Oncolytic virus expressing interferon and application therefor
12319931 ยท 2025-06-03
Assignee
Inventors
- Kangjian ZHANG (Shanghai, CN)
- Xianlong FANG (Shanghai, CN)
- Jinfa GU (Shanghai, CN)
- Xinyuan LIU (Shanghai, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/10345
CHEMISTRY; METALLURGY
C12N2710/10344
CHEMISTRY; METALLURGY
C12N2710/16145
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
Provided is an oncolytic virus expressing interferon. Specifically provided is an oncolytic adenovirus comprising a fusion protein expressing interferon, said oncolytic virus being capable of effectively suppressing tumors in vitro and in vivo.
Claims
1. An oncolytic virus comprising a nucleic acid encoding interferon, wherein the nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO:2, 3 and 4.
2. The oncolytic virus according to claim 1, wherein the virus comprises adenovirus early region 1A (E1A) gene driven by a survivin promoter, the endogenous promoter of the E1A gene in viral genome is replaced by the survivin promoter; and/or the E1A gene is modified to reduce or completely inactivate the activity of E1A protein to bind to retinoblastoma (Rb) protein by deleting a sequence encoding amino acids 122-129 of the E1A protein encoded by nucleic acid residues 364-387 of SEQ ID NO: 1.
3. The oncolytic virus according to claim 1, wherein the nucleic acid sequence is operably linked to a cytomegalovirus (CMV) promoter.
4. The oncolytic virus according to claim 1, wherein the oncolytic virus is deposited at China Center for Type Culture Collection, under Accession number CCTCC NO: V201871, CCTCC NO: V201957 or CCTCC NO: V201958.
5. A pharmaceutical composition comprising a pharmaceutically effective amount of the oncolytic virus according to claim 1 and optionally a pharmaceutically acceptable carrier.
6. The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition is formulated for intravenous, nebulized inhalation, perfusion, or intratumoral administration.
7. The pharmaceutical composition according to claim 5, comprising the oncolytic virus in an amount of about 10.sup.8 vp to 10.sup.12 vp.
8. A method for treating a proliferative disease, comprising administering the oncolytic virus according to claim 1 to a subject in need thereof, wherein the subject is a mammal, and the proliferative disease is a cancer.
9. A method for preventing or inhibiting metastasis of cancer cells, comprising administering the oncolytic virus according to claim 1 to a subject in need thereof, wherein the subject is a mammal.
10. A method for preventing cancer recurrence, comprising administering the oncolytic virus according to claim 1 to a subject in need thereof, wherein the subject is a mammal.
11. The method according to claim 8, wherein the oncolytic virus is administered to the subject in an amount of about 10.sup.8 vp to 10.sup.12 vp by intravenous, nebulized inhalation, perfusion, or intratumoral administration, with an administration number per treatment of 1-6, an administration interval of every 1, 2, 3, 4, 5, 6, 7 or more days, or 1, 2, 3, 4, 5, 6 or more times over the course of one day, and a treatment number of 1-12.
12. The method according to claim 8, wherein the cancer is selected from the group consisting of prostate cancer, breast cancer, colorectal cancer, lung cancer, liver cancer, melanoma, lymphoma, gastric cancer, esophageal cancer, ovarian cancer, head and neck squamous cell carcinoma, bladder cancer, glioma, cervical cancer, and kidney cancer.
13. The method according to claim 9, wherein the cancer is selected from the group consisting of prostate cancer, breast cancer, colorectal cancer, lung cancer, liver cancer, melanoma, lymphoma, gastric cancer, esophageal cancer, ovarian cancer, head and neck squamous cell carcinoma, bladder cancer, glioma, cervical cancer, and kidney cancer.
14. The method according to claim 10, wherein the cancer is selected from the group consisting of prostate cancer, breast cancer, colorectal cancer, lung cancer, liver cancer, melanoma, lymphoma, gastric cancer, esophageal cancer, ovarian cancer, head and neck squamous cell carcinoma, bladder cancer, glioma, cervical cancer, and kidney cancer.
15. The method according to claim 9, wherein the oncolytic virus is administered to the subject in an amount of about 10.sup.8 vp to 10.sup.12 vp by intravenous, nebulized inhalation, perfusion, or intratumoral administration, with an administration number per treatment of 1-6, an administration interval of every 1, 2, 3, 4, 5, 6, 7 or more days, or 1, 2, 3, 4, 5, 6 or more times over the course of one day, and a treatment number of 1-12.
16. The method according to claim 10, wherein the oncolytic virus is administered to the subject in an amount of about 10.sup.8 vp to 10.sup.12 vp by intravenous, nebulized inhalation, perfusion, or intratumoral administration, with an administration number per treatment of 1-6, an administration interval of every 1, 2, 3, 4, 5, 6, 7 or more days, or 1, 2, 3, 4, 5, 6 or more times over the course of one day, and a treatment number of 1-12.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION
(12) The term used in this application has the same meaning as in the prior art. In order to clearly explain the meaning of the terms used, the specific meanings of some terms in this application are given below. When the definition herein conflicts with the conventional meaning of the term, the definition herein shall prevail.
Definitions
(13) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present disclosure belongs. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the cell lines, vectors, and methods reported in the publications, which can be used in the present disclosure. Nothing can be considered admitted herein, and the present disclosure does not have the right to precede such disclosures based on previous inventions.
(14) The term oncolytic virus refers to a virus capable of selectively replicating in and slowing down the cell growth or inducing the death of a cancerous or hyperproliferative cell, while having no or minimal effect on normal cells. Exemplary oncolytic viruses include vesicular stomatitis virus (VSV), Newcastle disease virus (NDV), herpes simplex virus (HSV), reovirus, measles virus, retrovirus, influenza virus, Sinbis virus, vaccinia virus, and adenovirus (Reference could be made to Kirn et al., Nat. Med. 7:781 (2001); Coffey et al., Science 282: 1332 (1998); Lorence et al., Cancer Res. 54: 6017 (1994); and Peng et al., Blood 98: 2002 (2001)).
(15) The term interferon refers to a family of secreted proteins produced by a variety of eukaryotic cells after exposure to various environmental stimuli (including viral infection or exposure to mitogens). In addition to having antiviral properties, interferon has also been shown to affect a variety of cell functions. There are three main interferon, IFN-, IFN- and IFN-. Interferon was originally classified according to its cellular origin (leukocytes, fibroblasts or T cells). Leukocyte-derived interferon is currently called IFN-, fibroblast-derived interferon is IFN-, and T cell-derived interferon is IFN-.
(16) The term consensus interferon refers to a synthetic interferon whose amino acid sequence is roughly the average sequence of all known human interferon-a subtype sequences. It has been reported that consensus interferon has activities of antivirus, anti-proliferation and NK cell activation, which are better than (about 5 times) any natural human IFN- subtype. For an exemplary consensus interferon such as Infergen, reference could be made to the sequences disclosed in U.S. Pat. Nos. 4,695,623 and 4,897,471.
(17) The present disclosure can use interferon sequences known in the prior art. In a preferred embodiment, the present disclosure uses consensus interferon.
(18) The inventors of the present disclosure unexpectedly found that selection of a suitable nucleic acid coding sequence would affect the in vivo therapeutic effect of interferon protein. For the same interferon protein, such as consensus interferon, when carrying different interferon nucleic acid coding sequences, the oncolytic virus exhibits quite different oncolytic effect in vivo. The applicant also found that this difference in effect has nothing to do with biological codon preference, that is, this difference in effect is not caused by whether the codons that are most suitable for human expression are utilized. In one embodiment, when using codons suitable for prokaryotic expression (for example, the IFN-3 sequence shown in SEQ ID NO: 4), excellent and unexpected technical effects are also obtained.
