Synthetic ethylene-responsive binding element and uses thereof
12319919 ยท 2025-06-03
Assignee
- North Carolina State University (Raleigh, NC)
- INSTITUTE OF CYTOLOGY AND GENETICS, SIBERIAN BRANCH OF RUSSIAN ACADEMY OF SCIENCES (Novosibirsk, RU)
Inventors
- Anna N. STEPANOVA (Cary, NC, US)
- Jose M. ALONSO (Cary, NC, US)
- Josefina Patricia FERNANDEZ-MORENO (Raleigh, NC, US)
- Elena ZEMLYANSKAYA (Novosibirsk, RU)
- Victor LEVITSKY (Novosibirsk, RU)
Cpc classification
C12N2320/50
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
Provided is a recombinant nucleic acid construct comprising a sequence of Formula I (SEQ ID NO:48): XN.sub.1N.sub.2N.sub.3N.sub.4N.sub.5N.sub.6N.sub.7N.sub.8N.sub.9N.sub.10N.sub.11Y as an ethylene binding sequence (EBS). Tandems of two or more directly adjoining EBS are also described, and may be included in an expression cassette useful for modulating the expression of a nucleic acid of interest in a plant in response to plant hormone ethylene.
Claims
1. A recombinant nucleic acid construct comprising two or more directly adjoining ethylene binding sequences (EBS), wherein each of the EBS is a sequence of Formula I (SEQ ID NO:48):
XN.sub.1N.sub.2N.sub.3N.sub.4N.sub.5N.sub.6N.sub.7N.sub.8N.sub.9N.sub.10N.sub.11Y(I) wherein: N.sub.1 is A or G; N.sub.2 is T; N.sub.3 is G, T or A; N.sub.4 is C; N.sub.5 is A; N.sub.6 is A or T; N.sub.7 is T; N.sub.8 is G; N.sub.9 is A, T or C; N.sub.10 is A; N.sub.11 is T or C; and X and Y are each independently present or absent and when present is each independently a spacer sequence comprising 1 to 50 nucleotides.
2. The recombinant nucleic acid construct of claim 1, wherein the two or more EBS of Formula I comprise two or more of SEQ ID NOS:1-11.
3. The recombinant nucleic acid construct of claim 1, wherein the two or more EBS of Formula I are operably linked to a core promoter, optionally wherein the core promoter is within 0 to 2,000 base pairs downstream (3) of the two or more EBS of Formula I.
4. The recombinant nucleic acid construct of claim 1, wherein the two or more EBS of Formula I comprise EBS which are not identical with one another.
5. The recombinant nucleic acid construct of claim 1, wherein the two or more EBS of Formula I comprise four or five EBS of Formula I.
6. The recombinant nucleic acid construct of claim 1, wherein the two or more EBS of Formula I comprise six, seven, eight, or nine EBS of Formula I.
7. The recombinant nucleic acid construct of claim 1, wherein the two or more EBS of Formula I comprise ten, eleven or twelve EBS of Formula I, and optionally up to 50, 75 or 100 EBS of Formula I.
8. The recombinant nucleic acid construct of claim 1, wherein the EBS of Formula I does not comprise a transcription factor binding element that is not an EBS of Formula I.
9. The recombinant nucleic acid construct of claim 8, wherein the construct comprises a sequence selected from the group consisting of SEQ ID NOS:14 and 27-46; and sequences with 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity thereto.
10. An expression cassette comprising the recombinant nucleic acid construct of claim 1 operably linked to a core promotor, and optionally one or more of a subcellular localization signal, a nucleic acid of interest, and a transcriptional terminator.
11. The expression cassette of claim 10, wherein the nucleic acid of interest is present and encodes a reporter protein.
12. The expression cassette of claim 10, wherein the nucleic acid of interest is present and encodes an antioxidant protein, a toxin, a vitamin-biosynthesis protein, a pigment protein, a pathogen defense protein, or a flavor inducing enzyme.
13. The expression cassette of claim 10, wherein the expression cassette comprises, from 5 to 3, the recombinant nucleic acid construct, the minimal promotor, the nucleic acid of interest, and the transcriptional terminator.
14. A plant cell comprising the expression cassette of claim 10.
15. A plant comprising the plant cell of claim 14.
16. The plant of claim 15, wherein the plant is Arabidopsis, tomato, tobacco, maize, or rice.
17. A method of modulating the expression of a nucleic acid of interest in a plant in response to ethylene, the method comprising introducing into a plant cell the expression cassette of claim 10 to produce a transformed plant cell; regenerating a transformed plant from the transformed plant cell; and exposing the transformed plant, or a plant part or plant cell therefrom, to the ethylene, whereby the nucleic acid of interest is expressed.
18. The method of claim 17, wherein the recombinant nucleic acid construct and the nucleic acid of interest are integrated into the genome of the plant.
19. The method of claim 17, wherein the recombinant nucleic acid construct and the nucleic acid of interest are not integrated into the genome of the plant.
20. The method of claim 17, wherein the exposing is carried out by applying ethylene or an ethylene precursor to the transformed plant, or plant part or plant cell therefrom.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION
(11) The present invention now will be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.
(12) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
(13) All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and/or paragraph in which the reference is presented.
(14) Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a composition comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
(15) As used in the description of the invention and the appended claims, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise.
(16) Also as used herein, and/or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).
(17) The term about, as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 10%, 5%, 1%, 0.5%, or even 0.1% of the specified value as well as the specified value. For example, about X where X is the measurable value, is meant to include X as well as variations of 10%, 5%, 1%, 0.5%, or even 0.1% of X. A range provided herein for a measureable value may include any other range and/or individual value therein.
(18) As used herein, phrases such as between X and Y and between about X and Y should be interpreted to include X and Y. As used herein, phrases such as between about X and Y mean between about X and about Y and phrases such as from about X to Y mean from about X to about Y.
(19) The term comprise, comprises and comprising as used herein, specify the presence of the stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
(20) As used herein, the transitional phrase consisting essentially of means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term consisting essentially of when used in a claim of this invention is not intended to be interpreted to be equivalent to comprising.
(21) A heterologous or a recombinant nucleic acid is a nucleic acid not naturally associated with a host cell into which it is introduced, including but not limited to nucleic acid sequences that have been altered by changes in one or more base pairs, operative association with another nucleic acid from another species or that is not naturally found associated therewith (such as a coding sequence for a reporter gene), and/or non-naturally occurring multiple copies of a naturally-occurring nucleic acid.
(22) A native or wild type nucleic acid, nucleotide sequence, polypeptide or amino acid sequence refers to a naturally-occurring or endogenous nucleic acid, nucleotide sequence, polypeptide or amino acid sequence.
(23) A synthetic nucleic acid or nucleotide sequence, as used herein, refers to a nucleic acid or nucleotide sequence that is not found in nature but is constructed by human intervention and as a consequence is not a product of nature.
(24) Different nucleic acids or proteins having homology are referred to herein as homologues. The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. Homology refers to the level of similarity between two or more nucleic acid and/or amino acid sequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins. Thus, the compositions and methods of the invention further comprise homologues to the nucleotide sequences and polypeptide sequences of this invention. Orthologous, as used herein, refers to homologous nucleotide sequences and/or amino acid sequences in different species that arose from a common ancestral gene during speciation. A homologue of a nucleotide sequence of this invention has a substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and/or 100%) to said nucleotide sequence of the invention.
(25) As used herein, the term percent sequence identity or percent identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (query) polynucleotide molecule (or its complementary strand) as compared to a test (subject) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, percent identity can refer to the percentage of identical amino acids in an amino acid sequence.
(26) As used herein, the terms nucleic acid, nucleic acid molecule, nucleic acid construct, nucleotide sequence and polynucleotide refer to DNA, RNA, inclusive of RNA/DNA hybrids, the use of less common bases, such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, etc. Other modifications, such as modification to the phosphodiester backbone, or the 2-hydroxy in the ribose sugar group of the RNA, can also be made. Although the nucleic acid constructs of the present disclosure can be DNA or RNA, they are preferably DNA.
(27) As used herein, the term gene refers to a nucleic acid molecule capable of being used to produce mRNA, tRNA, rRNA, miRNA, anti-microRNA, regulatory RNA, and the like. Genes may or may not be capable of being used to produce a functional protein or gene product. Genes can include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences and/or 5 and 3 untranslated regions). A gene may be isolated by which is meant a nucleic acid that is substantially or essentially free from components normally found in association with the nucleic acid in its natural state. Such components include other cellular material, culture medium from recombinant production, and/or various chemicals used in chemically synthesizing the nucleic acid.
(28) A polynucleotide is also isolated if it is separated from the chromosome and/or cell in which it naturally occurs in and is then inserted into a genetic context, a chromosome and/or a cell in which it does not naturally occur (e.g., a different host cell, different regulatory sequences, and/or different position in the genome than as found in nature). Accordingly, the polynucleotides and their encoded polypeptides are isolated in that, through human intervention, they exist apart from their native environment and therefore are not products of nature, however, in some embodiments, they can be introduced into and exist in a recombinant host cell.
