Transposon, gene transfer system and method of using the same
11661588 · 2023-05-30
Assignee
Inventors
- Zsuzsanna Izsvak (Berlin, DE)
- Zoltan Ivics (Berlin, DE)
- Lajos Mates (Berlin, DE)
- Namitha Manoj (Boulder, CO, US)
- Carmen-Anisia Judis (Berlin, DE)
- Andrea Katzer (Wandlitz, DE)
Cpc classification
A61P43/00
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
C12N15/90
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/90
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The present invention refers to hyperactive variants of a transposase of the transposon system Sleeping Beauty (SB). The invention further refers to corresponding nucleic acids producing these variants, to a gene transfer system for stably introducing nucleic acid(s) into the DNA of a cell by using these hyperactive variants of a transposase of the transposon system Sleeping Beauty (SB) and to transposons used in the inventive gene transfer system, comprising a nucleic acid sequence with flanking repeats (IRs and/or RSDs). Furthermore, applications of these transposase variants, the transposon, or the gene transfer system are also disclosed such as gene therapy, insertional mutagenesis, gene discovery (including genome mapping), mobilization of genes, library screening, or functional analysis of genomes in vivo and in vitro. Finally, pharmaceutical compositions and kits are also encompassed.
Claims
1. A transposon comprising: an isolated nucleic acid sequence encoding for a sleeping beauty 10 (SB10) polypeptide variant of SEQ ID NO: 1 positioned between at least two repeats (inverted repeats (IRs) and/or inverted repeats/direct repeats (IR/DRs)), wherein the repeats can bind to a sleeping beauty 10 (SB10) polypeptide variant of SEQ ID NO: 1, wherein the amino acid sequence of said SB10 polypeptide variant differs from SEQ ID NO: 1 by 1 to 20 amino acids, wherein one of the mutations is K14R, and wherein the transposon inserts the nucleic acid sequence into the DNA of a mammalian cell.
2. The transposon of claim 1, wherein the nucleic acid sequence comprises an open reading frame.
3. The transposon of claim 1, wherein the transposon is part of a plasmid.
4. The transposon of claim 1, wherein the nucleic acid sequence comprises at least one expression control region.
5. The transposon of claim 4, wherein the expression control region is selected from the group consisting of: a promoter, an enhancer and a silencer.
6. The transposon of claim 1, wherein the nucleic acid sequence comprises a promoter operably linked to at least a portion of an open reading frame.
7. The transposon of claim 1, wherein the DNA of the mammalian cell is selected from the group consisting of: the mammalian cell genome or extrachromosomal DNA further selected from the group consisting of: an episome and a plasmid.
8. The transposon of claim 1, wherein at least one of the repeats comprises at least one direct repeat.
9. A gene transfer system for introducing DNA into DNA of a mammalian cell comprising the transposon of claim 1.
10. The gene transfer system of claim 9, wherein the transposon is inserted into the genome of the mammalian cell.
11. The gene transfer system of claim 9, wherein the SB10 polypeptide variant comprises a combination of mutations selected from the group consisting of: Variant 1: K14R/R214D/K215A/E216V/N217Q; Variant 3: K14R/K30R/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 7: K14R/T83A/M243Q; Variant 8: K14R/T83A/I100L/M243Q; Variant 9: K14R/T83A/R143L/M243Q; Variant 10: K14R/T83A/R147E/M243Q; Variant 11: K14R/T83A/M243Q/E267D; Variant 12: K14R/T83A/M243Q/T314N; Variant 13: K14R/K30R/I100L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 14: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 15: K14R/K30R/R147E/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 16: K14R/K30R/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/E267D; Variant 17: K14R/K30R/A205K/H207V/K208R/D210E//R214D/K215A/E216V/N217Q/M243H/T314N; Variant 18: K14R/K30R/A205K/H207V/K208R/D210E//R214D/K215A/E216V/N217Q/M243H/G317E; Variant 19: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H; Variant 20: K14R/K30R/R147E/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 21: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/E267D; Variant 22: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 23: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/G317E; Variant 24: K14R/K33A/R115H/R143L/R214D/K215A/E216V/N217Q/M243H; Variant 25: K14R/K33A/R115H/R147E/R214D/K215A/E216V/N217Q/M243H; Variant 26: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H/E267D; Variant 27: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 28: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H/G317E; and Variant 29: K14R/T83A/M243Q/G317E.
12. The gene transfer system of claim 9, wherein the DNA of the mammalian cell is selected from the group consisting of: the mammalian cell genome and extrachromosomal DNA, and further selected from the group consisting of: an episome and a plasmid.
13. The gene transfer system of claim 9 for introducing DNA into DNA of a mammalian cell, wherein the nucleic acid sequence is transfected into the mammalian cell using a method selected from the group consisting of: particle bombardment; electroporation; microinjection; combining the transposon with lipid-containing vesicles or DNA condensing reagents; and inserting the transposon into a viral vector and contacting the viral vector with the cell.