(19) The coding sequence of the consensus interferon used in the present disclosure is as follows:
(20) TABLE-US-00002 IFN-1: (SEQIDNO:2) ATGGCCCTGTCCTTCAGCCTGCTGATGGCCGTGCTGGTGCTGAGCTACA AGTCCATCTGCTCCCTGGGCATGTGTGATCTGCCTCAGACACACTCCCT GGGCAATAGAAGGGCCCTGATCCTGCTGGCCCAGATGAGAAGGATCAGC CCCTTCTCCTGCCTGAAGGATAGACACGATTTTGGCTTCCCTCAGGAGG AGTTCGACGGCAATCAGTTTCAGAAGGCCCAGGCCATCTCCGTGCTGCA CGAGATGATCCAGCAGACCTTTAACCTGTTCTCCACAAAGGACTCCAGC GCCGCCTGGGACGAGTCCCTGCTGGAGAAGTTTTACACAGAGCTGTACC AGCAGCTGAACGATCTGGAGGCCTGCGTGATCCAGGAGGTGGGCGTGGA GGAGACCCCCCTGATGAATGTGGATTCCATCCTGGCCGTGAAGAAGTAC TTTCAGAGAATCACCCTGTACCTGACCGAGAAGAAGTACAGCCCTTGTG CCTGGGAGGTGGTGAGAGCCGAGATCATGAGATCCTTTTCCCTGAGCAC AAACCTGCAGGAGAGGCTGAGAAGGAAGGAGTGA; IFN-2: (SEQIDNO:3) ATGGCCCTGTCCTTCTCCCTGCTGATGGCCGTGCTGGTGCTGAGCTACA AGTCCATCTGCTCCCTGGGCATGTGCGACCTGCCTCAGACACACTCCCT GGGCAATAGGAGAGCCCTGATCCTGCTGGCCCAGATGAGGAGGATCTCC CCTTTTAGCTGCCTGAAGGATAGACACGATTTCGGCTTCCCTCAGGAGG AGTTCGATGGCAATCAGTTCCAGAAGGCCCAGGCCATCAGCGTGCTGCA CGAGATGATCCAGCAGACCTTCAATCTGTTTAGCACCAAGGACTCCAGC GCCGCCTGGGACGAGTCCCTGCTGGAGAAGTTCTACACCGAGCTGTACC AGCAGCTGAACGACCTGGAGGCCTGCGTGATCCAGGAGGTGGGCGTGGA GGAGACCCCTCTGATGAATGTGGATAGCATCCTGGCCGTGAAGAAGTAC TTTCAGAGAATCACACTGTACCTGACAGAGAAGAAGTACAGCCCCTGCG CCTGGGAGGTGGTGAGGGCTGAGATCATGAGGAGCTTTTCCCTGTCCAC AAACCTGCAGGAGAGGCTGAGAAGGAAGGAGTGA; IFN-3: (SEQIDNO:4) ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACA AATCCATCTGTTCTCTGGGCATGTGCGACCTGCCGCAGACCCACTCCCT GGGTAACCGTCGTGCTCTGATCCTGCTGGCTCAGATGCGTCGTATCTCC CCGTTCTCCTGCCTGAAAGACCGTCACGACTTCGGTTTCCCGCAGGAAG AATTCGACGGTAACCAGTTCCAGAAAGCTCAGGCTATCTCCGTTCTGCA CGAAATGATCCAGCAGACCTTCAACCTGTTCTCCACCAAAGACTCCTCC GCTGCTTGGGACGAATCCCTGCTGGAAAAATTCTACACCGAACTGTACC AGCAGCTGAACGACCTGGAAGCTTGCGTTATCCAGGAAGTTGGTGTTGA AGAAACCCCGCTGATGAACGTTGACTCCATCCTGGCTGTTAAAAAATAC TTCCAGCGTATCACCCTGTACCTGACCGAAAAAAAATACTCCCCGTGCG CTTGGGAAGTTGTTCGTGCTGAAATCATGCGTTCCTTCTCCCTGTCCAC CAACCTGCAGGAACGTCTGCGTCGTAAAGAATAA.
(21) The term pharmaceutical composition as used herein means a combination of at least one drug and optionally a pharmaceutically acceptable carrier or excipient that are combined together to achieve a particular purpose. In certain embodiments, the pharmaceutical composition includes combinations that are separated in time and/or space as long as they can work together to achieve the purpose of the present disclosure. For example, the components of the pharmaceutical composition may be administered to the subject as a whole or separately. When the ingredients contained in the pharmaceutical composition are separately administered to a subject, the ingredients may be administered to the subject simultaneously or sequentially. Preferably, the pharmaceutically acceptable carrier is water, a buffered aqueous solution, an isotonic saline solution such as PBS (phosphate buffered saline), glucose, mannitol, dextrose, lactose, starch, magnesium stearate, cellulose, magnesium carbonate, 0.3% glycerol, hyaluronic acid, or polyalkylene glycols such as polypropylene glycol, triglycerides and the like. The type of the pharmaceutically acceptable carrier used depends in particular on whether the composition according to the present disclosure is formulated for oral, nasal, intratumoral, perfusion, intradermal, subcutaneous, intramuscular, or intravenous administration. The composition according to the present disclosure may contain a lubricant, a preservative, a stabilizer, a wetting agent, an emulsifier, salts that affect osmotic pressure, a buffer, coloring substances, flavoring substances and/or aromatic substances, etc., as an additive.
(22) Administration or administering means to provide a substance, such as a pharmaceutical composition, to a subject in a pharmacologically acceptable manner.
(23) The dosage of a pharmaceutical composition provided to a subject refers to a dose sufficient to show its benefit to the administered subject, and may also be referred to herein as a pharmaceutical effective amount or effective amount. The actual amount administered, as well as the rate and time-course of administration, will depend on the condition and severity of the subject being treated. Prescription of treatment, e.g., decisions on dosage, etc., is ultimately within the responsibility of general practitioners and other medical doctors and relies on decisions of them, and typically takes account of the disease being treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to physicians.
(24) In one embodiment of the present disclosure, the pharmaceutical composition comprises the oncolytic virus in an amount of 10.sup.8 vp to 10.sup.12 vp, such as 110.sup.8, 1.510.sup.8, 210.sup.8, 2.510.sup.8, 310.sup.8, 3.510.sup.8, 410.sup.8, 4.510.sup.8, 510.sup.8, 5.510.sup.8, 610.sup.8, 6.510.sup.8, 710.sup.8, 7.510.sup.8, 810.sup.8, 8.510.sup.8, 910.sup.8, 9.510.sup.8, 110.sup.9, 1.510.sup.9, 210.sup.9, 2.510.sup.9, 310.sup.9, 3.510.sup.9, 410.sup.9, 4.510.sup.9, 510.sup.9, 5.510.sup.9, 610.sup.9, 6.510.sup.9, 710.sup.9, 7.510.sup.9, 810.sup.9, 8.510.sup.9, 910.sup.9, 9.510.sup.9, 110.sup.10, 1.510.sup.10, 210.sup.10, 2.510.sup.10, 310.sup.10 3.510.sup.10, 410.sup.10, 4.510.sup.10, 510.sup.10, 5.510.sup.10, 610.sup.10, 6.510.sup.10, 710.sup.10, 7.510.sup.10, 810.sup.10, 8.510.sup.10, 910.sup.10, 9.510.sup.10, 110.sup.11, 1.510.sup.11, 210.sup.11, 2.510.sup.11, 310.sup.11, 3.510.sup.11, 410.sup.11, 4.510.sup.11, 510.sup.11, 5.510.sup.11, 610.sup.11, 6.510.sup.11, 710.sup.11, 7.510.sup.11, 810.sup.11, 8.510.sup.11, 910.sup.11, 9.510.sup.11 or 110.sup.12 vp, and any dosage between the above two.