(29) Except as otherwise indicated, nucleic acid molecules and/or nucleotide sequences provided herein are presented herein in the 5 to 3 direction, from left to right and are represented using the standard code for representing the nucleotide characters as set forth in the U.S. sequence rules, 37 CFR 1.821-1.825 and the World Intellectual Property Organization (WIPO) Standard ST.25. A 5 region as used herein can mean the region of a polynucleotide that is nearest the 5 end. Thus, for example, an element in the 5 region of a polynucleotide can be located anywhere from the first nucleotide located at the 5 end of the polynucleotide to the nucleotide located halfway through the polynucleotide. A 3 region as used herein can mean the region of a polynucleotide that is nearest the 3 end. Thus, for example, an element in the 3 region of a polynucleotide can be located anywhere from the first nucleotide located at the 3 end of the polynucleotide to the nucleotide located halfway through the polynucleotide. An element that is described as being at the 5end or at the 3end of a polynucleotide (5 to 3) refers to an element located immediately adjacent to (upstream of) the first nucleotide at the 5 end of the polynucleotide, or immediately adjacent to (downstream of) the last nucleotide located at the 3 end of the polynucleotide, respectively.
(30) Any polynucleotide and/or nucleic acid construct useful with this invention may be codon optimized for expression in any species of interest. Codon optimization is well known in the art and involves modification of a nucleotide sequence for codon usage bias using species-specific codon usage tables. The codon usage tables are generated based on a sequence analysis of the most highly expressed genes for the species of interest. When the nucleotide sequences are to be expressed in the nucleus, the codon usage tables are generated based on a sequence analysis of highly expressed nuclear genes for the species of interest. The modifications of the nucleotide sequences are determined by comparing the species-specific codon usage table with the codons present in the native polynucleotide sequences. As is understood in the art, codon optimization of a nucleotide sequence results in a nucleotide sequence having less than 100% identity (e.g., 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like) to the native nucleotide sequence but which still encodes a polypeptide having the same function (and in some embodiments, the same structure) as that encoded by the original nucleotide sequence. Thus, in some embodiments of the invention, polynucleotides and/or nucleic acid constructs useful with the invention may be codon optimized for expression in the particular organism/species of interest.
(31) A promoter is a nucleotide sequence that controls or regulates the transcription of another nucleotide sequence (i.e., a coding sequence) that is operatively associated with the promoter. The coding sequence may encode a polypeptide and/or a functional RNA. Typically, a promoter refers to a nucleotide sequence that contains a binding site for RNA polymerase II (core promoter herein) and directs the initiation of transcription. In general, promoters are found 5, or upstream, relative to the start of the coding region of the corresponding coding sequence. The promoter region may comprise other elements that act as regulators of gene expression. These include a TATA box consensus sequence, and often a CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50:349). In plants, the CAAT box may be substituted by the AGGA box (Messing et al., (1983) in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227).
(32) A core promoter as known in the art is a short DNA sequence comprised of a TATA box and/or other DNA elements that serve to recruit general transcription factors and RNA polymerase and specify the site of transcription initiation, to which regulatory elements may be added for control of expression. The core promoter is also referred to as a minimal promoter because it is functional on its own to promote a basal level of transcription (and core promoter and minimal promoter are used interchangeably herein). A core promoter thus consists only of basal elements needed for transcription initiation, e.g., a TATA box and/or an Initiator element.
(33) A regulatory element as used herein can be endogenous or heterologous. In some embodiments, an endogenous regulatory element derived from the subject organism can be inserted into a genetic context in which it does not naturally occur (e.g., a different position in the genome than as found in nature), thereby producing a recombinant or non-native nucleic acid. In some embodiments, promoters useful with the constructs of the invention may be any combination of heterologous and/or endogenous promoters.
(34) By operably linked or operably associated as used herein, it is meant that the indicated elements are functionally related to each other, and are also generally physically related or associated. Thus, the term operably linked or operably associated as used herein, refers to nucleotide sequences on a single nucleic acid molecule that are functionally associated. Thus, a first nucleotide sequence that is operably linked to a second nucleotide sequence means a situation when the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For instance, a promoter is operably associated with a nucleotide sequence of interest if the promoter effects the transcription or expression of said nucleotide sequence. Those skilled in the art will appreciate that the control sequences (e.g., promoter) need not be contiguous with the nucleotide sequence to which it is operably associated, as long as the control sequences function to direct the expression thereof. Thus, for example, intervening untranslated, yet transcribed, sequences can be present between a promoter and a nucleotide sequence, and the promoter can still be considered operably linked to the nucleotide sequence.
(35) In the present invention, the EBS (e.g., of Formula I) may be provided as a distal-proximal promotor or element that is operatively associated with a core promoter that recruits RNA Pol II and basal transcription factors (TFs). As known in the art, distal and proximal promoters have sequences that recruit gene- or tissue-specific TFs (such as EIN3 in the case of EBSnew) that, in turn, help bring RNA Pol II and basal TFs to the promoter. In some embodiments, the 35S core promoter (46 to +8) is used, although any core promoter can be used, including synthetic and viral minimal promoters such as FMV from Figwort mosaic virus. See, e.g., Kumar et al. (2012) Development of a salicylic acid inducible minimal sub-genomic transcript promoter from Figwort mosaic virus with enhanced root- and leaf-activity using TGACG motif rearrangement. Gene 503 (1), 36-47.
(36) Nucleotide sequence of interest, nucleic acid of interest, and polynucleotide of interest are used interchangeably herein and refer to any polynucleotide sequence which, when introduced into an organism such as a plant, confers upon the organism a desired characteristic such as detection of expression of a marker (or reporter) protein, tolerance to abiotic stress, antibiotic resistance, virus resistance, insect resistance, disease resistance, or resistance to other pests, herbicide tolerance, improved nutritional value, improved performance in an industrial process, or altered reproductive capability. The nucleotide sequence of interest may also be one that is useful for the production of commercially valuable products such as enzymes or metabolites in the plant. The nucleotide sequence of interest can also encode a polypeptide and/or an inhibitory polynucleotide (e.g., a functional RNA).
(37) By the term express, expressing or expression (or other grammatical variants) of a nucleic acid coding sequence, it is meant that the sequence is transcribed. In particular embodiments, the terms express, expressing or expression (or other grammatical variants) can refer to both transcription and translation to produce an encoded polypeptide.
(38) The term abiotic stress as used herein refers to outside, nonliving, factors which can cause harmful effects to plants. Thus, as used herein, abiotic stress includes, but is not limited to, drought/dehydration, and/or rehydration, or cycles of dehydration and rehydration. Parameters for the abiotic stress factors are species specific and even variety specific and therefore vary widely according to the species/variety exposed to the abiotic stress. In addition, because most crops are exposed to multiple abiotic stresses at one time, the interaction between the stresses affects the response of the plant. Thus, the particular parameters for high/low temperature, light intensity, drought and the like, which impact crop productivity, will vary with species, variety, degree of acclimatization and the exposure to a combination of environmental conditions.
(39) The nucleotide sequence of interest in some embodiments may encode an antioxidant protein. Examples of antioxidant proteins include, but are not limited to, catalases, glutathione peroxidases, and superoxide dismutases such as manganese superoxide dismutase (MnSOD). See, e.g., U.S. Pat. No. 7,994,406 to Patell. Antioxidant proteins may also include enzymes involved in the biosynthesis of antioxidant compounds such as vitamins (Vitamin C, Vitamin B6), flavonoids (e.g., anthocyanidins), lycopene, etc.
(40) Reporter proteins that may be encoded by a nucleic acid of interest include, but are not limited to, fluorescent or luminescent proteins or enzymes such as green fluorescent protein, luciferase, -glucuronidase (GUS), mCherry, mTagBFP2, Cerulean, Ypet, Ruby, etc. See, e.g., U.S. Pat. No. 6,232,107 to Bryan et al.
(41) In some embodiments, a recombinant nucleic acid construct of the invention may be an expression cassette or may be comprised within an expression cassette. As used herein, expression cassette means a recombinant nucleic acid construct comprising a polynucleotide of interest, wherein said polynucleotide of interest is operably associated with at least one control sequence (e.g., a promoter).
(42) An expression cassette may also optionally include a transcriptional and/or translational termination region (i.e., termination region) that is functional in the selected host cell. A variety of transcriptional terminators are available for use in expression cassettes and are responsible for the termination of transcription beyond the heterologous nucleotide sequence of interest and correct mRNA polyadenylation. The termination region may be native to the transcriptional initiation region, may be native to the operably linked polynucleotide of interest, may be native to the host cell, or may be derived from another source (i.e., foreign or heterologous to the promoter, to the polynucleotide of interest, to the host, or any combination thereof).
