Microbial approach for the production of long chain compounds

12325859 ยท 2025-06-10

Assignee

Inventors

Cpc classification

International classification

Abstract

This disclosure describes recombinant Megasphaera microbes designed to include increased consumption of acetate, increased carbon flux to butyryl-CoA and/or hexanoyl-CoA, increased production of butyrate and/or hexanoate, or a combination thereof, than a comparable control. This disclosure also describes methods that generally include growing such recombinant microbes under conditions effective for the recombinant microbes to consume greater amounts of acetate, produce increased amounts of butyryl-CoA and/or hexanoyl-CoA, produce increased amounts of butyrate and/or hexanoate, or a combination thereof.

Claims

1. A recombinant Megasphaera microbe genetically modified to (i) consume a greater amount of acetate than a comparable control microbe, or (ii) produce a greater amount of butyrate, hexanoate, or a combination thereof, than a comparable control microbe, or (iii) increase carbon flux to butyryl-CoA and/or hexanoyl-CoA than a comparable control microbe, or a combination thereof, wherein the recombinant Megasphaera microbe comprises a mutation of a CoA-transferase coding region, a mutation of a glyoxalase coding region, or a mutation of a lyase coding region, and the comparable control microbe is a microbe genetically identical to the recombinant Megasphaera microbe except for the mutation of the CoA-transferase coding region, the glyoxalase coding region, or the lyase coding region.

2. The recombinant Megasphaera microbe of claim 1, wherein the recombinant Megasphaera microbe is M. elsdenii.

3. The recombinant Megasphaera microbe of claim 2, wherein the M. elsdenii is a modified ATCC 25940.

4. The recombinant Megasphaera microbe of claim 1, wherein the mutation of the CoA-transferase coding region comprises a deletion of the CoA-transferase coding region.

5. The recombinant Megasphaera microbe of claim 1, wherein the CoA-transferase coding region encodes a propionyl-CoA transferase.

6. The recombinant Megasphaera microbe of claim 5, wherein propionate production by the recombinant Megasphaera microbe is undetectable.

7. The recombinant Megasphaera microbe of claim 1, wherein the CoA-transferase coding region is MELS_0742 (SEQ ID NO: 22), MELS_0464 (SEQ ID NO: 23), MELS_1631 (SEQ ID NO: 24), or MELS_1130 (SEQ ID NO: 25), or a combination thereof.

8. The recombinant Megasphaera microbe of claim 7, wherein the recombinant Megasphaera microbe comprises a mutation of at least 1, CoA-transferase coding regions selected from MELS_0742 (SEQ ID NO: 22), MELS_0464 (SEQ ID NO: 23), and MELS_0034 (SEQ ID NO: 26), or mutation of all 3 CoA-transferase coding regions.

9. The recombinant Megasphaera microbe of claim 1, wherein the mutation of the glyoxalase coding region comprises a deletion of the glyoxalase coding region.

10. The recombinant Megasphaera microbe of claim 9, wherein the glyoxalase coding region is MELS_0743 (SEQ ID NO: 27).

11. The recombinant Megasphaera microbe of claim 1, wherein the mutation of the lyase coding region comprises a deletion of the lyase coding region.

12. The recombinant Megasphaera microbe of claim 11, wherein the lyase coding region is MELS_0745 (SEQ ID NO: 28).

13. The recombinant Megasphaera microbe of claim 1, wherein the amount of butyrate or hexanoate produced is at least 2-fold greater than the comparable control microbe.

14. The recombinant Megasphaera microbe of claim 1, wherein the consumption of acetate is at least 2-fold greater than the comparable control microbe.

15. A recombinant Megasphaera microbe comprising a mutation of a pyrF coding region to result in undetectable expression of the pyrF coding region (SEQ ID NO: 29).

16. The recombinant Megasphaera microbe of claim 15, wherein the mutation is a deletion of the pyrF coding region.

17. The recombinant Megasphaera microbe of claim 15, wherein the Megasphaera microbe is M. elsdenii.

18. The recombinant Megasphaera microbe of claim 17, wherein the M. elsdenii is a modified ATCC 25940.

19. The recombinant Megasphaera microbe of claim 15, wherein the pyrF coding region is MELS_RS04415 (SEQ ID NO: 2).

20. A method for increasing carbon flux to acetoacetyl-CoA, comprising: incubating the recombinant Megasphaera microbe of claim 1 with lactate as a carbon source under conditions suitable for replication, wherein the carbon flux to acetoacetyl-CoA in the recombinant Megasphaera is at a level greater than the comparable control microbe.

21. A method for producing butyrate, hexanoate, or combination thereof, comprising: incubating the recombinant Megasphaera microbe of claim 1 with lactate as a carbon source under conditions suitable for replication, wherein the recombinant Megasphaera produces butyrate, hexanoate, or combination thereof at a level greater than the a comparable control microbe.

22. A method for genetically engineering a Megasphaera, comprising: providing the recombinant Megasphaera of claim 15, transforming the recombinant Megasphaera with a plasmid comprising a pyrF coding region and a mutagenic cassette, wherein the mutagenic cassette of the plasmid comprises a marker flanked by DNA sequences, wherein the DNA sequences are selected to result in homologous recombination between the plasmid and two regions of DNA present in the recombinant Megasphaera that flank a coding region targeted for mutation; and incubating the transformed recombinant Megasphaera under conditions suitable for positive selection of the transformed recombinant Megasphaera and counter selection of the transformed recombinant Megasphaera to select for those that have lost the pyrF coding region, wherein the transformed recombinant Megasphaera identified by the positive and counter selection comprise a mutation of the coding region targeted for mutation.

23. The method of claim 22, wherein the mutagenic cassette of the plasmid further comprises attachment sites flanking the marker, wherein the attachment sites are between the marker and the DNA sequences, and wherein the attachment sites are identified by a recombinase that can promote recombination between the two attachment sites and deletion of the marker flanked by the attachment sites.

24. The method of claim 22, wherein the mutation of the coding region targeted for mutation comprises a deletion of the targeted coding region.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) The following detailed description of illustrative embodiments of the present disclosure may be best understood when read in conjunction with the following drawings.

(2) FIG. 1 shows a metabolic reconstruction of central carbon metabolism of M. elsdenii.

(3) FIG. 2 shows an adaptation of predicted M. elsdenii ATCC 25940 metabolic map.

(4) FIGS. 3A-B show schematics depicting the deletion of a CDS encoding uracil phosphoribosyltransferase MELS_2191. FIG. 3A; Chromosomal address of MELS_2191, the gene for targeted deletion. FIG. 3B; Plasmid pLAR179 containing a nonfunctional pBC1 origin of replication, the cat gene, and sites for homologous recombination for marker replacement of MELS_2191. Transformants were selected on RCM+thiamphenicol, and subsequently counter-selected with RCM+5-FU.

(5) FIGS. 4A and 4B show schematics depicting the deletion of a CDS encoding a putative propionyl-CoA transferase MELS_0742. FIG. 4A; plasmid pLAR179 containing a copy of upp, and a copy of the cat gene flanked by sites for homologous recombination for marker replacement of MELS_0742 on the M. elsdenii chromosome. Transformants were selected on RCM+thiamphenicol, and then counter-selected with RCM+5-FU while maintaining positive selection for the cat gene. Plasmid was resolved via single-colony isolation in the presence of thiamphenicol. FIG. 4B; chromosomal address of MELS_0742 after targeted marker replacement.

(6) FIG. 5 shows growth of MELS_0742 mutant M. elsdenii on lactate and glucose. A; JWME04, AG6564, and AG5855 growth on glucose. B; JWME04, AG6564, AG5855, and wild-type (WT) growth on lactate. C; glucose media only and lactate media only.