(25) In another embodiment, a single dose of the oncolytic virus administered to the subject is in an amount of 10.sup.8 vp to 10.sup.12 vp, such as 110.sup.8, 1.510.sup.8, 210.sup.8, 2.510.sup.8, 310.sup.8, 3.510.sup.8, 410.sup.8, 4.510.sup.8, 510.sup.8, 5.510.sup.8, 610.sup.8, 6.510.sup.8, 710.sup.8, 7.510.sup.8, 810.sup.8, 8.510.sup.8, 910.sup.8, 9.510.sup.8, 110.sup.9, 1.510.sup.9, 210.sup.9, 2.510.sup.9, 310.sup.9, 3.510.sup.9, 410.sup.9, 4.510.sup.9, 510.sup.9, 5.510.sup.9, 610.sup.9, 6.510.sup.9, 710.sup.9, 7.510.sup.9, 810.sup.9, 8.510.sup.9, 910.sup.9, 9.510.sup.9, 110.sup.10, 1.510.sup.10, 210.sup.10, 2.510.sup.10, 310.sup.10, 3.510.sup.10, 410.sup.10, 4.510.sup.10, 510.sup.10, 5.510.sup.10, 610.sup.10, 6.510.sup.10, 710.sup.10, 7.510.sup.10, 810.sup.10, 8.510.sup.10, 910.sup.10, 9.510.sup.10, 110.sup.11, 1.510.sup.11, 210.sup.11, 2.510.sup.11, 310.sup.11, 3.510.sup.11, 410.sup.11, 4.510.sup.11, 510.sup.11, 5.510.sup.11, 610.sup.11, 6.510.sup.11, 710.sup.11, 7.510.sup.11, 810.sup.11, 8.510.sup.11, 910.sup.11, 9.510.sup.11 or 110.sup.12 vp, and any dosage between the above two. The administration number per course of treatment is 1-6, for example, 1, 2, 3, 4, 5 or 6, and the administration interval can be 1-7 days, for example, 1, 2, 3, 4, 5, 6, 7 days.
(26) In the present disclosure, the unit of virus dose is vp (viral particle), which represents the number of virus particles contained in the virus solution, and is virus particle titer.
(27) The term subject as used herein means animals, including warm-blooded mammals such as human and primate; birds; domesticated domestic or farm animals such as cats, dogs, sheep, goats, cattle, horses and pigs; laboratory animals such as mice, rats and guinea pigs; fish; reptiles; zoo animals and wild animals, etc.
(28) It should also be noted that if a specific numerical value is mentioned herein, at least that value will be included, unless the context clearly indicates that it refers otherwise. When a numerical value represents an approximate value, it should be understood that the specific numerical value forms another embodiment. As used herein, about X (where X is a number) means10% (inclusive) of the listed value. If present, all ranges are inclusive and combinable.
(29) Terms such as comprising, including, and containing as used herein are not intended to be limiting. In addition, unless otherwise indicated, or means and/or.
(30) Unless otherwise specified, any component, element, attribute or step disclosed in an embodiment of the method and product can be applied to any other method and product disclosed herein.
(31) Each patent, patent application, cited publication, or description in this document of this disclosure is incorporated herein by reference in its entirety.
(32) The present disclosure is further defined in the following examples. It should be understood that these examples are provided for illustration only and are not intended to limit the scope of the present disclosure. From the above discussion and these examples, those skilled in the art can determine the essential characteristics of the present disclosure, and make various changes and modifications to the present disclosure to adapt it to various usages and conditions without departing from the spirit and scope of the present disclosure.
(33) Materials and Methods
(34) I. Construction of recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B, rAd-IFN-2-SP-E1A(24 bp)-E1B and rAd-IFN-3-SP-E1A(24 bp)-E1B
(35) The construction process of the above three viruses is similar, where the difference lies in the coding sequence of the consensus interferon used in the construction. The rAd-IFN-1-SP-E1A(24 bp)-E1 construct used the coding sequence shown in SEQ IN NO: 2, the RAd-IFN-2-SP-E1A(24 bp)-E1 construct used the coding sequence shown in SEQ ID NO: 3, and the rAd-IFN-3-SP-E1A(24 bp)-E1 construct used the coding sequence shown in SEQ ID NO: 4. Taking the construction process of rAd-IFN-3-SP-E1A(24 bp)-E1 as an example, a construction process of an recombinant oncolytic adenovirus is described in detail below, and the other two oncolytic adenovirus constructs can be constructed just by replacing the coding sequence of consensus interferon in rAd-IFN-3-SP-E1A(24 bp)-E1 with the other two sequences.
(36) i. Construction of Recombinant Plasmid pShuttle-IFN-3-SP-E1A(24 bp)-E1B
(37) A nucleotide sequence with NotI restriction site at 5 end and XbaI restriction site at 3 end (as shown in SEQ ID NO: 5) was synthesized by commissioning gene synthesis company, and the coding sequence of consensus interferon is shown in SEQ ID NO: 4.
(38) TABLE-US-00003 (SEQIDNO:5) ataagaatgcggccgcctcgactaattccctggcattatgcccagtaca tgaccttatgggactttcctacttggcagtacatctacgtattagtcat cgctattaccatggtgatgcggttttggcagtacatcaatgggcgtgga tagcggtttgactcacggggatttccaagtctccaccccattgacgtca atgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcg taacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgg gaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctgga gacgccatccacgctgttttgacctccatagaagacaccgggaccgatc cagcctggggatcttcgagtcgtcaagcttgaattcgatccccgggctg caggaattcccaatactatggccctgtccttttctttactgatggccgt gctggtgctcagctacaaatccatctgttctctgggcatgtgcgacctg ccgcagacccactccctgggtaaccgtcgtgctctgatcctgctggctc agatgcgtcgtatctccccgttctcctgcctgaaagaccgtcacgactt cggtttcccgcaggaagaattcgacggtaaccagttccagaaagctcag gctatctccgttctgcacgaaatgatccagcagaccttcaacctgttct ccaccaaagactcctccgctgcttgggacgaatccctgctggaaaaatt ctacaccgaactgtaccagcagctgaacgacctggaagcttgcgttatc caggaagttggtgttgaagaaaccccgctgatgaacgttgactccatcc tggctgttaaaaaatacttccagcgtatcaccctgtacctgaccgaaaa aaaatactccccgtgcgcttgggaagttgttcgtgctgaaatcatgcgt tccttctccctgtccaccaacctgcaggaacgtctgcgtcgtaaagaat aaggatccatcgagcaacttgtttattgcagcttataatggttacaaat aaagcaatagcatcacaaatttcacaaataaagcatttttttcactgca ttctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgg atcgtgtcgagcgcgttctttgaaagcagtcgagggggcgctaggtgtg ggcagggacgagctggcgcggcgtcgctgggtgcaccgcgaccacgggc agagccacgcggcgggaggactacaactcccggcacaccccgcgccgcc ccgcctctactcccagaaggccgcggggggggaccgcctaagagggcgt gcgctcccgacatgccccgcggcgcgccattaaccgccagatttgaatc gccggacccgttggcagaggtggcggcggcggcatacgtactgaaaatg agacatattatctgccacggaggtgttattaccgaagaaatggccgcca gtcttttggaccagctgatcgaagaggtactggctgataatcttccacc tcctagccattttgaaccacctacccttcacgaactgtatgatttagac gtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttc ccgactctgtaatgttggcggtgcaggaagggattgacttactcacttt tccgccggcgcccggttctccggagccgcctcacctttcccggcagccc gagcagccggagcagagagccttgggtccggtttctatgccaaaccttg taccggaggtgatcgatccacccagtgacgacgaggatgaagagggtga ggagtttgtgttagattatgtggagcaccccgggcacggttgcaggtct tgtcattatcaccggaggaatacgggggacccagatattatgtgttcgc tttgctatatgaggacctgtggcatgtttgtctacagtaagtgaaaatt atgggcagtgggtgatagagtggtgggtttggtgtggtaattttttttt taatttttacagttttgtggtttaaagaattttgtattgtgattttttt aaaaggtcctgtgtctgaacctgagcctgagcccgagccagaaccggag cctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagac gcccgacatcacctgtgtctagagc.