(43) An expression cassette (e.g., recombinant nucleic acid constructs and the like) may include a nucleotide sequence of interest that is a selectable marker, which can be used to select a transformed host cell. As used herein, selectable marker means a nucleotide sequence that when expressed imparts a distinct phenotype to the host cell expressing the marker and thus allows such transformed cells to be distinguished from those that do not have the marker. Such a nucleotide sequence may encode either a selectable or screenable marker, depending on whether the marker confers a trait that can be selected for by chemical means, such as by using a selective agent (e.g., an antibiotic and the like), or on whether the marker is simply a trait that one can identify through observation or testing, such as by screening (e.g., fluorescence). Of course, many examples of suitable selectable markers are known in the art and can be used in the expression cassettes described herein.
(44) As anon-limiting example, the expression cassette may comprise, from 5 to 3, the EBS as taught herein (e.g., pEBSnew), a minimal promotor (e.g., 35S minimal promoter), a nucleic acid of interest (e.g., BT delta endotoxin coding sequence), and a transcriptional terminator (e.g., NOS terminator). Such an expression cassette may be used to induce the BT toxin in response to ethylene produced by the plant tissues attached by an herbivore insect.
(45) In addition to expression cassettes, the nucleic acid construct and nucleotide sequences described herein may be used in connection with vectors. The term vector refers to a composition for transferring, delivering or introducing a nucleic acid (or nucleic acids) into a cell. A vector comprises a nucleic acid construct comprising the nucleotide sequence(s) to be transferred, delivered or introduced. Vectors for use in transformation of host organisms are well known in the art. A vector can transform a host cell either by integration into the cellular genome, or it may exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication). Additionally included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells). A nucleic acid construct in the vector may be under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell. Accordingly, the recombinant nucleic acid constructs of this invention and/or expression cassettes comprising the recombinant nucleic acid constructs of this invention may be provided in vectors as described herein and as known in the art.
(46) The terms transformation, transfection, and transduction as used herein refer to the introduction of a heterologous nucleic acid into a cell. Such introduction into a cell may be stable or transient. Thus, in some embodiments, a host cell or host organism is stably transformed with a nucleic acid construct of the invention. In other embodiments, a host cell or host organism is transiently transformed with a recombinant nucleic acid construct of the invention.
(47) As used herein, the term stably introduced means that the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide. When a nucleic acid construct is stably transformed and therefore integrated into a cell, the integrated nucleic acid construct is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations.
(48) Transient transformation in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell.
(49) Transient transformation may be detected by, for example, an enzyme-linked immunosorbent assay (ELISA) or western blot, which can detect the presence of a peptide or polypeptide encoded by one or more transgene introduced into an organism. Stable transformation of a cell can be detected by, for example, a Southern blot hybridization assay of genomic DNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism (e.g., a plant, a mammal, an insect, an archaea, a bacterium, and the like). Stable transformation of a cell can be detected by, for example, a northern blot hybridization assay of RNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into a plant or other organism. Stable transformation of a cell can also be detected by, e.g., a polymerase chain reaction (PCR) or other amplification reactions as are well known in the art, employing specific primer sequences that hybridize with target sequence(s) of a transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods. Transformation can also be detected by direct sequencing and/or hybridization protocols well known in the art.
(50) A recombinant nucleic acid construct of the invention can be introduced into a cell by any method known to those of skill in the art. Exemplary methods of transformation or transfection include biological methods using viruses and bacteria (e.g., Agrobacterium), physicochemical methods such as electroporation, floral dip methods, particle or ballistic bombardment, microinjection, whiskers technology, pollen tube transformation, calcium-phosphate-mediated transformation, nanoparticle-mediated transformation, polymer-mediated transformation including cyclodextrin-mediated and polyethyleneglycol-mediated transformation, sonication, infiltration, as well as any other electrical, chemical, physical (mechanical) and/or biological mechanism that results in the introduction of nucleic acid into a cell, including any combination thereof.
(51) In some embodiments of the invention, transformation of a cell comprises nuclear transformation. In still further embodiments, the recombinant nucleic acid construct of the invention can be introduced into a cell via conventional breeding techniques.
(52) The invention further provides a recombinant plant cell or plant organism comprising the recombinant nucleic acid constructs taught herein, and/or comprising the recombinant expression cassette, plasmid, or otherwise containing a recombinant nucleic acid constructs of the invention.
(53) As used herein, the terms transformed and transgenic refer to any plant, plant cell, plant tissue (including callus), or plant part that contains all or part of at least one recombinant or isolated nucleic acid, polynucleotide or nucleotide sequence. In representative embodiments, the recombinant or isolated nucleic acid, polynucleotide or nucleotide sequence is stably integrated into the genome of the plant (e.g., into a chromosome or as a stable extra-chromosomal element), so that it is passed on to subsequent generations of the cell or plant.
(54) The term plant part, as used herein, includes but is not limited to reproductive tissues (e.g., petals, sepals, stamens, pistils, receptacles, anthers, pollen, flowers, fruits, flower bud, ovules, seeds, embryos, nuts, kernels, ears, cobs and husks); vegetative tissues (e.g., petioles, stems, roots, root hairs, root tips, pith, coleoptiles, stalks, shoots, branches, bark, apical meristem, axillary bud, cotyledon, hypocotyls, and leaves); vascular tissues (e.g., phloem and xylem); specialized cells such as epidermal cells, parenchyma cells, chollenchyma cells, schlerenchyma cells, stomates, guard cells, cuticle, mesophyll cells; callus tissue; and cuttings. The term plant part also includes plant cells, including plant cells that are intact in plants and/or parts of plants, plant protoplasts, plant tissues, plant organs plant cell tissue cultures, plant calli, plant clumps, and the like. As used herein, shoot refers to the above ground parts including the leaves and stems.
(55) The term tissue culture encompasses cultures of tissue, cells, protoplasts and callus.
(56) As used herein, plant cell refers to a structural and physiological unit of the plant, which typically comprise a cell wall but also includes protoplasts. A plant cell of the present invention can be in the form of an isolated single cell or can be a cultured cell or can be a part of a higher-organized unit such as, for example, a plant tissue (including callus) or a plant organ.
(57) Any plant (or groupings of plants, for example, into a genus or higher order classification) can be employed in practicing the present invention including angiosperms and/or gymnosperms, monocots and/or dicots.
(58) Exemplary plants include, but are not limited to corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago saliva), rice (Oryza sativa, including without limitation Indica and/or Japonica varieties), rape (Brassica napus), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tobacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), apple (Malus pumila), blackberry (Rubus), strawberry (Fragaria), walnut (Juglans regia), grape (Vitis vinifera), apricot (Prunus armeniaca), cherry (Prunus), peach (Prunus persica), plum (Prunus domestica), pear (Pyrus communis), watermelon (Citrullus vulgaris), duckweed (Lemna), oats (Avena sativa), barley (Hordium vulgare), vegetables, ornamentals, conifers, and turfgrasses (e.g., for ornamental, recreational or forage purposes), and biomass grasses (e.g., switchgrass and Miscanthus).
(59) Vegetables include Solanaceous species (e.g., tomatoes; Lycopersicon esculentum), lettuce (e.g., Lactuea sativa), carrots (Caucus carota), cauliflower (Brassica oleracea), celery (Apium graveolens), eggplant (Solanum melongena), asparagus (Asparagus officinalis), ochra (Abelmoschus esculentus), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), members of the genus Cucurbita such as Hubbard squash (C. Hubbard), Butternut squash (C. moschata), Zucchini (C. pepo), Crookneck squash (C. crookneck), C. argyrosperma, C. argyrosperma ssp. sororia, C. digitata, C. ecuadorensis, C. foetidissima, C. lundelliana, and C. martinezii, and members of the genus Cucumis such as cucumber (Cucumis sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
(60) Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherima), and chrysanthemum.
(61) Conifers, which may be employed in practicing the present invention, include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis).
(62) Turfgrass include but are not limited to zoysia grass, bent grass, fescue grass, bluegrass, St. Augustine grass, Bermuda grass, buffalo grass, rye grass, and orchard grass.
(63) Also included are plants that serve primarily as laboratory models, e.g., Arabidopsis.
(64) Ethylene Binding Sequences (EBS) and Uses Thereof
(65) Provided herein are ethylene binding sequences (EBS) useful to drive gene expression in response to ethylene. The EBS may be an inverted repeat of coreEBS-like sequences with a 1-bp overlap (2EBS(1)) as described herein. The inverted repeat need not be the exact sequence in an inverted form, so long as the basic 2EBS(1) structure as taught herein is present (see
(66) Such EBS may be a sequence of Formula I (SEQ ID NO:48):
XN.sub.1N.sub.2N.sub.3N.sub.4N.sub.5N.sub.6N.sub.7N.sub.8N.sub.9N.sub.10N.sub.11Y wherein: N.sub.1 is A or G; N.sub.2 is T; N.sub.3 is G, T or A; N.sub.4 is C; N.sub.5 is A; N.sub.6 is A or T; N.sub.7 is T; N.sub.8 is G; N.sub.9 is A, T or C; N.sub.10 is A; N.sub.11 is T or C; and X and Y are each independently present or absent and when present is each independently a spacer sequence, which may be comprised of any combination of 2, 5, or 10, to 20, 30 or 50 nucleotides. In some embodiments, the spacer may be 2 to 10 nucleotides, or 4 to 8 nucleotides (e.g., 5 nucleotides).
