (173)
(430) ##STR00179##
(431) Example 173 can be prepared from 7-fluoro-2-methyl-indole as shown above.
Example 174: Preparation of 2-amino-3-(7-fluoro-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (174)
(432) ##STR00180##
(433) Example 174 can be prepared from 4-fluoro-2-methyl-indole as shown above.
Example 175: Preparation of 2-amino-3-(5-chloro-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (175)
(434) ##STR00181##
(435) Example 175 can be prepared from 5-chloro-2-methyl-indole as shown above.
Example 176: Preparation of 2-amino-3-(6-chloro-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (176)
(436) ##STR00182##
(437) Example 176 can be prepared from 6-chloro-2-methyl-indole as shown above.
Example 177: Preparation of 2-amino-3-(7-chloro-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (177)
(438) ##STR00183##
(439) Example 177 can be prepared from 7-chloro-2-methyl-indole as shown above.
Example 178: Preparation of 2-amino-3-(4-chloro-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (178)
(440) ##STR00184##
(441) Example 178 can be prepared from 4-chloro-2-methyl-indole as shown above,
Example 179: Preparation of 2-amino-3-(5-bromo-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (179)
(442) ##STR00185##
(443) Example 179 can be prepared from 5-bromo-2-methyl-indole as shown above.
Example 180: Preparation of 2-amino-3-(6-bromo-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (180)
(444) ##STR00186##
(445) Example 180 can be prepared from 6-bromo-2-methyl-indole as shown above.
Example 181: Preparation of 2-amino-3-(7-bromo-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (181)
(446) ##STR00187##
(447) Example 181 can be prepared from 7-bromo-2-methyl-indole as shown above.
Example 182: Preparation of 2-amino-3-(4-bromo-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (182)
(448) ##STR00188##
(449) Example 182 can be prepared from 4-bromo-2-methyl-indole as shown above.
Example 183: Preparation of 2-amino-3-(5-methoxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (183)
(450) ##STR00189##
(451) Example 183 can be prepared from 5-methoxy-2-methyl-indole as shown above,
Example 184: Preparation of 2-amino-3-(6-methoxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (184)
(452) ##STR00190##
(453) Example 184 can be prepared from 6-methoxy-2-methyl-indole as shown above.
Example 185: Preparation of 2-amino-3-(7-methoxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (185)
(454) ##STR00191##
(455) Example 185 can be prepared from 7-methoxy-2-methyl-indole as shown above.
Example 186: Preparation of 2-amino-3-(4-methoxy-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (186)
(456) ##STR00192##
(457) Example 186 can be prepared from 4-methoxy-2-methyl-indole as shown above.
Example 187: Preparation of 2-amino-3-(5-amino-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (187)
(458) ##STR00193##
(459) Example 187 can be prepared from 5-amino-2-methyl-indole as shown above.
Example 188: Preparation of 2-amino-3-(6-amino-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (188)
(460) ##STR00194##
(461) Example 188 can be prepared from 6-amino-2-methyl-indole as shown above.
Example 189: Preparation of 2-amino-3-(7-amino-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (189)
(462) ##STR00195##
(463) Example 189 can be prepared from 7-amino-2-methyl-indole as shown above.
Example 190: Preparation of 2-amino-3-(4-amino-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (190)
(464) ##STR00196##
(465) Example 190 can be prepared from 4-amino-2-methyl-indole as shown above.
Example 191: Preparation of 2-amino-3-(5-hydroxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (191)
(466) ##STR00197##
(467) Example 191 can be prepared from 5-hydroxy-2-methyl-indole as shown above.
Example 192: Preparation of 2-amino-3-(6-hydroxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic acid (192)
(468) ##STR00198##
(469) Example 192 can be prepared from 6-hydroxy-2-methyl-indole as shown above.
Example 193: Preparation of 2-amino-3-(7-hydroxy-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (193)
(470) ##STR00199##
(471) Example 193 can be prepared from 7-hydroxy-2-methyl-indole as shown above.
Example 194: Preparation of 2-amino-3-(4-hydroxy-2-methyl-7 nitro-1H-indol-3-yl)propanoic Acid (194)
(472) ##STR00200##
(473) Example 194 can be prepared from 4-hydroxy-2-methyl-indole as shown above.
Example 195: Preparation of 2-amino-3-(2-methyl-4-nitro-5-phenyl-1H-indol-3-yl)propanoic Acid (195)
(474) ##STR00201##
(475) Example 195 can be prepared from 5-phenyl-2-methyl-indole as shown above.
Example 196: Preparation of 2-amino-3-(2-methyl-4-nitro-6-phenyl-1H-indol-3-yl)propanoic Acid (196)
(476) ##STR00202##
(477) Example 196 can be prepared from 6-phenyl-2-methyl-indole as shown above.
