Compositions and methods for controlling microbial growth
11661589 · 2023-05-30
Assignee
Inventors
Cpc classification
International classification
Abstract
Provided are modified microorganisms which are modified such that their growth can be controlled using exogenously provided compounds. The microorganisms can be modified by genetic alterations that include a promoter inducible by a first exogenously supplied compound. The promoter can be configured to drive expression of an RNA coding sequence that may be essential to growth of the microorganism. The microorganisms may also be modified to include site specific recombinase recognition sites flanking or within the RNA coding sequence so that expression of the corresponding site specific recombinase will disrupt transcription of the RNA. The site specific recombinase can be configured such that it expression and/or activity is suppressed by a second exogenously supplied compound. Methods of making the modified microorganisms and kits that contain reagents for making and using the modified microorganisms are also provided.
Claims
1. A modified microorganism, the growth of which can be controlled by exogenously provided first and second compounds, the modified microorganism having genetic alterations comprising: i) a promoter inducible by the first compound, wherein the inducible promoter is operably linked to an RNA coding sequence, expression of which is essential for growth of the microorganism, wherein the RNA coding sequence does not encode an auxotrophic marker; ii) a pair of site specific recombinase recognition sites (SSRRS) flanking or within the RNA coding sequence such that recombination between the SSRRS disrupts expression of the RNA coding sequence; and iii) a site specific recombinase (SSR) coding region, wherein the SSR is specific for the SSRRS, and wherein expression of the SSR is repressed by the second compound; wherein the modified microorganism is in an in vitro culture comprising a culture medium, wherein the culture medium comprises a sub-micromolar concentration of the first and/or second compounds, and wherein the culture medium comprises a greater than sub-micromolar concentration of at least one decoy compound.
2. The modified microorganism of claim 1, wherein a) the promoter is inducible by a sub-micromolar concentration of the first compound, or b) wherein the expression of the SSR is repressible by or inhibited by a sub-micromolar concentration of the second compound, or both a) and b).
3. The modified microorganism of claim 1, wherein the modified microorganism has the same or an enhanced growth rate relative to a microorganism of the same type that does not comprise the genetic alterations.
4. The modified microorganism of claim 1, further comprising at least one decoy RNA coding sequence or other decoy genetic element introduced into the microorganism, wherein if the decoy RNA coding sequence is present and expressed its expression is not affected by the first or the second compound.
5. The modified microorganism of claim 1, wherein the modified microorganism is a pathogenic microorganism.
6. A kit for use in controlling growth of a microorganism of claim 1, the kit comprising a plurality of compounds, wherein the plurality of compounds includes the first and second compounds and the at least one decoy compound, wherein the at least one decoy compound is included in a molar excess relative to the first and second compounds.
7. The kit of claim 6, further comprising at least 2, 3, 4 or 5 additional decoy compounds, wherein the additional decoy compounds are each included in a molar excess relative to the first and second compounds.
8. The kit of claim 6, further comprising a microorganism of claim 1.
9. The kit of claim 6, further comprising a growth medium.
10. A method for controlling growth of a population of microorganisms of claim 1, comprising culturing the population of microorganisms in a culture medium that comprises a sub-micromolar concentration of the first and second compounds, wherein the first and second compounds are added to the culture medium in a composition that comprises the at least one decoy compound, wherein the at least one decoy compound is included in a molar excess relative to the first and second compounds, and wherein the at least one decoy compound does not retard the growth of the microorganisms in the population.
11. The method of claim 10, wherein the population of microorganisms comprises pathogenic microorganisms.
Description
DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
DETAILED DESCRIPTION
(27) The present disclosure is generally directed to modified microorganisms, the growth of which can be controlled by exogenously provided chemical compounds that affect the expression and/or integrity of an RNA coding sequence present in a chromosome or other genetic element, non-limiting examples of which include plasmids and Yeast Artificial Chromosomes (YAC) in the microorganism.
(28) The RNA coding sequence encodes an RNA which may or may not encode a protein, but for the purpose of this disclosure it does not encode an auxotrophic marker. Those skilled in the art will appreciate that an auxotrophic marker is a gene encoding a protein that is required for the microorganism to synthesize a compound needed for growth, examples of which include but are not necessarily limited to nucleotides, amino acids, cofactors, vitamins and fatty acids. Further, the skilled artisan will be able to ascertain whether or not any particular DNA sequence encodes an auxotrophic marker based on well-known parameters.
(29) In general the present disclosure takes advantage of the discovery that growth of microorganisms can be tightly controlled using two modes of experimentally generated dependency on exogenously provided compounds, one being transcriptional, and the other the presence/absence of the RNA coding sequence, i.e., recombinational. For ease of description an RNA coding sequence may be referred to herein as a gene, but it should be understood that in various embodiments the RNA coding sequence can encode an mRNA that is translated into a protein, such as an essential protein, or an essential non-coding RNA, such as an essential miRNA, an essential snoRNA, an essential snRNA, or any other RNA that is required for cell survival but does not encode an auxotrophic marker, and wherein the expression of the RNA is controlled by an inducible promoter as will be more fully described below. Thus, an “essential” RNA coding sequence as used herein encodes an RNA, the expression of which is required for the cell to remain living and/or to divide. In this regard, the dual-pronged approach to biocontainment that is an aspect of this disclosure is directed to at least one gene that is essential for growth of the microorganism. However, notwithstanding its essentiality, the disclosure provides for concurrent control of transcription and maintenance of the integrity of the essential gene using exogenously provided compounds without negatively impacting the fitness of the microorganism. Thus, in embodiments, a modified microorganism of this disclosure that is under strict biocontainment via the exogenously provided compounds will nevertheless be, in certain embodiments, indistinguishable from a culture of non-modified microorganisms of the same type based on fitness. In embodiments, fitness is determined by factors such as growth rate, cell size and/or morphology, and transcriptome analysis, wherein the transcription of the gene under the control of the exogenously provided compounds, as well the transcription of other genes, is the same or essentially the same as those of a positive control culture, or other suitable reference.
(30) In certain embodiments the multiplex genome safeguards that are present in a modified microorganism of this disclosure comprise the following:
(31) i) a promoter inducible by a first exogenously provided compound, wherein the inducible promoter is operably linked to an RNA coding sequence, expression of which is essential for growth of the microorganism, wherein the RNA coding sequence does not encode an auxotrophic marker; and
(32) ii) a pair of site specific recombinase recognition sites (SSRRS) flanking or within the RNA coding sequence such that recombination between the SSRRS disrupts expression of the RNA coding sequence; and
(33) iii) a site specific recombinase (SSR) coding region, wherein the SSR is specific for the SSRS, and wherein expression of the SSR is repressed by a second exogenously provided compound.
(34) It will be recognized that the terms “first” and “second” compound are for ease of reference and do not specify any sequence or magnitude of importance.
(35) As an alternative to ii) and iii), the RNA coding sequence can comprise an endonuclease recognition target site, in which case the microorganism will also encode an endonuclease (as distinct from an SSRS) that can cleave the endonuclease site with specificity, wherein expression of the endonuclease is repressed by the exogenously provided second compound. Non-limiting examples of such endonucleases include clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) enzymes and their associated guide RNAs, as well as zinc finger nucleases and Transcription activator-like effector nucleases (TALENs). Each of these distinct endonucleases are well known in the art, as are their DNA site-recognition requirements and therefore, given the benefit of the present disclosure, the skilled artisan can adapt these alternatives to function in the orthogonal, multiplex safeguard approaches that are encompassed by the instant disclosure. However, as an illustrative proof of principle, this disclosure utilizes the SSR-based approach to show the capability to disrupt the DNA segment that comprises the RNA coding sequence by simply ceasing the provision of the second exogenous compound to the microorganisms. Accordingly, this disclosure uses the capability to eliminate (or otherwise disrupt) the RNA coding region from the cell via a recombinatorial approach, thereby resulting in a lethal event when and if the second compound is withdrawn from the microorganism. Any suitable SSR can be used as one of the prongs of the biocontainment approach of this disclosure, and many SSRs are known in the art, as are their site specific recognition sites. In non-limiting embodiments the SSR comprises a Cre recombinase, and is therefore used with loxP sites. A Cre recombinase is useful because it can recombine DNA sequences without the need for cofactors, but other SRR and related systems can also be used and include but are not limited to Flp Recombinase which functions in the Flp/FRT system, the Dre recombinase which functions in the Dre-rox system, the Vika recombinase which functions in the Vika/vox system, Bxb1 recombinase which functions with attP and attB sites, long terminal repeat (LTR) site-specific recombinase (Tre), and other serine recombinases, such as phiC31 integrase which mediates recombination between two 34 base pair sequences termed attachment sites (att), Hin recombinase, which recognizes 26 bp imperfect inverted repeat sequences or int2-13 each of which each recognizes distinct target sites of 39-66 bp (Yang et al. Nat Methods. 2014; 11(12): 1261-1266.
(36) Expression of the SSR could be under control of a repressor which requires persistence of an exogenously provided compound to sustain the repressed state. In embodiments, repression of SSR expression is achieved by a sub-micromolar concentration of an exogenously provided compound. As is known in the art, a repressor comprises a DNA binding protein that inhibits expression of the gene in question by binding with specificity to a DNA segment, such as an operator or a silencer, or to otherwise block the attachment of an RNA polymerase to DNA. Binding of the repressor protein requires the exogenously provided compound, and thus this arrangement comprises one non-limiting example of the multiplex switches of this disclosure. Examples of repressors include the Tet repressor, the lac repressor and the lambda repressor, the Met repressor and the Trp repressor, all from E. coli.
(37) In another embodiment, the small molecule may directly influence the biochemical activity of the SSR protein. In one embodiment, the exogenously provided compound that acts directly on the SSR protein comprises a steroid hormone. In an embodiment the exogenously provided compound is an estradiol, such as β-Estradiol. In embodiment, the compound releases the SSR protein from the binding by Hsp90 protein, allowing it to transit to the cell nucleus, where it can operate on the target. Any compound that blocks either the DNA binding activity of the SSR protein directly, interferes with the cutting and joining activity of the SSR protein, or the transit of the SSR protein to the nucleus will be useful in this embodiment.
(38) With respect to the inducible promoter, any suitable inducible promoter can be introduced into the microorganism such that it is operably linked to the essential RNA coding sequence, provided that the promoter is inducible by an exogenously provided compound at a sub-micromolar concentration. The DNA sequences of wide variety of inducible promoters for use in prokaryotic and eukaryotic microorganism sequences are known in the art, as are the agents that are capable of inducing them, and many cloning systems for introducing inducible promoters into microorganisms are commercially available and can be adapted for use with embodiments of this disclosure. In non-limiting embodiments, the promoters can be GAL1 or GAL7 promoters, the MET23 promoter, the FUS1 promoter, and the ecdysone promoter, such as for use in eukaryotic microorganisms, such as yeast. In an additional embodiment, engineered regulated promoters such as the Tet promoter TRE which is regulated by tetracycline, anhydrotetracycline or doxycline and the lad-regulated promoter ADHi, which is regulated by IPTG (isopropyl-thio-galactoside) may also be used in eukaryotic cells. In embodiments, the native lac, Tet, Ara, promoters and many others may be used in prokaryotic cells. Additional promoters will be known to those skilled in the art, such as eukaryotic promoters described in Maya et al., Biotechnol Lett. 2008 June; 30(6):979-87, Stanton et al. ACS Synth Biol. 2014; 3(12):880-91 and Ikushima et al. G3 (Bethesda). 2015; 5(10):1983-90. and prokaryotic promoters as described in Goldstein et al., Biotechnol Annu Rev. 1995; 1:105-28 and Brautaset et al., Microb Biotechnol. 2009 January; 2(1):15-30 or Stanton et al. Nat Chem Biol. 2014; 10(2):99-105.