(39) The nucleic acid fragment shown in SEQ ID NO: 5 was subjected to double restriction digestion with NotI and XbaI, followed by recovering the digested fragment. The restriction digestion system is as follows:
(40) TABLE-US-00004 DNA fragment shown in SEQ ID NO: 5 10 L NotI 0.5 L XbaI 0.5 L 10 Buffer 2 L ddH.sub.2O 7 L Total 20 L
(41) The above reaction system was placed in a 37 C. water bath for 2 hours.
(42) Construction of pShuttle-E1A-E1B Plasmid
(43) The pShuttle plasmid (Shanghai Jiran Biotechnology Co., Ltd.) and the adenovirus vector pXC2 plasmid (a gift from Academician Liu Xinyuan, Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were subjected to double restriction digestion with XhoI and MfeI, and the restriction digestion systems are as follows:
(44) TABLE-US-00005 Double restriction digestion system with XhoI and MfeI for pShuttle pShuttle 10 L XhoI 0.5 L MfeI 0.5 L 10 Buffer 2 L ddH.sub.2O 7 L Total 20 L
(45) TABLE-US-00006 Double restriction digestion system with XhoI and MfeI for pXC2 pXC2 10 L XhoI 0.5 L Mfel 0.5 L 10 Buffer 2 L ddH.sub.2O 7 L Total 20 L
(46) The above reaction system was placed in a 37 C. water bath for 2 h, and then subjected to agarose gel electrophoresis to recover the large fragment digested from pShuttle plasmid and the small fragment digested from pXC2 plasmid. Then the above recovered products were ligated using ligase to construct pShuttle-E1A-E1B plasmid, and the ligation system is as follows:
(47) TABLE-US-00007 Linearized pShuttle plasmid 4 L Linearized pXC2 plasmid 2 L Ligation High 4 L Total 10 L
(48) The above reaction system was placed in a water bath at 16 C. for 2 hours, and the ligation product obtained was pShuttle-E1A-E1B.
(49) The plasmid pShuttle-E1A-E1B was subjected to double restriction digestion with NotI and XbaI, followed by recovering the digested large fragment (vector fragment). Then the digested nucleic acid fragment and vector fragment were ligated using Ligation High ligase (TOYOBO). The ligation system is as follows:
(50) TABLE-US-00008 Digested pShuttle-E1A-E1B plasmid fragment 0.5 L Digested nucleic acid fragment 5.5 L Ligation High 4 L Total 10 L
(51) The above reaction system was placed in a water bath at 16 C. for 2 hours, and the ligation product obtained was pShuttle-IFN-3-SP-E1A(24 bp)-E1B.
(52) ii. Construction of Recombinant Plasmid pAd-IFN-3-SP-E1A(24 bp)-E1B
(53) 1. pShuttle-IFN-3-SP-E1A(24 bp)-E1B was subjected to single restriction digestion with PmeI enzyme for linearization, and the reaction system is as follows:
(54) TABLE-US-00009 pShuttle-IFN-3-SP-E1A(A24bp)-E1B 8 L PmeI 1 L 10 Buffer 2 L ddH.sub.2O 9 L Total 20 L
(55) The above reaction system was placed in a 37 C. water bath for 1 hour, followed by dephosphorylation reaction.
(56) 2. FastAp was used to dephosphorylate the linearized pShuttle-IFN-3-SP-E1A(24 bp)-E1B plasmid in step 1, and the reaction system is as follows:
(57) TABLE-US-00010 Linearized pShuttle-IFN-3-SP-E1A(A24bp)-E1B 8 L FastAp 1 L 10 Buffer 2 L ddH.sub.2O 9 L Total 20 L
(58) The above reaction system was placed in a 37 C. water bath for 1 hour, followed by transformation.
(59) 3. The adenovirus backbone plasmid was recombined with linearized pShuttle-IFN-3-SP-E1A(24 bp)-E1B in BJ5183 competent cells to generate the recombinant plasmid pAd-IFN-3-SP-E1A(24 bp)-E1B. The specific steps are as follows:
(60) (1) The linearized pShuttle-IFN-3-SP-E1A(24 bp)-E1B in the previous step was transformed into BJ5183 competent cells and then the cells were spread on the plate. Afterward, several single colonies were picked and cultured overnight with shaking.
(61) (2) The plasmid was extracted from the cultured bacterial cells using a plasmid extraction kit.
(62) The preparation method of BJ5183 competent cells can be found in Chinese patent application No. CN201810651914.2, which is briefly described as follows.
(63) The plasmid pBHGE3 (purchased from Shanghai Gemple biotech Co., Ltd.) was subjected to restriction digestion with HindIII, while the plasmid pAdEasy-1 (purchased from Shanghai Jiran Biotechnology Co., Ltd.) was subjected to restriction digestion with SpeI, and the above two digested plasmids were then co-transformed into E. coli BJ5183 for homologous recombination to generate a recombinant adenovirus backbone plasmid carrying E3 region. Then, the recombinant adenovirus backbone plasmid was transformed into E. coli DH5 for amplification to generate the recombinant adenovirus backbone plasmid. Next, the recombinant adenovirus backbone plasmid was transformed into E. coli BJ5183 competent cells to generate the E. coli BJ5183 carrying the recombinant adenovirus backbone plasmid. Finally, the E. coli cells were prepared into a competent cell, which was used as the BJ5183 competence cells in step (1).
(64) 4. Restriction digestion identification.
(65) The recombinant plasmid pAd-IFN-3-SP-E1A(24 bp)-E1B was transformed into E. coli DH5 competent cells, and then the cells were spread on the plate. Afterward, several single colonies were picked and cultured with shaking. The plasmid was extracted from the cultured bacterial cells for restriction digestion identification. The restriction digestion system is as follows:
(66) TABLE-US-00011 pAd-IFN-3-SP-E1A(A24bp)-E1B 8 pL MluI 1 L 10 Buffer 2 L ddH.sub.2O 9 L Total 20 L
(67) The above reaction system was placed in a 37 C. water bath for 30 min, and then subjected to electrophoresis identification.
(68) iii. Packaging of Recombinant Virus rAd-IFN-3-SP-E1A(24 bp)-E1B
(69) 1. Cell culture
(70) HEK-293 cells were cultured in a 6-well plate and allowed to reach 60%-80% confluence the next day.
(71) 2. The recombinant plasmid pAd-IFN-3-SP-E1A(24 bp)-E1B was subjected to restriction digestion with PacI for linearization, and the reaction system is as follows:
(72) TABLE-US-00012 pAd-IFN-3-SP-E1A(A24bp)-E1B 1 ug PacI 1 L 10 Buffer 2 L ddH.sub.2O up to 20 L
(73) 3. Plasmid transfection and virus packaging
(74) According to the instruction of Effectene Transfection Reagent kit, 1 g of the recombinant plasmid pAd-IFN-3-SP-E1A(24 bp)-E1B linearized in step 2 was transfected into the HEK-293 cells seeded in the 6-well plate of step 1. After about 7-10 days, when the cells were completely broken, the supernatant containing viruses was collected and stored at 80 C. for later use.
(75) iv. Titer Determination of Recombinant Virus
(76) The principle of virus titer determination is to determine the number of viruses with infectious activity based on the number of hexon-stained positive cells by immunocytochemistry. According to the instructions of the adenovirus titer kit, the virus titer of the amplified and purified adenovirus was determined.