Example 197: Preparation of 2-amino-3-(2-methyl-4-nitro-7-phenyl-1H-indol-3-yl)propanoic Acid (197)
(478) ##STR00203##
(479) Example 197 can be prepared from 7-phenyl-2-methyl-indole as shown above.
Example 198: Preparation of 2-amino-3-(2-methyl-7-nitro-4-phenyl-1H-indol-3-yl)propanoic Acid (198)
(480) ##STR00204##
(481) Example 198 can be prepared from 4-phenyl-2-methyl-indole as shown above.
Example 199: Preparation of 2-amino-3-(5-cyclopropyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (199)
(482) ##STR00205##
(483) Example 199 can be prepared from 5-cyclopropyl-2-methyl-indole as shown above.
Example 200: Preparation of 2-amino-3-(6-cyclopropyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (200)
(484) ##STR00206##
(485) Example 200 can be prepared from 6-cyclopropyl-2-methyl-indole as shown above.
Example 201: Preparation of 2-amino-3-(7-cyclopropyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (201)
(486) ##STR00207##
(487) Example 201 can be prepared from 7-cyclopropyl-2-methyl-indole as shown above.
Example 202: Preparation of 2-amino-3-(4-cyclopropyl-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (202)
(488) ##STR00208##
(489) Example 202 can be prepared from 4-cyclopropyl-2-methyl-indole as shown above.
Example 203: Preparation of 2-amino-3-(2-methyl-4-nitro-5-vinyl-1H-indol-3-yl)propanoic Acid (203)
(490) ##STR00209##
(491) Example 203 can be prepared from 5-vinyl-2-methyl-indole as shown above.
Example 204: Preparation of 2-amino-3-(2-methyl-4-nitro-6-vinyl-1H-indol-3-yl)propanoic Acid (204)
(492) ##STR00210##
(493) Example 204 can be prepared from 6-vinyl-2-methyl-indole as shown above.
Example 205: Preparation of 2-amino-3-(2-methyl-4-nitro-7-vinyl-1H-indol-3-yl)propanoic Acid (205)
(494) ##STR00211##
(495) Example 205 can be prepared from 7-vinyl-2-methyl-indole as shown above.
Example 206: Preparation of 2-amino-3-(2-methyl-7-nitro-4-vinyl-1H-indol-3-yl)propanoic Acid (206)
(496) ##STR00212##
(497) Example 206 can be prepared from 4-vinyl-2-methyl-indole as shown above.
Example 207: Preparation of 2-amino-3-(5-ethynyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (207)
(498) ##STR00213##
(499) Example 207 can be prepared from 5-ethynyl-2-methyl-indole as shown above.
Example 208: Preparation of 2-amino-3-(6-ethynyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (208)
(500) ##STR00214##
(501) Example 208 can be prepared from 6-ethynyl-2-methyl-indole as shown above.
Example 209: Preparation of 2-amino-3-(7-ethynyl-2-methyl-4-nitro-1H-indol-3-yl)propanoic Acid (209)
(502) ##STR00215##
(503) Example 209 can be prepared from 7-ethynyl-2-methyl-indole as shown above.
Example 210: Preparation of 2-amino-3-(4-ethynyl-2-methyl-7-nitro-1H-indol-3-yl)propanoic Acid (210)
(504) ##STR00216##
(505) Example 210 can be prepared from 4-ethynyl-2-methyl-indole as shown above.
Example 211: Preparation of 2-amino-3-(2-methyl-5-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (211)
(506) ##STR00217##
(507) Example 211 can be prepared from 5-morpholino-2-methyl-indole as shown above.
Example 212: Preparation of 2-amino-3-(2-methyl-6-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (212)
(508) ##STR00218##
(509) Example 212 can be prepared from 6-morpholino-2-methyl-indole as shown above.
Example 213: Preparation of 2-amino-3-(2-methyl-7-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (213)
(510) ##STR00219##
(511) Example 213 can be prepared from 7-morpholino-2-methyl-indole as shown above.
Example 214: Preparation of 2-amino-3-(2-methyl-4-morpholino-7-nitro-1H-indol-3-yl)propanoic Acid (214)
(512) ##STR00220##
(513) Example 214 can be prepared from 4-morpholino-2-methyl-indole as shown above.
Example 215: Preparation of 2-amino-3-(2-methyl-5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (215)
(514) ##STR00221##
(515) Example 215 can be prepared from 5-(methylthio)-2-methyl-indole as shown above.
Example 216: Preparation of 2-amino-3-(2-methyl-6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (216)
(516) ##STR00222##
(517) Example 216 can be prepared from 6-(methylthio)-2-methyl-indole as shown above.
Example 217: Preparation of 2-amino-3-(2-methyl-7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (217)
(518) ##STR00223##
(519) Example 217 can be prepared from 7-(methylthio)-2-methyl-indole as shown above.