(67) In some embodiments, the spacer sequence does not comprise another transcription factor binding element. As a non-limiting example, the consensus binding site for cytokinin activated transcription, 5-(A/G)GAT(C/T)T-3, may be removed from the spacer sequence (Plant Physiol. 2013 March; 161(3): 1066-1075.). See also: agris-knowledgebase.org/AtcisDB/bindingsites.html.
(68) Examples of preferred sequences of Formula I include, but are not limited to, those listed in Table 1, with key (conserved) bases capitalized (see also
(69) TABLE-US-00001 TABLE1 Example2EBS(1)ofFormulaI FormulaI ExampleSequences X-ATgCAaTGaAT-Y SEQIDNO:1 X-GTtCAaTGaAT-Y SEQIDNO:2 X-GTgCAaTGtAT-Y SEQIDNO:3 X-ATaCAtTGaAC-Y SEQIDNO:4 X-ATaCAtTGaAT-Y SEQIDNO:5 X-ATaCAtTGtAT-Y SEQIDNO:6 X-ATaCAaTGcAT-Y SEQIDNO:7 X-ATaCAaTGtAT-Y SEQIDNO:8 X-ATtCAaTGcAT-Y SEQIDNO:9 X-ATtCAaTGaAC-Y SEQIDNO:10 X-ATtCAtTGcAC-Y SEQIDNO:11 wherein X and Y are as defined above.
(70) The EBS may be provided as a combination, or stack, of two or more EBS of Formula I directly adjacent to each other (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more EBS). In some embodiments, the two or more EBS may comprise EBS of Formula I which are not identical with one another (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more different EBS in the stack, which may also optionally include one or more duplicate EBS, and optionally up to 50, 75 or 100 EBS of Formula I).
(71) The EBS may be operably linked to a core promoter to drive ethylene-dependent expression of an operatively associated nucleic acid of interest. In some embodiments, the core promoter may be within 0 to 2,000 base pairs downstream (3) of the EBS. In some embodiments, the EBS may be inserted into the sequence of a full promoter, upstream of the core promoter sequence of that promoter.
(72) In some embodiments, the EBS of Formula I does not comprise another transcription factor binding element, or does comprise another transcription binding element, as desired. For example, the sequence of the stacked EBS may be modified to remove or add such sequences, particularly at the X and Y linker positions. See, e.g.: agris-knowledgebase.org/AtcisDB/bindingsites.html. For example, a GCC box recognized by a subset of ERF transcription factors can be introduced at junctions between EBS copies to make the ethylene-responsive promoter also inducible by ERFs. See, e.g., Hao et al. (1998) Unique Mode of GCC Box Recognition by the DNA-binding Domain of Ethylene-responsive Element-binding Factor (ERF Domain) in Plant, J. Biol. Chem. vol. 273, no. 41, 26857-26861.
(73) In some embodiments, stacked EBS of Formula I may be selected from the group consisting of SEQ ID NOS:14 and 27-26; and sequences with 90, 92, 95 or 97% identity thereto.
(74) The EBS may be used in an expression cassette comprising the EBS and core promoter operably linked to a nucleic acid of interest. In some embodiments, the nucleic acid of interest encodes a reporter protein, such as those listed above. Nucleic acids of interest may also include those encoding a toxin (e.g., Barnase, see Faden et al. (2019) Modulating Protein Stability to Switch Toxic Protein Function On and Off in Living Cells, Plant Physiol vol. 179, 929-942) to arrest plant growth or kill a plant, a vitamin-biosynthesis protein to make a valuable nutrient (e.g., PDX1.1 to increase vitamin B6 levels, see Mangel et al. (2019) Enhancement of vitamin B6 levels in rice expression Arabidopsis vitamin B6 biosynthesis de novo genes, The Plant Journal vol. 99, 1047-1065), a pigment protein (e.g., synthetic protein Ruby, see He et al. (2020) A reporter for noninvasively monitoring gene expression and plant transformation, Horticulture Research 7, no. 152) to change the plant or organ color, a pathogen defense protein (e.g., NPR1, see Cao et al. (1998) Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance, PNAS vol. 95, no. 11, 6531-6536) to make plant withstand a pathogen attack, a flavor inducing enzyme (e.g., AADCla, see Tieman et al. (2006) Tomato aromatic amino acid decarboxylases participate in synthesis of the flavor volatiles 2-phenylethanol and 2-phenylacetaldehyde, PNAS vol. 103, no. 21, 8287-8292) or a sweet-tasting protein (e.g., Monellin, see Reddy et al. (2015) Improving Flavour and Quality of Tomatoes by Expression of Synthetic Gene Encoding Sweet Protein Monellin, Mol. Biotech. vol. 57, 448-453) to modify the fruit or vegetable taste, an insect toxin (e.g., BT delta endotoxin), etc.
(75) The construct comprising an EBS as taught herein may be introduced into a plant cell to produce a transformed plant cell by standard methods known in the art. The plant cell may be regenerated into a transformed plant, and the transformed plant, or a plant part, or plant cell therefrom, may be exposed to ethylene (e.g., by applying ethylene or an ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC)), thereby inducing expression of a nucleic acid of interest operably linked to the EBS. Depending on the method of transformation used, a recombinant nucleic acid construct comprising the EBS may be integrated into the genome of the plant, or not integrated into the genome of the plant.
(76) The invention will now be described with reference to the following examples. It should be appreciated that these examples are not intended to limit the scope of the claims to the invention, but are rather intended to be exemplary of certain embodiments. Any variations in the exemplified methods that occur to the skilled artisan are intended to fall within the scope of the invention.
EXAMPLES
Example 1: An Inverted Repeat of coreEBS with the Overlap of the Motifs Predicts EIN3 Binding in Arabidopsis Genome More Specifically than Other EBS
(77) Arabidopsis thaliana reporter EBS:GUS driven by the EIN3 binding site (Stepanova et al., 2007) is widely used as a sensor for detection of ethylene signaling. The binding specificities of A. thaliana EIN3 and its homolog from Nicotiana tabacum, TOBACCO EIN3-LIKE (TEIL), were investigated using high-throughput in vitro binding assays such as systematic evolution of ligands by exponential enrichment (SELEX) (Kosugi and Ohashi, 2000), chromatin immunoprecipitation and sequencing (ChIP-seq), protein binding microarrays (PBM) (Chang et al., 2013), and DNA affinity purification and sequencing (DAP-seq) (O'Malley et al., 2016). The corresponding models share a common 6-bp core sequence (hereinafter referred to as coreEBS).
(78) We first investigated EIN3 binding preferences at the genome level using publicly available ChIP-seq data on EIN3 binding in three-day-old etiolated Arabidopsis seedlings treated with ethylene gas for four hours (Chang et al., 2013, Temporal transcriptional response to ethylene gas drives growth hormone cross-regulation in Arabidopsis. Elife 2, e00675). We initially focused on ChIP-seq rather than on published DAP-seq data (O'Malley et al., 2016, Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape. Cell 165, 1280-1292) to ensure that we capture the sequences associated with the EIN3 function in vivo. De novo motif search in the peaks with Homer tool (Heinz et al., 2010, Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and b cell identities. Mol. Cell 38, 576-589) discovered a previously unknown EBS architecture top ranked among the enriched motifs (p-value 1e-300).
(79) This new configuration, referred to as 2EBS(1), is a head-to-head inverted repeat of coreEBS-like sequences with a 1-bp overlap (
(80) The predominant role of the new 2EBS(1) repeat in EIN3 binding was further supported by the quantitative analysis of 2EBS(1), TEIL-like and GC-EBS occurrence in ChIP-seq peaks relative to that in the whole-genome set of gene promoters. 2EBS(1) repeat showed greater occurrence in EIN3-bound ChIP-seq peaks as compared to the motifs with a single coreEBS at low false-positive rates (
(81) Next, we tested if preferential binding of EIN3 to 2EBS(1) could be caused by chromatin organization. Since DAP-seq detects TF interactions with naked chromosomal DNA, we repeated de novo motif search in EIN3 DAP-seq data from Arabidopsis (O'Malley et al., 2016). In DAP-seq peaks, 2EBS(1) enrichment was again top ranked (p-value 1e-659). Therefore, the 2EBS(1) repeat rather than the previously identified single-coreEBS-containing motifs is the primary EIN3 binding site in the Arabidopsis genome.
