Recombinant protein produced from cholinesterase gene derived from <i>Pseudomonas aeruginosa </i>and the composition comprising the same for treating or preventing a neurological disease

Abstract

The present invention relates to the present invention provides novel recombinant protein produced from cholinesterase gene derived from Pseudomonas aeruginosa and the composition comprising the same for treating or preventing a neurological disease.

Claims

1. A recombinant protein of SEQ ID NO: 1 (NP protein) that maintains ACHE activity without being inhibited by organophosphorus and carbamate-based nerve agents, which is produced from cholinesterase gene of SEQ ID NO: 2 (designated as NP gene hereinafter) derived from Pseudomonas aeruginosa.

2. A cholinesterase gene of SEQ ID NO: 2 (NP gene) encoding the recombinant protein of SEQ ID NO: 1 (designated as NP protein hereinafter) that maintains ACHE activity without being inhibited by organophosphorus and carbamate-based nerve agents, which is derived from Pseudomonas aeruginosa.

3. A pharmaceutical composition comprising the recombinant protein of SEQ ID NO: 1, as an active ingredient for treating or preventing a poisoning by nerve agents or a neurological system disorder.

4. The pharmaceutical composition according to claim 3, wherein said poisoning by nerve agents is a poisoning by chemical warfare agent selected from the group consisting of GA (tabun; dimethylphosphoramidocyanidic acid ethyl ester), GB {sarin, methylphosphonofluoridic acid (1-methylethyl) ester)}, GD (soman, methylphosphonofluoridic acid 1,2,2-trimethylpropyl ester), GE (O-isopropyl-methyl-phosphonofluoridate), GF (cyclohexyl sarin, methylphosphonofluoridic acid cyclohexyl ester), VX {methylphosphonothioic acid S-[2-[bis (1-methylethyl) amino]ethyl]O-ethyl ester)}, VE {S-(Diethylamino) ethyl O-ethyl ethylphosphonothioate}, VG {Tetram; O, O-diethyl S-[2-(diethylamino) ethyl] phosphorothioate} and VM (Edemo; S-[2-(Diethylamino) ethyl] O-ethyl methylphosphonothioate).

5. The pharmaceutical composition according to claim 3, wherein said neurological system disorder is acute cholinergic neurological symptoms, excitatory cranial nerve damage caused by inhibition of -aminobutyric acid (GABA) receptor, or organophosphate-induced delayed polyneuropathy due to neurotoxic esterase inhibition.

6. The pharmaceutical composition according to claim 5, wherein said neurological system disorder is selected from the group consisting of respiratory distress due to bronchoconstriction, convulsions, hypersecretion and respiratory muscle paralysis due to suppression of the respiratory center, pesticide poisoning, cramping, headache, hyperhidrosis, incontinence, irritable disease, tic disorder, early dementia symptoms, Parkinson's disease, asthma, and cholinergic urticaria disease.

7. The pharmaceutical composition according to claim 6, wherein said pesticide is a pesticide poisoning caused by organophosphorus-based pesticide selected from the group consisting of parathion, malathion, methyl parathion, chlorpyrifos, diazinon, dichlorvos, phosmet, fenitrothion, tetrachlorvinphos, azamethiphos, and azinphos-methyl terbufos; or a carbamate-based pesticide selected from the group consisting of Propoxur, carbofuran, aldicarb, carbaryl, ethienocarb, fenobucarb, oxamyl and methomyl.

8. A pharmaceutical composition comprising the recombinant protein of claim 1 and an existing therapeutic agent for nervous system disorder, as an active ingredient for the prevention or improvement of a poisoning by nerve agents or a neurological system disorder.

9. The pharmaceutical composition according to claim 8, wherein said existing therapeutic agent for nervous system disorder is selected from the group consisting of pyridostigmine, benztropine, hyoscine (scopolamine), pyridonium oxime, diazepam, enzyme scavenger, ACHE (acetylcholinesterase), BCHE (butylcholinesterase), CaE (Carboxylesterase) and exogenous enzyme.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 depicts the expression procedure of inventive NP protein (cloning diagram).