(77) II. Detection of the Functions of Recombinant Oncolytic Adenovirus
(78) i. Western Blot Detection of Target Protein Expression
(79) 1. Cell Infection and Sample Harvest
(80) MDA-MB-231 cells were cultured in a 6-well plate with 5105 cells per well in a CO2 incubator. In the next day, the MDA-MB-231 cells were infected with an no-load control virus rAd-SP-E1A(24 bp)-E1B and recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B, rAd-IFN-2-SP-E1A(24 bp)-E1B, and rAd-IFN-3-SP-E1A(24 bp)-E1B respectively at an inoculation ratio of 10 MOI. one well for each infection, followed by culturing in a CO2 incubator for 24 hours. The supernatant was discarded, and 100 l RIPA Lysis Buffer per well was added to lyse cells. The lysate was collected as a test sample.
(81) 2. Pretreatment of Protein Sample
(82) BCA protein quantification kit (purchased from Thermo) was used to determine the protein concentration of each sample collected in step 1, and specific procedures can be found in the kit's instruction manual. Then RIPA Lysis Buffer was used to adjust the concentration of each sample according to the measurement to make the protein concentration in all samples consistent. Next, an appropriate volume of 5SDS loading buffer (purchased from Beyotime) was added to each sample to make the final concentration as 1. The samples were mixed well and placed in a metal bath at 100 C. for 10 min. The samples were directly used for Western analysis or stored in a refrigerator at 20 C.
(83) 3. Western Blot Analysis
(84) SDS-PAGE gel electrophoresis was performed with a loading amount of 20 g of each pre-treated protein per slot. The proteins in the gel were transferred to PVDF membrane by using Biorad electrophoresis apparatus. The membrane was blocked with 5% non-fat milk for 30 min, and then incubated with rIFN antibody (HuaBio) and -tubulin antibody (purchased from CoWin Biosciences) diluted to working concentration overnight at 4 C. with shaking. Afterward, the primary antibody was discarded and the membrane was washed 3 times with PBST buffer, and then the corresponding secondary antibody (purchased from Beyotime) diluted to the working concentration was added. The membrane was subsequently incubated with the secondary antibody for 2 h at room temperature with shaking. Afterward, the secondary antibody was discarded and the membrane was washed 3 times with PBST buffer. ECL luminescent chromogenic kit (purchased from Yeasen) was used to develop the color, and specific procedures can be found in the kit's instruction manual.
(85) ii. Detection of MHC I Expression Regulated by Interferon.
(86) 1. Cell Culture and Virus Inoculation
(87) SW780 cells and MCF-7 cells were cultured in 24-well plates at a density of 1.510.sup.5 cells per well, 500 l/well, in a CO.sub.2 incubator. The next day, the cells were infected with no-load control virus rAd-SP-E1A(24 bp)-E1B and recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B, rAd-IFN-2-SP-E1A(24 bp)-E1B, and rAd-IFN-3-SP-E1A(24 bp)-E1B respectively at an inoculation ratio of 1 MOI, with an inoculation volume is 100 l/well. In addition, a blank control group without virus (PBS group) was set up for each cell type. After treatment, the plates were shaken gently to mix well and cultured in a CO.sub.2 incubator for 24 h.
(88) 2. Sample Treatment and Flow Cytometry Analysis
(89) The supernatants of the cells after 24 hours treatment as described above were discarded. Then the cells were washed once with 1PBS and 200 l/well of digestion solution Accutase was added. After all the cells became round and detached after gently shaking, 800 l of 1PBS was added, and the cells were pipetted 5 times repeatedly. The cell mixture was transferred to a 1.5 ml EP tube followed by centrifugation at 1,500 rpm for 5 min. Afterward, the supernatant was discarded, and 1 ml of 1PBS was added to wash and centrifuge again. Then, for each sample, 60 l of antibody working solution (1 l antibody stock solution in 240 l 1PBS) was added to the cells after washing and centrifugation. After mixing well, the cells were stained for 30 min in dark at room temperature. The unstained cells were as a negative control. After staining, the cells were washed with 1PBS and centrifuged once. The cells were fixed with 2% PFA at room temperature for 10 min and flow cytometry analysis (according to the instructions of instrument) was performed with a loading volume of 50 l/sample.
(90) iii. Determination of Virus Replication Ratio
(91) 1. Cell Culture and Virus Inoculation
(92) The breast cancer cell line MDA-MB-231 and normal breast cell line MCF-10A were cultured in a 6-well plate at a density of 1.210.sup.6 and 810.sup.5 cells/well respectively, 2 ml/well, in a CO.sub.2 incubator until the next day. Then, the cells were infected with recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B, rAd-IFN-2-SP-E1A(24 bp)-E1B, and rAd-IFN-3-SP-E1A(24 bp)-E1B respectively at an inoculation ratio of 1 MOI, with an inoculation volume of 100 l/well, triplicates for each type of virus. After treatment, the plates were shaken gently to mix well and cultured in a CO.sub.2 incubator for 72 h.
(93) 2. Sample Harvest, Pretreatment and Aliquoting
(94) The 6-well plate cultured with the cells and treated for 72 hours was sealed with parafilm around, and stored in a 80 C. refrigerator. Three freeze-thaw cycles were carried out from 80 C. to room temperature. After the third thawing, the cells were pipetted off and mixed well with culture medium. Considering the liquid evaporation during the culture process, the total volume of the sample in each well needed to be made up to 2 ml with culture medium in the end. The samples were mixed well and divided into 3 aliquots (one for titer detection, and two for later use), and then stored at 80 C.
(95) 3. Titer Determination and Calculation of Virus Replication Ratio
(96) One of the above aliquots was used for titer detection by QuickTiter Adenovirus Titer Immunoassay Kit from Cell Biolabs. The principle of this detection is to determine the number of viruses with infectious activity based on the number of hexon-stained positive cells by immunocytochemistry. The specific protocols are as follows:
(97) (1) 293A cells were seeded in a 24-well plate (1 ml/well) at a density of 2.510.sup.5 cells/well. After the cells were attached to the wall (approximately 24 h), 100 l of virus to be tested after gradient dilution was added to each well. The well without virus was used as a blank control, and two duplicate wells were set for each gradient. Then the cells were cultured under a condition of 37 C. and 5% CO.sub.2.
(98) (2) After culture for 2 days, in a biological safety hood, the supernatant in the 24-well plate was discarded using a pipet, then 500 l/well of methanol pre-cooled at 20 C. was added to each well. Afterward, the plate was placed in a refrigerator at 20 C. for 20 min.
(99) (3) The cells were washed gently with 1PBS 3 times, and blocked with 1% BSA for 1 h.
(100) (4) 1% BSA was discarded, and the pre-diluted primary antibody anti-Hexon was added at 250 l/well and incubated for 1 h at room temperature.
(101) (5) The cells were washed gently with 1PBS 3 times, and the pre-diluted secondary antibody (HRP) was added at 250 l/well and incubated for 1 h at room temperature.
(102) (6) The cells were washed gently with 1PBS 3 times, and 1DAB working solution was added to stain for 15 min at room temperature.
(103) (7) The cells were washed gently with 1PBS twice, and 1PBS was added at 200 1/well to prevent the cells from drying out.
(104) (8) A microscope setting to 10 objective lens and 10 eyepiece lens was used to take pictures. Nine fields were selected for each well (upper, lower, left, right, upper left, lower left, upper right, lower right, and center) for taking pictures.
(105) (9) The number of virus units in each field of view under the corresponding dilution gradient was counted, and the gradient of about 50 virus units per field was regarded as the optimal counting gradient. If it is assumed that the average number of positive points in each field obtained by actual counting is Y, then the virus titer (IFU/ml) is: 135.2Ydilution factor.