(82) The finding that the tandem arrangement of two adjacent copies of EBS improves EIN3 binding to DNA is in agreement with the previously reported EIN3 tendency to bind DNA as a homodimer (Solano et al., 1998, Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes Dev. 12, 3703-3714; Song et al., 2015, Biochemical and Structural Insights into the Mechanism of DNA Recognition by Arabidopsis ETHYLENE INSENSITIVE3. PLoS One 10, e0137439). Accordingly, recent fine-scale in vitro gel-shift experiments demonstrated that head-to-head inverted repeats of coreEBS-like sequences (ATGTAT or ATGTAC) separated by a 8-15 bp spacer display greater affinity for EIN3 than the DNA substrates with a single coreEBS sequence (Song et al., 2015). Therefore, we explored what configurations of the two head-to-head coreEBS repeats besides 2EBS(1) could be critical for EIN3 binding on a genome-wide scale. We analyzed the occupancy of EBS repeats with different architecture (in terms of mutual orientation of coreEBS motifs and spacer length) in ChIP-seq peaks using MCOT algorithm (Levitsky et al., 2019, A single ChIP-seq dataset is sufficient for comprehensive analysis of motifs co-occurrence with MCOT package. Nucleic Acids Res. 47, e139).
(83) To our surprise, head-to-head inverted repeats of coreEBS with 8-15 bp spacers were not enriched in ChIP-seq peaks compared to random expectation, and neither were the other configurations of two EBS repeats, except for 2EBS(1), as shown in
(84) Since our bioinformatic analysis identified the 2EBS(1) sequence as the canonical EIN3 binding site, we hypothesized that it should predominate in EIN3-binding datasets across all data points. We therefore analyzed whether this DNA element is associated with a sustained profile of EIN3 binding, i.e., recruits EIN3 regardless of the duration of ethylene treatment. We preprocessed three previously published EIN3 ChIP-seq datasets from three-day-old etiolated Arabidopsis seedlings that were treated with ethylene gas for one, four and 12 hours (Chang et al., 2013) and intersected the corresponding EIN3-binding peaks. The peaks that overlapped between all three datasets were classified as the sustained EIN3-binding events. To differentiate between distinct EBS configurations (2EBS(1), TEIL-like and GC-EBS), we kept only the peaks harboring one type of EBS for further analysis and discarded the peaks with combinations of these elements. We estimated the associations of distinct EBS configurations with sustained EIN3 binding using Fisher's exact test.
(85) Consistent with our expectations, 2EBS(1) repeat was significantly associated with sustained EIN3 binding (p-value 4.9e-32), whereas the single-coreEBS motifs, TEIL-like and GC-EBS, were not (
(86) We next evaluated the correlation between sustained EIN3 binding and gene responsiveness to ethylene in a set of EIN3 targets identified based on ChIP-seq data. For further analysis, we again kept only the genes harboring one type of EBS in the corresponding EIN3-bound sequences. To characterize ethylene responsiveness, we preprocessed three previously published RNA-seq datasets for three-day-old etiolated Arabidopsis seedlings treated with ethylene gas for one, four and 12 hours, or left untreated (Chang et al., 2013). We considered the gene ethylene responsive if it was differentially expressed in at least one dataset.
(87) We found that sustained EIN3 binding to a gene promoter was significantly associated with the gene's activation in response to ethylene treatment (p-value 1.3e-08) (
Example 2: A New Genetic Sensor for Highly Sensitive Detection of Ethylene Signaling in Arabidopsis
(88) In the only available synthetic ethylene reporter EBS:GUS (Stepanova et al., 2007), the reporter gene is driven by a tandem of single-core EBS-containing GC-EBS motifs (Stepanova, 2001). In light of the bioinformatic data reported above, we hypothesized that 2EBS(1) should induce more a pronounced response to ethylene than EBS:GUS.
(89) The synthetic ethylene transcriptional reporters described in this work were built using the GoldenBraid (GB) multiplexing technology (Sarrion-Perdigones et al., 2011 and 2013; Vazquez-Vilar et al., 2017). Each ethylene-specific distal promoter was domesticated into the GB platform (Level 0) in the pUPD2 vector by following the flanking 4-nucleotide coding grammar rules for a distal and proximal promoter bricks (aka A1-A2, GGAG-TCCC) (see
(90) Four synthetic ethylene-specific promoters were tested: the 2EBS[1]-containing 10xEBSn (n for new) generated in this work, the mutant version of 10xEBSn (10xmutEBSn) also from this work, a stacked version of the original 5xEBS (Stepanova, 2001) referred herein as 10xEBSc (c for classic), which differs from the original construct by having ten repeats of EBSc spaced by 10 nucleotides as compared to five repeats spaced by 3 nucleotides (Stepanova and Ecker, unpublished data), and a 10-copy tandem of the previously reported sequence 2EBS-S10 (Song et al., 2015). These promoters are listed in Table 2.
(91) TABLE-US-00002 TABLE2 TranscriptionFactorBinding SEQID Promoter Element(TFBE) Size(TFBE) NO Source Reference EBSclassic (AGCCTCATGATCAAAGGGGGGATG 400(40)bp SEQID EDF1- This (10) CACTATTTAAGGATCT)10 NO:12 Ethylene project Response DNA-binding Factors 2EBS-S10 (AAGATACATGCAAAAAAGCATGTAT 280(28)bp SEQID Synthetic Songet (10) CTT)10 NO:13 al.,2015 (PLoS ONE) EBSnew gtatcatgcaatgaatcaAcc|tcttggttcaat 210(21)bp SEQID Synthetic This (10) gaatcgagt|Gcaatatacattgtattatgg| NO:14 project gatGgattcaatgcatCgttc|tctcaattcatt gcactcTta|tttaaatacaatgcatcaGta| gtccgattcattgcacaacGa|attggatacaa tgtatttgtG|aacagatacattgaacattag| gagaGatacattgaatctata mutEBSnew gtatcaggcaatgactcaAcc|tcttggttgaa 210(21)bp SEQID Synthetic This (10) cgaatcgagt|Gcaatatagattgtaatatgg| NO:15 project gatGgattaaacgcatCgttc|tctcaattcgt agcactcTta|tttaaatactaggcatcaGta| gtccgattccttgctcaacGa|attggctacaat gtaattgtG|aacagatagatagaacattag| gagaGctacattgaaactata EBSoriginal (CCTCATGATCAAAGGGGGGATGCA 173(35)bp SEQID EDF1- Stepanova (5) CTATTTAAGAT)5 NO:16 Ethylene etal., Response 2007 DNA-binding (Plant Factors Cell)
(92) These synthetic promoters were initially screened for forbidden BsaI and BsmBI restriction sites within their sequences to allow their domestication into the GB platform. Then, the 4-nucleotide coding grammar corresponding to a distal-proximal promoter brick (A1-A2) was added to their sequences: the GGAG code at the 5 end, and the TCCC code at the 3 end. In addition, to be cloned into the GB Level 0 plasmid pUPD2, these GB codes were flanked by additional DNA sequences: (1) two pUPD2-compatible 4-nucleotide codes, one upstream of the GB A1 code (CTCG at the 5 end) and another downstream of the GB A2 code (TGAG at the 3 end); and (2) two flanking restriction sites for the type IIS enzyme BsmBI (nnnnCGTCTCn; SEQ ID NO:47) upstream and downstream of the aforementioned pUPD2 codes. Due to DNA synthesis limitations, these extra DNA sequences were not included in the synthetized sequences and were incorporated into the DNA fragments via PCR primers. The promoter sequences were too short to use the GB domestication tool, so the aforementioned flanks were added manually to the sequences of interest.
(93) Because the highly repetitive nature of the 2EBS-S10 promoter made the GB domestication and commercial synthesis impossible, the constructs were made by generating repetitive promoters that involved synthesizing the desired sequences with spacers that were enzymatically removed during subcloning into pUPD2. As a result, half of the 2EBS-S10 promoter was domesticated independently using the grammar for the distal promoter A1 brick (5-GGAG and TGAC-3) and the other half using the grammar for the proximal A2 promoter brick (5-TGAC and TCCC-3) (
(94) Synthetized promoters were amplified using iPROOF High-Fidelity DNA Polymerase (Bio-Rad), chloroform-purified and stored at 20 C. until use. The fragments containing the promoter sequences and their GB overhangs were cloned into the pUPD2 entry vector following the GB instructions (Sarrion-Perdigones, et al., 2014; Vazquez-Vilar, et al., 2015) with some modifications: the digestion-ligation cycle started with an initial BsmBI (NEB) digestion step at 55 C. for 20 min, followed by the addition of the DNA T4 ligase (NEB) prior to the full GB cycle (4 min at 37 C. and 5 min at 16 C., 25 times) and a final digestion step at 55 C. for 20 min with freshly added BsmBI and the inactivation of both enzymes at 80 C. for 20 min. The reactions were transformed into homemade chemically competent E. coli TOP10 cells (ThermoFisher) and the transformed colonies were selected in LB Agar (Genessee Scientific) supplemented with chloramphenicol (25 L mg.sup.1) (GoldBio) and X-Gal (20 L mg.sup.1) (GoldBio). Plasmid DNA from white colonies was extracted using alkaline lysis, verified by restriction digest and Sanger sequencing, and stored at 20 C.