(7) FIGS. 6A and 6B show the effect of the MELS_0742 deletion on fermentation products with lactate or glucose as the growth substrate. Wild type M. elsdenii ATCC 25940, M. elsdenii ATCC 25940 upp (strain AG5855), and M. elsdenii ATCC 25940 MELS_0742::C31-cat-C31 (strain JWME04) were grown in (A) 5 mL RCM+5 g/L sodium lactate or (B) 5 mL RCM+5 g/L glucose, with 5 g/mL thiamphenicol if necessary, overnight. Each strain (50 L) was added to Balch tubes containing 10 mL of modified RCM with lactate and separately with glucose for 72 hours at 37 C. Lactic, acetic, propionic, butyric, valeric, and hexanoic acids in supernatant following culture were quantified via HPLC. Error bars represent standard deviation from the mean of 5 replicates.

(8) FIGS. 7A and 7B show show schematics depicting the deletion of the CDS encoding an orotidine-5-phosphate decarboxylase MELS_RS04415. FIG. 7A; chromosomal address of MELS_RS04415, the gene for targeted deletion. FIG. 7B; plasmid pMRW003 containing a copy of the cat gene flanked by sites for homologous recombination for marker replacement of MELS_RS04415 on the M. elsdenii chromosome. Transformants were selected on thiamphenicol for plasmid integration, and then counter-selected with 5-FOA for plasmid loss and pyrF deletion.

DETAILED DESCRIPTION

(9) The present disclosure provides microbes, compositions, and methods useful for increasing microbial production of longer chain organic acids. The disclosure includes metabolically engineering a microbial host. The microbial host is engineered to increase carbon flux to butyryl-CoA and/or hexanoyl-CoA, to produce increased amounts of butyrate and/or hexanoate, or a combination thereof. The microbial host can be further metabolically engineered to convert butyryl-CoA to butyraldehyde and butanol, hexanoyl-CoA to hexanaldehyde and hexanol, or a combination thereof. The microbial host can also be further metabolically engineered to produce other molecules derived from the chain elongation pathway. Recombinant microbes can be referred to herein as metabolically engineered microbes when the genetic engineering is directed to disruption or alteration of a metabolic pathway so as to cause a change in the microbe's metabolism compared to a comparable control.

(10) Recombinant Microbes

(11) A microbial host that is used to engineer a recombinant microbe of the present disclosure is a member of the genus Megasphaera. Examples of members of the genus Megasphaera include M. hominis, M. cerevisiae, M. elsdenii, M. micronuciformis, M. paucivorans, and M. sueciensis. Megasphaera spp., are readily available. In one embodiment, the Megasphaera is M. elsdenii, and in one embodiment the M. elsdenii microbial host that is used to engineer a recombinant microbe is ATCC 25940. Methods for metabolically engineering a Megasphaera sp. are described herein.

(12) A recombinant Megasphaera microbe of the present disclosure includes one or more mutations designed to increase carbon flux towards the targeted products butyrate (the straight-chain alkyl carboxylic acid with the chemical formula CH.sub.3(CH.sub.2).sub.2CO.sub.2H, also referred to as butyric acid) and/or hexanoate (the straight-chain alkyl carboxylic acid with the chemical formula CH.sub.3(CH.sub.2).sub.4CO.sub.2H, also referred to as hexanoic acid). The increased carbon flux towards the targeted products butyrate and/or hexanoate can be referred to as increased carbon flux to butyryl-CoA and/or hexanoyl-CoA, an intermediate step in the pathway to butyrate and/or hexanoate.

(13) In one embodiment, a recombinant Megasphaera microbe, such as M. elsdenii, includes a mutation, such as a deletion, of a coding region encoding a CoA-transferase. Examples of CoA-transferases include those encoded by the coding regions MELS_0742, MELS_0464, and MELS_0034 of M. elsdenii ATCC 25940. MELS_0742 and MELS_0464 encode a propionate CoA transferase, and MELS_0034 encodes an acetate CoA/Acetoacetate CoA-transferase alpha subunit. In another embodiment, a recombinant Megasphaera sp., such as M. elsdenii, includes a mutation, such as a deletion, of a coding region encoding a member of the glyoxalase family, for instance MELS_0743. In another embodiment, a recombinant Megasphaera sp., such as M. elsdenii, includes a mutation, such as a deletion, of a coding region encoding a lyase such as lactoyl-CoA dehydratase subunit alpha, for instance MELS_0745. When a Megasphaera sp. other than M. elsdenii ATCC 25940 is used, closely related CoA-transferases, glyoxalases, and lyases can be identified using routine methods such as homology searches or RNAseq and proteomic analyses, and mutations of one or more coding regions can be engineered into the microbe using the methods described herein.

(14) A recombinant Megasphaera microbe can include reduced expression of a propionyl-CoA transferase. In one or more embodiments, when the microbe is M. elsdenii ATCC 25940, the mutation is in the coding region MELS_0742. For instance, M. elsdenii ATCC 25940 was found to include four coding regions encoding putative propionate-CoA transferases, MELS_0742, MELS_0464, MELS_1631, and MELS_1130, but analysis of expression suggested that MELS_0742 was most highly expressed. Subsequent deletion of MELS_0742 resulted in a recombinant M. elsdenii with undetectable propionate-CoA transferase activity as inferred from fermentation profile data (Example 1).

(15) A recombinant Megasphaera microbe having a mutation in one or more coding regions described herein can have increased carbon flux to butyryl-CoA, hexanoyl-CoA, or the combination thereof. In one or more embodiments, a recombinant Megasphaera described herein can produce increased amounts of butyrate, hexanoate, or the combination thereof, compared to a comparable control microbe. In one or more embodiments, a recombinant Megasphaera described herein can be further engineered to convert butyryl-CoA to butanol, hexanoyl-CoA to hexanol, or the combination thereof, and likely increased production of other molecules of longer chain length. In one or more embodiments, a recombinant Megasphaera described herein can consume increased amounts of acetate compared to a comparable control microbe. As used herein, a comparable control microbe is a microbe that is genetically identical to the recombinant Megasphaera except for the mutation or mutations being evaluated. The increased production of butyrate and/or hexanoate can be observed when the recombinant Megasphaera is grown on lactate (also referred to as lactic acid). In some embodiments, increased production of butyrate and/or hexanoate is not observed when the recombinant Megasphaera is grown on glucose. The increase of each of butyrate and/or hexanoate can be at least 2-fold, at least 4-fold, at least 6-fold, at least 8-fold, at least 10-fold, at least 100-fold, at least 1000-fold, or more compared to a comparable control microbe. In one or more embodiments, the increase of each of butyrate and/or hexanoate is no greater than 10,000-fold compared to a comparable control microbe. In some embodiments there is not a theoretical maximum fold-increase. For instance, where a microbe is engineered to produce a new compound that is not produced at detectable levels by the comparable control, the fold-increase can be extremely high even if the absolute amount of the new compound did not increase substantially. The increased consumption of acetate can be observed when the recombinant Megasphaera is grown on lactate (also referred to as lactic acid). In some embodiments, increased consumption of acetate is not observed when the recombinant Megasphaera is grown on glucose. The increase of acetate consumption can be at least 2-fold, at least 4-fold, at least 6-fold, at least 8-fold, at least 10-fold, at least 100-fold, at least 1000-fold, or more compared to a comparable control microbe.

(16) A recombinant Megasphaera microbe having reduced propionate-CoA transferase activity produces decreased amounts of valerate. The presence of decreased amounts of valerate was surprising, as the expected result was a much greater decrease in valerate or no detectable valerate. The enzyme deleted, MELS_0742, is thought to be responsible also for the lactate conversion to lactoyl-CoA. The inventors predicted interrupting this reaction would interrupt the entire acrylate cycle, which provides the propionyl-CoA that leads to valerate production.