Example 218: Preparation of 2-amino-3-(2-methyl-4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic Acid (218)
(520) ##STR00224##
(521) Example 218 can be prepared from 4-(methylthio)-2-methyl-indole as shown above.
Example 219: Preparation of 2-amino-3-(2-methyl-4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (219)
(522) ##STR00225##
(523) Example 219 can be prepared from 5-(pyridin-4-yl)-2-methyl-indole as shown above.
Example 220: Preparation of 2-amino-3-(2-methyl-4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (220)
(524) ##STR00226##
(525) Example 220 can be prepared from 6-(pyridin-4-yl)-2-methyl-indole as shown above.
Example 221: Preparation of 2-amino-3-(2-methyl-4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (221)
(526) ##STR00227##
(527) Example 221 can be prepared from 7-(pyridin-4-yl)-2-methyl-indole as shown above.
Example 222: Preparation of 2-amino-3-(2-methyl-7-nitro-4 (pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (222)
(528) ##STR00228##
(529) Example 222 can be prepared from 4-(pyridin-4-yl)-2-methyl-indole as shown above.
Example 223: Preparation of 2-amino-3-(1,2,5-trimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (223)
(530) ##STR00229##
(531) Example 223 can be prepared from 1,2,5-trimethyl-1H-indole as shown above.
Example 224: Preparation of 2-amino-3-(1,2,6-trimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (224)
(532) ##STR00230##
(533) Example 224 can be prepared from 1,2,6-trimethyl-1H-indole as shown above.
Example 225: Preparation of 2-amino-3-(1,2,7-trimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (225)
(534) ##STR00231##
(535) Example 225 can be prepared from 1,2,7-trimethyl-1H-indole as shown above.
Example 226: Preparation of 2-amino-3-(1,2,4-tri ethyl-7-nitro-1-indol-3-yl)propanoic Acid (226)
(536) ##STR00232##
(537) Example 226 can be prepared from 1,2,4-trimethyl-1H-indole as shown above.
Example 227: Preparation of 2-amino-3-(6-fluoro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (227)
(538) ##STR00233##
(539) Example 227 can be prepared from 6-fluoro-1,2-dimethyl-1H-indole as shown above.
Example 228: Preparation of 2-amino-3-(7-fluoro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (228)
(540) ##STR00234##
(541) Example 228 can be prepared from 7-fluoro-1,2-dimethyl-indole as shown above.
Example 229: Preparation of 2-amino-3-(4-fluoro-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (229)
(542) ##STR00235##
(543) Example 229 can be prepared from 4-fluoro-1,2-dimethyl-indole as shown above.
Example 230: Preparation of 2-amino-3-(5-chloro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (230)
(544) ##STR00236##
(545) Example 230 can be prepared from 5-chloro-1,2-dimethyl-indole as shown above.
Example 231: Preparation of 2-amino-3-(6-chloro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (231)
(546) ##STR00237##
(547) Example 231 can be prepared from 6-chloro-1,2-dimethyl-indole as shown above.
Example 232: Preparation of 2-amino-3-(7-chloro-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (232)
(548) ##STR00238##
(549) Example 232 can be prepared from 7-chloro-1,2-dimethyl-indole as shown above.
Example 233: Preparation of 2-amino-3-(4-chloro-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (233)
(550) ##STR00239##
(551) Example 233 can be prepared from 4-chloro-1,2-dimethyl-indole as shown above.
Example 234: Preparation of 2-amino-3-(5-bromo-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (234)
(552) ##STR00240##
(553) Example 234 can be prepared from 5-bromo-1,2-dimethyl-indole as shown above.
Example 235: Preparation of 2-amino-3-(6-bromo-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (235)
(554) ##STR00241##
(555) Example 235 can be prepared from 6-bromo-1,2-dimethyl-indole as shown above.
Example 236: Preparation of 2-amino-3-(7-bromo-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (236)
(556) ##STR00242##
(557) Example 236 can be prepared from 7-bromo-1,2-dimethyl-indole as shown above.
Example 237: Preparation of 2-amino-3-(4-bromo-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (237)
(558) ##STR00243##
(559) Example 237 can be prepared from 4-bromo-1,2-dimethyl-indole as shown above.
Example 238: Preparation of 2-amino-3-(5-methoxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (238)
(560) ##STR00244##
(561) Example 238 can be prepared from 5-methoxy-1,2-dimethyl-indole as shown above.
Example 239: Preparation of 2-amino-3-(6-methoxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (239)
(562) ##STR00245##
(563) Example 239 can be prepared from 6-methoxy-1,2-dimethyl-indole as shown above,
Example 240: Preparation of 2-amino-3-(7-methoxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (240)
(564) ##STR00246##
(565) Example 240 can be prepared from 7-methoxy-1,2-dimethyl-indole as shown above.