BEST MODE FOR CARRYING OUT THE INVENTION

(2) It will be apparent to those skilled in the art that various modifications and variations can be made in the compositions, use and preparations of the present invention without departing from the spirit or scope of the invention.

(3) The present invention is more specifically explained by the following examples. However, it should be understood that the present invention is not limited to these examples in any manner.

EXAMPLES

(4) The following Examples and Experimental Examples are intended to further illustrate the present invention without limiting its scope.

Example 1. Preparation of Inventive NP Protein (Table 1)

(5) 1-1. Expression and Purification of NP Protein

(6) NP gene (SEQ ID NO: 2) from the genomic DNA of Pseudomonas aeruginosa (KCCM no. 11328, Korea Microbial Conservation Center) was amplified with PCR amplifier (Thermal cycler, Bioer Technology) using a primer-1 (5-CAT ATG CAC ACA TCC CCG CTG-3; SEQ ID NO: 3), and primer-2 (5-CTC GAG TCA GCG CGC GTA GCG-3; SEQ ID NO: 4). The obtained PCR product was inserted into the TA cloning vector (Cat. No. RC013, RBC), cloned into host E. coli DH5a (Cat. No. RH617, RBC) and the NP gene sequence (sequences) was confirmed by analysis.

(7) The NP gene whose sequence was confirmed, was transferred to PET28a (an expression vector, Cat. No. 69864-3CN, novagen) using a restriction enzyme (Nde I, Cat. No. R006, Xho Cat. No. R007, enzynomics) and the gene was recombined into a vector containing six histidines (6 His) in order to facilitate expression. (See FIG. 1)

(8) The recombinant NP plasmid was transformed with BL21 (DE3) (Cat. No. 69450, Novagen) and the gene expression was induced with 0.4 mM IPTG (Isopropyl -D-1-thiogalactopyranoside, Cat. No.) for 18 hours.

(9) The cultured cells were collected through a centrifuge (1730R, LABOGENE), lysed with an ultrasonic processor (Coprotech Korea) at low temperature, and purified using HisTrap column (Cat. No. 29051021, GE healthcare) to determine the solubility of the enzyme.

(10) Purification was performed by removing the salt using a HiTrap Desalting column (Cat. No. 29048684, GE healthcare) and replacing the buffer with PBS (phosphate buffered saline).

(11) Protein concentration was measured according to the Bradford method (Cat. No. 5000006, Bio-rad) using bovine serum albumin (BSA; Bo5000 serum albumin, A500023, Biobasic) as a standard.

(12) Through the above purification process, purified cholinesterase recombinant protein (SEQ ID NO: 1) was obtained (95% or more purity, designated as NP protein hereinafter), which are used as a test samples in following experiment.