(17) A model was constructed using the Department of Energy (DOE) KBase and represents glucose fermentation to butyrate and lactate fermentation to butyrate and propionate (FIG. 1). A map adaptation was constructed from the metabolic reconstruction of central carbon metabolism (FIG. 2). The map adaptation represents steps to target in the engineering of Megasphaera, such as M. elsdenii, to alter its native metabolism to genetically funnel carbon towards longer chain-length targets such as butyryl-CoA and/or hexanoyl-CoA, enabling increased production of butyrate and hexanoate. Using the constructed map and the genomic DNA sequence for M. elsdenii, several coding regions annotated as putative acyl-CoA transferase genes were identified. The inventors predict that mutations in one or more of these coding regions will increase flux within Megasphaera sp. towards longer chain-length targets such as butyrate and hexanoate. Examples of coding regions that can be targeted for mutation, in addition to those discussed herein, include MELS_0034, MELS_0437, MELS_0464, MELS_0430, MELS_0033, MELS_0341, MELS_1130, and MELS_1631. The mutation can be any mutation that reduces expression of the protein encoded by a coding region, or a mutation that reduces the activity of the protein, including a point mutation an insertion, or a deletion. A recombinant Megasphaera having a mutation in one or more of a coding region described herein can produce, or is expected to produce, increased amounts of butyrate, hexanoate, or the combination thereof, compared to a comparable control microbe. Accordingly, the present disclosure includes a recombinant Megasphaera, such as M. elsdenii, that includes a mutation in one or more of the coding regions described herein, in any combination. In one embodiment, a recombinant Megasphaera includes a mutation in a coding region encoding a propionyl-CoA transferase, such as a mutation in the coding region MELS_0742.

(18) In one embodiment, a recombinant Megasphaera microbe, such as M. elsdenii, includes one or more mutations in coding regions responsible for the acrylate cycle pathway. The inventors used the map adaptation and the genomic DNA sequence for M. elsdenii to identify a cluster of several coding regions annotated as responsible for the acrylate cycle pathway. The inventors predict that mutations in these coding regions will increase flux within Megasphaera sp. towards longer chain-length targets such as butyryl-CoA and/or hexanoyl-CoA, leading to increased production of butyrate and hexanoate. The cluster of locus tags that will be targeted for mutation include MELS_0742-0747. The mutation can be any mutation that reduces expression of the protein encoded by a coding region, or a mutation that reduces the activity of the protein, including a point mutation, an insertion or a deletion. A recombinant Megasphaera having a mutation in one or more of these coding regions involved in the acrylate cycle pathway can produce increased amounts of butyrate, hexanoate, or the combination thereof, compared to a comparable control microbe. Accordingly, the present disclosure includes a recombinant Megasphaera, such as M. elsdenii, that includes a mutation in one or more of the putative acrylate cycle pathway genes.

(19) Thus, a recombinant Megasphaera microbe disclosed herein includes a mutation in one or more of the following coding regions, in any combination: MELS_0742, MELS_0034, MELS_0437, MELS_0464, MELS_0430, MELS_0033, MELS_0341, MELS_1130, MELS_1631, MELS_0742, MELS_0743, MELS_0744, MELS_0745, MELS_0746, or MELS_0747.

(20) In one embodiment, a recombinant Megasphaera microbe includes a mutation, such as a deletion, of a coding region encoding uracil phosphoribosyltransferase (Upp). An example of one upp coding region is MELS_2191. Uracil phosphoribosyltransferase converts the uracil analogue, 5-fluorouracil (5-FU), to the toxic product fluorodeoxyuridylate which kills growing microbes that are synthesizing uracil. As described herein, mutants of upp are, therefore resistant to 5-FU, providing 5-FU resistance as a counter selectable marker (Guss and Riley, US Published Patent Application No. 2021/0024965).

(21) In one embodiment, a recombinant Megasphaera microbe includes a mutation, such as a deletion, of a coding region encoding orotidine-5-phosphate decarboxylase (PyrF). An example of one pyrF coding region is MELS_RS04415. Deletion and complementation of orotidine-5-phosphate decarboxylase (pyrF) in Megasphaera, such as M. elsdenii allows for counter-selection of transformants growing in media containing uracil. In the presence of 5-Fluoroorotic acid (5-FOA), the pyrE gene product orotate phosphoribosyltransferase adds a phosphate group via phosphoribosyl pyrophosphate to 5-FOA becoming 5-fluoroorotidine monophosphate and the substrate for the pyrF gene. pyrF cleaves the carboxylic group from 5-fluoroorotidine monophosphate creating 5-fluorouridine monophosphate (5-FUMP), a toxic analog of uridine monophosphate and a precursor to both the RNA nucleotide uracil and the DNA nucleotide thymine. The addition of fluorine at the 5 carbon becomes a lethal inhibitor to thymidylate synthetase, preventing the methylation and conversion of 5-fluorouracil to thymidine. These toxic nucleotide analogs prevent the translation of RNA, the replication of DNA, and ultimately cause cell death. Nonconservative pyrF mutants are uracil auxotrophs and resistant to 5-FOA. The inventors have established 5-FOA minimal inhibitory concentrations (MICs) in Reinforced clostridial medium (RCM), a rich complex media, at 1 mg/mL and 2.5 mg/mL in liquid and solid media, respectively. 5-FOA allows for counter-selection with sufficient uracil present in the growth medium.

(22) In one embodiment a recombinant Megasphaera microbe includes an exogenous coding region encoding a bifunctional aldehyde-alcohol dehydrogenase. An example of a coding region encoding aldehyde-alcohol dehydrogenase is adhE2. An adhE2 coding region can be obtained from a member of the genus Clostridium, such as C. acetobutylicum. Examples of adhE2 coding regions and AdhE2 proteins, and engineering M. elsdenii to include adhE2, are described in Guss and Riley (US Published Patent Application No. 2021/0024965). A bifunctional aldehyde-alcohol dehydrogenase can catalyze the production of butanol from butyryl-CoA.

(23) In one embodiment a recombinant Megasphaera microbe includes an exogenous coding region encoding an acyl-CoA reductase. An example of a coding region encoding acyl-CoA reductase is acr. An acr coding region can be obtained from a member of the genus Clostridium, such as C. acetobutylicum, C. carboxidivorans, and C. saccharoperbutylacetonicum. An acyl-CoA reductase can catalyze the conversion of hexanoyl-CoA to hexanaldehyde.

(24) In one embodiment a recombinant Megasphaera microbe includes an exogenous coding region encoding an alcohol dehydrogenase. An example of a coding region encoding alcohol dehydrogenase is adh. An adh coding region can be obtained from a member of the genus Clostridium, such as C. acetobutylicum, C. carboxidivorans, and C. saccharoperbutylacetonicum. An alcohol dehydrogenase can catalyze the conversion of hexanaldehyde to hexanol.

(25) Methods of Making a Recombinant Megasphaera Microbe

(26) Megasphaera sp. typically include robust restriction systems that cleave a DNA polynucleotide introduced into a Megasphaera sp. This has prevented the establishment of methods for genetic analysis of Megasphaera sp. Provided herein are methods for genetically engineering Megasphaera, including M. elsdenii, to construct the recombinant Megasphaera described herein.

(27) Microbial strains have been created that methylate DNA for introduction into Megasphaera cells and the successful identification of transformants. The methylated DNA obtained from the methylating microbial strains can be introduced into Megasphaera cells and is protected from the Megasphaera restriction systems. One example of a methylating microbial strain includes the coding regions MELS_0050-0051 and MELS_1615-1616. In one embodiment, a methylating microbial strain expressing these coding regions is an E. coli such as TOP10 (ThermoFisher) further genetically modified to be dcm. The TOP10 strain can be further modified to include a poly-attB cassette, for instance integrated at the Hong Kong phage attachment locus, and MELS_0050-0051 integrated at the R4 site of the poly-attB and MELS_1615-1616 integrated at the lambda attB locus. The proteins encoded by MELS_0050-0051 and MELS_1615-1616 are useful in preparing DNA for transformation into M. elsdenii ATCC 25940 and potentially other Megasphaera spp. Methylating microbial strains are described in Guss and Riley (US Patent Application No. 2021/0024965).