Example 241: Preparation of 2-amino-3-(4-methoxy-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (241)
(566) ##STR00247##
(567) Example 241 can be prepared from 4-methoxy-1,2-dimethyl-indole as shown above.
Example 242: Preparation of 2-amino-3-(5-amino-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (242)
(568) ##STR00248##
(569) Example 242 can be prepared from 5-amino-1,2-dimethyl-indole as shown above.
Example 243: Preparation of 2-amino-3-(6-amino-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (243)
(570) ##STR00249##
(571) Example 243 can be prepared from 6-amino-1,2-dimethyl-indole as shown above.
Example 244: Preparation of 2-amino-3-(7-amino-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (244)
(572) ##STR00250##
(573) Example 244 can be prepared from 7-amino-1,2-dimethyl-indole as shown above.
Example 245: Preparation of 2-amino-3-(4-amino-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (245)
(574) ##STR00251##
(575) Example 245 can be prepared from 4-amino-1,2-dimethyl-indole as shown above.
Example 246: Preparation of 2-amino-3-(5-hydroxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (246)
(576) ##STR00252##
(577) Example 246 can be prepared from 5-hydroxy-1,2-dimethyl-indole as shown above.
Example 247: Preparation of 2-amino-3-(6-hydroxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (247)
(578) ##STR00253##
(579) Example 247 can be prepared from 6-hydroxy-1,2-dimethyl-indole as shown above.
Example 248: Preparation of 2-amino-3-(7-hydroxy-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (248)
(580) ##STR00254##
(581) Example 248 can be prepared from 7-hydroxy-1,2-dimethyl-indole as shown above.
Example 249: Preparation of 2-amino-3-(4-hydroxy-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (249)
(582) ##STR00255##
(583) Example 249 can be prepared from 4-hydroxy-1,2-dimethyl-indole as shown above.
Example 250: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-5-phenyl-1H-indol-3-yl)propanoic Acid (250)
(584) ##STR00256##
(585) Example 250 can be prepared from 5-phenyl-1,2-dimethyl-indole as shown above.
Example 251: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-6-phenyl-1H-indol-3-yl)propanoic Acid (251)
(586) ##STR00257##
(587) Example 251 can be prepared from 6-phenyl-1,2-dimethyl-indole as shown above.
Example 252: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-7-phenyl-1H-indol-3-yl)propanoic Acid (252)
(588) ##STR00258##
(589) Example 252 can be prepared from 7-phenyl-1,2-dimethyl-indole as shown above.
Example 253: Preparation of 2-amino-3-(1,2-dimethyl-7-nitro-4-phenyl-1H-indol-3-yl)propanoic Acid (253)
(590) ##STR00259##
(591) Example 253 can be prepared from 4-phenyl-1,2-dimethyl-indole as shown above,
Example 254: Preparation of 2-amino-3-(5-cyclopropyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (254)
(592) ##STR00260##
(593) Example 254 can be prepared from 5-cyclopropyl-1,2-dimethyl-indole as shown above.
Example 255: Preparation of 2-amino-3-(6-cyclopropyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (255)
(594) ##STR00261##
(595) Example 255 can be prepared from 6-cyclopropyl-1,2-dimethyl-indole as shown above.
Example 256: Preparation of 2-amino-3-(7-cyclopropyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (256)
(596) ##STR00262##
(597) Example 256 can be prepared from 7-cyclopropyl-1,2-dimethyl-indole as shown above.
Example 257: Preparation of 2-amino-3-(4-cyclopropyl-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (257)
(598) ##STR00263##
(599) Example 257 can be prepared from 4-cyclopropyl-1,2-dimethyl-indole as shown above.
Example 258: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-5-vinyl-1H-indol-3-yl)propanoic Acid (258)
(600) ##STR00264##
(601) Example 258 can be prepared from 5-vinyl-1,2-dimethyl-indole as shown above.
Example 259: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-6-vinyl-1H-indol-3-yl)propanoic Acid (259)
(602) ##STR00265##
(603) Example 259 can be prepared from 6-vinyl-1,2-dimethyl-indole as shown above.
Example 260: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-7-vinyl-1H-indol-3-yl)propanoic Acid (260)
(604) ##STR00266##
(605) Example 260 can be prepared from 7-vinyl-1,2-dimethyl-indole as shown above.
Example 261: Preparation of 2-amino-3-(1,2-dimethyl-7-nitro-4-vinyl-1H-indol-3-yl)propanoic acid (261)
(606) ##STR00267##
(607) Example 261 can be prepared from 4-vinyl-1,2-dimethyl-indole as shown above.
Example 262: Preparation of 2-amino-3-(5-ethynyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (262)
(608) ##STR00268##
(609) Example 262 can be prepared from 5-ethynyl-1,2-dimethyl-indole as shown above.
Example 263: Preparation of 2-amino-3-(6-ethynyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (263)
(610) ##STR00269##
(611) Example 263 can be prepared from 6-ethynyl-1,2-dimethyl-indole as shown above.