(13) TABLE-US-00001 TABLE1 SequenceList SEQIDNO Sequence 1 MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuValProArgGly SerHisMetHisThrSerProLeuLeuAlaProValArgGlnIleHisAlaPhe GlyAspSerTyrSerAspAsnGlyGluSerGlnArgLeuThrArgGluMet LeuAlaLysGlyIleAlaGlyAlaGlnAlaLeuProGlyGluValTyrTrpGln GlyArgTrpSerAsnGlyProThrAlaValGluValLeuAlaArgGlnLeu GlyAlaGlnLeuAlaAspHisAlaValGlyGlyAlaLysSerGlyAlaAsp AsnTyrTyrSerTrpMetSerAlaTyrArgHisThrGlyLeuAlaGlyGln ValAspAlaTyrLeuAlaThrLeuAspGlyLysProValAspGlyGlnAla LeuHisPheIlePheValSerAlaAsnAspPhePheGluHisGluAspPheAla GlyGluGlnProLeuGluGlnLeuAlaGlySerSerValAlaAsnIleArgAla AlaValGlnArgLeuGlyGluAlaGlyAlaArgArgPheLeuValValSer SerThrAspLeuSerValValProAlaValValValGlyAsnArgValGlu ArgAlaGlnHisTyrLeuGlnAlaValAsnAlaSerLeuProIleGlnLeuAla AlaLeuArgLysThrArgGlyLeuGluLeuAsnTrpPheAspHisLeuThr PheSerArgHisLeuArgArgAsnProAlaArgTyrGlyLeuValGluLeu AspAlaProCysGlnProThrGlnProSerValArgProAlaCysAlaAsnPro AspGlnTyrTyrPheTrpAspGluTrpHisProThrArgArgValHisGln LeuAlaGlyGluAlaMetAlaAlaArgTyrAlaArg 2 ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCC TGGTGCCGCGCGGCAGCCATATGCACACATCCCCGCTGCT CGCGCCGGTACGGCAGATCCACGCCTTCGGCGACAGCTAT TCGGACAACGGCGAAAGCCAGCGACTGACCCGCGAGATGC TCGCCAAGGGCATCGCCGGCGCCCAGGCATTGCCCGGCGA AGTCTACTGGCAGGGCCGCTGGAGCAACGGCCCGACCGCC GTCGAGGTGCTCGCCCGCCAGCTTGGTGCGCAACTGGCCG ACCATGCGGTGGGCGGCGCCAAGAGCGGAGCGGACAACTA CTACAGCTGGATGAGCGCCTACCGCCATACCGGCCTCGCC GGCCAGGTCGACGCCTACCTCGCCACGCTGGACGGCAAGC CGGTCGATGGCCAGGCGCTGCACTTCATCTTCGTCTCCGC CAACGATTTCTTCGAGCACGAGGATTTCGCCGGCGAGCAG CCCCTGGAACAACTGGCCGGCAGCAGCGTGGCGAACATCC GCGCCGCGGTGCAGCGTCTCGGAGAGGCCGGCGCACGACG CTTCCTGGTGGTCAGTTCGACCGACCTGAGCGTGGTCCCG GCGGTGGTCGTCGGCAACCGGGTCGAGCGTGCGCAGCACT ACCTGCAAGCGGTCAACGCCAGCCTGCCGATCCAGCTCGC CGCCCTGCGCAAGACCCGCGGCCTGGAGCTGAACTGGTTC GACCATCTCACCTTCAGCCGCCACTTGCGGCGCAACCCGG CACGCTACGGCCTGGTGGAGCTGGACGCGCCCTGCCAGCC GACCCAGCCCAGCGTCCGCCCGGCCTGCGCCAACCCGGAC CAGTACTACTTCTGGGACGAGTGGCATCCGACCCGGCGCG TGCACCAACTGGCCGGCGAAGCGATGGCGGCGCGCTACGC GCGCTGA 3 primer-1:5-CATATGCACACATCCCCGCTG-3 4 primer-2:5-CTCGAGTCAGCGCGCGTAGCG-3

Experimental Example 1. Determination of the Inhibitory Activity on ACHE Activity Inhibitor

(14) In order to determine the inhibitory activity of the inventive NP protein on ACHE activity inhibitor, following test was performed by the Ellman esterase assay disclosed in the literature (Ellman G L, Courtney K D, Andres V, Feather-Stone RM. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol. 1961 July; 7:88-95).

(15) 1-1. Test Procedure

(16) PBS (LB004-01, Welgene) was used as a negative control group and ACHE extracted from eel (Cat. No., C3389, Sigma) was used as positive control group.

(17) 100 mM NaHPO4 (pH 8.6, SP1010, Geogiachem.) was used as a buffer solution and 75 mM acetylthiocholine (Cat. No., A5626, Sigma) was used as a substrate.

(18) 10 mM DTNB {5,5-Dithiobis (2-nitrobenzoic acid), Cat. No., D8130, Sigma} was used for developing agent. trichlorfon (Cat. No., 45698, Sigma) was used as an organophosphorus-based pesticide and both of Carbofuran (Cat. No., 32056, Sigma) and propoxur (Cat. No., 45644, Sigma) were used as carbamate-based pesticide.

(19) 225 L of buffer solution, 3 L of acetylthiocholine, 7.5 L of DTNB and 14.5 L of sterilized distilled water were mixed together. 50 L of ACHE (NP or ACHE from eel) was added to the solution to the extent that total volume of the reaction solution reached to 300 L and reacted together for 5 mins at 25 C. to determine the absorbance of the solution at 412 nm using by spectrometer (Multiskan Go., Thermo Scientific).

(20) The inhibitory activity of the inventive NP protein as well as the positive control group containing Trichlrofon or Carbofuran on ACHE activity inhibitor was determined by comparing with the absorbance of negative control group.

(21) 1-2. Test Result

(22) As can be seen Table 2, it has been confirmed that the ACHE activity in the test group treated with NP protein was not inhibited by organophosphorous and carbamate compounds, while the ACHE activity in the control group treated with ACHE extracted with eel together with various pesticides (Trichlorfon, Carbofuran, Propoxur) was reduced by about 85-96%.

(23) TABLE-US-00002 TABLE 2 Inhibition Activity Of ACHE Activity Sample* Activity rate (%) ACHE (EE) 100 ACHE (EE) + Carbofuran 3.4 ACHE (EE) + Propoxur 25.6 ACHE (EE) + Trichlorfon 8.7 NP 100 NP + Carbofuran 99.3 NP + Propoxur 99.1 NP + Trichlorfon 93.8 *ACHE (EE): ACHE extracted from eel

Experimental Example 2. Determination of the Survival Rate

(24) In order to determine the survival rate of the inventive NP protein on pesticide-exposed animal model, following test was performed by the procedure disclosed in the literature (Gupta, Ramesh C., Carbofuran toxicity, Journal of Toxicology and Environmental Health, Part A, 43:4, pp 383-418, 1994).

(25) 2-1. Test Procedure

(26) Specific pathogen-free female ICR mice (about 20 g, aged 6 weeks) were purchased from ORIENT Co. (Seoul, Korea) and acclimated with the experimental environment for 1 week.

(27) 250 g of NP protein was intraperitoneally injected to the mice as a test sample group to observe the behavior of the mice for 40 mins and 30 g of carbofuran and 9 mg of trichlorfon were intraperitoneally injected to the mice to observe the survival rate of the mice for 30 mins.

(28) The group intraperitoneally injected with only 30 g of carbofuran or 9 mg of trichlorfon were used as positive control groups to observe the survival rate of the mice and the group intraperitoneally injected with only distilled water containing 250 g of NP protein was used as a negative control group to observe the survival rate of the mice.

(29) 2-2. Test Result

(30) As shown in Table 3, the group pretreated with NP protein showed 100% survival rate whereas the positive control group treated with only carbofuran or trichlorfon showed 0% and 60% survival rate.

(31) TABLE-US-00003 TABLE 3 Effect On Survival Rate Sample* Survival rate (%) PBS 100 NP 100 Carbofuran 0 NP + Carbofuran 100 Trichlorfon 60 NP + Trichlorfon 100 *PBS: phosphate buffer saline

(32) It has been confirmed that the NP protein showed potent treating or preventing activity from the poisoning by nerve agents or a neurological system disorder respectively.

Experimental Example 3. Determination of the Blood Level of Choline

(33) In order to determine the effect on the blood level of choline of the inventive NP protein in pesticide-exposed animal model, following test was performed by the procedure disclosed in the literature (Choline/Acetylcholine Quantification Colorimetric/Fluorometric Kit, Biovision incorporated 155 S Milpitas Boulevard, Milpitas, Calif. 95035 USA).

(34) 3-1. Test Procedure

(35) Specific pathogen-free female ICR mice (about 20 g, aged 6 weeks) were purchased from ORIENT Co. (Seoul, Korea) and acclimated with the experimental environment for 1 week.

(36) The mice used in Experimental Example 2 intraperitoneally injected with 250 g of NP protein as a test sample group, were killed with carbon dioxide gas (Shinyang Oxygen Industry, Korea) and the blood was collected from the heart to isolate the serum.

(37) The choline level of blood serum was determined Choline/Acetylcholine Quantification Colorimetric/Fluorometric Kit (Cat. No. K615-100, Biovision).