(28) Also provided herein is a recombinant Megasphaera that has been engineered to introduce a mutation to result in decrease expression of one or more of the coding regions MELS_0050, MELS_0051, MELS_1615, or MELS_1616. In one embodiment, a recombinant Megasphaera includes a mutation of both MELS_0050 and MELS_0051, both MELS_1615 and MELS_1616, or a mutation of MELS_0050, MELS_0051, MELS_1615, and MELS_1616. The mutation can be any mutation that reduces expression of the protein encoded by the coding region, or a mutation that reduces the activity of the protein, including a point mutation, an insertion, or a deletion. A recombinant Megasphaera including a mutation in one or more of these coding regions has a reduced or inactive restriction system, and DNA can be transformed into such a recombinant Megasphaera with the expectation that transformants will be identified.

(29) Accordingly, producing a recombinant Megasphaera, for instance M. elsdenii, includes transforming with DNA that has been obtained from a methylating microbial strain. DNA used to transform Megasphaera sp. is typically in the form of a vector. A vector is a replicating polynucleotide, such as a plasmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors. Typically, a vector is capable of replication in a microbial host, for instance E. coli. In some embodiments a vector is capable of replication in a Megasphaera sp. In some embodiments the vector is a plasmid. Origins of replication that are useful in Megasphaera include, but are not limited to, those present in the plasmids pIM13 (Projan et al., 1987), pBC1 (De Rossi et al., 1992), and pVJL1 (Liu et al., 2012).

(30) DNA used to transform a Megasphaera sp. optionally includes one or more marker sequences, which typically encode a molecule that inactivates or otherwise detects or is detected by a compound in the growth medium. For example, the inclusion of a marker sequence can render the transformed microbe resistant to an antibiotic, or it can confer compound-specific metabolism on the transformed microbe. Examples of marker sequence that confer resistance and can be used in Megasphaera sp. include those encoding resistance to chloramphenicol and to erythromycin.

(31) In one embodiment, the Megasphaera sp. to be transformed includes reduced expression, such as undetectable expression, of an upp coding region. In one embodiment, the upp coding region is MELS_2191. Use of a recipient Megasphaera sp. with an upp mutation is helpful in engineering targeted mutations, such as deletions, of specific coding regions, or targeted insertions of DNA, such as a coding region (Guss and Riley, US Published Patent Application No. 2021/0024965). The polynucleotide used to transform a Megasphaera sp. includes an upp coding region, e.g., MELS_2191, which encodes uracil phosphoribosyltransferase and converts 5-fluorouracil (5-FU), to the toxic product fluorodeoxyuridylate, which kills growing microbes. For instance, transformation of a Megasphaera sp. with a plasmid containing sequences of DNA sharing homology to sequences flanking a coding region targeted for deletion can result in the integration of the plasmid into the microbe's chromosome to produce a specific genetic lesion. If the Megasphaera sp. includes a deletion of upp and the vector includes an upp coding region, incubating the transformants in 5-FU can counter-selection against the integrated vector (see Example 1). Accordingly, the present disclosure also includes methods for using a Megasphaera having an upp mutation, including methods for constructing a Megasphaera having a targeted mutation. The targeted mutation can be the production of a deletion of the target coding region. The production of a deletion greatly reduces the likelihood of reversion.

(32) A method for using an upp-Megasphaera to construct a Megasphaera having a targeted mutation includes transforming the Megasphaera with a plasmid that includes an upp coding region that will complement the upp mutation. The plasmid is replication incompetent in the recipient Megasphaera. The plasmid also includes a mutagenic cassette. A mutagenic cassette is designed to target a specific location, typically a coding region, where a mutation is to be introduced.

(33) In one embodiment, the Megasphaera sp. to be transformed includes reduced expression, such as undetectable expression, of a pyrF coding region. In one embodiment, the pyrF coding region is MELS_RS04415. Use of a recipient Megasphaera sp. with a pyrF mutation is helpful in engineering targeted mutations, such as deletions, of specific coding regions, or targeted insertions of DNA, such as a coding region (see, for instance, Lipscomb et al., 2016, Applied and Environmental Microbiology, 82(14):4421-4428). The polynucleotide used to transform a Megasphaera sp. includes a pyrF coding region, e.g., MELS_RS04415, which encodes orotidine-5-phosphate decarboxylase and converts 5-Fluoroorotic acid (5-FOA) to a toxic product that kills the cells. Deleting pyrF results in a strain that is a uracil auxotroph resistant to 5-FOA, allowing prototrophic selection and counter-selection of the wild-type pyrF. For instance, transformation of a Megasphaera sp. with a plasmid containing sequences of DNA sharing homology to sequences flanking a coding region targeted for deletion can result in the integration of the plasmid into the microbe's chromosome to produce a specific genetic lesion. If the Megasphaera sp. includes a deletion of pyrF and the vector includes a pyrF coding region, incubating the transformants in 5-FOA can counter-selection against the integrated vector. Accordingly, the present disclosure also includes methods for using a Megasphaera having a pyrF mutation, including methods for constructing a Megasphaera having a targeted mutation. The targeted mutation can be the production of a deletion of the target coding region. The production of a deletion greatly reduces the likelihood of reversion.

(34) A method for using a pyrF-Megasphaera to construct a Megasphaera having a targeted mutation includes transforming the Megasphaera with a plasmid that includes a pyrF coding region that will complement the pyrF mutation. The plasmid is replication incompetent in the recipient Megasphaera. The plasmid also includes a mutagenic cassette. A mutagenic cassette is designed to target a specific location, typically a coding region, where a mutation is to be introduced.

(35) The mutagenic cassette includes two distinct DNA sequences that will permit homologous recombination between the plasmid and the microbe's chromosome. The two distinct DNA sequences typically flank the targeted coding region in the microbe's chromosome. On the plasmid, the two distinct DNA sequences flank the lesion that is to be introduced into the chromosome. The lesion, in combination with the two distinct DNA sequences, can be one that will result in deletion of the coding region. The mutagenic cassette also includes a marker, such as a coding region encoding an antibiotic marker, present within the lesion. Optionally, the mutagenic cassette also includes two attachment sites that flank the lesion. In one embodiment, the structure of a mutagenic cassette is first homologous DNA sequence-first attachment site-lesion/marker-second attachment site-second homologous DNA sequence. The attachment sites are sequence that can be identified by a recombinase, such as an integrase and, in the presence of a suitable recombinase, the region between the attachment sitesthe markercan be removed from the chromosome.

(36) Following transformation, recipients of the plasmid are selected using the marker present with the lesion. The result is transformants that are likely to include the plasmid integrated in the chromosome by virtue of a crossover event between one of the two DNA sequences and the appropriate sequences on the microbe's chromosome. After selection for successful transformants, subsequent exposure of the transformants to 5-FU or 5-FOA selects for a second crossover event that eliminates the upp coding region or the pyrF coding region and the plasmid sequences, resulting in the insertion of the lesion, such as a deletion, of the targeted coding region. The coding region encoding the marker can then be removed by use of a recombinase.

(37) A Megasphaera sp. can also be engineered to include an exogenous polynucleotide, such as, but not limited to, a bifunctional aldehyde-alcohol dehydrogenase such as one encoded by adhE2, an acyl-CoA reductase such as one encoded by acr, or an alcohol dehydrogenase such as one encoded by adh. Methods for use of upp and use ofpyrF to engineer insertions into microbe are described in Guss and Riley (US Published Patent Application No. 2021/0024965) and (Lipscomb et al., 2016, Applied and Environmental Microbiology, 82(14):4421-4428). A coding region present on a polynucleotide that is to be introduced into a Megasphaera sp. can be codon optimized for expression in the Megasphaera sp.