(39) The RNA coding sequence can comprise any essential RNA/gene. In one embodiment the gene that is the subject of the multiplex controls described herein encodes a histone protein. In embodiments, the modified microorganism is a yeast, and the protein coding gene that is subject to the biocontainment controls is SUI1, HSP10 or RPC11. In another embodiment, the RNA sequence encodes an essential tRNA or the RNA subunit of RNAse P, an essential enzyme. In various embodiments the RNA coding sequence can be resident on a chromosome of the microorganism, or it can be present on an episomal element. Those skilled in the art will comprehend how to recognize and/or identify candidate RNA coding sequences that are suitable for exploiting in the orthogonal safeguard switches of this invention, including but not necessarily limited to high throughput screening methods, and testing of randomly assembled or rationally designed transcription units, which can comprise promoters, genes and 3′UTRs. In one embodiment for use in eukaryotic microorganisms such as yeast, the Yeast Golden Gate approach can be adapted to identify suitable genes for use in biocontainment according to this disclosure. In certain embodiments, any one or any combination of the 47 genes depicted in
(40) In another aspect the present disclosure comprises modified microorganisms as described above in culture, wherein the culture medium comprises the first and second exogenously provided compounds. In embodiments the culture medium comprises sub-micromolar amounts of the first and second compounds (the inducer and the repressor compound). In embodiments the culture is a liquid culture, or is a culture provided on a solid or semi-solid growth medium. In embodiments, the culture comprises an agent that is used to inhibit cellular damage by ice crystal formation, such as glycerol. In embodiments the culture is maintained as a frozen stock. In embodiments microorganisms in the culture have an escape rate (meaning viability in the absence of one or both of the first and second compounds) of at least 10.sup.−5, 10.sup.−6, 10.sup.−7, 10.sup.−8, 10.sup.−9, 10.sup.−10, or an even lower escape rate.
(41) It is expected that the present disclosure will be adaptable for use with any microorganism, including prokaryotes and eukaryotes. In embodiments, the microorganism is pathogenic, or is capable of becoming pathogenic depending on its environment (conditionally pathogenic). In embodiments the microorganisms are human or non-human animal pathogens. In embodiments, the pathogens are selected from gram positive and gram negative bacteria. In embodiments the pathogens are obligate intracellular parasites. In embodiments the pathogens are pathogens maintained in a laboratory and are candidates for use as agents for bioterrorism. In embodiments the pathogens are members a following bacterial genus: Bacillus, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia and Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Escherichia, Francisella, Haemophilus, Helicobacter, Legionella, Leptospira, Listeria, Mycobacterium, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Staphylococcus, Streptococcus, Treponema, Vibrio, and Yersinia. In embodiments the microorganism is a pathogenic or potentially pathogenic eukaryote, such as a yeast or other fungus. In embodiments the pathogenic fungus is a member of a following genus: Candida, Aspergillus, Cryptococcus, Fusarium, Histoplasma, Pneumocystis, and Stachybotrys.
(42) In an effort to deter potential efforts to decrypt the genomic safeguards described herein, the culture medium can comprise one or more other compounds which are referred to herein as “decoy” compounds. Decoy compounds comprise exogenously provided compounds that may have known capabilities to alter gene expression in a microorganism, such as compounds that can induce a promoter or repress gene expression, but the present cultures are configured such that the decoy compounds do not substantially affect their gene expression or growth profiles. Thus, the first and second compounds described above for use as inducers and suppressor compounds can be considered “non-decoy” compounds for ease of reference. In embodiments the culture comprises greater molar concentrations of the decoy compounds relative to the non-decoy compounds. Thus, the decoy compounds can be included in micromolar, or millimolar, or greater concentrations. Any number of decoy compounds can be included. In embodiments, at least one, two, three, four or five decoy compounds are included. Decoy compounds known to regulate gene expression may be of heightened value. Decoy compounds suitable for use in embodiments of this disclosure include but are not limited to the following, and include all combinations of the following: IPTG (isopropyl thioglactoside), virginiamycin, gentamycin, quercetin, lincomycin, 1-Naphthaleneacetic acid, 2,4-DAPG, 3-oxo-octanoyl-L-homoserine (OAH), bepridil, catechin, choline, coumestrol, cumate, d-camphor, daidzein, doxycycline, erythromycin, estradiol, fisetin, fusaric acid, genistein, kinetin, and sodium salicylate.
(43) In another aspect the disclosure includes modified microorganisms that include decoy genetic elements. The decoy genetic elements can comprise genes, such as toxin genes, auxotrophic markers, other RNA coding sequences, but the decoy genes are not affected by the non-decoy compounds. In embodiments, the decoy genetic elements comprise SSRRS, or one or more SSRs that are not active in the modified organisms, or an inducible promoter that is not induced by the non-decoy or the decoy compounds. It will be recognized that decoy genetic elements may affect a transcriptome analysis relative to a non-modified organism of the same type, but the decoy genetic elements are designed so as not to substantially diminish the fitness of the modified microorganisms relative to microorganisms of the same type that are not similarly modified. Additional non-limiting examples of decoy genes include the lad (lac repressor) gene, the camphor repressor, virginiamycin repressor, gentamycin repressor or any of a large collection of known Tet repressor homologs.
(44) In another aspect the disclosure includes a kit for use in controlling growth of a modified microorganism as described above. The kit comprises a plurality of compounds, wherein the plurality of compounds includes the first and second non-decoy compounds described above, and further comprises at least one decoy compound, wherein the at least one decoy compound is included in a molar excess relative to the first and second compounds. In embodiments the kit can comprise at least 2, 3, 4 or 5 or more additional decoy compounds, wherein the additional compounds are each included in a molar excess relative to the first and second compounds. The kit can further comprise a modified microorganism described herein, including in a culture thereof. The kit can comprise separate or a single container(s) for containing the non-decoy and decoy compounds, or the culture, suitable containers being well known in the art. The kit can include one or all of the compounds in a ready-to-use solution, or combinations of the compounds can be provided for use in making a solution for adding to growth medium. The kit can include printed material that describes preparing the compounds for adding to the culture medium, or instructions for adding a composition comprising the compounds directly to the culture medium. In an embodiment, the kit includes pre-made culture media which comprises the non-decoy compounds at a sub-micromolar concentration, and the decoy compounds in a molar excess relative to the non-decoy compounds.
(45) In one embodiment, the disclosure includes the pre-made culture as a product that is independent of the kit, and which can be sold as, for example, a powder, solution or gelatinous substrate suitable for culturing the modified microorganisms, and which includes the decoy and non-decoy compounds.
(46) In another aspect the disclosure includes a method for controlling growth of a population of modified microorganisms described herein, comprising culturing the population of microorganisms in a culture medium that comprises a sub-micromolar concentration of the first and second non-decoy compounds described above, and which can further comprise one or more decoy compounds in a molar excess relative to the first and second compounds, and wherein the decoy compound(s) does not retard the growth of the microorganisms in the population.
(47) In yet another aspect the disclosure includes a method of making a modified microorganism, the growth of which can be controlled using a first and second compound at sub-micromolar concentration in a culture medium as described above, the method comprising introducing into the microorganism: i) a promoter inducible by the first compound, wherein the inducible promoter is operably linked to an RNA coding sequence, transcription of which is essential for growth of the microorganism, wherein the RNA coding sequence does not encode an auxotrophic marker; ii) a pair of site specific recombinase recognition sites (SSRRS) flanking or within the RNA coding sequence such that recombination between the SSRRS disrupts transcription of the RNA coding sequence; and iii) a site specific recombinase (SSR) coding region which is specific for the SSRS, and wherein expression of the SSR is repressed by the second compound; and iv) culturing the microorganism in a culture medium that comprises a sub-micromolar concentration of the first and second compounds. As described above, alternatives to the SSRRS and SSR are available and include endonuclease coding regions and sites that are specifically recognized by the endonuclease. Decoy genes can also be introduced into the microorganism. The disclosure also includes progeny of any of the modified microorganisms described herein.
(48) The following Examples are presented to illustrate particular embodiments of the present disclosure. They are not intended to be limiting in any manner.