14. A mammalian cell comprising the transposon of claim 1.
15. An ex vivo or in vivo gene therapy method comprising: administering to a subject the gene transfer system of claim 9.
16. The method of claim 15, wherein the gene transfer system is administered to a mammalian cell selected from the group consisting of: a pluripotent cell, a totipotent cell, a hepatocyte, a neural cell, a muscle cell and a blood hematopoietic system cell.
17. The method of claim 16, wherein the mammalian cell is a cell of the hematopoietic system selected from the group consisting of: B cells, T cells, NK cells, dendritic cells, granulocytes, macrophages, platelets, and erythrocytes or their progenitor cells.
18. A method of producing a transfected target mammalian cell, comprising: providing the gene transfer system of claim 9, providing a target mammalian cell, and transfecting the target mammalian cell with the gene transfer system.
19. A gene transfer system, comprising: a. a polypeptide variant of sleeping beauty 10 (SB10) transposase comprising an amino acid sequence differing from the sequence of SB10 transposase SEQ ID NO:1 by 1 to 20 amino acids and at least the following mutation: K14R; and b. a transposon comprising a nucleic acid sequence positioned between at least two repeats (inverted repeats (IRs) and/or inverted repeats/direct repeats (IR/DRs)), wherein the repeats can bind to the SB10 polypeptide variant, for introducing the nucleic acid sequence into DNA of a mammalian cell.
20. The gene transfer system of claim 19, wherein the nucleic acid sequence comprises at least one open reading frame.
21. An ex vivo or in vivo gene therapy method comprising: administering to a subject or to cells of a subject the gene transfer system of claim claim 19 or 20.
22. A gene transfer system for introducing a nucleic acid sequence into DNA of a mammalian cell comprising: a. an isolated nucleic acid encoding a variant of sleeping beauty 10 (SB10) transposase comprising an amino acid sequence differing from the sequence of SB10 transposase SEQ ID NO:1 by 1 to 20 amino acids and at least the following mutation: K14R; and b. a transposon comprising an isolated nucleic acid sequence positioned between at least two repeats (inverted repeats (IRs) and/or inverted repeats/direct repeats (IR/DRs)), wherein the repeats can bind to the SB10 variant.
23. The gene transfer system of claim 22, wherein the nucleic acid sequence comprises at least one open reading frame.
24. An ex vivo or in vivo gene therapy method comprising: administering to a subject or to cells of a subject the gene transfer system of claim 22 or 23.
25. A method of producing a transfected target mammalian cell, comprising: providing the gene transfer system of claim 19, providing a target mammalian cell, and transfecting the target mammalian cell with the gene transfer system.
26. A method of producing a transfected target mammalian cell, comprising: providing the gene transfer system of claim 22, providing a target mammalian cell, and transfecting the target mammalian cell with the gene transfer system.
27. The method of claim 25 or 26, wherein the transposon is part of a plasmid.
28. The method of claim 25 or 26, wherein the nucleic acid sequence comprises an open reading frame.
29. The method of claim 25 or 26, wherein the nucleic acid sequence encodes a marker protein.
30. The method of claim 25 or 26, wherein the nucleic acid sequence comprises at least one expression control region.
31. The method of claim 30, wherein the expression control region is selected from the group consisting of: a promoter, an enhancer and a silencer.
32. The method of claim 25 or 26, wherein the nucleic acid sequence comprises a promoter operably linked to at least a portion of an open reading frame.
33. The method of claim 25 or 26, wherein the DNA of the mammalian cell is selected from the group consisting of: the mammalian cell genome or extrachromosomal DNA further selected from the group consisting of: an episome and a plasmid.
34. The method of claim 25 or 26, wherein the transposon is inserted into the genome of the mammalian cell.
35. The method of claim 25 or 26, wherein at least one of the repeats comprises at least one direct repeat.
36. The method of claim 25 or 26, wherein the SB10 polypeptide variant comprises a combination of mutations selected from the group consisting of: Variant 1: K14R/R214D/K215A/E216V/N217Q; Variant 3: K14R/K30R/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 7: K14R/T83A/M243Q; Variant 8: K14R/T83A/I100L/M243Q; Variant 9: K14R/T83A/R143L/M243Q; Variant 10: K14R/T83A/R147E/M243Q; Variant 11: K14R/T83A/M243Q/E267D; Variant 12: K14R/T83A/M243Q/T314N; Variant 13: K14R/K30R/I100L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 14: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 15: K14R/K30R/R147E/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H; Variant 16: K14R/K30R/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/E267D; Variant 17: K14R/K30R/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 18: K14R/K30R/A205K/H207V/K208R/D210E/7R214D/K215A/E216V/N217Q/M243H/G317E; Variant 19: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H; Variant 20: K14R/K30R/R147E/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 21: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/E267D; Variant 22: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 23: K14R/K30R/R143L/A205K/H207V/K208R/D210E/R214D/K215A/E216V/N217Q/M243H/G317E; Variant 24: K14R/K33A/R115H/R143L/R214D/K215A/E216V/N217Q/M243H; Variant 25: K14R/K33A/R115H/R147E/R214D/K215A/E216V/N217Q/M243H; Variant 26: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H/E267D; Variant 27: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H/T314N; Variant 28: K14R/K33A/R115H/R214D/K215A/E216V/N217Q/M243H/G317E; and Variant 29: K14R/T83A/M243Q/G317E.