(38) Methods for transformation of Megasphaera spp. include electroporation. Examples of producing electrocompetent Megasphaera spp. are described in Example 1 and in Guss and Riley (US Patent Application No. 2021/0024965).

(39) Methods of Using Recombinant Megasphaera

(40) The present disclosure also includes methods of using a recombinant Megasphaera. In one embodiment, a method includes using a recombinant Megasphaera to produce butyrate and/or hexanoate. The method includes incubating a recombinant Megasphaera under conditions suitable for fermentation. Typically, the medium used includes lactate as the primary carbon source, and in one embodiment, the sole carbon source.

(41) In one embodiment, the method can include further processing of the butyryl-CoA and/or hexanoyl-CoA product. For instance, if the recombinant Megasphaera include an exogenous coding region encoding a bifunctional aldehyde-alcohol dehydrogenase, such as adhE2, butyryl-CoA is converted to butanol (Guss and Riley, US Patent Application No. 2021/0024965). Alternatively, if the recombinant Megasphaera include an exogenous coding region encoding an acyl-CoA reductase, such as acr, hexanoyl-CoA is converted to hexanaldehyde, and if the recombinant Megasphaera also includes an exogenous coding region encoding an alcohol dehydrogenase, such as adh, hexanaldehyde is converted to hexanol.

(42) A recombinant Megasphaera is incubated under anaerobic conditions and at a temperature, including but not limited to 21 C., 22 C., 23 C., 24 C., 25 C., 26 C., 27 C., 28 C., 29 C., 30 C., 31 C., 32 C., 33 C., 34 C., 35 C., 36 C., 37 C., 38 C., 39 C., 40 C., 41 C., 42 C., 43 C., 44 C., 45 C., 46 C. In one embodiment, the host cells are incubated at 37 C. Lactate is typically used as the carbon source for cell growth and maintenance, including the production of butyrate and/or hexanoate (e.g., 5 g/L, 44 mM). In some embodiments, such as the production of mutations, glucose can be used as the carbon source (e.g., 5 g/L, 27 mM).

(43) Exemplary Aspects

(44) The invention is defined in the claims. However, below there is provided a non-exhaustive listing of non-limiting exemplary aspects. Any one or more of the features of these aspects may be combined with any one or more features of another example, embodiment, or aspect described herein.

(45) Aspect 1. A recombinant Megasphaera microbe genetically modified to (i) consume a greater amount of acetate, (ii) produce a greater amount of butyrate, hexanoate, or a combination thereof, than a comparable control microbe, or (iii) increase carbon flux to butyryl-CoA and/or hexanoyl-CoA than a comparable control microbe, or a combination thereof, wherein the recombinant Megasphaera microbe comprises a mutation of a CoA-transferase coding region, a glyoxalase coding region, or a lyase coding region.

(46) Aspect 2. The recombinant Megasphaera microbe of Aspect 1, wherein the recombinant Megasphaera microbe is M. elsdenii.

(47) Aspect 3. The recombinant Megasphaera microbe of Aspect 1 or 2, wherein the M. elsdenii is a modified ATCC 25940.

(48) Aspect 4. The recombinant Megasphaera microbe of any one of Aspects 1-3, wherein the mutation of the CoA-transferase coding region comprises a deletion of the CoA transferase coding region.

(49) Aspect 5. The recombinant Megasphaera microbe of any one of Aspects 1-4, wherein the CoA-transferase coding region encodes a propionyl-CoA transferase.

(50) Aspect 6. The recombinant Megasphaera microbe of any one of Aspects 1-5, wherein propionate production by the recombinant Megasphaera microbe is undetectable.

(51) Aspect 7. The recombinant Megasphaera microbe of any one of Aspects 1-6, wherein the propionyl-CoA transferase coding region is MELS_0742, MELS_0464, MELS_1631, or MELS_1130, or a combination thereof.

(52) Aspect 8. The recombinant Megasphaera microbe of any one of Aspects 1-7, wherein the recombinant Megasphaera microbe comprises a mutation of at least 1, at least 2 propionyl-CoA transferase coding regions selected from MELS_0742, MELS_0464, and MELS_0034, or mutation of all 3 propionyl-CoA transferase coding regions.

(53) Aspect 9. The recombinant Megasphaera microbe of any one of Aspects 1-8, wherein the mutation of the glyoxalase coding region comprises a deletion of the glyoxalase coding region.

(54) Aspect 10. The recombinant Megasphaera microbe of any one of Aspects 1-9, wherein the glyoxalase coding region is MELS_0743.

(55) Aspect 11. The recombinant Megasphaera microbe of any one of Aspects 1-10, wherein the mutation of the lyase coding region comprises a deletion of the lyase coding region.

(56) Aspect 12. The recombinant Megasphaera microbe of any one of Aspects 1-11, wherein the lyase coding region is MELS_0745.

(57) Aspect 13. The recombinant Megasphaera microbe of any one of Aspects 1-12, wherein the increase of butyrate or hexanoate is at least 2-fold greater than the comparable control microbe.

(58) Aspect 14. The recombinant Megasphaera microbe of any one of Aspects 1-13, wherein the increase of acetate consumption is at least 2-fold greater than the comparable control microbe.

(59) Aspect 15. A recombinant Megasphaera microbe comprising a mutation of a pyrF coding region.

(60) Aspect 16. The recombinant Megasphaera microbe of any one of Aspects 1-15, wherein the mutation is a deletion of at least a portion of the pyrF coding region.

(61) Aspect 17. The recombinant Megasphaera microbe of any one of Aspects 1-16, wherein the Megasphaera microbe is M. elsdenii.

(62) Aspect 18. The recombinant Megasphaera microbe of any one of Aspects 1-17, wherein the M. elsdenii is a modified ATCC 25940.

(63) Aspect 19. The recombinant Megasphaera microbe of any one of Aspects 1-18, wherein the pyrF coding region is MELS_RS04415.

(64) Aspect 20. A method for increasing carbon flux to acetoacetyl-CoA, comprising: incubating a recombinant Megasphaera microbe with lactate as a carbon source under conditions suitable for replication, wherein the carbon flux to acetoacetyl-CoA in the recombinant Megasphaera is at a level greater than a comparable control, and, wherein the recombinant Megasphaera microbe comprises a mutation of a CoA-transferase coding region, a glyoxalase coding region, or a lyase coding region a mutation of a CoA-transferase.

(65) Aspect 21. A method for producing butyrate, hexanoate, or combination thereof, comprising: incubating a recombinant Megasphaera microbe with lactate as a carbon source under conditions suitable for replication, wherein the recombinant Megasphaera produces butyrate, hexanoate, or combination thereof at a level greater than a comparable control, wherein the recombinant Megasphaera microbe comprises a mutation of a CoA-transferase coding region, a glyoxalase coding region, or a lyase coding region a mutation of a CoA-transferase.

(66) Aspect 22. A method for genetically engineering a Megasphaera, comprising: providing the recombinant Megasphaera of any one of Aspects 1-19, transforming the recombinant Megasphaera with a plasmid comprising a pyrF coding region and a mutagenic cassette, wherein the mutagenic cassette of the plasmid comprises a marker flanked by DNA sequences, wherein the DNA sequences are selected to result in homologous recombination between the plasmid and two regions of DNA present in the recombinant Megasphaera that flank a coding region targeted for mutation; and incubating the transformed recombinant Megasphaera under conditions suitable for positive selection of the transformed recombinant Megasphaera and counter selection of the transformed recombinant Megasphaera to select for those that have lost the pyrF coding region, wherein the transformed recombinant Megasphaera identified by the positive and counter selection comprise a mutation of the targeted coding region.

(67) Aspect 23. The method of Aspect 22, wherein the mutagenic cassette of the plasmid further comprises attachment sites flanking the marker, wherein the attachment sites are between the marker and the DNA sequences, and wherein the attachment sites are identified by a recombinase that can promote recombination between the two attachment sites and deletion of the marker located between the attachment sites.