(38) 1 L of serum was added to 49 L of buffer solution in the kit and the reaction mixture containing 444 of buffer solution, 2 L of choline probe, 2 L of ACHE and 2 L of enzyme mixture solution was added thereto to react together in the shadow at 25 C. for 30 mins.

(39) 30 mins after the reaction, the absorbance of the reaction solution was determined at 570 nm using by spectrometer (Multiskan Go., Thermo Scientific) and the determined level was transformed into absolute value by comparing with the level of standard curve.

(40) The level of choline was calculated according to following Math. 1
Blood Level of choline(nmole/mL or micromole)=(calculated level of choline through standard curve)/(the amount of samples in each well;mL).[Math. 1]
3-2. Test Result

(41) As shown in Table 4, the group pretreated with NP protein showed reduced amount of acetylcholine whereas the positive control group treated with only carbofuran or trichlorfon showed sharply increased amount of acetylcholine.

(42) It has been confirmed that the NP protein showed potent treating or preventing activity from the poisoning by nerve agents or a neurological system disorder respectively.

(43) TABLE-US-00004 TABLE 4 Change In The Level Of Blood Acetylcholine Sample* Concentration (nmol/mL) PBS 1.0 NP 1.5 Carbofuran 1.8 NP + Carbofuran 0.5 Trichlorfon 1.4 NP + Trichlorfon 0.7 *PBS: phosphate buffer saline

Experimental Example 4 Determination of the Change in ACHE Activity

(44) In order to determine the change of ACHE activity of test sample, following test was performed by the Ellman esterase assay disclosed in the literature (Ellman G L, Courtney K D, Andres V, Feather-Stone RM. Anew and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol. 1961 July; 7:88-95).

(45) 4-1. Test Procedure

(46) Specific pathogen-free female ICR mice (about 20 g, aged 6 weeks) were purchased from ORIENT Co. (Seoul, Korea) and acclimated with the experimental environment for 1 week.

(47) The mice used in Experimental Example 2 intraperitoneally injected with 250 g of NP protein as a test sample group, were killed with carbon dioxide gas (Shinyang Oxygen Industry, Korea) and the blood was collected from the heart to isolate the serum.

(48) The choline level of blood serum was determined Choline/Acetylcholine Quantification Colorimetric/Fluorometric Kit (Cat. No. K764-100, Biovision) and ACHE (EE) (Catalog No., C3389, Sigma) extracted from eel was used as a positive control group.

(49) 30 L of serum was added to 20 L, of buffer solution in the kit and the reaction mixture containing 45 L of buffer solution, 2 L of choline oxidase enzyme mix solution, 2 L of ACHE probe and 1 L of ACHE substrate was added thereto to react with the serum together at 25 C. for 30 mins.

(50) 30 mins after the reaction, the absorbance of the reaction solution was determined at every 1 min at 570 nm using by spectrometer (Multiskan Go., Thermo Scientific) and the determined level was calculated according to following Math. 2
ACHE activity=(the definition of 100mU: the amount of enzyme to generate 1.0 nmol choline per 1 min at pH 7.4).[Math. 2]
4-2. Test Result

(51) As shown in Table 5, the group treated with NP protein showed potently increased sensitivity of ACHE activity by about 100 fold than that of positive control group treated with the identical concentration of ACHE (EE).

(52) It has been confirmed that the NP protein showed potent treating or preventing activity from the poisoning by nerve agents or a neurological system disorder respectively.

(53) TABLE-US-00005 TABLE 5 CHANGE IN THE ACHE ACTIVITY Sample Activity (OD.sub.412) PBS 0 ACHE (EE) (3 g) 1.042 NP (0.03 g) 1.480 * PBS: phosphate buffer saline

(54) As shown in Table 6, the group pretreated with NP protein showed increased ACHE activity comparing with negative control group whereas the positive control group treated with only carbofuran or trichlorfon showed decreased ACHE activity.