(95) Confirmed pUPD2 plasmids containing the distal-proximal ethylene-inducible promoters (A1-A2 grammar) were assembled into the destination vector pDGB3alpha1 along with the following GB bricks harbored in pUPD2: a 46 minimal 35S promoter (A3-B1), a triple nuclear localization signal (3NLS, B2), a triple yellow fluorescent protein (3YPet) or a -Glucoronidase CDS (GUS) (B3-B5), and the 35S terminator (B6-C1 grammar) to build two different types of transcriptional reporters (
(96) The pDGB3alpha1 plasmids harboring the ethylene-inducible reporters were assembled together with the plant BASTA resistance marker Bar harbored in pDGB3alpha2 into the pDGB3omega1 vector following the GB binary assembly rules (Sarrion-Perdigones, et al., 2014; Vazquez-Vilar, et al., 2015) with some modifications. The digestion-ligation cycle (4 min at 37 C. and 5 min at 16 C., repeated 25 times) was followed by a final digestion step at 55 C. for 20 min and a 20-min enzyme inactivation step at 80 C. The reactions were transformed into Top10 cells and selected in LB Agar supplemented with spectinomicin (100 g mL.sup.1) (GoldBio) and X-Gal (20 L mg.sup.1), with white colonies tested as described above for pUPD2 and pDGB3alpha1 constructs.
(97) Both the ethylene inducible reporters (level alpha) and the final modules (level omega) were transformed into Agrobacterium tumefaciens strain GV3101 by electroporation (Gene Pulser, Bio-Rad) as described (Alonso and Stepanova, 2015; Shen and Forde, 1989). Positive colonies were identified in LB Agar (Genessee Scientific) supplemented with spectinomicin (100 g mL.sup.1) (Gold Biothechnology), rifampicin (20 g mL.sup.1) (Gold Biotechnology) and gentamycin (25 g mL.sup.1) (Gold Biotechnology), re-streaked once, grown at 28 C. for 48 h, and confirmed by PCR using construct-specific primers.
(98) The pDGB3omega1 modules harboring the ethylene-inducible reporters and the plant selectable marker were transformed into wild-type Arabidopsis thaliana ecotype Columbia (Col-0) as described (Alonso and Stepanova, 2015; Brumos, Zhao et al., 2019, Clough and Bent, 1998). Briefly, fresh Agrobacterium colonies were inoculated into 5 ml liquid LB supplemented with spectinomycin (100 g mL.sup.1) (brandGold Biootechnology), rifampicin (20 g mL.sup.1) (brandGold Biotechnology) and gentamycin (25 g mL.sup.1) (brandGold Biotechnology) and grown overnight at 28 C. at 200 rpm. Next day, the 5 ml culture was split into two flasks containing 250 ml of liquid LB supplemented with spectinomicin (100 g mL.sup.1) and grown overnight under the same conditions. Grown cultures were pulled together, pelleted by centrifugation and resuspended in 250 ml of dipping solution (5% glucose (Fisher) in water and 200 l/L Silwet L-77 200 l L.sup.1 (Lehle Seeds)). Arabidopsis Col-0 plants grown on soil under 16 h light/8 h dark cycle and 24 C. until inflorescences were 15 cm long were transformed by floral dipping as described (Clough and Bent, 1998) and recovered for 24-48 h under a plastic dome. Plants were then watered and cared for until maturity and their seeds were harvested in bulk. T1 transformants were selected in 20 g ml.sup.1 phosphinothricin (GoldBio) in MS plates (4.33 g L.sup.1 Murashige & Skoog media (PhytoTech Labs), 10 g L.sup.1 sucrose (Fisher), 6 g L.sup.1 Bactroagar (Fisher)) supplemented with 300 g ml-1 timentin (GoldBio) and propagated in soil (50:50 mix of SunGro propagation mix and Jolly Gardener pro-line growing mix) under same growing conditions. T3 plants homozygous for the modules were identified in phosphinothricin and confirmed by genotyping using construct-specific primers.
(99) Seeds from T2 and T3 GUS-containing reporter lines, as well as T2, T3 and T4 fluorescent reporter lines, were surface-sterilized for 10-20 min with 50% (v/v) commercial bleach containing 3-4% sodium hypochlorite and 100 l L.sup.1 Triton X-100 (Pharmacia). Bleach was removed by progressive washes with sterile di water and seeds were plated on plain MS (4.33 g L.sup.1 Murashige & Skoog media (PhytoTech Labs), 10 g L.sup.1 sucrose, 6 g L.sup.1 Bactoagar) or MS plates supplemented with 10 M ACC (1-aminocyclopropane-1-carboxylic acid, PhytoTech Labs) or 200 ppm 1-MCP (1-methylcyclopropene, AgroFresh) using melted and precooled sterile 0.7% (w/v) low-melting point agarose (Fisher). Plates with seeds were stratified at 4 C. for two days, exposed to light for 1-2 hours at room temperature to restart the clock, wrapped in aluminum foil and incubated for three days in the dark at 22 C. Plates for each treatment were kept separately from each other during the germination process to avoid the different treatments interfering with one another.
(100) Three-day-old etiolated seedlings from the different treatments were fixed in cold 90% acetone and stained for GUS for 30 min, 2 h and overnight at 37 C. as described (Stepanova et al., 2005). Stained seedlings were optically cleared using freshly prepared ClearSee solution (Kurihara et al., 2015) for 7 days before imaging. Optically cleared GUS-stained seedlings were mounted on glass slides and imaged using a 5.0 RTV digital camera (Q Imaging, Surrey, BC, 904 Canada) under a Zeiss AxioSkop2 Plus microscope with Nomarski optics (Brumos, Zhao et al., 2019).
(101) Three-day-old etiolated seedlings from T2, T3 and T4 fluorescent reporter lines germinated under different treatments (see above) were mounted on glass slides and imaged using a DFC365 FX camera and a Zeiss Axioplan microscope. Objective 5 was used to image full seedlings (100% intensity, 812.5 ms Exposure, 2.2 Gain) and objective 20 (17% intensity, 587.5 ms Exposure, 1.5 Gain) was utilized for imaging root tip, root sections, root-hypocotyl junctions, hypocotyl sections and apical hook regions in the seedlings.
(102) Pre-selected seedlings from three-day-old etiolated T4 fluorescent reporter lines under epifluorescence microscopy, were analyzed at higher resolution using Zeiss LSM880 confocal microscope. The excitation/emission wavelengths for imaging were 488 nm/492-570 nm for YPet yellow fluorescent protein and the objective used was the water-immersion 40 (0.6 mm).
(103) Phenotypic Analysis of Ethylene-Inducible Fluorescent Reporters
(104) To test the functionality in planta of the new reporter constructs, 10xEBSnew, 10xEBSclassic and 2xEBS-S10 distal promoters fused to a triple yellow fluorescent protein (3xYPet) were individually transformed into Arabidopsis thaliana Col-0 wild type. Microscopy studies on three-day-old T2 seedlings germinated in the dark in the presence of the ethylene precursor ACC detected strong and moderate fluorescence for the 10xEBSnew:3xYPet and 10xEBSclassic:3xYPet reporters, respectively, in three independent lines examined per construct (
(105) In order to test the inducibility and specificity of the 10xEBSnew distal promoter, the lines harboring the 10xEBSnew:3xYPet reporter where tested in: (1) control conditions (mock) to determine whether the reporter was able to detect endogenous levels of ethylene; (2) in the presence of the ethylene precursor (10 M ACC) to demonstrate its ethylene-inducible behavior; and (3) in the presence of the ethylene receptor inhibitor (200 ppm 1-MCP) to establish the baseline of this reporter expression in the absence of endogenous ethylene signaling. The results shown in
(106) Taken together, these results demonstrate that 10xEBSnew:3xYPet is a highly sensitive, ethylene-inducible fluorescent reporter suitable for the detection of both basal and ACC-triggered ethylene signaling and showing no appreciable background activity in the presence of 1-MCP.
(107) Phenotypic Analysis of Ethylene-Inducible Histochemical Reporters
(108) To further increase the sensitivity of 10xEBSnew, the GUS (-glucoronidase) version of the reporter was also built, along with its mutant variant, mut10xEBSnew (that harbors nucleotide substitutions in the core EIN3 target site, see Table 2), and previously mentioned 10xEBSclassic and 2xEBS-S10 reporter versions. Transgenic lines were generated in the Arabidopsis thaliana Col-0 wild type background and T2 lines were tested in three-day-old seedlings germinated in the dark in 10M ACC. Overnight GUS staining of transgenic seedlings showed that in the presence of ACC the 10xEBSnew:GUS reporter was highly active in all tissues (
(109) The inducibility of 10xEBSnew:GUS reporter was also examined in mock- and ACC-treated plants (
(110) Shorter staining of these transgenic lines revealed that the GUS activity of the 10xEBSnew:GUS reporter lines treated with ACC was detectable in apical hooks and roots within 10 minutes of incubation with the X-gluc substrate. In contrast, ACC-treated 10xEBSclassic:GUS did not present detectable reporter activity until after 1 hour of staining, and ACC-exposed 5xEBS:GUS and 2xEBS-S10 lines required several hours of staining to become detectable (data not shown).