(68) Aspect 24. The method of Aspect 22 or 23, wherein the mutation of the targeted coding region comprises a deletion of the targeted coding region.

EXAMPLES

(69) The present disclosure is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the disclosure as set forth herein.

Example 1

(70) Methods for Engineering Deletions in Megasphaera: Deletion of upp Gene

(71) A coding sequence (CDS) of an M. elsdenii is referred to herein using one of two locus tag identifiers. One locus tag identifier has the prefix MELLS_ followed by the number of the CDS in the Megasphaera elsdenii strain DSM 20460 draft genome, GenBank accession HE576794.1. The second locus tag identifier has the prefix MELS_RS followed by the number of the CDS in the Megasphaera elsdenii strain DSM 20460 complete sequence, GenBank accession NC_015873.1.

(72) Deletion of MELS_2191, a uracil phosphoribosyltransferase (upp), in the M. elsdenii chromosome. To construct a deletion of MELS_2191 in the M. elsdenii ATCC 25940 genome (Hatmaker, 2019), plasmid pLAR151 was constructed by Gibson assembly (Table 1) via an intermediate plasmid, pLAR147. The pBC1 origin of replication was amplified from the pBC1 plasmid (DeRossi, 1992) cloned in place of pIM13 in the shuttle plasmid pMTL82151 (Heap, 2009), resulting in plasmid pLAR147. Then, 490 bp each that are DNA regions upstream and downstream of the upp gene (MELS_2191) were amplified and cloned into the MCS of pLAR147, resulting in the plasmid pLAR151. Additionally, a point mutation was inadvertently obtained in the pBC1 origin of replication, potentially rendering it non-functional. All PCR amplifications were performed using Phusion Master Mix (Thermo Fisher). The plasmid pLAR151 was transformed into E. coli strain AG4157 (Table 1) which expresses two methyltransferases and their corresponding specificity subunits (MELS_0051-0052, MELS_1615-1616) from M. elsdenii cloned into the E. coli chromosome. Electrocompetent cells of M. elsdenii ATCC 25940 were prepared (Guss 2021), and methylated plasmid DNA was subsequently isolated and used to transform M. elsdenii ATCC 25940 according to the transformation procedure of Guss 2021. Transformants were selected on RCM (HIMEDIA) agar plates with 5 g/mL thiamphenicol (TM) incubated for 72 hours. Colonies were picked into RCM (BD Difco) with 5 g/mL TM and incubated overnight. The liquid cultures were passaged into RCM (HIMEDIA) liquid cultures and subsequently plated in RCM (BD Difco) with 20 g/mL 5-fluorouracil. The plates were incubated overnight, and colonies were streaked on RCM plates. Single colonies were picked into RCM (HIMEDIA) and PCR screened for the chromosomal deletion of upp (FIGS. 3A and 3B).

(73) TABLE-US-00001 TABLE 1 Strains and plasmids Strains & plasmids Genotype/phenotype Source E. coli AG4157 Top10 dcm- HK::poly-att-cassette this study R4::MELS_0051-52 ::MELS_1616-17 M. elsdenii AG5855 ATCC 29540 upp this study JWME04 ATCC 29540 upp MELS_0742::phiC31- this study cat-phiC31 plasmids pMTL85141 Shuttle vector containing plM13 ori Heap 2009 pMTL82151 Shuttle vector containing plM13 ori Heap 2009 pLAR147 Intermediate plasmid containing pBC1 ori this study pLAR151 upp deletion vector containing potentially this study nonfunctional pBC1 ori pLAR179 MELS-0742 deletion vector this study

(74) TABLE-US-00002 TABLE2 Primersusedinthisstudy Primer Sequence Description NW062 TACGTCTATCGGCTTTGTCAGCAGCG(SEQIDNO:1) Screeningprimerslocated NW063 TTTTCAAGCCGCCAGCCGTGAA(SEQIDNO:2) insideMELS_0742gene NW066 TCAAAGGCCTCCGCAATACGATCAT(SEQIDNO:3) Screeningprimers NW067 ACATCGTCCACTTCGAAGGCGATGT(SEQIDNO:4) located outsideof flankingregions ofMELS_0742gene NW065 GAACTTGAATTGCCAAAGGAAGT(SEQIDNO:5) Screeningprimerlocated insidethecatgeneused inmarkerreplacement ofMels_0742 147_backbone_F gtaagctagcTCAGATCCTTCCGTATT Primerstoamplify (SEQIDNO:6) backboneofpMTL85121, 147_backbone_R aggtgtccatGCAGGTAAACCTCCTT excludingpIM13ori (SEQIDNO:7) 147_insert_F gtttacctgcATGGACACCTACGCG(SEQIDNO:8) PrimerstoamplifypBC1 147_insert_R aaggatctgaGCTAGCTTACGCCG(SEQIDNO:9) orifrompBC1plasmidfor constructionofpLAR147 upp_up_F CGCCTTTGAGTGAGCTGATACCGCACATCCAAGTCTATAA Primerstoamplify490bp TACGCCGCAGC(SEQIDNO:10) upstreamofMELS_2191, upp_down_R CATGCTCCAACAGCAAAAAGGAAAATTAGTACTCGGCGCC upp,forconstruction GATCA(SEQIDNO:11) ofpLAR147 151_backbone_F TCCTTTTTGCTGTTGGAGCATG(SEQIDNO:12) PrimerstoamplifY 151_backbone_R GCGGTATCAGCTCACTCAAAGGC(SEQIDNO:13) andlinearizethe backboneofpLAR151 frompLAR149for constructionof pLAR151 upp_up_R GATTTCACACTAATCGTTCATCGACGTA Primerstoamplify490bp (SEQIDNO:14) downstreamofMELS_2191, upp_down_F TGAACGATTAGTGTGAAATCTCCTTTCCTA upp,forconstruction (SEQIDNO:15) ofpLAR151 179_backbone_F aagcctggttgcatgCTTCAGGTTTGTCTGTAACT Primerstoamplifythe (SEQIDNO:16) backboneofpMTL85141, 179_backbone_R tacttgtacgtgcatCTAAGTTCCCTCTCAAATT excludingthecatgene, (SEQIDNO:17) forconstruction ofpLAR179 179_upp_F tgagagggaacttagATGCACGTACAAGTAATG Primerstoamplify (SEQIDNO:18) MELS_2191,upp,for 179_upp_R tcagggagatggcccTTATTTCGTGCCGA constructionofpLAR179 (SEQIDNO:19) 179_homology_F ttcggcacgaaataaGGGCCATCTCCC Primerstoamplify (SEQIDNO:20) homologyarmcassette 179_homology_R cagacaaacctgaagCATGCAACCAGGCT containing800bp (SEQIDNO:21) upstreamanddownstream ofMELS_0742, catgene,and phiC31sites,for constructionofpLAR179

(75) Results

(76) Deletion of the M. elsdenii uracil phosphoribosyltransferase gene allows counter-selection of the wild type allele using 5-fluorouracil. Uracil phosphoribosyltransferase (upp) converts the uracil analogue, 5-fluorouracil (5-FU), to a toxic product, fluorodeoxyuridylate (HdUMP, Singh 2015). To test whether M. elsdenii was sensitive to 5-FU, cells were grown in liquid medium with 5-200 g of 5-FU and found to be sensitive to 5 g/mL 5-FU. Growth of the wild type strain on 5-FU selecting resistance also resulted in spontaneous mutations in this gene, indicating that it is responsible for conversion of 5-FU to FdUMP. A deletion of the uracil phosphoribosyltransferase (upp, MELS_2191) in the M. elsdenii chromosome resulted in a strain, AG5855, that is resistant to 50 g/ml 5-FU. This chromosomal deletion allowed for the counter-selection of plasmids containing a copy of the wild type allele. This is the first counter-selection strategy developed in M. elsdenii.