Example 264: Preparation of 2-amino-3-(7-ethynyl-1,2-dimethyl-4-nitro-1H-indol-3-yl)propanoic Acid (264)
(612) ##STR00270##
(613) Example 264 can be prepared from 7-ethynyl-1,2-dimethyl-indole as shown above.
Example 265: Preparation of 2-amino-3-(4-ethynyl-1,2-dimethyl-7-nitro-1H-indol-3-yl)propanoic Acid (265)
(614) ##STR00271##
(615) Example 265 can be prepared from 4-ethynyl-1,2-dimethyl-indole as shown above.
Example 266: Preparation of 2-amino-3-(1,2-dimethyl-5-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (266)
(616) ##STR00272##
(617) Example 266 can be prepared from 5-morpholino-1,2-dimethyl-indole as shown above.
Example 267: Preparation of 2-amino-3-(1,2-dimethyl-6-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (267)
(618) ##STR00273##
(619) Example 267 can be prepared from 6-morpholino-1,2-dimethyl-indole as shown above.
Example 268: Preparation of 2-amino-3-(1,2-dimethyl-7-morpholino-4-nitro-1H-indol-3-yl)propanoic Acid (268)
(620) ##STR00274##
(621) Example 268 can be prepared from 7-morpholino-1,2-dimethyl-indole as shown above.
Example 269: Preparation of 2-amino-3-(1,2-dimethyl-4-morpholino-7-nitro-1H-indol-3-yl)propanoic Acid (269)
(622) ##STR00275##
(623) Example 269 can be prepared from 4-morpholino-1,2-dimethyl-indole as shown above.
Example 270: Preparation of 2-amino-3-(1,2-dimethyl-5-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (270)
(624) ##STR00276##
(625) Example 270 can be prepared from 5-(methylthio)-1,2-dimethyl-indole as shown above.
Example 271: Preparation of 2-amino-3-(1,2-dimethyl-6-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (271)
(626) ##STR00277##
(627) Example 271 can be prepared from 6-(methylthio)-1,2-dimethyl-indole as shown above.
Example 272: Preparation of 2-amino-3-(1,2-dimethyl-7-(methylthio)-4-nitro-1H-indol-3-yl)propanoic Acid (272)
(628) ##STR00278##
(629) Example 272 can be prepared from 7-(methylthio)-1,2-dimethyl-indole as shown above.
Example 273: Preparation of 2-amino-3-(1,2-dimethyl-4-(methylthio)-7-nitro-1H-indol-3-yl)propanoic Acid (273)
(630) ##STR00279##
(631) Example 273 can be prepared from 4-(methylthio)-1,2-dimethyl-indole as shown above.
Example 274: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-5-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (274)
(632) ##STR00280##
(633) Example 274 can be prepared from 5-(pyridin-4-yl)-1,2-dimethyl-indole as shown above.
Example 275: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-6-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (275)
(634) ##STR00281##
(635) Example 275 can be prepared from 6-(pyridin-4-yl)-1,2-dimethyl-indole as shown above.
Example 276: Preparation of 2-amino-3-(1,2-dimethyl-4-nitro-7-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (276)
(636) ##STR00282##
(637) Example 276 can be prepared from 7-(pyridin-4-yl)-1,2-dimethyl-indole as shown above.
Example 277: Preparation of 2-amino-3-(1,2-dimethyl-7-nitro-4-(pyridin-4-yl)-1H-indol-3-yl)propanoic Acid (277)
(638) ##STR00283##
(639) Example 277 can be prepared from 4-(pyridin-4-yl)-1,2-dimethyl-indole as shown above.