Example 1
(49) This Example provides a demonstration of plasmid based chemically regulated transcriptional switches. As a proof of principle, we first constructed a chemically regulated transcriptional switch based on two essential synthetic histone genes called HHTS and HHFS encoding histone H3 and H4 respectively; the “S” refers to the synthetic nature of the genes (described in Dai J, et al. (2008) Cell 134(6):1066-1078). In the safeguard strains described here, the HHTS and HHFS genes are regulated by GAL1 and GAL7 promoters, respectively, and each histone transcriptional unit is flanked by a pair of loxP sites as explained further below. Thus the transcription of the same genes can be regulated by the presence of galactose or glucose in the growth medium, or related methods, and the presence/absence of the genes can be regulated by the expression of Cre recombinase activity. This histone-based triplex safeguard was cloned into a pRS415 centromeric (episomal) vector (Sikorski R S & Hieter P (1989). Genetics 122(1):19-27)) to construct plasmid pPC012 (
(50) To evaluate ability to function as a genome safeguard, we generated yeast strain bearing the construct, PCy230 (his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 hht1-hhf1Δ:: natMX4 hht2-hhf2Δ:: hygMX4, [pRS415-loxPWT-HHTS-loxPWT-HHFS-loxpWT], see Methods). Strain PCy230 was subsequently plated on both permissive (galactose) and restrictive (glucose) conditions, and the escape (reversion) rate was calculated according to Luria & Delbruck fluctuation analysis using the method of the median (Lea D E & Coulson C A (1949) Journal of genetics 49(3):264-285) (Table 5). Although the escape rate was quite favorable at 10-7, we observed a significant fitness defect by comparing the colony size of PCy230 with that of a control strain (
Example 2
(51) This Example demonstrates that chromosomal integration of histone switches restores fitness. It was hypothesized that the fitness decrease of PCy230 may reflect variations in histone abundance in individual cells as the copy number of centromeric plasmids can fluctuate between 1-3 copies. Alternatively, it was possible that the expression of the two histone genes would give rise to aberrant histone ratios that differed from the native situation, or deviations in expression dynamics between galactose inducible and native histone promoters. Integration of the histone based safeguard into the genome would ensure stable single copy. Thus the histone safeguard (tagged with URA3) was integrated into the HO locus of PCy230, and after spontaneous mitotic loss of the original pPC012 plasmid (tagged with LEU2) on YP-galactose medium, new integrated safeguard strains PCy596-599 were constructed. These integrated safeguard strains have similar low escape rates as PCy230 on glucose (Table 4), yet the fitness and gene expression profiles were significantly improved as determined by measuring colony sizes (
Example 3
(52) This Example provides a demonstration of regulating transcriptional switches with 30 nM estradiol as one non-limiting example of use of a sub-micromolar concentration of an exogenously provided compound. In this regard, for many applications, a low ligand concentration, and a non-native ligand unlikely to alter cell physiology is desirable. To demonstrate ability to regulate the cell viability using non-native small molecules at nM concentration, we transformed a second plasmid pHCA/GAL4(1-93).ER.VP16 (henceforth called GEV) that produces a GAL4 DBNA binding domain-estrogen receptor-VP16 tribrid protein (GAL4DB.ER.VP16; GEV) (34), into safeguard strain PCy599 to construct strain NAy236. This safeguard strain can be regulated not only by galactose, used at mM concentrations, but also by estradiol, a small molecule non-native to yeast able to maintain viability at sub-micromolar (30 nM) concentrations. The GEV localizes into nucleus and binds to Gal4p consensus sequences to activate transcription of the targeted gene, upon induction by β-estradiol. The GEV protein is retained in the cytoplasm by Hsp90 in the absence of estradiol, resulting in fairly tight control of gene expression. The histone safeguard strains (PCy230 and PCy599) was able to be regulated with 30 nM estradiol on normal glucose-containing yeast growth medium, with an escape reversion frequency of 10-7 to 10-9 (
Example 4
(53) This Example provides an analysis of escape mutants using GEV regulated GAL-histone transcriptional safeguards as non-limiting examples of aspects of this disclosure. In performing this analysis five independent escape mutants of the GEV-regulated histone safeguard strains were isolated. These strains grow on glucose media in absence of the estradiol. The GEV plasmids from those five escapers were recovered from yeast into E. coli, transformed into the parental strain PCy599, and tested for their ability to recapitulate the “growth in absence of estradiol” phenotype (
Example 5
(54) This Example provides a demonstration of chemically regulated site specific recombination switches. A chemically regulated Cre (Gibson D G, et al. (2010). Science 329(5987):52-56); Dymond J S, et al. (2011), Nature 477(7365):471-476; Lindstrom D L & Gottschling D E (2009) Genetics 183(2):413-422, 411SI-413SI) was adapted and demonstrated to very effectively kill yeast with a semisynthetic genome containing numerous loxP sites flanking a number of essential genes. The specialized Cre protein from Lindstrom D L & Gottschling D E (2009) is tightly regulated both transcriptionally and post-translationally. A daughter cell specific promoter, pSCW11, ensures expression only in the daughter cell state. Furthermore, the Cre is fused to the estrogen binding domain (EBD) which is unfolded in the absence of estradiol, causing it to be retained in the cytoplasm by binding to the Hsp90 chaperone. In this Example, we induced Cre with estradiol, leading to excision of the histone gene(s) and loss of viability. Those skilled in the art will recognize, given the benefit of this disclosure, how to “reverse” this logic, so that the small molecule maintains the viability of the cell. In particular, we transformed the pSCW11-Cre-EBD plasmid into safeguard strain PCy230 to construct PCy251, and induced killing on Gal plates (galactose is required to maintain histone gene expression) with 1 μM estradiol, intended to delete the histone genes, despite their expression. However in this context the killing effect was not as complete as expected. It was hypothesized that this was due to SCW11 promoter strength/expression properties and thus a set of Cre-EBD plasmids by replacing the SCW11 promoter with various constitutive yeast promoters was constructed (see Example 9). After transforming the set of constructed Cre-EBD plasmids into PCy230, and screening on Gal-estradiol plates, pTDH3-Cre-EBD was identified as the best candidate for our approach, as it effectively killed the safeguard strain upon induction but remained inactive in the absence of estradiol. Upon estradiol induction, the Cre protein localizes into the nucleus and excises the histone transcription unit(s) residing between the three loxP sites. The reversion rate of this site-specific recombination-based safeguard was systematically measured, and is less than 10.sup.−6.
Example 6
(55) This Example provides an analysis of escape mutants by determining CRE-EBD sensitivity of GAL-histone recombinational safeguards. In this regard, we evaluated the site-specific recombination regulation of the original GAL-histone safeguard in the presence of a CRE-EBD plasmid by studying escape mutants. We isolated 21 independent escape mutants of the safeguard strains which grew in the restrictive condition of Cre expression, which in this case is galactose containing 1 μM estradiol. The Cre-EBD plasmids were recovered and retransformed into the parent strain PCy599, and the resulting strains were found to be insensitive to estradiol induction, confirming that the responsible mutation resided on the plasmid. The Cre-EBD mutant plasmids were sequenced to identify the mutations leading to the phenotype (
Example 7
(56) This Example demonstrates that combined escape of transcriptional and recombinational safeguard switches was not observed. To this end, a combined escape experiment was performed by plating yeast strain PCy599 carrying TDH3-Cre-EBD and growing cells permissively, and then plating nearly 10.sup.10 cells on restrictive medium (Glucose+estradiol). Even after replica plating (i.e. two rounds of growth on restrictive medium), no escaper colonies were observed. It is estimated that the cells went through at least one doubling after hitting the selective plates, possibly more. Thus it is concluded that the reversion frequency was <10.sup.−10, consistent with the predicted frequency of about 10.sup.−11.
Example 8
(57) This Example provides a description of construction of additional safeguard switches. To screen for additional essential genes suitable as candidate safeguards, a variant of the Golden Gate DNA assembly method (Engler C, et al. (2009) PloS one 4(5):e5553) was used to efficiently design and construct a systematic set of safeguard switches (
(58) These were tested individually in the corresponding heterozygous diploid yeast deletion mutant. Diploids transformed with the appropriate test plasmid were sporulated and tetrads were dissected on permissive agar plates, and resulting haploid spore clones were replica plated onto restrictive plates to identify potential safeguard strains. Subsequently three essential genes were identified, namely SUI1, HSP10 and RPC11 as preferred gene candidates by this method. The selection criteria were: 1) the safeguard strain should grow well on the permissive medium and 2) should have a low escape rate under restrictive conditions. Transcriptome profiling was carried out on the constructed safeguard strains to identify potential fitness defects (
(59) This Example also demonstrates reducing leakiness of new safeGuard switches. We discovered that the non-histone based GEV-regulated safeguard strains grew under restrictive conditions, and hypothesized that this resulted from leakiness of the galactose promoters (pGAL1/pGAL7/pGAL10) in this context, where lower amounts of the protein products might be required for viability than for histone genes. Various numbers (2 to 10) of Gal4 binding sites have been fused to the SPO13 promoter, which contains a repressive URS sequence, to generate a set of tightly regulated galactose dependent promoters called SPAL promoters (SPO/GAL). We retrieved this set of promoters from strains containing such promoters (see Example 9), and used them to construct a second generation of safeguard strains based on RPC11. The resulting safeguard strains had the appropriate growth phenotypes compared to those with native galactose promoters (
Example 9
(60) The Example provides a description of the materials and methods used to obtain the results described in the foregoing Examples.
(61) Strains, Plasmids and Oligonucleotides
(62) Yeast strains and the plasmids contained are listed in Table 1. Oligonucleotides used are listed in Table 2.
(63) Plasmid Shuffling
(64) Plasmid pPC012 was transformed into a yeast strain, JDY6, from which all four genomic copies of histones H3 and H4 genes had been previously deleted with viability maintained by plasmid pDM9, a plasmid carrying the URA3 marker and wild-type histone H3 and H4 genes HHT 1 and HHF1. After introducing pPC012, a centromeric (CEN) LEU2 plasmid, into the strain by LioAc/SS/PEG transformation, plasmid shuffling on 5-fluoro-orotic acid (5Foa) 2% galactose medium was successful, indicating that the GAL promoters could successfully express the two histone genes. Such 5-FoaR strains were unable to grow on glucose, consistent with effective shutoff of histone gene expression.
(65) Golden Gate DNA Assembly
(66) The golden gate assembly protocol is described in Engler C, et al. (2009) PloS one 4(5):e5553. Specifically, a 15 μl golden gate reaction containing 1.5 μl 10× T4 DNA ligase reaction buffer (New England Biolabs, Ipswich, Mass.), 0.15 μl 100× Bovine Serum Albumin (BSA, New England Biolabs, Ipswich, Mass.), 1 μL 600 units/μL T4 DNA ligase (Enzymatics, Beverly, Mass.), 10 μl H2O, 1 μl acceptor vector DNA (˜100 ng/μl) and 0.5 μl insert DNA (˜100 ng/μl). The following temperature cycles were used: 1 hour at 37° C., 5 min at 50° C., 5 min at 80° C. followed by incubation at 4° C. 1 μl of the finished golden gate reaction was transformed into 100 μl Top10/DH5α chemical competent cells.
(67) Plasmid Recovery from Yeast
(68) Plasmid recovery from yeast was carried out using a Zymoprep yeast plasmid miniprep kit (Zymo Research, Irvine, Calif.) following the manufacturer's instructions.
(69) Cloning and Sequencing of SPALX Promoters
(70) 12 yeast MAV strains (Vidal M, et al. (1996) Proceedings of the National Academy of Sciences of the United States of America 93 (19): 10315-10320) containing various numbers of Gal4 binding sites were used as template to clone out SPAL promoters with varying numbers of Gal4 binding sites. Genomic DNAs of these yeast strains were extracted using phenol/chloroform isolation method. Two rounds of PCR were used to amplify the SPALX promoters from gDNA: first, F primer PC_oligo379 and Ura3 R primer PC_oligo380 were used; then the PCR product was diluted 1000 fold. Primers PC_oligo401 and PC_oligo324 were used to amplify the SPAL promoter fragments with appropriate Golden Gate overhangs. The PCR products were cloned using a Zero Blunt Topo kit (Life Technologies, Grand Island, N.Y.). The resulting plasmids were sequenced to identify the exact number of Gal4 binding sites. These promoters were used in subsequent assembly of safeguard switches to identify tighter constructs.
(71) β-Estradiol Induction of Cre Expression
(72) Safeguard strains were grown up on appropriate selective growth medium, then either plated or spotted on appropriate selective solid medium containing 1 μM β-estradiol, and incubated at 30° C. for 2-3 days.
(73) β-Estradiol Induction of GEV System
(74) Safeguard strains were grown up in appropriate glucose selective growth medium containing 30 nM β-estradiol, then either plated or spotted on appropriate glucose selective solid medium containing 30 nM β-estradiol (or restrictive plates lacking estradiol), and incubated at 30° C. for 2-3 days.
(75) Reversion Rate Measurement and Colony Picking for Sequencing
(76) Escape rates were calculated using the method of the median (Lea D E & Coulson C A (1949) 49(3):264-285, the disclosure of which is incorporated herein by reference). For measurement rates in the 10-5 to 10-9 range, 5-12 independent cultures (each grown from a single parent colony) were inoculated into 20 mL SC−His supplemented with 2% galactose in liquid cultures. 108 and 107 cells were plated on restrictive medium. Viable titer was determined by plating 100 μL of a 5-6 serial 10-fold dilution on permissive medium. The reversion frequency was obtained by dividing cfus (colony forming units) on restrictive plates by cfus on permissive plates. The median reversion frequency was then used to calculate the rate using the method of the median.
(77) For each safeguard strain to be measured, 5 “escaper” revertant colonies were picked from independently grown cultures and grown up in 10 mL permissive liquid culture (with plasmid selection if applicable), for 48 hours at 30° C. 10 fold serial dilutions were plated on restrictive and permissive agar plates, and incubated at 30° C. for 2-3 days until single colonies appeared. One colony was chosen per culture to assure independence.