Example 2

(77) Methods for Engineering Deletions in Megasphaera: Deletion of a Putative Propionyl-CoA Transferase Gene

(78) Deletion of a putative propionyl CoA transferase (MELS_0742) from the M. elsdenii chromosome. Plasmid pLAR179 was constructed via Gibson assembly. The plasmid's backbone was amplified from plasmid pMTL85141 (Heap, 2009) to linearize the plasmid, excluding the cat gene. MELS_2191, the uracil phosphoribosyltransferase, was amplified from the M. elsdenii chromosome and was cloned in place of the cat gene for the purposes of counter-selection. Additionally, a cassette containing 800 bp upstream and downstream of MELS_0742 flanking a cat gene driven by the promoter region of MELS_0747 (P.sub.MELS_0747) and PhiC31 attB/P sites, was synthesized by Twist Bioscience. Subsequently, the cassette was amplified and cloned into the final construct downstream of the upp gene. The plasmid was transformed into E. coli strain AG4157 (Table 1), and isolated. Electrocompetent cells of M. elsdenii ATCC 25940 were prepared (Guss 2021), and methylated plasmid pLAR179 was subsequently isolated and used to transform AG5855 (M. elsdenii ATCC25940 upp). Colonies were selected on RCM agar plates containing 5 g/mL thiamphenicol and incubated at 37 C. for 72 hours. Colonies were picked into liquid medium containing RCM medium (Difco) with 5 g/mL TM, incubated overnight, and then plated on RCM (Difco) with 5 g/mL TM and 50 g/mL 5-fluorouracil for counter-selection of the plasmid. Plates were incubated for 48 hours at 37 C. and single colonies were picked into RCM (Difco) liquid medium with 5 g/mL TM and screened for the marker-replacement (FIGS. 4A and 4B). Three single colony purifications were needed to generate a pure culture of the deletion from the initial merodiploid.

(79) Results

(80) Deletion of a putative propionyl-CoA reductase gene results in loss of propionate production and decreased valerate production.

(81) There are nine annotated propionate-CoA transferases, (ptc) in M. elsdenii. We performed RNAseq and proteomic analysis on wild type M. elsdenii, and it revealed that expression of MELS_0742 was highest during growth on lactic acid, and MELS_1130 was not detectable. To investigate the role of the most highly expressed of these, MELS_0742, a deletion of this gene was constructed in the AG5855 (upp) background strain, generating strain JWME04. The plasmid designed to generate this deletion contained a cat gene with upstream and downstream homology to MELS_0742 with C31 attachment sites flanking the cat gene. The cat gene allowed selection of marker replacement events and the C31 attachment sites allows subsequent removal of the cat gene for subsequent engineering. Growth of AG5855 (upp) and JWME04 (upp pct::phiC31 attB-cat-C31 attB) was compared to the wild type during growth on both glucose and lactate (FIG. 5). While both strains grew better on glucose, growth of the deletion strains was indistinguishable from wildtype suggesting that these deletions had no effect on growth on either glucose or lactate.

Example 3

(82) Evaluation of Fatty Acid Production and Carbon Substrate Usage

(83) To investigate the effect MELS_0742 on organic acid production, High Performance Liquid Chromatography (HPLC) analysis was performed on cells grown in either glucose or lactate. As shown in FIGS. 6A and 6B, there was a complete loss of propionate production and a significant reduction in valerate production in the strain lacking MELS_0742. M. elsdenii ATCC 25940 wild type, M. elsdenii ATCC 25940 upp (strain AG5855), and M. elsdenii ATCC 25940 MELS_0742::C31-cat-C31 (strain JWME04) were grown in 5 mL RCM (HiMedia)+5 g/mL thiamphenicol, if necessary, overnight. 50 L of each strain was added to Balch tubes containing 10 mL of modified RCM with lactate and, separately, with glucose. Each strain was cultured in duplicate for 72 hours at 37 C. Samples were taken at 24-hour intervals, optical densities measurements taken, and fermentation products were quantified using HPLC. Lactate, glucose, acetic acid, butyric acid, valeric acid, propionic acid, (and octanoic acid) were quantified on Agilent 1260 infinity series HPLC with the Aminex-HPX-87H column (Bio-Rad). The mobile phase was 5 mM sulfuric acid. The column was heated at 65 C., the flow rate was 0.6 mL/min, and the chromatograph was visualized using an RI detector.

Example 4

(84) Methods Transformation of M. elsdenii

(85) Seed cultures of M. elsdenii ATCC 25940 were grown, inoculated and grown to stationary phase in 500 mL RCM. Competent cells were prepared at room temperature, and the washes were performed with a 250 mM sucrose, 10% glucose solution. Electrocompetent cells (20 L) were electroporated with 1 g of DNA. A 1 mM cuvette was used and electroporated with a square wave at 1200 v and 1.5 ms using a Bio-Rad GenePulser. After electroporation, cells were recovered in 1 mL RCM (BD Difco) and incubated for 3 hours. Cells were then plated in molten RCM+1.5% agar, and, once the agar solidified, they were incubated for 2-3 days at 37 C. in sealed boxes in an anaerobic chamber.

Example 5

(86) Deletion of pyrF in Megasphaera elsdenii Results in Resistance to 5-FOA, Allowing Selection and Counter Selection of Genetic Markers and Facilitates Strain Construction

(87) The native ability to condense acetyl-CoA groups to efficiently generate C4 to C8 compounds makes Megasphaera elsdenii a compelling platform for the production of fuels and chemicals from lactate and plant carbohydrates. Our overall objective is to develop M. elsdenii as a platform for the conversion of lignocellulosic biomass sugars and organic acids into longer chain alcohols such as hexanol as well as other valuable chemicals. While progress has been made in developing basic genetic tools in this strain methods for DNA transformation rely on in vivo methylation of DNA in a strain of E. coli that contains two methyltransferases from M. elsdenii. A deletion of pyrF that allows counter selection of plasmids containing the wild type allele is constructed as shown in FIG. 7.

Example 6

(88) Defined Medium for Megasphaera

(89) A defined medium for any strain of Megasphaera was developed. A defined medium allows for mass balance analysis and manipulation of carbon and nitrogen sources to study and manipulate increased production of organic acids. This defined medium is also useful for the selection of uracil prototrophy, making pyrF both a selectable and a counter-selectable marker. The defined medium is produced by combining the following:

(90) TABLE-US-00003 TABLE 3 Amino Acids Molar g used/L Working Component Mass (g) media Molarity molarity L-Alanine 89.09 0.0038 4.26535E05 43 M L-Arginine 174.2 0.0062 3.55913E05 36 M L-Asparagine 150.13 0.005 3.33045E05 33 M monohydrate L-Aspartic acid 173.1 0.0024 1.38648E05 14 M sodium salt monohydrate L-Glutamic acid 169.11 0.01 5.91331E05 59 M monosodium salt L-Glutamine 146.1 0.0024 1.64271E05 16 M Glycine 75.07 0.01 0.000133209 13 M L-Isoleucine 131.17 0.005 3.81185E05 38 M L-Leucine 131.17 0.005 3.81185E05 38 M L-Lysine HCl 182.65 0.005 2.73748E05 27 M L-Methionine 149.21 0.0038 2.54675E05 25 M L-Phenylalanine 165.19 0.0019 1.15019E05 12 M L-Proline 115.13 0.0062 5.38522E05 54 M L-Serine 105.09 0.0038 3.61595E05 36 M L-Threonine 119.12 0.005 4.19745E05 42 M L-Tryptophan 204.23 0.0019 9.30324E06 9.3 M Cystein HCl H2O* 175.63 0.018125 0.0001032 103 M *Added separately as a reducing agent

(91) TABLE-US-00004 TABLE 4 No Carbon Buffer Molar Mass g used/L Working Component (g) media Molarity molarity Potassium 136.09 2.72 0.019986773 20 mM phosphate monobasic Ammonium Sulfate 132.14 2.64 0.01997881 20 mM