Example 278: Genetic Engineering of E. coli for Further Improving the Productivity
(640) In E. coli, L-Trp has been observed to be converted into indole, pyruvate and NH.sub.3 by tryptophanase TnaA. L-Trp consumption and the formation of 4-NO.sub.2-L-Trp and indole was monitored during the whole cell transformation process (
(641) During the biological synthesis of L-Trp in E. coli, TrpR has been observed to repress the transcription of genes involved in L-Trp synthesis and transport when high concentration of L-Trp are present. In addition, in the biosynthesis pathways of aromatic amino acids, carbon flux from chorismite has been observed to flow to the synthesis of L-Phe, L-Tyr and L-Trp (
(642) TABLE-US-00002 TABLE2 Primersusedforthegeneknockout. tnaA_fw ACATCCTTATAGCCACTCTGTAGTATTAATTAAACTTCTTTAAGTT TTGCATTCCGGGGATCCGTCGACC(SEQIDNO:27) tnaA_rv AATATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTAT GTAATGTGTAGGCTGGAGCTGCTTCG(SEQIDNO:28) trpR-FRT_fw TACAACCGGGGGAGGCATTTTGCTTCCCCCGCTAACAATGGCGA CATATTGTGTAGGCTGGAGCTGCTTC(SEQIDNO:29) trpR-FRT_rv ATTCGGTGCACGATGCCTGATGCGCCACGTCTTATCAGGCCTACA AAACATATGAATATCCTCCTTA(SEQIDNO:30) pheA-FRT_fw GGCCTCCCAAATCGGGGGGCCTTTTTTATTGATAACAAAAAGGC AACACTGTGTAGGCTGGAGCTGCTTC(SEQIDNO:31) pheA-FRT_rv GCCAGTAATAATCCAGTGCCGGATGATTCACATCATCCGGCACCT TTTCACATATGAATATCCTCCTTA(SEQIDNO:32) tyrA-FRT_fw TCAGGATCTGAACGGGCAGCTGACGGCTCGCGTGGCTTAAGAGG TTTATTGTGTAGGCTGGAGCTGCTTC(SEQIDNO:33) tyrA-FRT_rv CAACCTGATGAAAAGGTGCCGGATGATGTGAATCATCCGGCACT GGATTACATATGAATATCCTCCTTA(SEQIDNO:34)
Example 279: Direct Aromatic Nitration System for Synthesis of Nitrotryptophans in Escherichia coli
(643) This example describes design of a biosynthetic pathway for nitrotrp production in E. coli. The production of Nitrotrp and its derivatives primarily uses complicated, heavily polluting synthetic methods, while biocatalytic nitration processes typically require the use of costly, unstable nitric oxide donors. Native thaxtomin-producing plant pathogenic Streptomyces species produce trace amounts of Nitrotrp along with NCH.sub.3-Nitrotrp and the txtB-inactivated mutant accumulates only up to 6 mg/L of Nitrotrp after 5-day fermentation. TxtB is a nonribosomal peptide synthase that utilizes Nitrotrp as substrate to synthesize thaxtomin D. Production of up to 0.22 g/L of thaxtomins within 6 days by heterologously expressing the thaxtomin gene cluster from S. scabiei 87.22 in S. albus J1074 (S. albus-thx2) has been observed. The S. albus-thx2 and its mutant carrying only the txtE and txtD genes have been observed to produce up to 80 mg/L. of Nitrotrp derivatives, mainly N-acetyl-Nitrotrp, but not Nitrotrp.
(644) A biosynthetic route to Nitrotrp, in some embodiments, comprises TxtE for 1-Trp nitration and one bacterial NOS for the generation of NO from 1-Arg (
(645) TB14 and BsNOS were cloned into the first and second multiple cloning sites (MCS) of pETDuet-1, respectively (
(646) TABLE-US-00003 TABLE 3 Bacterial strains Name Function E. coli DH5 Routine molecular biology studies E. coli BL21-GOLD Protein expression and production (DE3) host E. coli tnaA E. coli BL21-GOLD (DE3) carrying inactivated tnaA E. coli trpRtyrApheA E. coli BL21-GOLD (DE3) carrying inactivated trpR, tyrA, and pheA E. coli-I E. coli BL21-GOLD (DE3) carrying the pathway I E. coli-II E. coli BL21-GOLD (DE3) carrying the pathway II E. coli-III E. coli BL21-GOLD (DE3) carrying the pathway III E. coli-IV E. coli BL21-GOLD (DE3) carrying the pathway IV E. coli-II-TB14 E. coli BL21-GOLD (DE3) carrying the pathway II without TB14 E. coli-II-BsNOS E. coli BL21-GOLD (DE3) carrying the pathway II without BsNOS E. coli-II-GDH E. coli BL21-GOLD (DE3) carrying the pathway II without GDH E. coli trpRtyrApheA-II E. coli trpRtyrApheA carrying the pathway II E. coli-TB14 E. coli BL21-GOLD (DE3) carrying only TB14
(647) After the selection with both ampicillin and kanamycin, one positive colony (E. coli-I) was picked up to express proteins in TB medium induced with 0.5 mM IPTG for 20 h. The SDS-PAGE analysis of the soluble crude extract revealed the successful overexpression of BsNOS (42 kD) and GDH (28 kD) (Lane I.