(111) These data demonstrate that 10xEBSnew outperforms all other constructs tested and represents a much more sensitive, strong, fast, and specific reporter suitable for monitoring both endogenous levels of ethylene activity and the response to a saturating exogenous ACC treatment in a large variety of tissues.
Example 3: Additional Ethylene Responsive Sequences
(112) To generate the EBSnew construct (see Table 2 above), 21 bp-long natural DNA elements from the Arabidopsis genome were extracted from EIN3 ChIP-seq data. These sequences consist of an 11 bp-long natural 2EBS(1) element flanked by 5 bp-long spacers naturally present in the genome upstream and downstream of the 11 bp core. The following two criteria were applied as filters to retrieve the best 2EBS(1) elements: (1) the sequences are located within the EIN3 ChIP-seq peaks; and (2) those 2EBS(1) sequences fall in the promoters of genes strongly inducible by ethylene.
(113) The 21 bp-sequences from 18 top hits that passed these two criteria were randomly stacked together in groups of 10 to generate multiple versions of 10xEBS. The resulting tandems were then bioinformatically screened using position weight matrix for the presence of EIN3-unrelated transcription factor (TF) binding sites unintentionally generated at repeat junctions. The top ten 10xEBS sequence stacks (those with the lowest number and quality of undesired TF hits) obtained from multiple algorithm runs are listed below, with the individual wild-type (WT) repeat variants separated by a | and the core conserved 2EBS(1) nucleotides in each repeat capitalized:
(114) TABLE-US-00003 1WTvariant (SEQIDNO:17) gtatcATgCAaTGaATcatcc|tcttgGTtCAaTGaATcgagt|tcaatATaCAtTGtATtatgg|gattg ATtCAaTGcATtgttc|tctcaATtCAtTGcACtcgta|tttaaATaCAaTGcATcatta|gtccgATtCAtTGcA Caacaa|attggATaCAaTGtATttgtc|aacagATaCAtTGaACattag|gagatATaCAtTGaATctata 2WTvariant (SEQIDNO:18) gtatcATgCAaTGaATcatcc|tcttgGTtCAaTGaATcgagt|tctcaATtCAtTGcACtcgta|tttaaA TaCAaTGcATcatta|gtccgATtCAtTGcACaacaa|attggATaCAaTGtATttgtc|aacagATaCAtTGa ACattag|gattgATtCAaTGcATtgttc|tcaatATaCAtTGtATtatgg|gagatATaCAtTGaATctata 3WTvariant (SEQIDNO:19) tctcgGTgCAaTGtATtggta|gtccgATtCAtTGcACaacaa|attggATaCAaTGtATttgtc|aacag ATaCAtTGaACattag|gattgATtCAaTGcATtgttc|tcaatATaCAtTGtATtatgg|gtatcATgCAaTGa ATcatcc|tcttgGTtCAaTGaATcgagt|tctcaATtCAtTGcACtcgta|gagatATaCAtTGaATctata 4WTvariant (SEQIDNO:20) tctcgGTgCAaTGtATtggta|gtccgATtCAtTGcACaacaa|attggATaCAaTGtATttgtc|aacag ATaCAtTGaACattag|gattgATtCAaTGcATtgttc|tcaatATaCAtTGtATtatgg|gtatcATgCAaTGa ATcatcc|tcttgGTtCAaTGaATcgagt|tctcaATtCAtTGcACtcgta|gagatATaCAtTGaATctata 5WTvariant (SEQIDNO:21) tctcgGTgCAaTGtATtggta|gtccgATtCAtTGcACaacaa|aacagATaCAtTGaACattag|gatt gATtCAaTGcATtgttc|tcaatATaCAtTGtATtatgg|gtatcATgCAaTGaATcatcc|tcttgGTtCAaTGa ATcgagt|tctcaATtCAtTGcACtcgta|tttaaATaCAaTGcATcatta|gagatATaCAtTGaATctata 6WTvariant (SEQIDNO:22) tcaatATaCAtTGtATtatgg|gtatcATgCAaTGaATcatcc|tcttgGTtCAaTGaATcgagt|gtccg ATtCAtTGcACaacaa|attggATaCAaTGtATttgtc|aacagATaCAtTGaACattag|gattgATtCAaTG cATtgttc|tctcaATtCAtTGcACtcgta|tttaaATaCAaTGcATcatta|gagatATaCAtTGaATctata 7WTvariant (SEQIDNO:23) tctcgGTgCAaTGtATtggta|gattgATtCAaTGcATtgttc|tcaatATaCAtTGtATtatgg|gtatcA TgCAaTGaATcatcc|tcttgGTtCAaTGaATcgagt|tctcaATtCAtTGcACtcgta|gtccgATtCAtTGcA Caacaa|attggATaCAaTGtATttgtc|aacagATaCAtTGaACattag|gagatATaCAtTGaATctata 8WTvariant (SEQIDNO:24) tcaatATaCAtTGtATtatgg|gtatcATgCAaTGaATcatcc|tcttgGTtCAaTGaATcgagt|tctca ATtCAtTGcACtcgta|tttaaATaCAaTGcATcatta|gattgATtCAaTGcATtgttc|gtccgATtCAtTGcA Caacaa|attggATaCAaTGtATttgtc|aacagATaCAtTGaACattag|gagatATaCAtTGaATctata 9WTvariant (SEQIDNO:25) tcaagATtCAaTGaACtccgt|tctcaATtCAtTGcACtcgta|tttaaATaCAaTGcATcatta|gattgA TtCAaTGcATtgttc|tcaatATaCAtTGtATtatgg|gtatcATgCAaTGaATcatcc|tcttgGTtCAaTGaAT cgagt|gtccgATtCAtTGcACaacaa|aacagATaCAtTGaACattag|gagatATaCAtTGaATctata 10WTvariant (SEQIDNO:26) tctcgGTgCAaTGtATtggta|gtccgATtCAtTGcACaacaa|aacagATaCAtTGaACattag|gatt gATtCAaTGcATtgttc|tctcaATtCAtTGcACtcgta|gaaagATaCAtTGaATgcgag|gtatcATgCAaT GaATcatcc|tcttgGTtCAaTGaATcgagt|tcaatATaCAtTGtATtatgg|gagatATaCAtTGaATctata
(115) Of these ten 10xEBS stacks, we chose the first sequence, WT variant 1 (SEQ ID NO:17), for further analysis. To optimize this sequence, the potential transcription factor binding sites at the flanks of each repeat were eliminated by replacing the key nucleotides within those target sites, thus likely abolishing the binding of undesired TFs. The resulting improved version of the 10xEBS variant 1 was named EBSnew.
(116) TABLE-US-00004 EBSnew(withthereplaced,non-naturalflanking nucleotidescapitalized) (SEQIDNO:14) gtatcatgcaatgaatcaAcc|tcttggttcaatgaatcgagt|Gcaata tacattgtattatgg|gatGgattcaatgcatCgttc|tctcaattcatt gcactcTta|tttaaatacaatgcatcaGta|gtccgattcattgcacaa cGa|attggatacaatgtatttgtG|aacagatacattgaacattag|ga gaGatacattgaatctata
(117) EBSnew is a tandem of 10 semi-synthetic, buffered 2EBS(1) elements spaced in a manner that places EIN3 dimers on the same side of the DNA double helix, with each 21 bp imperfect repeat taking exactly two helical turns.
(118) A mutant version of this sequence, mutEBSnew, in which the core conserved 2EBS(1) nucleotides presumed necessary for EIN3 binding were mutated (with one conserved nucleotide replaced per each half-site), was also generated to be employed as a negative control.
(119) TABLE-US-00005 mutEBSnew(withthe mutatedcorenucleotidesbolded)(SEQIDNO:15): gtatcaggcaatgactcaAcc|tcttggttgaacgaatcgagt|Gcaatat agattgtaatatgg|gatGgattaaacgcatCgttc|tctcaattcgtagc actcTta|tttaaatactaggcatcaGta|gtccgattccttgctcaacGa |attggctacaatgtaattgtG|aacagatagatagaacattag|gagaGc tacattgaaactata
(120) Both the optimized sequence, EBSnew, and its mutant version, mutEBSnew, were commercially synthesized and cloned into the GoldenBraid 3.0 entry vector, pUPD2, confirmed by sequencing, and used in the generation of reporter constructs.
(121) Twenty products of two additional runs, A and B, of the algorithm that optimized the sequences of ten best 10xEBS sequence stacks by eliminating the undesired TF-binding sites at the junctions of stacked WT variants 1 though 10 are listed below. These improved sequences should be functionally equivalent to the characterized EBSnew sequence, but have not been experimentally validated.
(122) Additional EBSnew variants 1 through 10 generated in A & B runs of the algorithm (with the replaced, non-natural flanking nucleotides capitalized) are provided below.