(92) TABLE-US-00005 TABLE 5 Carbon sources Molar Mass g used/L Working Component (g) media Molarity molarity alpha-D(+)Glucose anhydrous 180.2 5 0.027746948 28 mM contains approx. 5% beta anomer OR Na-lactate 112.06 4.7 0.041941817 42 mM OR Lactic acid 89.07 3.7365 0.041950152 42 mM

(93) TABLE-US-00006 TABLE 6 Caldi vitamin mix Molar Mass g used/L Working Component (g) media Molarity molarity Biotin 244.31 0.00002 8.18632E08 82 nM Folic acid 441.41 0.00002 4.53093E08 45 nM Pyridoxine HCl 205.6 0.0001 4.86381E07 486 nM Thiamine 337.3 0.00005 1.48236E07 148 nM HCl 2H.sub.2O Riboflavin 376.4 0.00005 1.32837E07 133 nM Nicotinic acid 123.1 0.00005 4.06174E07 406 nM D CaPentothenate 476.5 0.00005 1.04932E07 105 nM Vitamin B12 1355.37 0.000001 7.37806E10 0.74 nM p-amino- 159.1 0.00005 3.14268E07 314 nM benzoic acid Lipoic acid 206.32 0.00005 2.42342E07 242 nM

(94) TABLE-US-00007 TABLE 7 Bacillus trace elements Molar g used/L Working Component Mass (g) media Molarity molarity CaCl.sub.2 110.98 0.000055 4.95585E07 496 nM FeCl.sub.2 126.751 0.00014 1.10453E06 1.1 M MnCl.sub.24H.sub.2O 197.91 0.00001 5.0528E08 51 nM ZnCl.sub.2 136.286 0.00002 1.4675E07 147 nM CuCl.sub.22H.sub.2O 170.48 0.000004 2.34632E08 23 nM CoCl.sub.26H.sub.2O 237.93 0.000006 2.52175E08 25 nM Na2MoO4 205.92 0.000006 2.91375E08 29 nM Na2SeO4 188.94 0.0000047 2.48756E08 25 nM 1M HCl 0.000002 0.000002 2 M

(95) TABLE-US-00008 TABLE 8 Magnesium sulfate Molar Mass g used/L Working Component (g) media Molarity molarity Magnesium sulfate 120.366 0.120366 0.001 1 mM

(96) TABLE-US-00009 TABLE 9 Cysteine Molar g used/L Working Component Mass (g) media Molarity molarity Cysteine HCl 175.63 0.725 0.004127996 4.1 mM

(97) TABLE-US-00010 TABLE 10 Resazurin Molar g used/L Working Component Mass (g) media Molarity molarity Resazurin 229.191 0.000025 1.09079E07 109 nM

(98) TABLE-US-00011 TABLE 11 Sodium acetate Molar g used/L Working Component Mass (g) media Molarity molarity Sodium acetate anhydrous 82.03 2.78 0.03389004 34 mM

CITATIONS

(99) Nelson R S, Peterson D J, Karp E M, Beckham G T, Salvachua D. Mixed Carboxylic Acid Production by Megasphaera elsdenii from Glucose and Lignocellulosic Hydrolysate. Fermentation. 2017 March; 3(10). Lamsen E N, Atsumi S. Recent progress in synthetic biology for microbial production of C3-C10 alcohols. Front Microbiol. 2012;3:196. doi: 10.3389/fmicb.2012.00196. eCollection 2012. PubMed PMID: 22701113; PubMed Central PMCID: PMC3370425. Tracy B P, Jones S W, Fast A G, Indurthi D C, Papoutsakis E T. Clostridia: the importance of their exceptional substrate and metabolite diversity for biofuel and biorefinery applications. Curr Opin Biotechnol. 2012 June; 23(3):364-81. doi: 10.1016/j.copbio.2011.10.008. Epub 2011 Nov. 11. Review. PubMed PMID: 22079352. Weimer P J, Nerdahl M, Brandl D J. Production of medium-chain volatile fatty acids by mixed ruminal microorganisms is enhanced by ethanol in co-culture with Clostridium kluyveri. Bioresour Technol. 2015 January; 175:97-101. doi: 10.1016/j.biortech.2014.10.054. Epub 2014 Oct. 18. PubMed PMID: 25459809. Dekishima Y, Lan E I, Shen C R, Cho K M, Liao J C. Extending carbon chain length of 1-butanol pathway for 1-hexanol synthesis from glucose by engineered Escherichia coli. J Am Chem Soc. 2011 Aug. 3; 133(30):11399-401. doi: 10.1021/ja203814d. Epub 2011 Jul. 7. PubMed PMID: 21707101. Clomburg J M, Vick J E, Blankschien M D, Rodriguez-Moya M, Gonzalez R: A synthetic biology approach to engineer a functional reversal of the beta-oxidation cycle. ACS Synth Biol 2012, 1(11):541-554. Kim S, Clomburg J M, Gonzalez R. Synthesis of medium-chain length (C6-C10) fuels and chemicals via -oxidation reversal in Escherichia coli. J Ind Microbiol Biotechnol. 2015 March; 42(3):465-75. doi: 10.1007/s10295-015-1589-6. Epub 2015 Feb. 3. PubMed PMID: 25645093. Kataoka N, Vangnai A S, Pongtharangkul T, Yakushi T, Matsushita K: Butyrate production under aerobic growth conditions by engineered Escherichia coli. Journal of bioscience and bioengineering 2017, 123(5):562-568. Dellomonaco C, Clomburg J M, Miller E N, Gonzalez R: Engineered reversal of the beta-oxidation cycle for the synthesis of fuels and chemicals. Nature 2011, 476(7360):355-359. Zhang X, Mao Y, Wang B, Cui Z, Zhang Z, Wang Z, Chen T. Screening, expression, purification and characterization of CoA-transferases for lactoyl-CoA generation. J Ind Microbiol Biotechnol. 2019 Jul. 1; 46(7):899-909. Prabhu R, Altman E, Eiteman M A. Lactate and acrylate metabolism by Megasphaera elsdenii under batch and steady-state conditions. Appl Environ Microbiol. 2012 December; 78(24):8564-70. doi: 10.1128/AEM.02443-12. Epub 2012 Sep. 28. PubMed PMID: 23023753; PubMed Central PMCID: PMC3502912. Singh V, Brecik M, Mukherjee R, Evans J C, Svetlkov Z, Blako J, Surade S, Blackburn J, Warner D F, Mikuov K, Mizrahi V. The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan. 22; 22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec. 24. PMID: 25544046. Projan S J, Monod M, Narayanan C S, Dubnau D. Replication properties of pIM13, a naturally occurring plasmid found in Bacillus subtilis, and of its close relative pE5, a plasmid native to Staphylococcus aureus. J Bacteriol. 1987; 169(11):5131-5139. doi:10.1128/jb.169.11.5131-5139.1987 De Rossi E, Milano A, Brigidi P, Bini F, Riccardi G. Structural organization of pBC1, a cryptic plasmid from Bacillus coagulans. J Bacteriol. 1992; 174(2):638-642. doi:10.1128/jb.174.2.638-642.1992 Liu J, Xie Z, Merritt J, Qi F. Establishment of a tractable genetic transformation system in Veillonella spp. Appl Environ Microbiol. 2012 May; 78(9):3488-91. doi: 10.1128/AEM.00196-12. Epub 2012 Feb. 17. PMID: 22344660; PMCID: PMC3346448. Hatmaker et al., 2019, Complete genome sequences of two Megasphaera elsdenii strains, NCIMB 702410 and ATCC 25940. Microbiol Resour Announc, 8:e01430-18. doi.org/10.1128/MRA.01430-18. Guss and Riley, US Published Patent Application No. 2021/0024965.

(100) The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and/or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The disclosure is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the disclosure defined by the claims.

(101) Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term about. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present disclosure. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

(102) Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

(103) All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.