(78) RNASeq
(79) A single colony was picked and grown up in 10 mL permissive liquid medium, and incubated at 30° C. until the A600 was between 0.8 and 1.2 and RNA was isolated as described using a Qiagen RNAEasy kit using the manufacturer's protocol. We performed RNA-seq of strains integrating the histone, RPC11, SUI1 and HSP10 safeguards. mRNA was sequenced using an Illumina HiSeq and standard TruSeq preparation kits. For each strain we obtained approximately 12 million 50 bp single end reads. Reads were mapped using TOPHAT to the reference S. cerevisiae genome (S288c). Approximately 95% of the reads were mapped. For each gene, read counts were computed using HTSEQ and analyzed for differential expression using DESEQ, with standard parameters and following the no replicates scenario. For each gene, a raw p-value was obtained and an adjusted p-value using the standard Benjamini-Hochberg procedure (Benjamini Y & Hochberg Y (1995) Journal of the Royal Statistical Society. Series B (Methodological) 57(1):289-300). The 1% False Discovery Rate (adjusted p-value≤0.01) was used to identify genes that are significantly differentially expressed. Differentially expressed genes are reported in Table 3.
Example 10
(80) As will be apparent from the foregoing, Examples 1-9 demonstrate engineering of a yeast strain carrying multiplex biocontainment combining transcriptional and recombinational based safeguards, reaching an escape rate of less than 10.sup.−10. This was achieved with transcription control of a single essential gene with an escape rate of 10.sup.−6; however, this could potentially be lower with modifications of the safeguard construct that will be apparent to those skilled in the art, given the benefit of the present disclosure. This and the following Examples provide aspects of this disclosure that comprise such modifications. In particular, this and the following Examples describe efforts to determine what are believed to be the best acting transcriptional safeguard for yeast cells, and a construct(s) achieving the following criteria were sought: fitness approaching the wild type in permissive conditions, lowest possible escape rate under restrictive conditions and essential growth supplement in a nanomolar scale. This and the following Examples describe analysis of a library of essential genes to, without intending to be bound by any particular theory, find the best candidates. Combinatorial assembly was used to screen for what is believed to be the best acting regulatory elements, and genetic engineering was used to modify and improve the safeguard constructs. In addition, an analysis was performed of possible regulators and decoy compounds for use in growth media masking the proprietary components, which permit growth of the safeguarded strain, but do not themselves affect fitness.
(81) The transcriptionally regulated safeguards as described in Examples 1-9 above comprise a promoter regulated by an externally supplied ligand, driving the expression of one or more essential genes. To meet the requirements of robust growth in the presence of the ligand and essentially complete failure to grow or loss of viability in the absence of ligand, the genes believed to be best adapted to the purpose were sought, as described in this and the following Examples. Such genes are expected to tolerate a certain variation in their expression without a fitness penalty, but stop growing entirely, or lose viability when expression falls below a certain threshold—i.e. they should not display leaky growth when minimally expressed. To identify potential safeguard essential genes, 250 strains from the Yeast Tet-Promoters Hughes Collection (yTHC) annotated as having a “Severe” or “Very Severe” phenotype on Doxycycline in a “Tet-OFF” strain background (Mnaimneh S, et al. (2004) Cell 118(1):31-44) were selected. These 250 strains as well as a WT control (Strain R1158) were grown in YPD medium, diluted serially and plated on YPD, YPD+G418 (validating for the presence of the integrated tet promoter cassette) and YPD+10 μg/mL Doxycycline. All strains grew as expected both on YPD and on YPD+G418, but, showed various colony sizes (fitness) in the presence of doxycycline. In addition, the different strains also showed various fitness levels in the presence of doxycycline. From the 250 strains initially chosen for this analysis 47 strains were selected for further analysis, all of which showed high fitness (similar to WT) on YPD, and low fitness in the presence of Doxycycline (
Example 11
(82) This Example provides a description of building shuffle strains for combinatorial screening of SG strains. Because the safeguard strategy relies at least in part on using essential genes, the safeguards (SGs) transcription units (TUs) are introduced into a yeast strain that already expresses the gene of interest. Having the unguarded copy of the gene on a URA3 shuffle plasmid allows quick and efficient spontaneous plasmid loss in the presence of ligand, leaving only the safeguarded copy. Thus 49 haploid shuffle strains were constructed, each carrying a deletion of each essential gene as well as a shuffle plasmid with a wild type copy of the essential gene and a URA3 marker, enabling its loss using 5-Foa counter selection.
(83) To create shuffle plasmids for each candidate gene we amplified the corresponding CDS from the genome with 500 bp upstream and 200 bp downstream sequences, to include the native promoter and terminator sequences. The primers used for the genome amplification include 50 bp overhangs, which served as recombination sites with pRS416 (
Example 12
(84) This Example provides a description of combinatorial yGG assembly of safeguard constructs and screening for candidate SG strains. Having the ability to combinatorially assemble transcription units (TUs) provides many more variants for testing than could be made one at a time. Thus, assembly of the SG constructs was carried out using a combinatorial yeast Golden Gate (yGG) assembly to screen the best candidates in yeast. All the parts (promoters, essential genes CDSs and terminators) were amplified with the proper yGG overhangs from the yeast genome. For each essential gene a one pot yGG assembly was performed, adding 6 distinct galactose-regulated promoters [GAL1, GAL7, GAL10, SPAL2, SPAL5 and SPAL6 (Vidal M, et al. (1996) Proceedings of the National Academy of Sciences of the United States of America 93(19):10315-10320], GAL1 terminator and acceptor vector (pAV10.HO5.loxP). Following yGG assembly, the reaction mix was transformed into bacteria and grown in liquid medium for a bulk plasmid prep which was digested to evaluate assembly efficiency.
(85) Following combinatorial yGG assembly and verification, each assembly was transformed into its corresponding yeast shuffle strain. Transformations were plated on SGal−Leu to allow expression of the promoters and to enable loss of the shuffle plasmid. Transformation plated were then replica plated to SC+5-Foa 2% galactose plates. In most cases the majority of the colonies were 5-Foa resistant. 10 isolates were chosen from each gene and were plated on YPD and YEP−GAL to assess their ability to serve as a safeguard strain (
(86) All 13 strains were examined for their doubling time in dextrose supplemented with 30 nM Estradiol. They were all compared to their corresponding shuffle strain (
Example 13
(87) This Example describes measuring fitness of SG strains. Due to the fact that these strains were created in a combinatorial assembly strategy and chosen from a pool of safeguards, we decided to evaluate performance in both a MATa and MATα backgrounds. This was done using yeast Golden-Gate (yGG) assembly and transformed into yeast as described above. Candidates were plated on media with or without 30 nM Estradiol for verification. The results were similar to the counterparts made using combinatorial assembly (Data not shown) in both mating types. To evaluate fitness of the strains we measured their growth rate and calculated their doubling time compared to WT strain carrying the GEV plasmid (
(88) In order to examine the difference between safeguard strains and control we preformed transcriptome and metabolomics profiling (
(89) For metabolomics profiling each strain was compared to a WT strain carrying the GEV plasmid.
(90) Fitness was measured compared to a control carrying the GEV expression plasmid. This was done based in part on the observation that expression of the GEV construct causes a global activation of Gal-UAS regulated genes and thus reduces growth rate of the strain (McIsaac R S, et al. (2013) Nucleic acids research 41(4):e57). This is addressed further below. In addition, the escape rate of an SG strain was measured; all 5 SG strains were less than 10.sup.−7 escapers per cell division (Table 6).
Example 14
(91) This Example provides a description of analysis of escapers. Escape rate experiments were performed on the presently described safeguard strains; 16 independent escapers were isolated from each strain (8 MATa and 8 MATα). For complementation group analysis, strains were replica plated in crisscross to allow for mating at the junctions (FIG. 21). Mating was done in permissive medium containing estradiol, and then replica plated to restrictive medium selecting for diploids with estradiol and finally replica plated to medium lacking estradiol for analysis of complementation groups. Escapers that originated due to a recessive mutation in the same gene will not complement and thus grow on medium lacking estradiol. In contrast, escapers that originated from recessive mutants in different genes will complement and will fail to grow on media lacking estradiol. In addition, crosses to the original SG strain will indicate whether the mutation is recessive or dominant. Table 8 summarizes the complementation analysis. 8 complementation groups for FAS2 SG escapers and 7 complementation groups for SEC4 SG escapers were isolated. For RPB11, complementation groups could not be determined because all escapers were dominant. One candidate from each complementation group was selected for further analysis.
(92) In order to analyze the location (GEV plasmid or genome) of the mutation in each escaper, the plasmid from each escaper strain was isolated and transformed into bacteria for sequence analysis. Digestion of plasmid DNA revealed that all but one (RPB11 MATa R1) showed a similar plasmid digest pattern as the original plasmid (
(93) All of these were plated in serial dilution on SC-Ura supplemented with 2% Galactose, SC-Ura+30 nM Estradiol and SC-Ura (
(94) The escapers cured of the plasmid were analyzed on YP-GAL medium (
(95) In order to locate the genomic mutations that caused the occurrence of these escapers genome sequencing of the escapers (one from each complementation group) was performed. This revealed mutations in four different components of the Rpd3L complex (Table 9). This complex represses transcription of URS1 containing genes by hypoacetylation of histone H3 and H4 (Keogh et al. (2005) Cell 123(4):593-605). Due to the fact that the SG constructs have a SPALX promoter (Vidal M, Bet al. (1996) Proceedings of the National Academy of Sciences of the United States of America 93(19):10315-10320) that contains the URS1 sequence (Sumrada R A & Cooper T G (1987) Proceedings of the National Academy of Sciences of the United States of America 84(12):3997-4001), mutations in genes encoding the components of the Rpd3L complex will alleviate the repression and cause expression of the SG gene even in the absence of estradiol. Since 100% of the mutations isolated as described herein in SEC4 and FAS2 SG strains are recessive, it is expected that the escape rate can be lowered substantially by use of diploid strains.
(96) To verify the effect that mutations in Rpd3L component genes has on our SG strain, UME6 was deleted in all FAS2 MATa SG strain. As a control a member of the Rpd3 S complex, EAF3 was deleted. As seen in
Example 15
(97) This Example and other Examples herein provide a description of non-limiting improvements to SG strains. In a system known as the ZEV system the transcription factor (VP16) is fused to an Estrogen-Binding-Domain (EBD) and a Zinc-finger binding domain recognizing a 9 bp sequence was cloned into a minimal GAL1 promoter (McIsaac R S, et al. (2013) Nucleic acids research 41(4):e57). The ZEV system was shown to have no effect on growth rate in yeast cells. In the present disclosure the Z4 array was cloned into the SPAL promoter, replacing the GAL4 binding sites (
Example 16
(98) This example provides a description of one approach to engineering a yeast TET promoter. In addition to the GALx promoters and their derivatives, other known switches are based on the TET system, which has been used in yeast (Gari E, Pet al. (1997) Yeast 13(9):837-848) as well as in other organisms. In the present disclosure it was an objective to construct a TET-based SG strain. In one approach a TET system was too leaky and thus showed no significant reduction in growth without Doxycycline for all of 44 essential genes SG. Therefore, based on success with the SPAL and SPAZ promoters, a promoter referred to herein as the “SPET” promoter was constructed. This promoter is based on an embodiment of a TET promoter (
Example 17
(99) This Example provides a description of analysis of a library of representative decoy compounds.