(106) The titer value of each sample multiplied by the total sample volume of 2 ml is the total yield of each sample well. Finally, the replication factor of each sample was calculated, and the virus replication ratio=total yield (total amount)/initial inoculation amount.
(107) iv. Detection of the Safety of Oncolytic Virus by Crystal Violet Method
(108) The cells were seeded in a 24-well plate. One day later, the cells were infected with the recombinant adenovirus to be tested at appropriate MOI. After 4 days of culture at 37 C., the culture medium was discarded, and 500 L of crystal violet staining solution (2% crystal violet in 20% methanol solution) was added to each well to stain for 30 min, and then the excess staining solution was washed away with clean water. Pictures were taken after the plate became dry.
(109) v. In Vivo Drug Efficacy Test
(110) SW620 Xenograft Tumor Model in Nude Mice
(111) When the experimental nude mice reached 6 weeks old, they were injected with 110.sup.6 SW620 cells for tumor formation. When the tumor sizes were about 80-100 mm.sup.3 and the mice were in normal condition, the mice were randomly divided into three groups, namely PBS group, rAd-IFN-3-SP-E1A(24 bp)-E1B group and Ad-IFN-3-SP-E1A(24 bp)-E1B group. Mice in each group were all injected intratumorally with the desired virus at a dose of 1.510.sup.10 vp/mouse/time, once every other day and a total of 4 times. The tumor size was observed and measured every 3 days.
(112) MDA-MB-231 Xenograft Tumor Model in Nude Mice
(113) When the experimental nude mice reached 5 weeks old, they were injected with 210.sup.6 MDA-MB-231 cells for tumor formation. When the tumor sizes were about 80-100 mm.sup.3 and the mice were in normal condition, the mice were randomly divided into three groups, namely PBS group (intratumoral administration, once every other day, a total of 4 times), positive drug sorafenib group (gavage, single dose of 30 mg/kg, once every day for 14 days) and rAd-IFN-3-SP-E1A(24 bp)-E1B group (intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 4 times), with each group of 8 mice. The tumor size was observed and measured every 3 days.
(114) HCC827xenograft Tumor Model in Nude Mice
(115) When the experimental nude mice reached 5 weeks old, they were injected with 210.sup.6 HCC827 cells for tumor formation. When the tumor sizes were about 80-100 mm.sup.3 and the mice were in normal condition, the mice were randomly divided into four groups, namely PBS group (n=8, intratumoral administration, once every other day, a total of 4 times), positive drug sorafenib group (n=5, gavage, a dose of 30 mg/kg, once every day for 14 days), positive drug gemcitabine group (n=5, tail vein injection, a dose of 120 mg/kg, once every 4 days, a total of 4 times) and rAd-IFN-3-SP-E1A(24 bp)-E1B group (n=5, intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 4 times). The tumor size was observed and measured every 3 days.
(116) HCC1806xenograft Tumor Model in Nude Mice
(117) When the experimental nude mice reached 5 weeks old, they were injected with 210.sup.6 HCC1806 tumor cells for tumor formation. When the tumor sizes were about 80-100 mm3 and the mice were in normal condition, the mice were randomly divided into five groups, namely, virus preservation solution (vehicle) group (n=5, intratumoral administration, once every other day, a total of 5 times), recombinant interferon rIFN (20 g/mouse/time) group (n=5, intraperitoneal injection, once every other day, a total of 5 times), no-load oncolytic virus rAd-SP-E1A(24 bp)-E1B group (n=5, intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 5 times), a combination of no-load oncolytic virus and recombinant interferon rIFN+rAd-SP-E1A(24 bp)-E1B group (n=5; for no-load oncolytic virus: intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 5 times; for rIFN: intraperitoneal injection, once every other day, a total of 5 times), and recombinant oncolytic virus rAd-IFN-1-SP-E1A(24 bp)-E1B group (n=5, intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 5 times). The first administration of oncolytic virus was the day of grouping, and the first administration of recombinant interferon was the second day of grouping. The tumor size was observed and measured every 3 days after administration of oncolytic virus.
(118) HCC827 Xenograft Tumor Model in Mice with Humanized Immune System
(119) This experiment was completed by commissioning PharmaLegacy Biomedical Technology (Shanghai) Co., Ltd. The CD34.sup.+ humanized mice prepared by PharmaLegacy were used in this experiment. The animals were specific pathogen free (SPF) mice, about 22-23 weeks old, which have been identified as mice with humanized immune system (the proportion of human CD45.sup.+ cell was greater than 15%). Each mouse was injected with 210.sup.6 HCC827 tumor cells on both sides for tumor formation. When the size of tumors on the right side was about 80-100 mm.sup.3 and the mice were in a healthy constitution, the mice were randomly divided into four groups, namely vehicle group (virus cryopreservation solution, n=6, intratumoral administration, once every other day, a total of 5 times), positive drug Gemcitabine group (Gemzar Gemcitabine, n=6, tail vein injection, a dose of 120 mg/kg, once every 4 days, a total of 4 times), positive control PD-1 antibody group (a gift from Lyvgen Biopharma (Shanghai) Co., Ltd., n=6, intraperitoneal injection, a dose of 10 mg/kg, 2 times a week, a total of 6 times) and rAd-IFN-3-SP-E1A(24 bp)-E1B group (n=6, intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 5 times). Tumors were formed on both sides but only the right side was administered with drugs. The tumor size was observed and measured twice a week.
(120) PDX (Patient Derived Xenograft) Model in Nude Mice
(121) This experiment was completed by commissioning Shanghai Lide Biotech Co., Ltd. The tumor tissues from one case of triple negative breast cancer, one case of lung squamous carcinoma and one case of lung adenocarcinoma were cut into tumor tissues pieces with a size of about 3 mm3 mm3 mm (about 50-90 mg) for constructing PDX models. 5-week-old nude mice were inoculated with the tumor pieces subcutaneously. The mice after inoculation were observed and monitored for the tumor growth. When the average tumor volume of tumor-bearing mice reached about 150 mm.sup.3, the mice were grouped and administered for observation. Mice in each PDX model were randomly divided into 2 groups with 3 mice in each group. One group was vehicle group (virus cryopreservation solution, intratumor administration, once every other day, a total of 5 times), and the other group is rAd-IFN-1-SP-E1A(24 bp)-E1B group (intratumoral administration, a dose of 1.510.sup.10 vp/mouse/time, once every other day, a total of 5 times). The tumor size was observed and measured twice a week.
(122) III. Single Cell Yield Test in Medium-Scale Production
(123) The subcultured HEK-293 cells were cultured with DMEM medium (containing 10% FBS) for expansion into seventeen T175 culture flasks (purchased from Corning), taking care to keep the cells in each flask evenly distributed. Before virus inoculation, the medium in one T175 culture flask was discarded, and 5 ml of trypsin was added for digestion and then the cells were collected. The cell concentration was determined by a cell counter after appropriate dilution of cells, so that the number of cells in one T175 culture flask at this time point could be calculated. The recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B and rAd-IFN-3-SP-E1A(24 bp)-E1B were subjected to VP measurement (HPLC method) for the concentration of virus. Cells in T175 culture flasks were inoculated with one of the two oncolytic adenoviruses to be tested at a virus/cell ratio of 400:1 or 800:1, each group has four flasks for a total of 16 T175 culture flasks, making sure the groups were labeled. After 42 h of culture in a CO.sub.2 incubator, cells of two T175 flasks in each group were harvested, and after 54 hours of culture, cells of the remaining two T175 flasks in each group were harvested. Upon harvesting, the culture medium in the flasks was collected as a supernatant sample. Then 5 ml of virus preservation solution was added to each flask, and all the cells were scraped into 15 ml centrifuge tubes as a cell sample. Each cell sample was subjected to three freeze-thaw cycles from 80 C. to room temperature, followed by centrifugation. 2 ml of the supernatant was used for VP measurement. Based on the sum of the VP measurement results of the supernatant sample and the cell sample, the total yield of cells in each group was obtained, which was divided by the number of cells at the time of inoculation to obtain the single cell yield of each group.