(55) It has been confirmed that the NP protein showed potent treating or preventing activity from the poisoning by nerve agents or a neurological system disorder respectively and particularly, the neurological disorder caused by the uncontrolled mechanism of acetylcholine.

(56) TABLE-US-00006 TABLE 6 Change In ACHE Activity Sample* Concentration (mU/mL) PBS 591.8 NP 1,410 Carbofuran 463.8 NP + Carbofuran 1,266 Trichlorfon 117.7 NP + Trichlorfon 1,051 *PBS: phosphate buffer saline

MODE FOR THE INVENTION

(57) Hereinafter, the formulating methods and kinds of excipients will be described, but the present invention is not limited to them. The representative preparation examples were described as follows.

(58) Preparation of Injection

(59) NP protein: 100 mg Sodium metabisulfite: 3.0 mg Methyl paraben: 0.8 mg Propyl paraben: 0.1 mg Distilled water for injection: optimum amount Injection preparation was prepared by dissolving active component, controlling pH to about 7.5 and then filling all the components in 2 ml ample and sterilizing by conventional injection preparation method. Preparation of Powder NP protein: 500 mg Corn Starch: 100 mg Lactose: 100 mg Talc: 10 mg Powder preparation was prepared by mixing above components and filling sealed package.
Preparation of Tablet NP protein 200 mg Corn Starch 100 mg Lactose 100 mg Magnesium stearate optimum amount Tablet preparation was prepared by mixing above components and entabletting.
Preparation of Capsule NP protein: 100 mg Lactose: 50 mg Corn starch: 50 mg Talc: 2 mg Magnesium stearate optimum amount Tablet preparation was prepared by mixing above components and filling gelatin capsule by conventional gelatin preparation method.
Preparation of Liquid NP protein: 1000 mg Sugar: 20 g Polysaccharide: 20 g Lemon flavor: 20 g Liquid preparation was prepared by dissolving active component, and then filling all the components in 1000 ml ample and sterilizing by conventional liquid preparation method.
Preparation of Health Food NP protein: 1000 mg Vitamin mixture: optimum amount Vitamin A acetate: 70 g Vitamin E: 1.0 mg Vitamin B.sub.10: 13 mg Vitamin B.sub.2: 0.15 mg Vitamin B6: 0.5 mg Vitamin B1: 20.2 g Vitamin C: 10 mg Biotin: 10 g Amide nicotinic acid: 1.7 mg Folic acid: 50 g Calcium pantothenic acid: 0.5 mg Mineral mixture: optimum amount Ferrous sulfate: 1.75 mg Zinc oxide: 0.82 mg Magnesium carbonate: 25.3 mg Monopotassium phosphate: 15 mg Dicalcium phosphate: 55 mg Potassium citrate: 90 mg Calcium carbonate: 100 mg Magnesium chloride: 24.8 mg

(60) The above mentioned vitamin and mineral mixture may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention.

(61) Preparation of Health Beverage

(62) NP protein: 1000 mg Citric acid: 1000 mg Oligosaccharide: 100 g Apricot concentration: 2 g Taurine: 1 g Distilled water: 900 Mq

(63) Health beverage preparation was prepared by dissolving active component, mixing, stirred at 85 C. for 1 hour, filtered and then filling all the components in 1000 ml ample and sterilizing by conventional health beverage preparation method.

(64) The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

INDUSTRIAL APPLICABILITY

(65) As described in the present invention, the present invention provides a recombinant protein produced from cholinesterase gene derived from Pseudomonas aeruginosa and the composition comprising the same for treating or preventing a neurological disease and the inventive protein showed potent treating effect on the poisoning by nerve agents or a neurological system disorder, which is confirmed by various experiments, for example, determination of the inhibitory activity on ACHE activity inhibitor (Experimental Example 1), determination of the survival rate in pesticide-exposed animal model (Experimental Example 2), determination of the blood level of choline in pesticide-exposed animal model (Experimental Example 3), determination of the change in ACHE activity (Experimental Example 4) etc. Therefore, the inventive protein of the present invention can be usefully used in a pharmaceutical composition, health functional food, and health supplement food for preventing and treating a neurological disease.