(100) In certain embodiments, an aspect of using a safeguard strain to guard proprietary elements is having the ability to prevent outside sources from propagating the strains without previous knowledge of the specific medium requirements of a given SG strain. In addition to enabling growth in very low concentrations of the required compound the identity of that compound could be masked using an array of different but inert decoy compounds, as discussed above in Examples 1-9. An aspect of such decoy molecules is that they should not by themselves have any deleterious effect on the growth of the yeast strain. This should also be true of ligands used to activate the SG. To this end, the transcriptome of yeast cells (BY4741) in the presence of 22 compounds (Table 10) was analyzed, at two concentrations each. They were separated into three groups depending on their solvent (Water, DMSO or Ethanol) and the metabolomes were compared to a solvent control.
(101) Analysis of the transcriptome of cells exposed to the compounds revealed that in many cases there is a strong effect on transcription (
(102) It will be recognized from the foregoing that the present disclosure describes a process of screening a library of 250 essential genes selecting what are believed to be the three best acting genes (FAS2, RPB11 and SEC4) under estradiol induction. In the present screen what is believed to be the best acting promoter for each gene was selected out of 6 possible candidates. Constructs that showed what is believed to be the lowest possible escape rate with the least measurable effect on growth were compared to a control strain. This analysis facilitated achieving an escape rate of 10.sup.−8 with only a single essential gene; compared to 10.sup.−6 demonstrated in Examples 1-9 for a single gene; and closer to 10.sup.−9 that was observed for two histone genes.
(103) It is also demonstrated herein that using promoter engineering can decrease the genome wide effect of the GAL promoter using a synthetically designed zinc-finger while improving promoter leakiness using a natural URS sequence (
(104) Thus it is demonstrated herein that two systems (ZEV and TET) when combined may decrease escape rate to below detectable levels.
Example 18
(105) This Example provides a description of the material and methods used to obtain the results discussed in Examples 10-17.
(106) Strains, plasmids, oligonucleotides and mediaYeast strains and the plasmids contained are listed in Table 11. Oligonucleotides used to amplify essential genes for shuffle plasmid construction are listed in Table 12. Media used were as follows. Yeast strains were cultured in YPD medium or SD-based medium supplemented with appropriate amino acids; fully supplemented medium containing all amino acids plus uracil and adenine is referred to as SC. □Estradiol was purchased from Sigma-Aldrich (St. Louis, Mo.), and 5-fluoroorotic acid (5-FOA) was from US Biological (Massachusetts, Mass.). Doxycycline (Dox) was obtained from Clontech laboratories (Mountain View, Calif.). Escherichia coli was grown in Luria Broth (LB) media. To select strains with drug-resistant genes, carbenicillin (Sigma-Aldrich) or kanamycin (Sigma-Aldrich) were added at final concentrations of 75 μg/ml and 50 μg/ml respectively. Agar was added to 2% for preparing solid media. Final concentrations of compounds and their solvents are listed in Table 10, 1000× stock solution was prepared for all compounds.
(107) Plasmid Recovery from Yeast
(108) Plasmid recovery from yeast was carried out using a Zymoprep yeast plasmid miniprep kit (Zymo Research, Irvine, Calif.) following the manufacturer's instructions.
(109) Safeguard Promoter Identification
(110) For each strain, genomic DNA was extracted and the promoter region was amplified using the vector forward primer and a reverse primer 100 bp downstream of the ATG. Each PCR fragment was sent for sequencing using the same primers. The results of the sequencing are summarized in Table 6.
(111) Escape Rate Measurement
(112) Escape rates were calculated using the method of the median (Lea D E & Coulson C A (1949) Journal of genetics 49(3):264-285). For measurement rates in the 10.sup.−5 to 10.sup.−9 range, 5-12 independent cultures (each grown from a single parent colony) were inoculated into 20 mL of media supplemented with 30 nM estradiol in liquid cultures. In total, 10.sup.8 and 10.sup.−7 cells were plated on restrictive medium. Viable titer was determined by plating 100 μL of a five to six serial 10-fold dilution on permissive medium. The reversion frequency was obtained by dividing colony-forming units on restrictive plates by colony-forming units on permissive plates. The median reversion frequency was then used to calculate the rate using the method of the median.
(113) For each SG strain to be measured, 8 “escaper” escaper colonies were picked from independently grown cultures and grown up in 10 mL of permissive liquid culture (with plasmid selection if applicable), for 48 h at 30° C. Tenfold serial dilutions were plated on restrictive and permissive agar plates, and incubated at 30° C. for 2-3 d until single colonies appeared. One colony was chosen per culture to assure independence.
(114) RNASeq
(115) A single colony was picked and grown up in 10 mL of permissive liquid medium, and incubated at 30° C. until the A600 was between 0.8 and 1.2, and RNA was isolated as described using a Qiagen RNAEasy kit using the manufacturer's protocol. We performed RNASeq of strains integrating the histone, RPC11, SUI1, and HSP10 safeguards. mRNA was sequenced using an Illumina HiSeq and standard TruSeq preparation kits. For each strain, we obtained ˜12 million 50-bp single-end reads. Reads were mapped using TOPHAT (Kim D, et al. (2013) Genome biology 14(4):R36)) to the reference S. cerevisiae genome (S288c). Approximately 95% of the reads were mapped. For each gene, read counts were computed using HTSEQ (Anders S, et al. (2015) Bioinformatics 31(2):166-169) and analyzed for differential expression using DESEQ (Anders S & Huber W (2010) Genome biology 11(10):R106), with standard parameters and following the no-replicates scenario. For each gene, a raw P value was obtained and an adjusted P value using the standard Benjamini-Hochberg procedure (Benjamini Y & Hochberg Y (1995) J R Stat Soc B (57 (1)):289-300). A 1% false-discovery rate (adjusted P value≤0.01) to identify genes that are significantly differentially expressed was used.
(116) Creating Parts for Combinatorial Yeast Golden-Gate (yGG)
(117) In addition to the 47 strains chosen from the TET-off library three additional genes (HSP10, RPC11 and SUI1) were added based on Examples 1-9 where they were shown to function as safeguard genes. All 50 genes were to be potentially cloned downstream of 7 different promoters: GAL1, GAL10, GAL7, SPAL2, SPAL10, SPAL7. They were assembled with the GAL1 terminator and into an acceptor vectors with integration cassettes. All combinations were examined for their ability to serve as potential safeguards. All 50 genes, 6 promoters and terminator were amplified with the appropriate overhangs for yGG from the yeast genome Agmon N, et al. (2015) ACS synthetic biology), cloned into a pCR-Blunt II-TOPO vector (Invitrogen) and sequence verified. Most genes were amplified as one part genes, however, some were either too large to amplify as one part or had an internal BsaI site, which is incompatible with yGG assembly and thus were amplified as multiple gene parts compatible with yGG assembly. All but one gene, PSA1, failed at this step, the successful 49 genes were further analyzed. In total 67 gene parts, 6 promoter parts and one terminator part were synthesized for the yGG assembly. As an acceptor vector pAV10.HO5.loxP, an integrating vector was selected, with the LEU2 marker for integration into the HO locus.
(118) DNAseq
(119) Pair-end whole genome sequencing of escapers was performed using an IlluminaHiSeq using TruSeq preparations kits. Totally 20 samples were sequenced with 19.5M-33.5M paired reads generated per sample. The length of read is 101 base pairs. Quality control was performed using software FastQC version 0.11.2 All the reads in FASTQ format were aligned to Yeast reference genome constructed starting with the sequence for control strains (S. cerevisiae strain BY4741 genome sequence and S. cerevisiae strain BY4742 genome sequence) using BWA version 0.7.8 with -P-M-R parameter settings. Approximately 86%-93% reads were aligned to the corresponding reference genome. Software SAMtools version 0.1.19 was used to call variants with mpileup -A -uf and bcftools view -bvcg parameter settings. The results were subjected to a set of post-processing filters requiring (i) a minimum of 10× coverage per variant site; (ii) wild-type reads in <10% of the total reads per site; (iii) Reads supporting the variant of the control sample in <5%.
(120) The following Tables are pertinent to those discussed above.