Example 1 Construction of Recombinant Oncolytic Adenovirus Carrying Consensus Interferon Gene
(124) The structure and construction method of a recombinant oncolytic adenovirus carrying consensus interferon gene are as follows. First, on the back bone of wild-type adenovirus, the 24 base pairs (364-387 bp) of the E1A protein encoding gene responsible for encoding amino acids 122-129 of E1A protein were deleted. After deletion of the above-mentioned fragments, E1A protein cannot bind to Rb protein, which prevents the release of E2F which promotes the host cell to enter cell cycle. The virus undergoing the above modifications can only selective replicate in tumor cells with dysfunctional Rb protein. Then, the wild-type promoter of E1A gene was replaced with a tumor-specific survivin promoter, which further enhances the safety and targeting of the adenovirus. The expression cassette of consensus interferon protein (Infergen) (as shown in SEQ ID NOs: 2, 3 and 4) was inserted into the above-mentioned adenovirus vector to generate a recombinant oncolytic adenovirus carrying the consensus interferon gene rAd-IFN-1-SP-E1A(24 bp)-E1B (containing the expression cassette shown in SEQ ID NO: 2), rAd-IFN-2-SP-E1A(24 bp)-E1B (containing the expression cassette shown in SEQ ID NO: 3), or rAd-IFN-3-SP-E1A(24 bp)-E1B (containing the expression cassette shown in SEQ ID NO: 4).
(125) The above three types of viruses were deposited at China Center for Type Culture Collection (Wuhan, China). The specific deposit information is as follows:
(126) (1) Deposit date: Dec. 12, 2018. Deposit name: Recombinant Human Type 5 Adenovirus rAd-IFN-3-SP-E1A(24 bp)-E1B. Accession number: CCTCC NO: V201871.
(127) (2) Deposit date: Aug. 26, 2019. Deposit name: Recombinant Human Type 5 Adenovirus rAd-IFN-1-SP-E1A(24 bp)-E1B. Accession number: CCTCC NO: V201957.
(128) (3) Deposit date: Aug. 26, 2019. Deposit name: Recombinant Human Type 5 Adenovirus rAd-IFN-2-SP-E1A(24 bp)-E1B. Accession number: CCTCC NO: V201958.
(129) In addition, an no-load virus rAd-SP-E1A(24 bp)-E1B without rIFN expression cassette was also constructed as a control. The structure of the above virus constructs are shown in
Example 2 Expression Level and Function Analysis of Target Protein of Recombinant Oncolytic Adenoviruses
(130) In order to compare the expression ability of the recombinant oncolytic adenoviruses carrying different consensus interferon expression cassettes constructed in Example 1, that is, the ability to express the consensus interferon rIFN protein, the human breast cancer cell line MDA-MB-231 cells were infected with 10 MOI rAd-IFN-1-SP-E1A(24 bp)-E1B, rAd-IFN-2-SP-E1A(24 bp)-E1B, and rAd-IFN-3-SP-E1A(24 bp)-E1B, respectively. After 24 hours of infection, cells were lysed to collect protein samples for Western Blotting analysis.
(131) The results are shown in
(132) Next, whether the rIFN protein expressed by viruses has normal functions was tested. Since interferon can up-regulate the expression of type I major histocompatibility complex (MHC I, also known as HLA-ABC), the change in the expression of MHC I was employed as a standard to compare the functions of the exogenous recombinant interferon rIFN expressed by each recombinant oncolytic adenovirus.
(133) The human bladder cancer SW780 cells were infected with 1 MOI recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B, rAd-IFN-2-SP-E1A(24 bp)-E1B and rAd-IFN-3-SP-E1A(24 bp)-E1B respectively. After 24 hours of infection, cells were collected and then stained for flow cytometry analysis. The results are shown in
Example 3 Tumor Targeting Test of Recombinant Oncolytic Adenoviruses
(134) As described in Example 1, the all three recombinant oncolytic adenoviruses had undergone replication-targeted modification to replicate only in tumor cells. The effectiveness of targeting tumor cells for replication is closely related to the actual clinical therapeutic effect of oncolytic viruses. In this example, the replication ability of each recombinant oncolytic adenovirus in the breast cancer cell line MDA-MB-231 and normal breast cell line MCF-10A was tested.
(135) In this example, the replication ability of a virus was measured by virus replication ratio and targeting replication coefficient. Virus replication ratio refers to a ratio of the number of progeny viruses produced by host cells after being infected with the oncolytic adenovirus for a certain period of time to the number of the original virus for infection, which is used to quantitatively represent the replication ability of an oncolytic adenovirus in the host cell. Targeting replication coefficient refers to a ratio of the virus replication ratio of an oncolytic adenovirus in tumor cells to the virus replication ratio of the same oncolytic adenovirus in normal cells, which is used to quantitatively represent the tumor-targeting replication of an oncolytic adenovirus.
(136) Specifically, 1 MOI of each recombinant oncolytic adenovirus was used to infect host cells. After 72 hours of infection, progeny virus was collected and the titer was determined. The virus replication ratio was obtained by dividing the progeny virus titer with the original infection titer. The targeting replication coefficient was calculated from the virus replication ratios of each virus in tumor cells and normal cells.
(137) The results are shown in Table 1 and
(138) TABLE-US-00013 TABLE 1 Targeting replication coefficient of each recombinant oncolytic adenovirus Virus name Targeting replication coefficient rAd-IFN-1-SP-E1A(24bp)-E1B 23.36 rAd-IFN-2-SP-E1A(24bp)-E1B 8.15 rAd-IFN-3-SP-E1A(24bp)-E1B 9.64
Example 4 Recombinant Oncolytic Adenovirus can Specifically Kill Cancer Cells
(139) In this example, the recombinant oncolytic adenovirus rAd-IFN-3-SP-E1A(24 bp)-E1B with a moderate targeting replication coefficient verified in Example 2 was used as an example to study the effect of the recombinant oncolytic adenovirus of the present disclosure on cancer cells and normal cells (
(140) In the liver cancer cell line Huh-7, the killing effects of rAd-IFN-3-SP-E1A(24 bp)-E1B and Ad-IFN-3 were studied. As shown in
(141) In the colon cancer cell line SW620, the killing effects of replicative and non-replicative oncolytic adenoviruses were compared. As shown in
(142) In this example, the killing effect of oncolytic adenovirus carrying or not carrying interferon sequence on cancer cells was further compared. As shown in
(143) In the lung cancer cell line HCC827, the killing effects of rAd-IFN-3-SP-E1A(24 bp)-E1B and the no-load control virus rAd-SP-E1A(24 bp)-E1B were compared. As shown in
(144) On the contrary, for the normal cell human liver fibroblast cell line HLF, as shown in
(145) The above results indicated that the recombinant oncolytic adenovirus of the present disclosure can specifically kill tumor cells with minimal effect on normal cells, and thus has good safety.