37. The method of claim 25 or 26, wherein components of the gene transfer system are transfected into the mammalian cell using a method selected from the group consisting of: particle bombardment; electroporation; microinjection; combining the transposon with lipid-containing vesicles or DNA condensing reagents; and inserting the transposon into a viral vector and contacting the viral vector with the cell.
38. The method of claim 25 or 26, wherein the gene transfer system is administered to a mammalian cell selected from the group consisting of: a pluripotent cell, a totipotent cell, a hepatocyte, a neural cell, a muscle cell and a blood hematopoietic system cell.
39. The method of claim 25 or 26, wherein the mammalian cell is a cell of the hematopoietic system selected from the group consisting of: B cells, T cells, NK cells, dendritic cells, granulocytes, macrophages, platelets, and erythrocytes or their progenitor cells.
Description
DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
EXAMPLES
(27) Description of the Experimental Strategy
(28) I.) Collecting hyperactive mutations within the SB transposase coding sequence (CDS) for the shuffling.
(29) a) Mutagenesis through the whole SB CDS. b) Selection of hyperactives using an activity test-system.
II.) In vitro recombination of the selected mutants by DNA shuffling. a) Isolation of the point mutations on 100-300 bp fragments. b) DNaseI breakage to 30-70 bp fragments. c) PCR shuffling and cloning of the library. d) Sequencing the library.
III.) Searching for clones exhibiting high transpositional activity. a) Large scale purification of shuffling clones. b) Test of the library clones for transpositional activity in HeLa cells. c) Manual creation of promising new combinations based on the sequencing data of the selected hyperactive clones
(30) In all tests for activity as a transposase described here SB10 (Ivics, Z., Hackett, P. B., Plasterk, R. H. and Izsvak, Zs. (1997) Molecular reconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and its transposition in human cells. Cell 91:501-510) was used as a comparator.
(31) I.a) Mutagenesis Through the Whole SB Coding Sequence.
(32) The Tc1 family of transposons is the biggest transposon family representing a lot of related sequences available for comparison. As a first step a number of single AA substitutions were designed. A range of related transposase sequences were aligned to find promising positions to be changed in the SB CDS (coding sequence). Although emphasis was laid on getting the new AA from known active sequences, also sources with no information of their activity and some known inactive sequences were used, too. So, the transposase CDSs of other known related Tc1 transposones (
(33) I.b) Selection of Hyperactives Using an Activity Test-System.
(34) The transpositional activity of all the mutations created was tested using the classical binary transposition assay (Ivics, 1997, see above). This test was the standard test for transposase activity used here. The scheme of the two component system is depicted on
(35) All the polypeptides (all single mutations) according to the invention (transposase variants) causing at least 200% hyperactivity compared to SB10 in the above assay were selected for further use in the shuffling experiment below. The hyperactivity of these variants was typically between 200-400% compared to SB10.
(36) II.a) Isolation of the Point Mutations on 100-300 bp Fragments.
(37) The PCR shuffling method originally published by Stemmer W. P. C. in 1994 (Stemmer, W. P. C. (1994) DNA shuffling by random fragmentation and reassembly: In vitro recombination for molecular evolution. Proc. Natl. Acad. Sci. 91:10747-10751) is a suitable method for mixing related parental. All the hyperactive mutations on smaller parts of the transposase CDS were isolated. The isolated fragments were broken to a 30-70 bp fragment population by DNaseI to facilitate high recombination rates.