(648) Despite the successful production of Nitrotrp by E. coli-I (I,
(649) The fermentation processes in two commonly used, nutritionally rich media, LB and TB were investigated. As cellular 1-Trp and 1-Arg are consumed to produce Nitrotrp (
(650) Temperature effects on the whole-cell nitration process were also examined. Fermentation experiments were performed at 20 C., 15 C., 28 C., and 37 C. Crude extracts of fermentation media of E. coli-II cultured at the four temperatures were prepared at 0 h, 8 h, 16 h, 20 h, 24 h, 28 h, and 40 h. HPLC analysis indicated a similar level of Nitrotrp at 8 b and 16 h when E. coli-II was fermented at 15 C., 20 C. and 28 C. (
(651) Nitrotrp pathway II comprises TB14, BsNOS, and GDH (
(652) The production of Nitrotrp consumes cellular 1-Trp and 1-Arg of E. coli (
(653) Increasing the metabolic flux to 1-Trp biosynthesis was investigated (
(654) Production of Nitrotrp analogs was examined by feeding eight unnatural racemic 1-Trp analogs (except for 5-F-1-Trp) (5 mM) to the fermentation medium of E. coli-II (
Materials and Methods
(655) General Chemicals, DNA Sub-Cloning, and Bacterial Strains
(656) Molecular biology reagents and enzymes were purchased from Fisher Scientific. Primers were ordered from Sigma-Aldrich. Racemic 4-Me-Trp was from MP Biomedical (Santa Ana, CA). Other chemicals and solvents were purchased from Sigma-Aldrich or Fisher Scientific. Escherichia coli DH5 (Life Technologies) was used for molecular biology work, while E. coli BL21-GOLD (DE3) (Agilent) was used for protein overexpression and the development of the whole cell nitration systems (Table 3). E. coli strains were grown in M9, LB or TB. DNA sequencing was performed at Eurofins. A Shimadzu Prominence UHPLC system (Kyoto, Japan) fitted with an Agilent Poroshell 120 EC-C18 column (2.7 m, 3.050 mm), coupled with a PDA detector was used for HPLC analysis.
(657) Creation of Nitrotrp Biosynthetic Pathways
(658) BsNOS, TB14 and GDH genes were amplified from pET15b-BsNOS, pET28b-TB14, and pET21b-GDH, respectively using primers listed in Table 4. PCR amplicons were analyzed by agarose gel and extracted with GeneJET Gel Extraction Kit (Thermo). Purified PCR products, pACYCDuet-1, pETDuet-1, and pET28b were digested with corresponding restriction enzymes, purified and then ligated to create expression constructs. All inserts in the constructs were sequenced to exclude potential errors introduced during PCR amplification and gene manipulation.
(659) Whole-Cell Biotransformation
(660) E. coli BL21-GOLD (DE3) competent cells were transformed with the designed pathway I-IV individually (Table 3). Positive colonies of E. coli-I, to -IV were selected on LB agar supplemented with 0.1 mg/mL ampicillin and 0.05 mg/mL kanamycin or 0.05 mg/mL chloramphenicol and 0.05 mg/mL kanamycin. One colony of each strain was then grown in LB with proper antibiotics at 37 C., 250 rpm overnight. The seed cultures were used to inoculate 100 mL of TB with proper antibiotics and 1 trace metal solution (1000 stock solution: 50 mM FeCl.sub.3, 20 mM CaCl.sub.2, 10 mM MnSO.sub.4, 10 mM ZnSO.sub.4, 2 mM CoSO.sub.4, 2 mM CuCl.sub.2, 2 mM NiCl, 2 mM Na.sub.2MoO.sub.4, and 2 mM H.sub.3BO.sub.3) for culturing at 37 C., 250 rpm until OD.sub.600 reached 0.6-0.8. We then induced protein expression by 0.5 mM IPTG at 18 C., 250 rpm for 20 h. For the evaluation of protein expression, cell pellets were then collected after centrifugation (5,000 g, 10 min, and 4 C.), and resuspended in the suitable volume of lysis buffer (cell biomass; volume=1:4) [25 mM Tris-HCl. pH 8.0, 100 mM NaCl, 20 mM imidazole, 3 mM -mercaptoethanol (BME) and 10% glycerol]. Soluble proteins were released by sonication and collected after centrifugation at 35,000g at 4 C. for 30 min. Clear supernatants (20 L) was mixed with dye and subject to SDS-PAGE analysis. For the whole cell biotransformation, bacterial cells in TB were harvested after centrifugation (2,000 g at 4 C. for 10 min) and resuspended to OD.sub.600=30 in fresh test media (M9, LB, or TB with or without 5 mM 1-Trp or 1-Arg). The fermentation was then performed at different temperatures, 250 rpm and aliquots (0.1 mL) of the fermentation culture were taken at various time points. The whole-cell biotransformation in aliquots was quenched by mixing with 0.2 mL of methanol. After centrifugation at 14.000 rpm for 30 minutes, the supernatant was subject to HPLC analysis. All experiments were independently repeated at least twice.