Example 5 Recombinant Oncolytic Adenovirus Significantly Inhibits the Growth of Xenograft Tumor in Nude Mice
(146) In this example, the inhibitory effect of rAd-IFN-3-SP-E1A(24 bp)-E1B on SW620 xenograft tumor in nude mice was tested (
(147) The effect of the recombinant oncolytic adenovirus rAd-IFN-3-SP-E1A(24 bp)-E1B in the MDA-MB-231 xenograft tumor in nude mouse was further tested. As shown in
(148) Also, the effect of the recombinant oncolytic adenovirus rAd-IFN-3-SP-E1A(24 bp)-E1B in the HCC827 xenograft tumor model in nude mouse was tested. As shown in
Example 6 Recombinant Oncolytic Adenoviruses Show Synergistic Inhibitory Effect on Tumors
(149) In this example, it was verified that the recombinant oncolytic adenovirus of the present disclosure (rAd-IFN-1-SP-E1A(24 bp)-E1B) can achieve better results than rIFN protein alone, no-load oncolytic virus alone, or a combination of rIFN protein and no-load oncolytic virus (
(150) Specifically, the triple negative breast cancer cell line HCC1806 xenograft tumor of nude mice with less immune cell infiltration were used for in vivo drug efficacy testing. Each nude mouse was injected subcutaneously with 210.sup.6 HCC1806 cells for subcutaneous tumor formation. When the tumor volume reached about 90 mm.sup.3, mice were randomly divided into groups and administered. The dosage regimen is shown in
(151) The results are shown in
Example 7 Recombinant Oncolytic Adenoviruses Show Overall Inhibitory Effect on Tumors In Vivo
(152) In this example, it was found that the inhibition of the recombinant oncolytic adenovirus on tumor in vivo was not limited to the injection site, but also with a surprising effect at the non-injection site (
(153) Specifically, the triple negative breast cancer cell line MDA-MB-231 xenograft tumor model in nude mouse was employed. A recombinant oncolytic adenovirus rAd-IFN--SP-E1A(24 bp)-E1B carrying natural IFN- was constructed as a control for drug effect. Each nude mouse was injected with 210.sup.6 MDA-MB-231 cells on left and right sides to form subcutaneous tumors on both sides. When volume of the tumor on the left side reached about 90 mm.sup.3, mice were randomly divided into groups and administered. Vehicle control and each recombinant oncolytic adenovirus were administered on the left side tumor on the day of grouping by intratumoral injection at a dose of 1.510.sup.10 VP/time/mouse (50 L/time/mouse), once every other day for a total of five times, while the tumor on the right side was not treated. The size of tumors on both sides were measured every three days.
(154) For the tumor on administration side (left side), as shown in
(155) TABLE-US-00014 TABLE 2 Number of mice (tumor free) in each treatment group on Day 19 and Day 28 Tumor free Tumor free Group on Day 19 on Day 28 Vehicle 0/5 0/5 rAd-SP-E1A(24bp)-E1B 0/5 0/5 rAd-IFN-1-SP-E1A(24bp)-E1B 5/5 5/5 rAd-IFN-2-SP-E1A(24bp)-E1B 2/5 5/5 rAd-IFN-3-SP-E1A(24bp)-E1B 0/5 4/5 rAd-IFN-B-SP-E1A(24bp)-E1B 2/5 4/5
(156) For the tumor on no administration side (right side), as shown in
(157) It can be seen that the recombinant oncolytic viruses of the present disclosure can kill tumor cells not limited to the local injection site but also non-injection site, which gives immeasurable value for the clinical treatment of cancer, such as for the treatment of tumor metastasis.
Example 8 Recombinant Oncolytic Adenoviruses Effectively Prevent Tumor Recurrence
(158) In order to investigate the duration of the therapeutic effect of the oncolytic adenoviruses of the present disclosure, the mice in which the HCC827 xenograft tumors have been completely regressed by intratumoral injection of rAd-IFN-3-SP-E1A(24 bp)-E1B in Example 5 were employed. The mice were again injected with 210.sup.6 HCC827 tumor cells for tumor formation on one side. In the control group, untreated nude mice of the same age were also injected with 210.sup.6 HCC827 tumor cells for tumor formation on one side. After tumor formation, the mice in these two groups were not treated any more, and the tumor volume was measured twice a week. As shown in
Example 9 Recombinant Oncolytic Adenovirus rAd-IFN-3-SP-E1A(24 bp)-E1B Significantly Inhibits the Growth of Xenograft Tumors in Humanized Mice
(159) In order to further investigate the tumor-suppressive effect of the recombinant oncolytic adenovirus in an environment more similar to human immune environment, in this example, the tumor-suppressive effect of the recombinant oncolytic adenovirus of the present disclosure on xenograft tumors of mice with humanized immune system was tested. rAd-IFN-3-SP-E1A(24 bp)-E1B was selected for test in this example. Mice with humanized immune system were injected subcutaneously on both sides with human HCC827 cells for formation of xenografts. The recombinant oncolytic adenoviruses were administered to the tumor on the right side only, while no treatment on the left side.
(160) The results are shown in
Example 10 Recombinant Oncolytic Adenovirus rAd-IFN-1-SP-E1A(24 bp)-E1B Significantly Inhibits the Growth of PDX Xenograft Tumor in Nude Mice
(161) In order to further investigate the tumor-suppressive effect of the recombinant oncolytic adenovirus in an environment more similar to the patients (considering tumors have a strong heterogeneity), in this example, the tumor-suppressive effect of the recombinant oncolytic adenovirus of the present disclosure in patient-derived xenograft (PDX) model of nude mouse was tested. rAd-IFN-1-SP-E1A(24 bp)-E1B was selected for test in this example. One case of lung adenocarcinoma, one case of lung squamous cell carcinoma, and one case of triple negative breast cancer were used for PDX tests.
(162) The results are shown in
Example 11 Single Cell Yield Test of the Recombinant Oncolytic Adenovirus in Medium-Scale Production
(163) To be used as a drug, the recombinant oncolytic adenovirus needs to be fermented by large-scale production. The single cell yield in medium-scale production is not only a basis for evaluating whether the virus can be produced by fermentation, but also an important indicator of the drug cost. Therefore, in this example, the single cell yield of the recombinant oncolytic adenovirus in medium-scale level was tested.
(164) The engineered cell line for single cell yield test was HEK-293 cells from ATCC, which was commonly used in the art. The virus to be tested was inoculated into a certain number of engineered cells at different inoculation ratios (VP/cell), and 42 and 54 hours after the inoculation, the cells were broken and the progeny virus was collected for determining the VP number of the progeny virus, which was then divided by the number of cells at the time of inoculation to obtain the single cell yield.
(165) The results are shown in Table 3. Both recombinant oncolytic adenoviruses rAd-IFN-1-SP-E1A(24 bp)-E1B and rAd-IFN-3-SP-E1A(24 bp)-E1B can achieve single cell yield required by industrial-scale production. The single cell yield of recombinant oncolytic adenovirus rAd-IFN-1-SP-E1A(24 bp)-E1B reached the highest value after 42 hours of culture, but decreased after 54 hours of culture, indicating that the recombinant oncolysis adenovirus had a fast fermentation speed, which means that in industrial production, fermentation can be completed in a shorter time, so as to save costs. In comparison, the single cell yield of rAd-IFN-3-SP-E1A(24 bp)-E1B reached the peak after 54 hours of culture, lower than the fermentation speed of rAd-IFN-1-SP-E1A(24 bp)-E1B. Moreover, the single cell yield of rAd-IFN-1-SP-E1A(24 bp)-E1B after 42 hours culture was higher than that of rAd-IFN-3-SP-E1A(24 bp)-E1B after 56 hours culture, which means that the production efficiency of the former is also higher. Thus, in terms of single cell yield, the recombinant oncolytic adenovirus rAd-IFN-1-SP-E1A(24 bp)-E1B has more advantages.
(166) TABLE-US-00015 TABLE 3 Single cell yield of recombinant oncolytic adenovirus Inoculation rAd-IFN-1-SP- rAd-IFN-3-SP- Harvest ratio E1A(24bp)-E1 E1A(24bp)-E1 time (h) (VP/cell) B (VP/cell) B (VP/cell) 42 400:1 30200 20867 800:1 36900 19293 54 400:1 25000 25069 800:1 27100 25720