(38) 41 single hyperactive mutations were collected to combine them in DNA shuffling (
(39) II.b) DNaseI Breakage to 30-70 bp Fragments
(40) Next the fragments were broken in a random fashion by DNaseI digestions. The similarly sized fragments were treated in groups taking care for their same ratio in the total population. Then the mixtures of broken DNA molecules carrying the mutations were run on 12% acrylamide gels and the 30-70 bp populations of fragments were isolated. An example of the isolated fragment populations is presented on
(41) II.c) PCR Shuffling and Cloning of the Library
(42) The isolated fragment populations were shuffled to reassemble the SB transposase CDS. Approximately the same amount of all individual mutations was used in the PCR reassembly reaction. As non-overlapping restriction fragment populations for narrowing the CDS around the mutations were used the addition of bridging oligos (for sequence see connect1-3 on Table 1) was also necessary to connect the neighboring fragment groups to finally get the full length SB transposase CDS. The PCR reassembly reaction was done similarly to Stemmer, 1994, (see above). Briefly, the isolated 30-70 bp fragment populations of all the selected hyperactive mutations were added in the same ratio into the PCR reaction. The final concentration of DNA in the mixture was about 20 ng/μl. Further 2 pmol of each bridging oligos (see Table 1) was added. High-fidelity polymerase was used to minimize the introduction of further mutations created by the PCR reaction itself. The program for the PCR reassembly was the following: 1) 94 C°-60 sec, 2) 94 C°-30 sec, 3) 50 C°-30 sec, 4) 68 C°-1 min, 5) 68 C°-5 min, and 40 cycles has been made of the 2-4 steps. The transposase CDS reassembly to the higher molecular weight was nicely visible after 40 cycles (
(43) TABLE-US-00001 TABLE I Oligonucleotides used for the creation of the shuffling library. Connect1 5′ gtaccacgttcatctgtacaaacaatagtacgcaagt ataa 3′ SEQ ID NO: 2 Connect2 5′ cgacataagaaagccagactacggtttgcaactgcac atgggg 3′ SEQ ID NO: 3 Connect3 5′ atattgaagcaacatctcaagacatcagtcaggaagt taaagcttggtcg 3′ SEQ ID NO: 4 SBcInfw 5′ ggtcactagtaccatgggaaaatcaaaagaaatcagc ca 3′ SEQ ID NO: 5 SBcInrev 5′ ggtcgggcccctagtatttggtagcattgcctttaa 3′ SEQ ID NO: 6
II.d) Sequencing the Library.
(44) As a next step the library of the shuffling clones (see IIc) were characterized. The library was transferred into E. Coli DH5 competent cells, then isolated and 45 reassembled COS fully sequenced. It was found that all the 45 CDS were full length without insertions or deletions and moreover only a very low incidence of extra mutations were observed. Only 2 specific nucleotide positions in the 1023 bp long CDS were found, where typical point mutations were inserted by the shuffling process itself into some of the clones. None of them caused AA change, and they remained silent on the protein level. After aligning the sequences to the SB10 transposase CDS the clonal distribution of the 41 mutations taken into the shuffling were identified. The incidence of the mutations was fairly statistical in the unselected library, 31 of the 41 mutations introduced into the shuffling in the 45 sequenced clones were identified (data not shown). However, the average number of mutations/clone was only about 2 mutations in contrast to the prediction (see above;
(45) III.a) Large Scale Purification of Shuffling Clones.
(46) The cell culture system described above was used for the activity tests. A large scale automated purification of plasmid DNA of the shuffling clones was done using a pipetting robot and a plasmid kit. The plasmid preparations were producing fairly similar yields and their quality was tissue culture compatible. All the plasmid samples were run on agarose gel to verify their similar concentrations and quality. Plasmid DNA of about 2000 clones was purified.
(47) III.b) Test of the Library Clones for Transpositional Activity in HeLa Cells.
(48) The clones were tested in transposition assays in HeLa cells as described in Ib) above with the difference that 96 well formats were used. All the tests were done as duplicates. For reference SB16 (Baus, 2005) was used on all the plates. All the clones that showed similar or higher activity compared to SB16 on the duplicated 96 well test plates were chosen for further operations. Further the activity of the best 20 clones on 12 well formats were verified. 7 (Variants 1 to 7) of the 20 retested clones showed clearly higher activity compared to SB16. The best 2 clones (Variants 2 and 3) exhibited about 2 times higher activity than SB16 which means about 30 times higher activity compared to SB10.