(661) Inactivation of Genes in E. coli
(662) Inactivation of tnaA, trpR, tyrA, and pheA in E. coli BL21-GOLD (DE3) was performed following the red recombination protocol (
(663) TnaA Assay
(664) The tnaA gene was amplified from E. coli genomic DNA using primers listed in Table 4. PCR amplicons were analyzed by agarose gel and extracted with GeneJET Gel Extraction Kit (Thermo). Purified PCR products and pET28b were digested with corresponding restriction enzymes, purified and then ligated to create expression constructs. Insert in the construct was sequenced to exclude potential errors introduced during PCR amplification and gene manipulation. Recombinant TnaA was prepared in E. coli BL21-GOLD (DE3). The enzyme assay (0.1 mL) contained 100 mM potassium phosphate buffer (pH 8.3), 0.2 mM pyridoxal 5-phosphate and 0.1 M purified tnaA. The reaction mixtures were pre-warmed at 37 C. for 5 minutes, and initiated by adding 0.5 mM 1-Trp or Nitrotrp as substrate. After 10 minutes, the reactions were quenched by mixing well with 0.2 mL of methanol. After centrifugation at 14,000 rpm for 30 minutes, the supernatant was subject to HPLC analysis. All experiments were independently repeated at least twice.
(665) HPLC and LC-MS Methods
(666) For HPLC analysis, the C18 column was kept at 30 C. and ran first with 5% solvent B (acetonitrile, 0.1% formic acid) for 2 min and then a linear gradient of 5-15% solvent B in 5 min, followed by another linear gradient of 15-95% solvent B in 10 min. The column was further cleaned with 95% solvent B for 3 min and then re-equilibrated with 5% solvent B for 2 min. Solvent A was water with 0.1% formic acid. The flow rate was set as 0.5 mL/min, and the products were detected at 211 nm with a PDA detector. The concentrations of Nitrotrp and/or 1-Trp in the samples were determined on the basis of standard curves of two authentic compounds after HPLC analysis (
(667) TABLE-US-00004 TABLE4 Name Sequence(5.fwdarw.3) Function TB14FN ATACCATGGTGACCGTCCCCTCGCCG(SEQIDNO:35) TB14cloning TB14RH ATCAAGCTTCCCAGCCCACACGTCTTTTGC(SEQIDNO:36) TB14cloning GDHFB CAGGATCCGATGTATAAAGATCTGGAAGGTAAAGTGGTG GDHcloning (SEQIDNO:37) GDHRH CAAAGCTTTTAGCCACGACCTGCCTGAAAG(SEQIDNO:38) GDHcloning BsNOSFN ACTCATATGATGGAAGAAAAAGAAATC(SEQIDNO:39) BsNOScloning BsNOSRH ACTAAGCTTCTATTCATACGGTTTGTC(SEQIDNO:40) BsNOScloning tnaAFB ACTGGATCCGATGGAAAACTTTAAACATCTCC(SEQIDNO:41) tnaAcloning tnaARE ACTGAATTCGAAACTTCTTTAAGTTTTGCGGTG(SEQIDNO:42) tnaAcloning trpR-F TACAACCGGGGGAGGCATTTTGCTTCCCCCGCTAACAATGGCGAC trpRknockout ATATTGTGTAGGCTGGAGCTGCTTC(SEQIDNO:43) trpR-R ATTCGGTGCACGATGCCTGATGCGCCACGTCTTATCAGGCCTACA trpRknockout AAACATATGAATATCCTCCTTA(SEQIDNO:44) pheA-F GGCCTCCCAAATCGGGGGGCCTTTTTTATTGATAACAAAAAGGCA pheAknockout ACACTGTGTAGGCTGGAGCTGCTTC(SEQIDNO:45) pheA-R GCCAGTAATAATCCAGTGCCGGATGATTCACATCATCCGGCACCTT pheAknockout TTCACATATGAATATCCTCCTTA(SEQIDNO:46) tyrA-F TCAGGATCTGAACGGGCAGCTGACGGCTCGCGTGGCTTAAGAGG tyrAknockout TTTATTGTGTAGGCTGGAGCTGCTTC(SEQIDNO:47) tyrA-R CAACCTGATGAAAAGGTGCCGGATGATGTGAATCATCCGGCACTG tyrAknockout GATTACATATGAATATCCTCCTTA(SEQIDNO:48) tnaA-F GGATCACTGTAATTAAAATAAATGAAGGATTATGTAATGGTGTAGGC tnaAknockout TGGAGCTGCTTC(SEQIDNO:49) tnaA-R GTGGCTAACATCCTTATAGCCACTCTGTAGTATTAATTACATATGAAT tnaAknockout ATCCTCCTTA(SEQIDNO:50)
EQUIVALENTS
(668) While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
(669) All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
(670) All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
(671) The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
(672) The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
(673) As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of. or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
(674) As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B. or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
(675) It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
(676) In the claims, as well as in the specification above, all transitional phrases such as comprising. including, carrying, having, containing, involving. holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., comprising) are also contemplated, in alternative embodiments, as consisting of and consisting essentially of the feature described by the open-ended transitional phrase. For example, if the disclosure describes a composition comprising A and B, the disclosure also contemplates the alternative embodiments a composition consisting of A and B and a composition consisting essentially of A and B.