(121) TABLE-US-00001 TABLE 1 Yeast Strains Strain MAT Parent Plasmid Genotype Plasmid Type Marker PCy068 a BY385 pRS415 his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 pRS415 LEU2 PCy163 a JDY6 pDM9 his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 HHT1 HHF1 URA3 CEN URA3 hht1-hhf1Δ::natMX4 hht2-hhf2Δ::hygMX4 PCy230 a PCy163 pPC012 his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 loxP-HHTS-loxP HHFS LEU2 hht1-hhf1Δ::natMX4 hht2-hhf2Δ::hygMX4 loxP LEU2 CEN PCy251 a PCy230 PCy012; his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 pGal1-HHT SpGal7- LEU2; SCW11- hht1-hhf1Δ:: natMX4 hht2-hhf2Δ:: hygMX4 HHFS CEN LEU2 HIS3 CreEBD PCy426 a MM ura3Δ0, leu2Δ0, his3Δ1, can1D:: LEU2+- URA3 diploid MFA1pr-His3, RPC11::KanMX collection HO::pGAL1_RPC11_Gal1 3′UTR-URA3 RPC11Δ PCy437 a MM ura3Δ0, leu2Δ0, his3Δ1, can1D:: LEU2+- URA3 diploid MFA1pr-His3, SUI1::KanMX collection HO::pGAL1_SUI1_Gal1 3′UTR-URA3 SUI1Δ PCy448 a MM ura3Δ0, leu2Δ0, his3Δ1, can1D::LEU2+- URA3 diploid MFA1pr-His3, HSP10::KanMX collection HO::pGal1_HSP10_Gal1 3′UTR-URA3 HSP10Δ PCy599 a PCy230 his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 URA3 hht1-hhf1Δ:: natMX4 hht2-hhf2Δ:: hygMX4 HO::loxPWT-HHTS-loxPWT-HHFS-loxPWT- URA3 PCy636 a PCy599 Tdh3- his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 Tdh3-CreEBD-HIS3 PCy636 CreEBD- hht1-hhf1Δ:: natMX4 hht2-hhf2Δ:: hygMX4 HIS3 HO::loxPWT-HHTS-loxPWT-HHFS-loxPWT- URA3 NAy236 a PCy599 pGal4- his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 pGal4-ER-VP16-HIS3 HIS3 ER- hht1-hhf1Δ:: natMX4 hht2-hhf2Δ:: hygMX4 VP16- HO::loxPWT-HHTS-loxPWT-HHFS-loxPWT- HIS3 URA3 NAy460 a Yeast Het- pRS416- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS416-RPC11 URA3 dip RPC11 RPC11::KanMX deletion collection URA3 HIS3 AZy0010 a RPC11 Tdh3- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Tdh3-CreEBD-HIS3 LEU2 shuffle CreEBD- RPC11::KanMX HO::GAL1p-RPC11- HIS3 strain HIS3 GAL1t::LEU2 AZy0011 a RPC11 pGal4- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pGal4-ER-VP16-HIS3 LEU2 shuffle ER- RPC11::KanMX HO::GAL1p-RPC11- HIS3 strain VP16- GAL1t::LEU2 HIS3 AZy0012 a RPC11 pRS413 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS413 LEU2 shuffle RPC11::KanMX HO::GAL1p-RPC11- HIS3 strain GAL1t::LEU2 AZy0013 a RPC11 Tdh3- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Tdh3-CreEBD-HIS3 LEU2 shuffle CreEBD- RPC11::KanMX HO::GAL7p-RPC11- HIS3 strain HIS3 GAL1t::LEU2 AZy0014 a RPC11 pGal4- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pGal4-ER-VP16-HIS3 LEU2 shuffle ER- RPC11::KanMX HO::GAL7p-RPC11- HIS3 strain VP16- GAL1t::LEU2 HIS3 AZy0015 a RPC11 pRS413 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS413 LEU2 shuffle RPC11::KanMX HO::GAL7p-RPC11- HIS3 strain GAL1t::LEU2 AZy0016 a RPC11 Tdh3- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Tdh3-CreEBD-HIS3 LEU2 shuffle CreEBD- RPC11::KanMX HO::GAL10p-RPC11- HIS3 strain HIS3 GAL1t::LEU2 AZy0017 a RPC11 pGal4- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pGal4-ER-VP16-HIS3 LEU2 shuffle ER- RPC11::KanMX HO::GAL10p-RPC11- HIS3 strain VP16- GAL1t::LEU2 HIS3 AZy0018 a RPC11 pRS413 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS413 LEU2 shuffle RPC11::KanMX HO::GAL10p-RPC11- HIS3 strain GAL1t::LEU2 AZy0019 a RPC11 Tdh3- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Tdh3-CreEBD-HIS3 LEU2 shuffle CreEBD- RPC11::KanMX HO::SPAL2p-RPC11- HIS3 strain HIS3 GAL1t::LEU2 NAy390 a RPC11 pGal4- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pGal4-ER-VP16-HIS3 LEU2 shuffle ER- RPC11::KanMX HO::SPAL2p-RPC11- HIS3 strain VP16- GAL1t::LEU2 HIS3 AZy0021 a RPC11 pRS413 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS413 LEU2 shuffle RPC11::KanMX HO::SPAL2p-RPC11- HIS3 strain GAL1t::LEU2 AZy0022 a RPC11 Tdh3- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Tdh3-CreEBD-HIS3 LEU2 shuffle CreEBD- RPC11::KanMX HO::SPAL5p-RPC11- HIS3 strain HIS3 GAL1t::LEU2 NAy391 a RPC11 pGal4- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pGal4-ER-VP16-HIS3 LEU2 shuffle ER- RPC11::KanMX HO::SPAL5p-RPC11- HIS3 strain VP16- GAL1t::LEU2 HIS3 AZy0024 a RPC11 pRS413 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS413 LEU2 shuffle RPC11::KanMX HO::SPAL5p-RPC11- HIS3 strain GAL1t::LEU2 AZy0025 a RPC11 Tdh3- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Tdh3-CreEBD-HIS3 LEU2 shuffle CreEBD- RPC11::KanMX HO::SPAL6p-RPC11- HIS3 strain HIS3 GAL1t::LEU2 NAy392 a RPC11 pGal4- leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pGal4-ER-VP16-HIS3 LEU2 shuffle ER- RPC11::KanMX HO::SPAL6p-RPC11- HIS3 strain VP16- GAL1t::LEU2 HIS3 AZy0027 a RPC11 pRS413 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 pRS413 LEU2 shuffle RPC11::KanMX HO::SPAL6p-RPC11- HIS3 strain GAL1t::LEU2
(122) TABLE-US-00002 TABLE 2 Primers used Examples 1-9. Name Sequence Purpose M13F GTAAAACGACGGCCAG (SEQ ID NO: 1) GEV sequencing M13R CAGGAAACAGCTATGAC (SEQ ID NO: 2) GEV sequencing PC_oligo379 GAAGGTTAATGTGGCTGTGGTTTCAGGGTCCATAAAGCTTGTC SPALX CTGGAAGTCTCATGGAG (SEQ ID NO: 3) PCR PC_oligo380 TCAGGATCCCTAGGTTCCTTTGTTACTTCTTCCG (SEQ ID NO: 4) SPALX PCR PC_oligo401 ggtctcacagtGAAGGTTAATGTGGCTGTGGTTTCA SPALX (SEQ ID NO: 5) PCR PC_oligo324 ggtctcacattATTATTCTCGACTCAACT (SEQ ID NO: 6) SPALX PCR GEVF2 GTACAGATGCTCCATGCCTT (SEQ ID NO: 7) GEV sequencing GEVR2 AAGAATGAGCCAAGACTTGC (SEQ ID NO: 8) GEV sequencing GEVF3 GGATCATACTCGGAATAGAGT (SEQ ID NO: 9) GEV sequencing GEVR3 CGAACTAATACTGTAGCCCT (SEQ ID NO: 10) GEV sequencing
(123) TABLE-US-00003 TABLE 3 Differentially expressed genes in safeguard switches Safe- Pro- Log2Fold Adjusted guard moter Gene Change P-value P-value RPC11 GAL1 LYS2 Inf 1.424 .Math. 10.sup.−08 9.573 .Math. 10.sup.−05 RPC1 6.660 9.017 .Math. 10.sup.−08 3.031 .Math. 10.sup.−04 YNL194C 6.004 6.146 .Math. 10.sup.−07 0.001 YNL195C 5.712 1.924 .Math. 10.sup.−06 0.003 GAL7 — — — — GAL10 — — — — SUI1 GAL1 MET17 −8.725 4.184 .Math. 10.sup.−16 2.786 .Math. 10.sup.−12 BTN2 −2.792 5.591 .Math. 10.sup.−13 1.861 .Math. 10.sup.−09 ZPR1 −2.148 8.326 .Math. 10.sup.−09 1.848 .Math. 10.sup.−05 HO 2.027 1.909 .Math. 10.sup.−08 3.177 .Math. 10.sup.−05 YPR117W 1.818 6.437 .Math. 10.sup.−07 8.572 .Math. 10.sup.−04 IRA1 1.646 1.107 .Math. 10.sup.−06 0.001 GCN1 1.795 1.350 .Math. 10.sup.−06 0.001 TRA1 1.549 2.632 .Math. 10.sup.−06 0.002 GAL7 MET17 −Inf 1.812 .Math. 10.sup.−12 1.202 .Math. 10.sup.−08 MUP1 2.946 3.404 .Math. 10.sup.−09 1.129 .Math. 10.sup.−05 YLR307C-A −2.859 1.112 .Math. 10.sup.−06 0.002 SAM1 2.371 3.818 .Math. 10.sup.−06 0.006 GAL10 URA3 3.305 1.888 .Math. 10.sup.−14 1.252 .Math. 10.sup.−10 BTN2 −2.812 6.603 .Math. 10.sup.−11 2.190 .Math. 10.sup.−07 ZPR1 −2.168 2.056 .Math. 10.sup.−07 4.547 .Math. 10.sup.−04 PDR12 2.271 3.575 .Math. 10.sup.06 0.005 GCN1 1.945 3.843 .Math. 10.sup.−06 0.005 YPR117W 1.878 6.911 .Math. 10.sup.−06 0.008 YKL031W −2.026 1.006 .Math. 10.sup.−05 0.010 HSP10 GAL1 LYS2 −Inf 1.005 .Math. 10.sup.−58 6.697 .Math. 10.sup.−55 HO 4.666 2.974 .Math. 10.sup.−36 9.914 .Math. 10.sup.−33 MET17 −Inf 1.735 .Math. 10.sup.−25 3.856 .Math. 10.sup.−22 SNR6 −4.019 5.451 .Math. 10.sup.−14 9.084 .Math. 10.sup.−11 BTN2 −2.063 3.586 .Math. 10.sup.−11 4.781 .Math. 10.sup.−08 ICY2 −2.196 1.106 .Math. 10.sup.−10 1.228 .Math. 10.sup.−07 PDR5 −1.506 6.577 .Math. 10.sup.−07 6.263 .Math. 10.sup.−04 YGR035C −1.773 7.848 .Math. 10.sup.−07 6.539 .Math. 10.sup.−04 HSP10 1.529 1.927 .Math. 10.sup.−06 0.001 YLR346C −1.560 6.564 .Math. 10.sup.−06 0.004 COS8 2.258 9.962 .Math. 10.sup.−06 0.006 ZPR1 −1.327 1.316 .Math. 10.sup.−05 0.007 GAL7 LYS2 −10.438 1.085 .Math. 10.sup.−46 7.199 .Math. 10.sup.−43 MET17 −Inf 1.098 .Math. 10.sup.−20 3.644 .Math. 10.sup.−17 ICY2 −3.025 3.510 .Math. 10.sup.−15 3.510 .Math. 10.sup.−15 SNR6 −3.879 2.320 .Math. 10.sup.−11 3.850 .Math. 10.sup.−08 BTN2 −2.124 2.334 .Math. 10.sup.−10 3.098 .Math. 10.sup.−07 PDR5 −1.795 4.080 .Math. 10.sup.−08 4.513 .Math. 10.sup.−05 ZPR1 −1.772 8.424 .Math. 10.sup.−08 7.988 .Math. 10.sup.−05 HO 2.265 1.430 .Math. 10.sup.−07 1.187 .Math. 10.sup.−04 HSP42 −1.684 2.392 .Math. 10.sup.−07 1.764 .Math. 10.sup.−04 GAL10 LYS2 −Inf 5.175 .Math. 10.sup.−78 3.433 .Math. 10.sup.−74 URA3 3.270 1.030 .Math. 10.sup.−50 1.030 .Math. 10.sup.−50 HO 3.576 1.568 .Math. 10.sup.−41 3.469 .Math. 10.sup.−38 SNR6 −3.849 7.327 .Math. 10.sup.−14 1.215 .Math. 10.sup.10 HSP10 1.425 5.730 .Math. 10.sup.−13 7.604 .Math. 10.sup.−10 COS8 2.246 3.920 .Math. 10.sup.−06 0.004 KRI1 −0.747 8.536 .Math. 10.sup.−06 0.008
(124) TABLE-US-00004 TABLE 4 Escape frequencies of safeguard strains Strain name Genotype Reversion rate (n)* PCy426 ura3Δ0, leu2Δ0, his3Δ1, can1D:Leu2+-MFA1pr-His3, 2.49E−07 (5) RPC11::KanMX HO::PGal1_RPC11_Gal1 3′UTR PCy437 ura3Δ0, leu2Δ0, his3Δ1, can1D:Leu2+-MFA1pr-His3, 2.00E−06 (5) SUI1::KanMX HO:pGal1_SUI1_Gal1 3′UTR PCy448 ura3Δ0, leu2Δ0, his3Δ1, can1D::Leu2+-MFA1pr-His3, 1.33E−05 (5) HSP10::KanMX HO:pGal1_HSP10_Gal1 3′UTR PCy599 his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 hht1-hhf1Δ:: <1.16E−07 (5) natMX4 hht2-hhf2Δ:: hygMX4 HO::loxPWT-HHTS-loxPWT- HHFS-lopWT-URA3 PCy230 his3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 hht1-hhf1Δ:: <2.56E−0.7 (5) natMX4 hht2-hhf2Δ:: hygMX4 [PRS415-loxPWT-HHTS- loxPWT-HHFS-lopWT] NAy236 His3Δ200 leu2Δ1 lys2Δ202 trp1Δ63 ura3-52 hht1-hhf1Δ:: <1.6E−07 (5) natMX4 hht2-hhf2Δ:: hygMX4 HO::loxPWT-HHTS-loxPWT- HHFS-lopWT-URA3 NAy390 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 RPC11::KanMX 6.11E−06 (12) HO:SPAL2p-RPC11-GAL1t:LEU2 [pRS413-GEV] NAy391 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 RPC11::KanMX 6.39E−06 (12) HO:SPAL5p-RPC11-GAL1t:LEU2 [pRS413-GEV] NAy392 leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 RPC11::KanMX 8.57E−06 (12) HO:SPAL6p-RPC11-GAL1t ::LEU2 [pRS413-GEV] *Mean reversion rate; n, Number of replicate experiments (in parentheses)