(123) TABLE-US-00006 1a-10a (SEQIDNO:27) gtatcatgcaatgaatcatcctcCtggttcaatgaatcgagttcaaAatacattgtattatgggGttgattcaatgcattgttc GctcaattcattgcactcTtatttaaatacaatgcatcCttagtccgattcattgcacaacGaattggatacaatgtatttgtAaacagat acattgaacattaTgagatatacattgaatctata (SEQIDNO:28) gtatcatgcaatgaatcatcctcCtggttcaatgaatcgagCtctcaattcattgcactcTtatttaaatacaatgcatcCttag tccgattcattgcacaacGaattggatacaatgtatttgtAaacagatacattgaacaGtaggattgattcaatgcattgtGctcaatata cattgtattatgggagaAatacattgaatctata (SEQIDNO:29) tctcggtgcaatgtattggtagCccgattcattgcacaacGaattggatacaatgtatttgtAaacagatacattgaacattT ggattgattcaatgcattgttctcTatatacattgtattatgggtatTatgcaatgaatcaAcctcttggttcaatgaatcgagtGctcaatt cattgcactcAtagagatatacattgaatctata (SEQIDNO:30) tctcggtgcaatgtattggtagCccgattcattgcacaacGaattggatacaatgtatttgtAaacagatacattgaacatta gTattgattcaatgcattgttctcTatatacattgtattatgggtatTatgcaatgaatcatcTtcttggttcaatgaatcgagtGctcaatt cattgcactcAtagagatatacattgaatctata (SEQIDNO:31) tctcggtgcaatgtattggtagCccgattcattgcacaaTaaaacagatacattgaacaAtaggattgattcaatgcattgtt ctcTatatacattgtattatgggtatTatgcaatgaatcatcctcCtggttcaatgaatcgagtGctcaattcattgcactcTtatttaaata caatgcatcaGtagagatatacattgaatctata (SEQIDNO:32) tcaatatacattgtattatgggtatAatgcaatgaatcatcTtcttggttcaatgaatcgGgtgtccgattcattgcacaacGa attggatacaatgtatttgtGaacagatacattgaacattagTattgattcaatgcattgttctctcTattcattgcactcgtTtttaaataca atgcatcaGtagagatatacattgaatctata (SEQIDNO:33) tctcggtgcaatgtattCgtagattgattcaatgcattgttctcTatatacattgtattatgggtatTatgcaatgaatcatcctc CtggttcaatgaatcgagttctcTattcattgcactcgtagtccAattcattgcacaacGaattggatacaatgtatttgtAaacagatac attgaacattaggagaGatacattgaatctata (SEQIDNO:34) tcaatatacattgtattatgggtatAatgcaatgaatcaCcctcttggttcaatgaatcgagttctcCattcattgcactcCtatt taaatacaatgcatcCttagattgattcaatgcattgttcTtccgattcattgcacaacGaattggatacaatgtatttgtGaacagataca ttgaacattaggagaGatacattgaatctata (SEQIDNO:35) tcaagattcaatgaactccTttctcaattcattgcactAgtatttaaatacaatgcatcaGtagattgattcaatgcattgttctc TatatacattgtattatgggtatTatgcaatgaatcaAcctcttggttcaatgaatcgagtgtccAattcattgcacaaTaaaacagata cattgaacattaTgagatatacattgaatctata (SEQIDNO:36) tctcggtgcaatgtattggtagCccgattcattgcacaaTaaaacagatacattgaacattTggattgattcaatgcattgttc tctGaattcattgcactcgtagCaagatacattgaatgcgaggtatAatgcaatgaatcatcctcttTgttcaatgaatcgagCtcaata tacattgtattatgggagaAatacattgaatctata 1b-10b (SEQIDNO:37) gtatcatgcaatgaatcaAcctcttggttcaatgaatcgagttcaTtatacattgtattatgggatGgattcaatgcatAgttct ctcaattcattgcactcTtatttaaatacaatgcatcCttagtccgattcattgcacaacGaattggatacaatgtatttgtGaacagatac attgaacaAtaggagatatacattgaatctata (SEQIDNO:38) gtatcatgcaatgaatcaAcctcttggttcaatgaatcgagtGctcaattcattgcactcTtatttaaatacaatgcatcCtta gtccgattcattgcacaacGaattggatacaatgtatttgtAaacagatacattgaacattagTattgattcaatgcattgtGctcaatata cattgtattatgAgagatatacattgaatctata (SEQIDNO:39) tcaagattcaatgaactccTttctcaattcattgcactcTtagattgattcaatgcattgttctcTatatacattgtattatgggtat TatgcaatgaatcatcctcCtggttcaatgaatcgagtgtccAattcattgcacaacGaattggatacaatgtatttgtAaacagatac attgaacatAaggagatatacattgaatctata (SEQIDNO:40) tctcggtgcaatgtattggtagtGcgattcattgcacaacGaattggatacaatgtatttgtAaacagatacattgaacaGta ggattgattcaatgcattgttctcTatatacattgtattatgggtatTatgcaatgaatcatcctcCtggttcaatgaatcgagtGctcaatt cattgcactcAtagagatatacattgaatctata (SEQIDNO:41) tctcggtgcaatgtattggAagtccgattcattgcacaaTaaaacagatacattgaacattaggaCtgattcaatgcattgtt ctcTatatacattgtattatgggtatTatgcaatgaatcaAcctcttggttcaatgaatcgagtGctcaattcattgcactcTtatttaaata caatgcatcaAtagagatatacattgaatctata (SEQIDNO:42) tcaatatacattgtattatgggtatAatgcaatgaatcatcctAttggttcaatgaatcgagtgtTcgattcattgcacaacGa attggatacaatgtatttgtGaacagatacattgaacattagAattgattcaatgcattgttctcAcaattcattgcactcCtatttaaatac aatgcatcaCtagagatatacattgaatctata (SEQIDNO:43) tctcggtgcaatgtattggtagCttgattcaatgcattgttctcTatatacattgtattatgggtatTatgcaatgaatcaCcctc ttggttcaatgaatcgagttctTaattcattgcactAgtagtccgattcattgcacaacGaattggatacaatgtatttgtGaacagatac attgaacattaTgagatatacattgaatctata (SEQIDNO:44) tcaatatacattgtattatgggtatAatgcaatgaatcatGctcttggttcaatgaatcgagttctTaattcattgcactcgtTttt aaatacaatgcatcaCtagattgattcaatgcatAgttcgtccgattcattgcacaacGaattggatacaatgtatttgtAaacagatac attgaacaGtaggagatatacattgaatctata (SEQIDNO:45) tcaagattcaatgaactccTttctcaattcattgcactcgtTtttaaatacaatgcatcaGtagattgattcaatgcattgttctc TatatacattgtattatgggtatTatgcaatgaatcCtcctcttggttcaatgaatcgagtgtTcgattcattgcacaaTaaaacagatac attgaacattaggagaGatacattgaatctata (SEQIDNO:46) tctcggtgcaatgtattggAagtccgattcattgcacaaTaaaacagatacattgaacatCaggattgattcaatgcattgtt ctctcTattcattgcactcgtagTaagatacattgaatgcgaggtatAatgcaatgaatcatcctAttggttcaatgaatcgagtGcaat atacattgtattatgggCgatatacattgaatctata
Example 4: The EBSnew Promoter Enables Ethylene Signal Detection in Tomato Plants
(124) The EBSnew distal promoter (see Example 2) was combined with a minimal (46) 35S promoter, the mCherry red fluorescent protein coding sequence, the peroxisome targeting sequence KSRM, and the 35S terminator using the Golden Braid technology as previously described in Example 2. The final constructs were transformed into Agrobacterium tumefaciens and used to generate transgenic tomato (Solanum lycopersicum cv. M82) using the standard callus transformation protocol as described in Patel et al. (2015, Tomato plants overexpressing a celery mannitol dehydrogenase (MTD) have decreased susceptibility to Botrytis cinerea. American Journal of Plant Sciences, 6, 1116-1125).
(125) To examine the effects of ethylene on the expression of the mCherry reporter, seeds of T1 tomato plants (Solanum lycopersicum cv. M82) were surface-sterilized in 70% (v/v) ethanol for 3 minutes, followed by 30% (v/v) commercial bleach (1.8% sodium hypochlorite final concentration) for 7 minutes, and rinsed five times with sterile deionized water to wash the bleach off Sterilized seeds were placed in Magenta boxes containing solid (5 g/L agar) medium with half-strength Murashige & Skoog basal salts, 1% sucrose pH 6, and grown for four days in the dark. Wild type M82 and transgenic tomato seedlings harboring the 10xEBSnew:mCherry reporter were then transferred to fresh Petri dishes containing the media described above supplemented or not supplemented with the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC, 10 M), kept for 24 hours in the dark at room temperature and imaged with the fluorescence microscope (Zeiss Axioimager M.2).
(126) Under the fluorescence microscope (Zeiss Axioimager M.2), no mCherry fluorescence signal in the peroxisomes was observed in wild type roots or in transgenic roots not exposed to the ethylene precursor ACC (
(127) These results indicate that the EBSnew promoter sequences can be used to generate highly sensitive, ethylene-inducible reporters using different fluorescent proteins and subcellular localization signals not only in Arabidopsis but also in very distantly related plant species such as tomato and potentially many other plant species.
(128) The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.