(49) III.c) Manual Creation of Promising New Combinations Based on the Sequencing Data of the 25 Selected Hyperactive Clones
(50) The best 20 clones retested on 12 well format and also 18 other clones still showing high activity in the range of SB16, (thus 38 clones all together), were fully sequenced to collect a data pool. The mutational content of the best 7 clones is shown in
(51) Among the 38 sequenced hyperactive clones only 8 containing 4 mutations and 5 containing 5 mutations were found. This means 21% and 13% incidence of 4 and 5 mutation carrying clones, respectively, in the selected library. No clones were identified bearing more than 5 mutations. Moreover, among the 7 best variants already 4 carried 4 or 5 mutations (see
(52) After analyzing the sequencing data of the 38 most hyperactive shuffling clones 3 clones were chosen for further mutagenesis: 3D5, 6A5 and 1281 (variants 2, 3 and 7) (
Overview of Transposase Activity of Tested Variants (Table II)
(53) TABLE-US-00002 TABLE II Activity compared Variant (with mutation pattern) to SB10 (factor) Variant 1: K14R/R214D//K215A/E216V/N217Q; ~20 Variant 2: K33A/R115H//R214D/K215A/E216V/ ~30 N217Q//M243H; Variant 3: K14R/K30R//A205K/H207V/K208R/ ~30 D210E// R214D/K215A/E216V/N217Q//M243H; Variant 4: K13D/K33A/T83A//H207V/K208R/ ~20 D210E//M243Q; Variant 5: K13A/K33A//R214D/K215A/E216V/ ~20 N217Q; Variant 6: K33A/T83A//R214D/K215A/E216V/ ~20 N217Q//G317E; Variant 7: K14R/T83A/M243Q; ~15 Variant 8: K14R/T83A/I100L/M243Q; ~5 Variant 9: K14R/T83A/R143L/M243Q; 20-30 Variant 10: K14R/T83A/R147E/M243Q; 20-30 Variant 11: K14R/T83A/M243Q/E267D; 15-20 Variant 12: K14R/T83A/M243Q/T314N; ~10 Variant 13: K14R/K30R/I100L//A205K/H207V/ K208R/D210E//R214D/K215A/E216V/N217Q// M243H; Variant 14: K14R/K30R/R143L//A205K/H207V/ ~40 K208R/D210E//R214D/K215A/E216V/N217Q// M243H; Variant 15: K14R/K30R/R147E//A205K/H207V/ ~30 K208R/D210E//R214D/K215A/E216V/N217Q// M243H; Variant 16: K14R/K30R//A205K/H207V/K208R/ ~30 D210E//R214D/K215A/E216V/N217Q//M243H/ E267D; Variant 17: K14R/K30R//A205K/H207V/K208R/ ~25 D210E//R214D/K215A/E216V/N217Q//M243H/ T314N; Variant 18: K14R/K30R//A205K/H207V/K208R/ ~25 D210E//R214D/K215A/E216V/N217Q//M243H/ G317E; Variant 19: K14R/K33A/R115H//R214D/K215A/ 70-80 E216V/N217Q//M243H; Variant 20: K14R/K30R/R147E//A205K/H207V/ ~40 K208R/D210E//R214D/K215A/E216V/N217Q// M243H/T314N; Variant 21: K14R/K30R/R143L//A205K/H207V/ ~50 K208R/D210E//R214D/K215A/E216V/N217Q// M243H/E267D; Variant 22: K14R/K30R/R143L//A205K/H207V/ K208R/D210E//R214D/K215A/E216V/N217Q// M243H/T314N; Variant 23: K14R/K30R/R143L//A205K/H207V/ ~35 K208R/D210E//R214D/K215A/E216V/N217Q// M243H/G317E; Variant 24: K14R/K33A/R115H/R143L//R214D/ 70-80 K215A/E216V/N217Q//M243H; Variant 25: K14R/K33A/R115H/R147E//R214D/ 70-80 K215A/E216V/N217Q//M243H; Variant 26: K14R/K33A/R115H//R214D/K215A/ 70-80 E216V/N217Q//M243H/E267D; Variant 27: K14R/K33A/R115H//R214D/K215A/ 90-100 E216V/N217Q//M243H/T314N; Variant 28: K14R/K33A/R115H//R214D/K215A/ 80-90 E216V/N217Q//M243H/G317E; Variant 29: K14R/T83A/M243Q/G317E; Variant 30: K13A/K33A/T83A// R214D/K215A/ ~10 E216V/N217Q
(54) Further examples IV to IX were carried out with the object to determine the activity of various hyperactive transposase mutants as compared to non-hyperactive or inactive mutants (control experiments) in cell lines of various lineages (see
(55) Description of the Experimental Strategy
(56) Materials and Methods for Examples IV to IX
(57) A) Sleeping Beauty Transposon System
(58) The SB transposon system is a binary system composed of (i) the inverted repeat/direct repeats (IR/DR) flanking the gene of interest, and (ii) the expression cassette encoding the transposase. Different transposons containing the gene of interest and different transposases were used in this study (see also above).
(59) 1) SB Transposon-Based Vectors
(60) pT2-HB-CAG-GFP
(61) The pT2-HB-CAG-GFP transposon is a SB transposon vector in which the GFP reporter gene is transcriptionally regulated by the CAG promotor. The CAG promotor is a chimeric promoter composed of the CMV (human cytomegalovirus) immediate early enhancer in conjunction with the chicken b-actin/rabbit-b-globin hybrid promoter and intron (CAG) HYPERLINK LMBP 2453); (pA: polyadenylation signal) (
(62) (ii) pT2-HB-CMV-FIX-neo The pT2-HB-CMV-FIX-neo transposon is a SB transposon vector in which the human coagulation factor IX cDNA (FIX) is driven by the CMV promoter. The vector also contains a Simian Virus 40 (SV40) promoter driving a neomycin resistance gene (Neo.sup.R) that confers resistance to G418 (Geneticin) in stably transfected cells (
(63) (iii) pT2-HB-CMV-GFP-neo The pT2-HB-CMV-GFP-neo transposon is a SB transposon vector in which the GFP reporter gene is transcriptionally regulated by the CMV promotor. The vector also contains a SV40 promoter driving a neomycin resistance gene (Neo.sup.R) that confers resistance to G418 (Geneticin) in stably transfected cells (
(64) (iv) pT2-HB-Apo/AAT-FIX The pT2-HB-Apo/AAT-FIX transposon is a SB transposon vector in which the FIX cDNA was driven from the ApoE HCR/AAT promoter composed of the apolipoprotein E enhancer/al-antitrypsin promoter, the hepatocyte control region (HCR) and the first FIX intron (kindly provided by Dr. Miao, University of Washington) (
2) Transposases
(65) All transposases (active, inactive of hyper-active) are encoded by a CMV expression plasmid and contain different mutations in the DNA binding domain, catalytic domain or both (
(66) B) Cells
(67) Umbilical cord blood (UCB) mononuclear cells were separated from UCB over Ficoll/Hypaque by centrifugation at 2400 rpm for 30 min at 20° C., then washed with PBS containing 2 mM EDTA and centrifuged twice at 1000 rpm for 10 min. The CD34+ cells were further enriched by immunomagnetic separation according to the manufacturer's instructions (Miltenyi Biotech Inc. CA, USA) using magnetic beads conjugated to anti-CD34 antibodies. This immunomagnetic cell separation typically yielded >95% CD34+ cells which are enriched for hematopoietic stem/progenitor (HSC) cells. Primary human skeletal muscle stem/progenitors cells (myoblasts) were obtained by needle biopsy.sup.5 from the vastus lateralis muscle of volunteers. Myoblasts were expanded in SkGM medium, as described by the manufacturer (Cambrex Bio Science, MD USA).
C) Mice C57Bl/6 mice were hydrodynamically transfected with 50 micrograms of transposon with 25 μg of transposase plasmid diluted in 2 ml of PBS and injected into the tail vein. Typically, the injection took less than 10 seconds for each mouse and is results in efficient hepatic gene delivery.
D) Transfection Nucleofection of CD34+ HSCs was done according to the optimized protocol for human CD34+ cells using the nucleofection kit developed by Aamaxa Biosystems (Amaxa Biosystems, Cologne Germany). The U-01 program was employed using the Amaxa electroporation device (Nucleofector I, Cologne Germany). Enriched CD34+ cells in PBS were centrifuged at 1200 rpm for 10 min and re-suspended in Nucleofector buffer. Typically, 1.5×10.sup.5 cells in 100 microliter of human CD34 cell Nucleofector buffer (Amaxa Biosystems, Cologne Germany) per cuvette were subjected to electroporation with purified plasmids containing the transposon (10 microgram) and transposase (5 microgram) (concentration: 1 microgram/microliter). Nucleofection of human muscle progenitor/stem cells (myoblasts) was done according to the optimized protocol for human myoblasts using the nucleofection kit developed by Aamaxa Biosystems (Amaxa Biosystems, Cologne Germany). The A-33 program was employed using the Amaxa electroporation device (Nucleofector I, Cologne Germany). Myoblasts in PBS were centrifuged at 1200 rpm for 10 min and resuspended in Nucleofector buffer. Typically, 10.sup.6 cells in 100 microliter of Primary Smooth Muscle Cell Nucleofector buffer (Amaxa Biosystems, Cologne Germany) per cuvette were subjected to electroporation with purified plasmids containing the transposon (3.6 microgram) and transposase (1.4 microgram) (concentration: 1 microgram/microliter). Transfected myoblasts were selected in G418 (400-600 microgram/ml).
E) Clonogenic Assays
(68) 1) CFU-Mk (Megakaryocytes/Platelets) Megakaryocytic clonogenic assays were performed by adding 50 microliter of Stemline medium (Sigma-Aldrich, USA) supplemented with SCF 100 ng/ml, IL-6 20 ng/ml, IL-3 100 ng/ml, FIt3-L 20 ng/ml and TPO 100 ng/ml to the 100 microliter of electroporated CD34+ cell suspension. Fifty microliter of the final cell suspension was then added to 450 microliter of megakaryocyte differentiation medium corresponding to Myelocult H5100 (Stemcell Technologies, Vancouver Canada) supplemented with TPO 25 ng/ml, hSCF 25 ng/ml, hIL-6 10 ng/ml, hIL1b 10 ng/ml and seeded over 3 wells in a 24-well plate, hence containing 5×10.sup.4 cells per well. At day 6 post-transfection, medium was changed by centrifuging the plate briefly, discarding the supernatant and adding fresh megakaryocyte differentiation medium. At day 10, colonies were counted. GFP expression was monitored using the Olympus fluorescence inverted microscope and CFU-Mk colonies were scored with this microscope. In addition, the automated Zeiss Inverted Microscope was employed.
(69) 2) CFU-GM (Granulocyte/Monocyte/Macrophage) Granulocyte/monocyte/macrophage clonogenic assays were performed by adding microliter of the final cell suspension to 270 microliter of granulocyte/monocyte/macrophage differentiation medium corresponding to semi-solid Methocult GF H4534 (Stemcell Technologies, Vancouver Canada) composed of 1% methylcellulose (4000 cps), 30% fetal bovine serum, 1% bovine serum albumin, 10.sup.4 M 2-mercaptoethanol, 2 mM L-glutamine, 50 ng/ml rhSCF, 10 ng/ml rhGM-CSF, 10 ng/ml rhIL-3 in Iscove's MDM. The cell suspension were seeded over 3 wells in a 24-well plate, hence containing 5×10.sup.4 cells per well. At day 14, colonies were counted. GFP expression was monitored using the Olympus fluorescence inverted microscope and CFU-GM colonies were scored with this microscope. In addition, the automated Zeiss Inverted Microscope was employed.
(70) 3) CFU-E (erythrocytes) Erythroid clonogenic assays were performed by adding 30 microliter of the final cell suspension to 270 microliter of erythoid differentiation medium corresponding to semi-solid Methocult SF.sup.BIT H4436 (Stemcell Technologies, Vancouver Canada) composed of methylcellulose, fetal bovine serum, bovine serum albumin, 2-mercaptoethanol, L-glutamine, rhSCF, rhGM-CSF, rhIL-3, rhIL-6, rhG-CSF, rh Epo in Iscove's MDM. The cell suspension were seeded over 3 wells in a 24-well plate, hence containing 5×10.sup.4 cells per well. At day 7, colonies were counted which typically contained about 70% glycophorin A.sup.+ cells, a characteristic marker of erythroid cells. GFP expression was monitored using the Olympus fluorescence inverted microscope and CFU-E colonies were scored with this microscope. In addition the automated Zeiss Inverted Microscope was employed.
(71) F) Detection of FIX The level of FIX in culture supernatant or in citrated plasma was assayed for FIX antigen by Asserachrome IX sandwich ELISA (Asserachrome/Diagnostica Stago, Parsippany, N.J., USA). Blood was collected by retro-orbital bleeds.
(72) G) Microscopy Epifluorescence and bright field images were taken with Zeiss Axiovert 200M microscope, using the Axiovision 4.6 program and AxioCam MR3 camera. If not mentioned otherwise, pictures were taken by automatic exposure time selection and optimal display of the minimum and maximum contained gray or color value (A. Min/Max option). The settings were kept as same throughout a series of imaging and were not reset at each individual image. Confocal microscopy was carried out with Axiovert 100M, LSM510, Zeiss using the AxioPlan 2 LSM 510 version 2.8 software. In all images GFP expression was monitored at 488 nm excitation wavelength.
Examples IV to IX
Example IV
(73) Transposition in Human CD34+ Hematopoietic Stem/Progenitor Cells
(74) This Example was intended to provide a comparative analysis of hyperactive transposases SB M3a and SB6/A5, respectively, versus the non-hyperactive transposases SB10 and SB11 in erythroid lineage. Human CD34+ HSC were transfected by nucleofection with the pT2-HB-CAG-GFP and transposase expression vectors encoding SB M3a and SB 6/A5 as described in the Materials and Method section for Examples IV to IX. The performance of these novel engineered transposases was compared with that of the originally derived SB10 transposase and SB11. The total number of CFU-E colonies, the absolute number of GFP+ CFU-E colonies and the % GFP+ CFU-E colonies are shown in
(75) The results indicate that transposases SB M3a and SB 6/A5 lead to a robust increase in % GFP+ colonies compared to the originally derived SB10 transposase and SB11. In contrast, no GFP+ CFU-E colonies were detectable after co-transfection with the inactive transposase SB DNGP in which the catalytic site had been mutated. Hence, the inventive SB M3a and SB 6/A5 transposases correspond to the inventive group of “hyper-active” transposases that result in more efficient transposition in human CD34+ HSC compared to non-hyperactive transposase SB10 and SB11. The total number of CFU-E colonies remained unchanged after electroporation with the various constructs, suggesting that there is no overt toxicity associated with over-expression of these hyper-active transposases which underscores the safety of this approach.
Example V
(76) Transposition in Human CD34/Hematopoetic Stem/Progenitor Cells
(77) This comparative analysis was designed to determine the results of hyperactive transposases M3a, SB6/A5 and SB 3D5-K14R in erythroid lineage. Human CD34+ HSC were transfected by nucleofection with the pT2-HB-CAG-GFP and transposase expression vector encoding SB M3a, SB 6/A5 or SB 3D5-K14R, as described above. The total number of CFU-E colonies, the absolute number of GFP+ CFU-E colonies and the % GFP+ CFU-E colonies are shown in
(78) The results indicate that the transposases SB 6/A5 and SB 3D5-K14R lead to a significant increase of 2 and 4.8-fold in % GFP+ relative to the hyperactive transposase SB M3a. In contrast, no GFP+ CFU-E colonies were detectable after co-transfection with the inactive transposase SB DNGP in which the catalytic site had been mutated. This indicates that the SB 3D5-K14R results in even more robust transposition than the hyperactive SB M3a and SB 6/A5 transposases. Hence, the data shown in
Example VI
(79) Transposition in Human CD34+ Hemopoietic Stem/Progenitor Cells
(80) This Example was intended to provide a comparative analysis of hyperactive transposases SB6/A5 (Variant 3) versus SB100X (Variant 27) in erythroid, megakaryocytic and granulocytic/macrophage monocyte/lineage. Human CD34+ HSC were transfected by nucleofection with the pT2-HB-CAG-GFP and transposase expression vector encoding SB 6/A5 or SB 100x, as described above. The total number of CFU-E colonies, the absolute number of GFP+ CFU-E colonies and the % GFP+ CFU-E colonies are shown in
(81) The results indicate that the transposases SB 100x (Variant 27) lead to a robust increase in % GFP+ colonies compared to the hyperactive transposase SB 6/A5 in all lineages (CFU-E, CFU-Mk, CFU-GM). The increase in % GFP CFU's, that reflects the concomitant increase in stable gene transfer efficiencies following SB-mediated transposition, was consistent among the different lineages and hereby provides compelling evidence that a genuine hematopoietic stem/progenitor cells had been stable and efficiently transfected using this transposon technology. In contrast, no GFP+ CFU-E, CFU-Mk and CFU-GM colonies were detectable after co-transfection with the inactive transposase SB DNGP in which the catalytic site had been mutated. The total number of CFU-E, CFU-Mk and CFU-GM colonies remained unchanged after electroporation with the various constructs, suggesting that there is no overt toxicity associated with over-expression of hyper-active transposases SB100x or SB 6/A5.
(82) Comparative analysis of the different transposases in the erythroid lineage indicates that all inventive hyperactive transposases (SB M3a, SB 6A5, SB 3D5-K14R and SB 100x) result in more efficient stable gene transfer in CD34+ HSCs and hence a higher % GFP+ colonies compared to when the originally derived transposase SB10 and its derivative SB11 were used (
Example VII
(83) Transposition in Human Muscle Stem/Progenitor Cells
(84) This Example was intended to validate inventive hyperactive transposases SBM3a and SB6/A5. Human muscle stem/progenitor cells (myoblasts) were transfected by nucleofection with the pT2-HB-CMV-GFP-Neo (see
Example VII
(85) Transposition in Human Muscle Stem/Progenitor Cells
(86) This Example serves to validate hyperactive transposases SB 100x, SB 3D5-K14R, SB M3a vs. non-hyperactive SB 11. Human muscle stem/progenitor cells (myoblasts) were transfected by nucleofection with the pT2-HB-CMV-GFP-Neo and transposase expression vector encoding the hyperactive SB 100x, SB 3D5-K14R, SB M3a transposase, vs. non-hyperactive SB transposase (SB11) as described above. Transfected cells were enriched after G418 selection (7 days selection). High and stable levels of GFP expression were obtained and most cells survived the G418 selection (
(87) Comparison of the hyperactive SB transposases with the SB10-derivative SB11, confirm the superior transposition efficiency of the SB 100x, SB 3D15-K14R and SB M3a, consistent with a robust increase in % GFP+ transfected cells. The SB100x transposase yielded the highest % GFP+ cells. The stable gene transfer efficiency as reflected by the % GFP cells was less when the SB 3D15 transposase was used relative to SB10x. The stable gene transfer efficiency as reflected by the % GFP cells was less with the SB M3a transposase compared to SB 3D5-K14R. Hence, the relative differences in transposition/stable gene transfer obtained with different transposases in human muscle progenitor/stem cells correlated with the relative differences in gene transfer in other primary cell types, particularly CD34 human hematopoietic stem/progenitor cells (
Example IX
(88) Transposition In Vivo
(89) This Example was intended to validate inventive hyperactive transposase SB100X. To assess whether the hyperactive transposase SB100x also resulted in more robust gene transfer in vivo compared to when non-hyperactive transposases are used, a liver-directed gene transfer experiment was conducted as described above. To achieve this, a plasmid containing a transposon expressing factor IX (FIX) from a potent liver-specific promoter (pT2-HB-Apo/AAT-FIX) (see
(90) To confirm that the FIX transposon had been stably integrated into the hepatocyte genome following in vivo gene transfer, hepatocyte cell cycling was induced following partial hepatectomy (Phx) (