(125) TABLE-US-00005 TABLE 5 GEV and Cre-EBD escape mutant analysis summary Escape Revertant mutant name Type Summary NAy259 GEV A 831 bp in frame deletion in the hER and VP16 regions (between 2120 bp and 2950 bp); GAGC microhomology mediated; retains 14aa of VP16 NAy261 GEV 528 bp deletion between 1967 bp and 2497 bp (hER region) GAGC microhomology mediated NAy262 GEV 780 bp deletion between 1947 bp and 2726 bp (hER). NAy263 GEV 4 bp insertion at 1078 bp: TACT (hER). Frameshift creates a C-terminus with several acidic residues NAy264 GEV 807 bp deletion from 2001 bp to 2807 bp (hER) R250-1* Cre-EBD Insertion of a TCC codon, increasing number of Leucine codons from L4 to L5 at aa571 R250-3 Cre-EBD D329Y R250-4 Cre-EBD Δ1437-1749 R250-10 Cre-EBD Δ514-819 R250-25 Cre-EBD Insertion of 8 bp CAGTAGC at bp 2506 R250-27 Cre-EBD Nonsense; E69(TAA) R250-29 Cre-EBD Δ1390-1405 R250-30 Cre-EBD S205R R250-32 Cre-EBD 1792-2085 R250-39 Cre-EBD T188I R250-44 Cre-EBD 1313-2412 R250-46 Cre-EBD Y324F 250-47 Cre-EBD V204F/S205C 250-48 Cre-EBD A131P
(126) TABLE-US-00006 TABLE 6 SG strains promoters and escape rates. Essential Gene Promoter Escape rate* FAS2 SPAL5 6.6E−08 HTS1 SPAL6 7.0E−08 RPB11 SPAL5 1.9E−08 SEC17 SPAL2 8.8E−08 SEC4 SPAL2 6.5E−08 *Escape rates were calculated according to method of the median
(127) TABLE-US-00007 TABLE 7 Transcript changes in SG strains. GS Gene log2Fold GS Gene log2Fold strain name P-value Change strain name P-value Change FAS2 ND NA NA PXA1 5.68E−28 2.4 MATa ROG3 3.68E−27 −2.36 FAS2 RTN2 1.71E−84 2.24 BIO5 1.30E−26 2.33 MATα FAS2 5.19E−76 2.09 PNS1 8.58E−26 2.3 RPB11 SPS100 3.31E−61 3.86 ECI1 1.13E−25 2.29 MATa RGI2 7.88E−41 3.01 YER121W 4.16E−25 2.29 SPG1 7.86E−39 2.92 PHO89 2.57E−24 2.21 ADH2 1.57E−38 2.9 BOP2 1.09E−23 2.18 ADY2 2.18E−38 2.89 ARO10 2.79E−23 2.16 DCI1 3.79E−36 2.82 RPI1 4.56E−23 2.18 CYB2 1.33E−33 2.67 DMC1 5.98E−23 2.15 POX1 1.52E−33 2.68 STP4 8.70E−23 −2.14 CTA1 4.07E−33 2.65 PUN1 3.26E−21 2.04 YKL065W-A 1.26E−32 2.67 YAR029W 4.40E−21 −2.19 CIT3 8.30E−32 2.59 SLZ1 6.22E−21 2.04 tV(AAC) 2.84E−31 −3.89 CYC7 6.69E−21 −2.03 E2 ENA1 7.01E−21 2.03 PHM7 4.12E−29 2.46 PX42 8.45E−21 2.02 CSM4 3.33E−28 2.44 TPO2 1.81E−20 −2.01 RMA1 7.18E−20 −2.06 RRT7 6.12E−06 −2.87 YAR030C 1.23E−17 −2 SEC4 ND NA NA RRT5 3.37E−12 −2.32 MATa PAU19 4.42E−08 −2.41 SEC4 RTN2 3.29E−70 2.51 SUF17 2.74E−06 −3.13 MATα HBT1 2.18E−61 2.32 SLZ1 6.22E−21 3.86 PFK27 6.22E−61 −2.37 CYC7 6.69E−21 3.01 COM2 1.89E−50 −2.09 ENA1 7.01E−21 2.92 HSP12 5.94E−50 2.06 PXA2 8.45E−21 2.9 TKL2 1.63E−49 2.06 TPO2 1.81E−20 2.89 CTT1 6.69E−49 2.04 RMA1 7.18E−20 2.82 YAR030C 1.23E−17 2.67 RRT5 3.37E−12 2.68 PAU19 4.42E−08 2.65 SUF17 2.74E−06 2.67 RPB11 OYE3 4.27E−70 2.42 MATα GAL2 3.08E−62 2.05 YHR054C 7.44E−08 −2.41
(128) TABLE-US-00008 TABLE 8 Escaper complementation group analysis GENE R/D* FAS2 Group 1: MATa (R1, R4, R5, R8) and R MAT-α (R9, R10, R13, R14, R15) Group 2: MATa R2 R Group 3: MAT a R3 R Group 4: MATa R6 R Group 5: MATa R7 R Group 6: MATα R11 R Group 7: MATα R12 R Group 8: MATα R16 R RPB11 Could not be determined D SEC4 Group 1: MATa (R2, R4, R5, R6, R7) and R MATα (R11, R12, R13, R15, R16) Group 2: MATa R1 R Group 3: MATa R3 R Group 4: MATa R8 R Group 5: MATα R9 R Group 6: MATα R10Group R Group 7: MATα R15 R R *R = recessive, D = Dominant
(129) TABLE-US-00009 TABLE 9 Genomic mutations found in escapers by DNAseq SG Escaper Gene Mutation FAS2 R1 UME6 E75* FAS2 R2 RPD3 M1V FAS2 R3 RPD3 G312D FAS2 R6 DEP1 Y236* FAS2 R7 YTA12 T971A.sup.& SDS3 E71* FAS2 R11 RHO1 D129N.sup.& SIN3 3061insT† FAS2 R12 SIN3 Y630* FAS2 R16 DEP1 Y242* RPB11 R9 UME6 C165* SEC4 R1 RPD3 G309C SEC4 R2 UBP13 L67M.sup.& UME6 Q113* SEC4 R3 SDS3 Q65* SEC4 R9 SRL2 K74L.sup.& DEP1 E222* SEC4 R10 DEP1 512insC† SEC4 R14 UME6 W368* *Indicates premature stop codon; †indicates frameshift; .sup.&indicates assumed secondary mutation
(130) TABLE-US-00010 TABLE 10 Decoy molecule properties Compound Solvent Conc. 1 Conc. 2 1-Naphthaleneacetic acid DMSO 100 μM 1 μM 2,4-DAPG DMSO 20 μM 1 μM 3-oxo-octanoyl-L- DMSO 100 μM 1 μM homoserine (OAH) Bepridil DMSO 100 μM 1 μM Catechin DMSO 100 μM 1 μM Choline Water 100 μM 1 μM Coumestrol DMSO 100 μM 1 μM Cumate Ethanol 100 μM 1 μM D-camphor DMSO 100 μM 1 μM Daidzein DMSO 100 μM 1 μM Doxycycline Water 100 μM 1 μM Erythromycin Ethanol 100 μM 1 μM Estradiol Ethanol 30 μM 1 μM Fisetin DMSO 100 μM 1 μM Fusaric Acid DMSO 100 μM 1 μM Genistein DMSO 100 μM 1 μM Gentamycin Water 100 μM 1 μM IPTG Water 100 μM 1 μM kinetin DMSO 100 μM 1 μM Lincomycin Water 100 μM 1 μM Quercetin DMSO 100 μM 1 μM Sodium Salicylate DMSO 100 μM 1 μM
(131) TABLE-US-00011 TABLE 11 Strain list Strain # genotype Origin BY4741 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 Brachmann et al., 1998 BY4742 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1 Brachmann et al., 1998 BY4743 MATa/MATα leu2Δ0/leu2Δ0 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 Brachmann lys2Δ0/LYS MET15/met15Δ0 et al., 1998 R1158 MATa URA3::CMV-tTA MATa his3-1 leu2-0 met15-0 Mnaimneh et al., 2004 NAy395 MATa leu2Δ0ura3Δ0 his3Δ1 lys2Δ0 FAS2::KanMX [pRS416- This FAS2] disclosure NAy396 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1 FAS2::KanMX [pRS416- This FAS2] disclosure NAy397 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 RPB11::KanMX [pRS416- This RPB11] disclosure NAy398 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1RPB11::KanMX [pRS416- This RPB11] disclosure NAy399 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 SEC4::KanMX [pRS416- This SEC4] disclosure NAy400 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1 SEC4::KanMX [pRS416- This SEC4] disclosure NAy407 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 FAS2::KanMX This HO::SPAL5p-FAS2-GAL1t::LEU2 [pRS416-GEV] disclosure NAy408 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1 FAS2::KanMX This HO::SPAL5p-FAS2-GAL1t::LEU2 [pRS416-GEV] disclosure NAy409 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 RPB11::KanMX This HO::SPAL5p-RPB11-GAL1t::LEU2 [pRS416-GEV] disclosure NAy410 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1 RPB11::KanMX This HO::SPAL5p-RPB11-GAL1t::LEU2 [pRS416-GEV] disclosure NAy411 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 SEC4::KanMX This HO::SPAL2p-SEC4-GAL1t::LEU2 [pRS416-GEV] disclosure NAy412 MATα leu2Δ0 lys2Δ0 ura3Δ0 his3Δ1 SEC4::KanMX This HO::SPAL2p-SEC4-GAL1t::LEU2 [pRS416-GEV] disclosure NAy484 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 FAS2::KanMX This HO::SPAZ4p-FAS2-GAL1t-LEU2[pRS413-Z4EV] disclosure NAy486 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1RPB11::KanMX This HO::SPAZ4p-RPB11-GAL1t-LEU2[pRS413-Z4EV] disclosure NAy488 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1SEC4::KanMX This HO::SPAZ4p-SEC4-GAL1t-LEU2[pRS413-Z4EV] disclosure NAy497 MATa leu2Δ0 met15Δ0 ura3Δ0 his3Δ1 HO::RFP-LEU2 [pRS413] This disclosure NAy471 MATa leu2Δ0ura3Δ0 his3Δ1 lys2Δ0 SEC4::KanMX ChVI::SpHIS5- This TETp-SEC4-GSH1t-CMVp-rtTA-STR1t disclosure NAy472 MATa leu2Δ0ura3Δ0 his3Δ1 lys2Δ0 SEC4::KanMX ChVI::SpHIS5- This SPETp-SEC4-GSH1t-CMVp-rtTA-STR1t disclosure NAy473 MATa leu2Δ0ura3Δ0 his3Δ1 lys2Δ0 SEC4::KanMX ChVI::SpHIS5- This 3xSPETp-SEC4-GSH1t-CMVp-rtTA-STR1t disclosure NAy474 MATa leu2Δ0ura3Δ0 his3Δ1 lys2Δ0 SEC4::KanMX ChVI::SpHIS5- This 3xSPETp-SEC4-GSH1t-CMVp-rtTA-STR1t disclosure
(132) TABLE-US-00012 TABLE 12 Oligo list SEQ ID Oligo name sequence NO: ADE13_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTGGTTTACCACTAACAAGAAAAGAA 11 ARC35_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTGCATATATACCGGGTGAGGGCCAC 12 CDC42_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTTTTAAAAAAAGTTGCATTATTTC 13 DED1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTCTTGCGAGATGATCCCGCATTTTC 14 EMW1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGTCACAGGTGTCAAGGTGTTAACTC 15 ERG1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTGAGCGTGGTTCAGGGCACTCTACG 16 ERG25_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagACTACCACTGCCTCCCTTCGTATAC 17 ERO1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagACGAGATCATTTTCTTATCTATCTA 18 FAS2_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagAACTATTTTCTATATTTCTATTCTA 19 GRC3_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTGTTGCGCACTAGGTACGATTTCC 20 HSP10_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTATTTTATTACGGTTCAGCAAAGGC 21 HTS1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagACAGATCCTTTATAATGTAGTAATT 22 ADE13_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAAAATCCGTAAGCCAAAAAAACAAG 23 ARC35_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAGAGAGGGCGTTGTTCCTCCTGTAG 24 CDC42_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGAACGTTTGGGGCTTGACGGCTCGA 25 DED1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTAAAAAATAAGAGTGGAAAAAAAGT 26 EMW1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTAAAGAAAAGGCAAGAAGATTTTGA 27 ERG1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAAAGTATAAAACACTTCGGTTAATA 28 ERG25_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccATATAGTTTTTAGAATTAACCTGAA 29 ERO1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccCAATGAGGAGTGATTTTACACAAAA 30 FAS2_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTGTGGGCCGACCAAATAGAAGAATT 31 GRC3_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGGGTTTAACGGAGGAGATGAAGGAT 32 HSP10_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccATAGTTTGTACACATAGTGTCCCTA 33 HTS1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTGAGCAGACTGGAAAAGATGTAATG 34 ILV5_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCGCTGTCACTGAACTAAAACAATAA 35 IPI3_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCTTTGATAAATTAATACGGTAAGAT 36 IQG1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGAAAAATTGCAAAATTTTGATAGAG 37 MRD1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGTAGACATGATGTACTATACAACCA 38 MTR2_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTCTTTTCTTAGAAGAGGTTTTGTT 39 NAB3_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTAATCTTCGCTACTTCAAGTTTCAT 40 NDC1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCGCTCATCCAAAAAATCGATAACTA 41 NOC4_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCAACAAAAGAATGAAAGAAAAAAGA 42 NRD1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGAAAGTCGGCGGCAAAAATAAATGT 43 PGA1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTAGCTGCTCTATTTATATTTGAAG 44 POL1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTACATGAACTGACCGAAATTGCAGC 45 POP6_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGCTTCCCTTCATCCCCAGTTTTTAC 46 ILV5_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccCATTGAATCATAATAAATATGTAAA 47 IPI3_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccACTAAAGGCGGCCCATATTCTGAGA 48 IQG1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccACATCTTATTTTTATCTACTGAAGA 49 MRD1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAACAAGATGTGCTAACATTTTCCAT 50 MTR2_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTTAGGGACCGCCAGGGACCATGATT 51 NAB3_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAGTTTTTCGTTCTGAAAGAGATGCA 52 NDC1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTCTCTATACTTTTCTTTACTATTAT 53 NOC4_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTAACGCGGGGATCAGCGGTTCGATC 54 NRD1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccCTTGAAAAAAAACCAGGAATACGGT 55 PGA1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccATTCAGTTTAGTTAAATCTGGGTTA 56 POL1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccATGATGCATGTGAGAACTGATCACC 57 POP6_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTGAATTTCCGATTTCCAAAGGGAAG 58 PRE6_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagAGAAATTATATATAAATATACTTCT 59 PSA1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCGTGTACTTGCTGGCCAGCTAGAAA 60 RFT1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGCATCTTTCGATACCTTAGCACTCG 61 RIO1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCGATTGTTCGCCGGTGTTATAACTT 62 RNA1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCTAATCCACTGCCGGCAGAATTTCC 63 RPB11_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCGTTTGCTGAAGAACTGCAAAATGA 64 RPC11_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGTTAAAGAACTCTTCAATATTCGTC 65 RPN8_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTAAGGTAAGGCATCATTAGCAGGAT 66 RPT4_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagAGGTCTATTACCGATGGGCAAAAGA 67 SDA1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagACTGCTGATAGTGTCAAGAACATGT 68 SEC11_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTATAGCAACCTCGTTGACATTGTGA 69 SEC14_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGCCGTACGTGTCGTCTGATCTCCAA 70 PRE6_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAAGTCATTCCATTCCATTCTATATC 71 PSA1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGTTACATAAGGATCAACCTTTTTTT 72 RFT1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTTTACGGTGAAATAGCTTCTCTCTT 73 RIO1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGGATTGATTTCACTAAAAATCAAGA 74 RNA1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccATGCTGTTTTTTGCTTGGCTTCTTA 75 RPB11_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccCATGGCTGGTTTTTTTTCTTTTTTT 76 RPC11_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAAAAATATTAATTATTGCGTCCTAT 77 RPN8_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccCGTTAATATAAACTTATGTATATTC 78 RPT4_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAATTGAAACTACGTACCTGAAAGAA 79 SDA1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGGGAAAAGCCGAGAATTCCCGATGA 80 SEC11_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAAAAAATGACACAAATCATCTCTGT 81 SEC14_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccATAATCTAATAGCTGAGTGGAAGAA 82 SEC17_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTCTTTGTCAATTGCATCTCTAGTT 83 SEC4_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagAGTTCGATAGAGCATCTTTCAATAC 84 SLY1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTGGACTTGAACATAGGTGATTCTTG 85 SRP68_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGATGTACTTCCCGCCATACAAATAT 86 SSU72_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagAAAGATGCAAGCAATAATGAAAATC 87 SU11_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTTCTATTGTTTCACTATTCTTTAT 88 TRS20_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagATTCTCACCCTGTCTGCTTTTATTC 89 UFD1_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTTCCTCATCTTGAATCAAATGCTTA 90 UTP11_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGAGTTCAGAACCGTGACCTTTATTC 91 UTP20_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagGTTCGAGTCCTGCAGTTGTCGTTAT 92 UTP22_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagAGTTCTGTCCATCCGGTGGGCGACC 93 UTP5_TU_F cccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagTGCACGATAGAAATCGACAAGGCGA 94 SEC17_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccCACGAACAAAGGTTTATTGCGCTTG 95 SEC4_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTAGATAATATAAAAGTGACATCTAA 96 SLY1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGCCTAAAGCACATTTCATAAATAAA 97 SRP68_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTAATTTAACGTATAGTTATGTAAAG 98 SSU72_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTTCTTGATAAAAAAATAGCTATGTG 99 SUI1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccACTTGTTCTTATATCTCTGTATGTA 100 TRS20_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccTGTAACGGAACACTCAAAAGTGACT 101 UFD1_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccGGTAAACGAAGAGAATTACTTCGGC 102 UTP11_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccACAAATCTTGTCCTAAATACTCCCA 103 UTP20_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccACTGGTATGTCTTTTATCTAACAGT 104 UTP22_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccACCTAGCTTTATTCTGAGCGTCGCC 105 UTP5_TU_R aaaagctggagctccaccgcggtggcggccgctctagaactagtggatccAACGATGCCAGATGCAGTTCAAAAA 106
(133) TABLE-US-00013 TABLE 13 Essential genes Standard Systematic Transcript Protein Accession Gene Name Gene Name Accession number number ADE13 YLR359W NM_001182248.1 NP_013463.1 ARC35 YNR035C NM_001183212.1 NP_014433.1 CDC42 YLR229C NM_001182116.1 NP_013330.1 DED1 YOR204W NM_001183623.3 NP_014847.3 EMW1 YNL313C NM_001183151.1 NP_014086.1 ERG1 YGR175C NM_001181304.1 NP_011691.1 ERG25 YGR060W NM_001181189.3 NP_011574.3 ERO1 YML130C NM_001182493.1 NP_013576.1 FAS2 YPL231W NM_001184045.1 NP_015093.1 GRC3 YLL035W NM_001181855.1 NP_013065.1 HSP10 YOR020C NM_001183439.1 NP_014663.1 HTS1 YPR033C NM_001184130.1 NP_015358.1 ILV5 YLR355C NM_001182244.1 NP_013459.1 IPI3 YNL182C NM_001183020.1 NP_014217.1 IQG1 YPL242C NM_001184056.1 NP_015082.1 MRD1 YPR112C NM_001184209.1 NP_015437.1 MTR2 YKL186C NM_001179752.1 NP_012735.1 NAB3 YPL190C NM_001184004.1 NP_015134.1 NDC1 YML031W NM_001182389.1 NP_013681.1 NOC4 YPR144C NM_001184241.1 NP_015470.1 NRD1 YNL251C NM_001183089.1 NP_014148.1 PGA1 YNL158W NM_001182996.1 NP_014241.1 POL1 YNL102W NM_001182940.3 NP_014297.3 POP6 YGR030C NM_001181159.1 NP_011544.1 PRE6 YOL038W NM_001183292.1 NP_014604.1 PSA1 YDL055C NM_001180114.1 NP_010228.1 RFT1 YBL020W NM_001178260.1 NP_009533.1 RIO1 YOR119C NM_001183538.3 NP_014762.3 RNA1 YMR235C NM_001182742.1 NP_013962.1 RPB11 YOL005C NM_001183259.1 NP_014638.1 RPC11 YDR045C NM_001180353.1 NP_010330.1 RPN8 YOR261C NM_001183680.3 NP_014904.3 RPT4 YOR259C NM_001183678.3 NP_014902.3 SDA1 YGR245C NM_001181374.3 NP_011761.3 SEC11 YIR022W NM_001179544.1 NP_012288.1 SEC14 YMR079W NM_001182578.1 NP_013796.1 SEC17 YBL050W NM_001178290.1 NP_009503.1 SEC4 YFL005W NM_001179961.1 NP_116650.1 SLY1 YDR189W NM_001180497.1 NP_010475.1 SRP68 YPL243W NM_001184057.1 NP_015081.1 SSU72 YNL222W NM_001183060.1 NP_014177.1 SUI1 YNL244C NM_001183082.1 NP_014155.1 TRS20 YBR254C NM_001178602.1 NP_009813.1 UFD1 YGR048W NM_001181177.1 NP_011562.1 UTP11 YKL099C NM_001179665.1 NP_012823.2 UTP20 YBL004W NM_001178244.1 NP_009551.2 UTP22 YGR090W NM_001181219.3 NP_011604.3 UTP5 YDR398W NM_001180706.1 NP_010686.1 VAS1 YGR094W NM_001181223.1 NP_011608.1
(134) While the disclosure has been particularly shown and described with reference to specific embodiments, it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure.