METHODS FOR PRODUCING BIOMASS RICH IN DHA, PALMITIC ACID AND PROTEIN USING A EUKARYOTIC MICROORGANISM
20250188499 ยท 2025-06-12
Inventors
- Violeta Ugalde (Dartmouth, CA)
- Zachary Sun (Dartmouth, CA)
- Anthony Windust (Dartmouth, CA)
- Roberto E. Armenta (Dartmouth, CA)
Cpc classification
A23K50/00
HUMAN NECESSITIES
C12P23/00
CHEMISTRY; METALLURGY
A23K20/158
HUMAN NECESSITIES
C12P7/6427
CHEMISTRY; METALLURGY
A23L33/115
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A23K20/147
HUMAN NECESSITIES
C12P7/6472
CHEMISTRY; METALLURGY
International classification
A23K20/158
HUMAN NECESSITIES
C12P7/6472
CHEMISTRY; METALLURGY
A23L33/115
HUMAN NECESSITIES
A23K20/147
HUMAN NECESSITIES
A23K50/00
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
C12P7/6427
CHEMISTRY; METALLURGY
Abstract
Provided herein are eukaryotic microorganisms having a simple lipid profile comprising long chain fatty acids (LCFAs). Also provided are compositions and cultures comprising the eukaryotic microorganisms as well as methods of using the eukaryotic microorganisms.
Claims
1. A culture comprising (a) a lipid-producing eukaryotic microorganism with an 18S sequence, wherein the 18S sequence has at least 98% identity to the sequence set forth in SEQ ID NO:1, and (b) a heterotrophic medium that results in the lipid-producing eukaryotic microorganism having a simple lipid profile comprising long chain fatty acids (LCFAs).
2. The culture of claim 1, wherein the simple lipid profile comprises triglycerides and wherein greater than 95% of the triglycerides are comprised of myristic acid (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA).
3. The culture of claim 1, wherein the simple lipid profile comprises less than 3% of each of lauric acid (C12:0), pentadecylic acid (C15:0), palmitoleic acid (C16:1), margaric acid (C17:0), stearic acid (C18:0), vaccenic acid (C18:1n-7), oleic acid (C18:1n-9), -linolenic acid (C18:3n-6), -linolenic acid (C18:3n-3), stearidonic acid (C18:4), arachidic acid (C20:0), dihomo--linolenic acid (C20:3n-6), arachidonic acid (C20:4n-6, ARA), eicosapentaenoic acid (C20:5n-3, EPA), behenic acid (C22:0), docosatetraenoic acid (C22:4), docosapentaenoic acid n3 (C22:5n-3, DPAn3), and lignoceric acid (C24:0).
4. The culture of claim 1, wherein the simple lipid profile comprises less than 0.02% short chain fatty acids.
5. The culture of claim 1, wherein the simple lipid profile comprises at least 35% C22:6n-3 (DHA) in the triglycerides in the total fatty acids.
6. The culture of claim 1, wherein the heterotrophic medium results in production of at least 20% protein in the whole algae biomass.
7. The culture of claim 6, wherein the heterotrophic medium results in production of at least 20 to 40% protein of the biomass.
8. The culture of claim 7, wherein the heterotrophic medium results in production of at least about 40% protein.
9. The culture of claim 7, wherein the heterotrophic medium further results in production of at least about 10% C22:6n-3 (DHA).
10. The culture of claim 1, wherein the heterotrophic medium results in production of at least 30% palmitic acid.
11. The culture of claim 10, wherein the heterotrophic medium results in production of at least 40% palmitic acid.
12. The culture of claim 1, wherein the heterotrophic medium results in production of one or more carotenoids.
13. The culture of claim 12, wherein the one or more carotenoids comprises -carotene, and wherein the -carotene comprises at least 95% of total carotenoids.
14. A eukaryotic microorganism having, in a heterotrophic medium, a simple lipid profile comprising long chain fatty acids (LCFAs).
15. The eukaryotic microorganism of claim 14, wherein the simple lipid profile comprises greater than 3% of each of myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA).
16. The eukaryotic microorganism of claim 14, wherein the simple lipid profile comprises less than 3% of each of lauric acid (C12:0), pentadecylic acid (C15:0), palmitoleic acid (C16:1), margaric acid (C17:0), stearic acid (C18:0), vaccenic acid (C18:1n-7), oleic acid (C18:1n-9), -linolenic acid (C18:3n-6), -linolenic acid (C18:3n-3), stearidonic acid (C18:4), arachidic acid (C20:0), dihomo--linolenic acid (C20:3n-6), arachidonic acid (C20:4n-6, ARA), eicosapentaenoic acid (C20:5n-3, EPA), behenic acid (C22:0), docosatetraenoic acid (C22:4), docosapentaenoic acid n3 (C22:5n-3, DPAn3), and lignoceric acid (C24:0).
17. The eukaryotic microorganism of claim 14, wherein the simple lipid profile comprises less than 0.02% short chain fatty acids.
18. The eukaryotic microorganism of claim 14, wherein the simple lipid profile comprises at least 35% C22:6n-3 (DHA) in the triglycerides in the total fatty acids.
19. The eukaryotic microorganism of claim 14, wherein the eukaryotic microorganism produces a biomass of at least 20% protein.
20. The eukaryotic microorganism of claim 19, wherein the biomass is at least 20 to 40% protein.
21. The eukaryotic microorganism of claim 20, wherein the biomass is at least about 40% protein.
22. The eukaryotic microorganism of claim 21, wherein the eukaryotic microorganism produces at least about 10% C22:6n-3 (DHA) in the triglycerides in the total fatty acids.
23. The eukaryotic microorganism of claim 14, wherein the eukaryotic microorganism produces at least 30% palmitic acid in the triglycerides in the total fatty acids.
24. The eukaryotic microorganism of claim 23, wherein the eukaryotic microorganism produces at least 40% palmitic acid in the triglycerides in the total fatty acids.
25. The eukaryotic microorganism of claim 14, wherein the eukaryotic microorganism produces one or more carotenoids.
26. The eukaryotic microorganism of claim 25, wherein the one or more carotenoids comprises -carotene and wherein the -carotene comprises at least 95% of the carotenoids.
27. A eukaryotic microorganism having IDAC Accession No. 220716-01.
28. A method of making a lipid composition, the method comprising (a) culturing the eukaryotic microorganism of claim 14 in a heterotrophic medium to produce at least 35% DHA, (b) and isolating the lipid composition.
29. The method of claim 28, wherein the heterotrophic medium contains less than 3.75 g/L chloride.
30. The method of claim 28, wherein the biomass productvity of the cultured microorganisms is greater than 0.65 g/L/h.
31. The method of claim 28, wherein the triglyceride productivity of the cultured microorganisms is greater than 0.3 g/L/h.
32. A method of using the lipid composition of claim 28 comprising incorporating the lipid composition into a foodstuff.
33. The method of claim 32, wherein the foodstuff is pet food, a livestock feed, or an aquaculture feed.
34. A method of making a protein-rich biomass comprising (a) culturing the microorganism of claim 14 in a heterotrophic medium and (b) isolating the protein-rich biomass.
35. The method of claim 34, further comprising incorporating the protein-rich biomass into a foodstuff.
36. The method of claim 35, wherein the foodstuff is pet food, a livestock feed, or an aquaculture feed.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0005]
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
DETAILED DESCRIPTION
[0016] Microalgae are the primary producers of aquatic ecosystems and represent the origin of essential nutrients (e.g., protein and omega-3 fatty acids), which are metabolized and/or bio-accumulated in the aquatic food chain. As such, high protein and high omega-3 long chain polyunsaturated fatty acid (LC-PUFA) products derived from microalgae have enormous potential to sustainably meet the dietary demands of the rapidly-growing aquaculture sector. Among the large variety of microalgae, the use of heterotrophic microalgae has the greatest potential to provide aquaculture feed inputs that are free from the supply and demand constraints of plant and animal products. Heterotrophic microalgae production requires significantly less land and water, has better process economics, and is independent of environmental conditions (i.e., climate independent). For example, volumetric biomass productivity of heterotrophic microalgae can be two orders of magnitude higher than that of photosynthetic microalgae. The use of heterotrophic microalgae also provides the opportunity to leverage inexpensive and abundant non-food carbon sources converting them directly into high value products through fermentation. Such production processes can also be more easily scaled up, as would be required for an aquaculture feed product.
[0017] Provided herein are eukaryotic microorganisms having a simple lipid profile comprising long chain fatty acids (LCFAs). Microorganisms, including Thraustochytrids, produce a variety of lipids including fatty acids in various forms and amounts. As used herein, the term lipid includes phospholipids, free fatty acids, esters of fatty acids, triacylglycerols, sterols and sterol esters, carotenoids, xanthophylls (e.g., oxycarotenoids), hydrocarbons, and other lipids known to one of ordinary skill in the art. Fatty acids are hydrocarbon chains that terminate in a carboxyl group, being termed unsaturated if they contain at least one carbon-carbon double bond, and polyunsaturated when they contain multiple carbon-carbon double bonds. For example, microorganisms can produce (i) short-chain fatty acids (SCFA), which are fatty acids with aliphatic tails of fewer than six carbons (e.g., butyric acid); (ii) medium-chain fatty acids (MCFA), which are fatty acids with aliphatic tails of 6-12 carbons; (iii) long-chain fatty acids (LCFA), which are fatty acids with aliphatic tails 13 to 21 carbons; and very long chain fatty acids (VLCFA), which are fatty acids with aliphatic tails longer than 22 carbons. Various microorganisms produce varying types and amounts of these fatty acids. The specific types and amounts of fatty acids are collectively referred to herein in as the microorganism's lipid profile. Thus, as used herein, the term lipid profile refers to the types of lipids and amounts of lipids produced in a microorganism.
[0018] As used herein, a simple lipid profile refers to a microorganism having 95% or more of the triglycerides in the microorganism being made up of 1, 2, 3, or 4 of the major long chain fatty acids. Optionally, 95%, 96%, 97%, 98%, 99%, or 100% of the triglycerides in the microorganism comprise 1, 2, 3, or 4 of the major long chain fatty acids. Optionally, 95%, 96%, 97%, 98%, 99%, or 100% of the triglycerides in the microorganism comprises myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA). As used herein, a triglyceride refers to a molecule composed of three fatty acids covalently linked to a glyceride molecule. Thus, the triglyceride fraction of the total fatty acids in the microorganism can be comprised of 95%, 96%, 97%, 98%, 99%, or 100% myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA).
[0019] Long chain fatty acids (LCFA) include, but are not limited to, myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), docosahexaenoic acid (C22:6n-3, DHA), lauric acid (C12:0), pentadecylic acid (C15:0), palmitoleic acid (C16:1), margaric acid (C17:0), stearic acid (C18:0), vaccenic acid (C18:1n-7), oleic acid (C18:1n-9), -linolenic acid (C18:3n-6), -linolenic acid (C18:3n-3), stearidonic acid (C18:4), arachidic acid (C20:0), dihomo--linolenic acid (C20:3n-6), arachidonic acid (C20:4n-6, ARA), eicosapentaenoic acid (C20:5n-3, EPA), behenic acid (C22:0), docosatetraenoic acid (C22:4), docosapentaenoic acid n3 (C22:5n-3, DPAn3), and lignoceric acid (C24:0). Optionally, the four major LCFA comprise myristate, palmitic acid, DPA and DHA.
[0020] Optionally, the simple lipid profile comprises greater than 3% of each of myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA). Optionally, the simple lipid profile comprises triglycerides and 95% of the triglycerides are comprised of myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA). Optionally, the simple lipid profile comprises less than 3% of each of lauric acid (C12:0), pentadecylic acid (C15:0), palmitoleic acid (C16:1), margaric acid (C17:0), stearic acid (C18:0), vaccenic acid (C18:1n-7), oleic acid (C18:1n-9), -linolenic acid (C18:3n-6), -linolenic acid (C18:3n-3), stearidonic acid (C18:4), arachidic acid (C20:0), dihomo--linolenic acid (C20:3n-6), arachidonic acid (C20:4n-6, ARA), eicosapentaenoic acid (C20:5n-3, EPA), behenic acid (C22:0), docosatetraenoic acid (C22:4), docosapentaenoic acid n3 (C22:5n-3, DPAn3), and lignoceric acid (C24:0).
[0021] Optionally, the simple lipid profile comprises less than 0.02% short chain fatty acids. Optionally, the simple lipid profile comprises at least 35% C22:6n-3 (DHA) in the triglycerides in the total fatty acids. Optionally, the simple lipid profile comprises 35-40%, 35-45%, 35-50%, 40-45%, 40-50%, or 50%-60% DHA in the triglycerides in the total fatty acids. Stated another way, in the triglyceride fraction of the total fatty acids in the microorganism, the triglycerides can comprise 35-40%, 35-45%, 35-50%, 40-45%, 40-50%, or 50%-60% DHA.
[0022] Optionally, the eukaryotic microorganism produces a biomass of at least 20% protein, at least 40% protein, or at least 20-40% protein.
[0023] Optionally, the eukaryotic microorganism produces at least about 10% C22:6n-3 (DHA) in the triglycerides in the total fatty acids. Optionally, the eukaryotic microorganism produces at least 30% palmitic acid in the triglycerides in the total fatty acids. Optionally, the eukaryotic microorganism produces at least 40% palmitic acid in the triglycerides in the total fatty acids. Optionally, the eukaryotic microorganism produces one or more carotenoids. Optionally, the one or more carotenoids comprises -carotene. Optionally, -carotene comprises at least 95%, 96%, 97%, 98%, 99%, or 100% of the carotenoids produced in the microorganism.
[0024] Disclosed are eukaryotic microorganisms that produce lipids, wherein the eukaryotic microorganism has a simple lipid profile. Optionally, the lipid-producing eukaryotic microorganism has an 18S sequence with at least 97%, 98%, 99% or 100% identity to the sequence set forth in SEQ ID NO: 1. Optionally, the eukaryotic microorganism has IDAC Accession No. 220716-01, which was deposited with the International Depositary Authority of Canada (IDAC), National Microbiology Laboratory, Public Health Agency of Canada, 1015 Arlington Street, Winnipeg, Manitoba Canada R3E 3R2, on Jul. 22, 2016, and assigned Accession No. 220716-01. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit is exemplary and was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required for patentability (e.g., under 35 U.S.C. 112). The terms G3-1 or G3-1 strain or strain G3-1 are used herein interchangeably to refer to the eukaryotic microorganism deposited with the IDAC and having IDAC Accession No. 220716-01.
[0025] The provided microorganisms have distinguishing features over wild type microorganisms in their natural environment. Wild type microorganisms can be found in natural aquatic environments extending from oceanic environments to freshwater lakes and rivers, and also include brackish environments such as estuaries and river mouths. Such environments are not considered to be encompassed by the term heterotrophic medium. The provided microorganisms produce, in a heterotrophic medium, different amounts of one or more lipids and/or protein content from the microorganisms in their natural environment.
[0026] Nucleic acid, as used herein, refers to deoxyribonucleotides or ribonucleotides and polymers and complements thereof. The term includes deoxyribonucleotides or ribonucleotides in either singleor doublestranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs). Unless otherwise indicated, conservatively modified variants of nucleic acid sequences (e.g., degenerate codon substitutions) and complementary sequences can be used in place of a particular nucleic acid sequence recited herein. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
[0027] The terms identical or percent identity, in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be substantially identical. This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0028] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0029] A comparison window, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981); by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970); by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988); by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI); or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).
[0030] A preferred example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977), and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for nucleic acids or proteins. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information, as known in the art. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of a selected length (W) in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al.). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The Expectation value (E) represents the number of different alignments with scores equivalent to or better than what is expected to occur in a database search by chance. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, expectation (E) of 10, and the BLOSUM62 scoring matrix (sec Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)), alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
[0031] The term polypeptide, as used herein, generally has its art-recognized meaning of a polymer of at least three amino acids and is intended to include peptides and proteins. However, the term is also used to refer to specific functional classes of polypeptides, such as, for example, desaturases, elongases, etc. For each such class, the present disclosure provides several examples of known sequences of such polypeptides. Those of ordinary skill in the art will appreciate, however, that the term polypeptide is intended to be sufficiently general so as to encompass not only polypeptides having the complete sequence recited herein (or in a reference or database specifically mentioned herein), but also to encompass polypeptides that represent functional fragments (i.e., fragments retaining at least one activity) of such complete polypeptides. Moreover, those in the art understand that protein sequences generally tolerate some substitution without destroying activity. Thus, any polypeptide that retains activity and shares at least about 30-40% overall sequence identity, often greater than about 50%, 60%, 70%, or 80%, and further usually including at least one region of much higher identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99% in one or more highly conserved regions, usually encompassing at least 3-4 and often up to 20 or more amino acids, with another polypeptide of the same class, is encompassed within the relevant term polypeptide as used herein. Those in the art can determine other regions of similarity and/or identity by analysis of the sequences of various polypeptides described herein. As is known by those in the art, a variety of strategies are known, and tools are available, for performing comparisons of amino acid or nucleotide sequences in order to assess degrees of identity and/or similarity. These strategies include, for example, manual alignment, computer assisted sequence alignment and combinations thereof. A number of algorithms (which are generally computer implemented) for performing sequence alignment are widely available, or can be produced by one of skill in the art. Representative algorithms include, e.g., the local homology algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2:482); the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol., 1970, 48:443); the search for similarity method of Pearson and Lipman (Proc. Natl. Acad. Sci. (USA), 1988, 85:2444); and/or by computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.). Readily available computer programs incorporating such algorithms include, for example, BLASTN, BLASTP, Gapped BLAST, PILEUP, CLUSTALW, etc. When utilizing BLAST and Gapped BLAST programs, default parameters of the respective programs may be used. Alternatively, the practitioner may use non-default parameters depending on his or her experimental and/or other requirements (see for example, the Web site having URL www.ncbi.nlm.nih.gov).
[0032] The provided eukaryotic microorganisms can be cultured in a heterotrophic medium. Thus, provided herein are eukaryotic microorganisms having, in a heterotrophic medium, a simple lipid profile comprising long chain fatty acids (LCFAs). Also provided are cultures comprising a lipid-producing eukaryotic microorganism with an 18S sequence, wherein the 18S sequence has at least 98% identity to the sequence set forth in SEQ ID NO:1, and a heterotrophic medium that results in the lipid-producing eukaryotic microorganism having a simple lipid profile comprising long chain fatty acids (LCFAs). Optionally, the simple lipid profile comprises greater than 3% of each of myristic acid (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA). Optionally, the simple lipid profile comprises less than 3% of each of lauric acid (C12:0), pentadecylic acid (C15:0), palmitoleic acid (C16:1), margaric acid (C17:0), vaccenic acid (C18:1n-11), oleic acid (C18:1n-9), -linolenic acid (C18:3n-6), -linolenic acid (C18:3n-3), stearidonic acid (C18:4), arachidic acid (C20:0), dihomo--linolenic acid (C20:3n-6), arachidonic acid (C20:4n-6, ARA), (C20:3n-3), eicosapentaenoic acid (C20:5n-3, EPA), behenic acid (C22:0), docosatetraenoic acid (C22:4), docosapentaenoic acid n-3 (C22:5n-3, DPAn3), and lignoceric acid (C24:0). Optionally, 95%, 96%, 97%, 98%, 99%, or 100% of the triglycerides in the microorganism comprises myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA). Optionally, the simple lipid profile comprises less than 0.02% short chain fatty acids. Optionally, the simple lipid profile comprises at least 35% C22:6n-3 (DHA) in the triglycerides in the total fatty acids. Optionally, the heterotrophic medium results in production of at least 20% protein in the whole algae biomass. Optionally, the heterotrophic medium results in production of at least 20 to 40% protein of the biomass. Optionally, the heterotrophic medium results in production of at least about 40% protein. Optionally, the heterotrophic medium further results in production of at least about 10% C22:6n-3 (DHA). Optionally, the heterotrophic medium results in production of at least 30% palmitic acid. Optionally, the heterotrophic medium results in production of at least 40% palmitic acid. Optionally, the heterotrophic medium results in production of one or more carotenoids. Optionally, the one or more carotenoids comprises -carotene, and wherein the -carotene comprises at least 95% of total carotenoids. Optionally, -carotene comprises at least 95%, 96%, 97%, 98%, 99%, or 100% of the carotenoids produced in the microorganism.
[0033] The provided microorganisms produce greater than 50% DHA in small fermenters. Optionally, the provided microorganisms produce greater than 50% DHA in 2 liter (L) or 5 liter (L) fermenters. Optionally, the biomass productivity of the microorganism is from 0.5 to 0.8 g/L/h in small fermenters, for example, 2 L or 5 L fermenters. Optionally, the total fatty acid productivity of the microorganism is 0.3 to 0.6 g/L/h in small fermenters, for example, 2 L or 5 L fermenters. Optionally, the DHA productivity of the microorganism is 0.1 to 0.4 g/L/h in small fermenters, for example, 2 L or 5 L fermenters. Optionally, the productivity of C:16 of the microorganism is 0.1 to 0.3 g/L/h in small fermenters, for example, 2 L or 5 L fermenters.
[0034] The heterotrophic medium supplies various nutritional components, including a carbon source and a nitrogen source, for the microorganism. Medium for culture can include any of a variety of carbon sources. Examples of carbon sources include fatty acids, lipids, glycerols, triglycerols, carbohydrates, polyols, amino sugars, and any kind of biomass or waste stream. Fatty acids include, for example, oleic acid. Carbohydrates include, but are not limited to, glucose, cellulose, hemicellulose, fructose, dextrose, xylose, lactulose, galactose, maltotriose, maltose, lactose, glycogen, gelatin, starch (corn or wheat), acetate, m-inositol (e.g., derived from corn steep liquor), galacturonic acid (e.g., derived from pectin), L-fucose (e.g., derived from galactose), gentiobiose, glucosamine, alpha-D-glucose-1-phosphate (e.g., derived from glucose), cellobiose, dextrin, alpha-cyclodextrin (e.g., derived from starch), and sucrose (e.g., from molasses). Polyols include, but are not limited to, maltitol, erythritol, and adonitol. Amino sugars include, but are not limited to, N-acetyl-D-galactosamine, N-acetyl-D-glucosamine, and N-acetyl-beta-D-mannosamine. Optionally, the carbon source is present in the heterotrophic medium at a concentration of less than 60 g/L. Optionally, the carbon source is present in the heterotrophic medium at a concentration of 1 to 60 g/L. Optionally, the carbon source is present in the heterotrophic medium at a concentration of 5 to 60 g/L. Optionally, the carbon source is present in the heterotrophic medium at a concentration of 20 to 40 g/L.
[0035] Optionally, the microorganisms can be cultured in medium having a chloride concentration from about 0.5 g/L to about 50.0 g/L. Optionally, microorganisms are cultured in medium having a chloride concentration from about 0.5 g/L to about 35 g/L (e.g., from about 18 g/L to about 35 g/L). Optionally, the microorganisms are cultured in a medium having a chloride concentration from about 2 g/L to about 35 g/L. Optionally, the microorganisms described herein can be grown in low chloride conditions. For example, the microorganisms can be cultured in a medium having a chloride concentration from about 0.5 g/L to about 20 g/L (e.g., from about 0.5 g/L to about 15 g/L). The culture medium optionally includes NaCl. The culture medium can include non-chloride-containing sodium salts as a source of sodium. Examples of non-chloride sodium salts suitable for use in accordance with the present methods include, but are not limited to, soda ash (a mixture of sodium carbonate and sodium oxide), sodium carbonate, sodium bicarbonate, sodium sulfate, and mixtures thereof. See, e.g., U.S. Pat. Nos. 5,340,742 and 6,607,900, the entire contents of each of which are incorporated by reference herein. Optionally, the medium comprises 9 g/L chloride when using 20 g/L of carbon, 20 g/L soy peptone, and 5 g/L yeast extract. Optionally, the medium comprises 35 g/L chloride when the medium contains 10 g/L carbon, 5 g/L soy peptone, 5 g/L yeast extract and 10 g/L agar. Optionally, the medium comprises 2 g/L chloride when the medium contains 20-40 g/L carbon, 1 g/L yeast extract, 1-20 g/L monosodium glutamate (MSG), 0.3-2.0 g/L phosphates, 4 g/L magnesium sulfate, 5-10 g/L ammonium sulfate, 1.5 mL/L trace elements solution, 1 mL/L of vitamin B solution, 0.1 g/L CaCl.sub.2.
[0036] Medium for a Thraustochytrid culture can include any of a variety of nitrogen sources. Exemplary nitrogen sources include ammonium solutions (e.g., NH.sub.4 in H.sub.2O), ammonium or amine salts (e.g., (NH.sub.4).sub.2SO.sub.4, (NH.sub.4).sub.3PO.sub.4, NH.sub.4NO.sub.3, NH.sub.4OOCH.sub.2CH.sub.3(NH.sub.4Ac)), peptone, soy peptone, tryptone, yeast extract, malt extract, fish meal, sodium glutamate, soy extract, casamino acids and distiller grains. Concentrations of nitrogen sources in suitable medium typically range between and including about 1 g/L and about 25 g/L. Optionally, the concentration of nitrogen is in the medium is about 5 to 20 g/L. Optionally, the concentration of nitrogen in the medium is about 10 to 15 g/L. Optionally, the concentration of nitrogen in the medium is about 20 g/L. Optionally, the concentration of nitrogen is about 10 to 15 g/L when yeast extract is the source of complex nitrogen in the medium. Optionally, the concentration of nitrogen is about 1 to 5 g/L when soy peptone is in the medium along with L-Glutamic acid monosodium salt hydrate (MSG) or ammonium sulfate.
[0037] The medium optionally includes a phosphate, such as potassium phosphate or sodium-phosphate. Optionally, the culture or heterotrophic medium comprises potassium phosphate monobasic.
[0038] Inorganic salts and trace nutrients in medium can include ammonium sulfate, sodium bicarbonate, sodium orthovanadate, potassium chromate, sodium molybdate, selenous acid, nickel sulfate, copper sulfate, zinc sulfate, cobalt chloride, iron chloride, manganese chloride calcium chloride, and EDTA. Optionally, the medium includes at least 1.5 ml/L of a trace element solution. Optionally, the trace element solution comprises 2 mg/mL copper (II)sulfate pentahydrate, 2 mg/mL zinc sulfate heptahydrate, 1 mg/mL cobalt(II) chloride hexahydrate, 1 mg/mL manganese (II) chloride tetrahydrate, 1 mg/mL sodium molybdate dihydrate, 1 mg/mL nickel (II) sulfate.
[0039] Optionally, the medium includes magnesium sulfate. Optionally, the heterotrophic medium or culture comprises magnesium sulfate, trace element solution and potassium phosphate monobasic.
[0040] Vitamins such as pyridoxine hydrochloride, thiamine hydrochloride, calcium pantothenate, p-aminobenzoic acid, riboflavin, nicotinic acid, biotin, folic acid and vitamin B12 can be included.
[0041] The pH of the medium can be adjusted to between and including 3.0 and 10.0 using acid or base, where appropriate, and/or using the nitrogen source. Optionally, the medium can be sterilized.
[0042] Optionally, the medium comprises L-Glutamic acid monosodium salt hydrate or monosodium glutamate (MSG). Optionally, the medium comprises 1-20 g/L MSG. Optionally, the medium comprises 1 g/L MSG when the medium comprises at least 1 g/L yeast extract, 40 g/L carbon, 0.3 g/L KH2PO4, 4 g/L magnesium sulfate and 1.5 mL/L trace elements solution. Optionally, the medium comprises 20 g/L MSG when the medium comprises 5-15 g/L yeast extract, 0-10 g/L ammonium sulfate, 20-40 g/L carbon, 2 g/L chloride, 4 g/L magnesium sulfate, 1.5 mL/L trace elements solution, 0.3-2.0 g/L phosphates, 1 mL/L vitamin solution and 0.1 g/L CaCl.sub.2.
[0043] Generally a medium used for culture of a microorganism is a liquid medium. However, the medium used for culture of a microorganism can be a solid medium. In addition to carbon and nitrogen sources as discussed herein, a solid medium can contain one or more components (e.g., agar and/or agarose) that provide structural support and/or allow the medium to be in solid form.
[0044] Cultivation of the microoganisms can be carried out using known conditions, for example, those described in International Publication Nos. WO 2007/069078 and WO 2008/129358. For example, cultivation can be carried out for 1 to 30 days, 1 to 21 days, 1 to 15 days, 1 to 12 days, 1 to 9 days, or 3 to 5 days. Optionally, cultivation is carried out at temperatures between 4 to 30 C. Optionally, cultivation is carried out by aeration-shaking culture, shaking culture, stationary culture, batch culture, continuous culture, rolling batch culture, wave culture, or the like. Optionally, cultivation is carried out with a dissolved oxygen content of the culture medium between 1 and 20%, between 1 and 10%, or between 1 and 5%.
[0045] Provided herein are methods of making a lipid composition. The methods include culturing the provided lipid-producing eukaryotic microorganisms in a heterotrophic medium to produce a simple lipid profile and isolating the lipid composition. Optionally, the lipid-producing eukaryotic microorganism has an 18S sequence, wherein the 18S sequence has at least 98% identity to the sequence set forth in SEQ ID NO:1, and the heterotrophic medium results in the lipid-producing eukaryotic microorganism having a simple lipid profile comprising long chain fatty acids (LCFAs). Optionally, the heterotrophic medium contains less than 3.75 g/L chloride. Optionally, the biomass productivity of the cultured microorganisms is greater than 0.65 g/L/h. Optionally, the triglyceride productivity of the cultured microorganisms is greater than 0.3 g/L/h. Optionally, the heterotrophic medium contains less than 3.75 g/L chloride and the biomass productvity of the cultured microorganisms is greater than 0.65 g/L/h and the triglyceride productivity of the cultured microorganisms is greater than 0.3 g/L/h. Optionally, the simple lipid profile of the microorganism used in the methods of making a lipid composition comprises greater than 3% of each of myristate (C14:0), palmitic acid (C16:0), docosapentaenoic acid n-6 (C22:5n-6, DPAn6), and docosahexaenoic acid (C22:6n-3, DHA). Optionally, the simple lipid profile comprises less than 3% of each of lauric acid (C12:0), pentadecylic acid (C15:0), palmitoleic acid (C16:1), margaric acid (C17:0), stearic acid (C18:0), vaccenic acid (C18:1n-7), oleic acid (C18:1n-9), -linolenic acid (C18:3n-6), -linolenic acid (C18:3n-3), stearidonic acid (C18:4), arachidic acid (C20:0), dihomo--linolenic acid (C20:3n-6), arachidonic acid (C20:4n-6, ARA), eicosapentaenoic acid (C20:5n-3, EPA), behenic acid (C22:0), docosatetraenoic acid (C22:4), docosapentaenoic acid n3 (C22:5n-3, DPAn3), and lignoceric acid (C24:0).
[0046] Optionally, the simple lipid profile of the microorganism used in the methods of making a lipid composition comprises less than 0.02% short chain fatty acids. Optionally, the simple lipid profile comprises at least 35% C22:6n-3 (DHA) in the triglycerides in the total fatty acids. Optionally, the simple lipid profile comprises 35-40%, 35-45%, 35-50%, 40-45%, 40-50%, or 50-60% DHA in the triglycerides in the total fatty acids. Optionally, the eukaryotic microorganism as described herein produces a biomass of at least 20% protein. Optionally, the biomass is at least 20 to 40% protein. Optionally, the biomass is at least about 40% protein. Optionally, the eukaryotic microorganism as described herein produces at least about 10% C22:6n-3 (DHA) in the triglycerides in the total fatty acids. Optionally, the eukaryotic microorganism used according to the disclosed methods produces at least 30%, at least 40%, or at least 30-40% palmitic acid in the triglycerides in the total fatty acids.
[0047] Optionally, the eukaryotic microorganism produces one or more carotenoids. Optionally, the one or more carotenoids comprises -carotene. Optionally, -carotene comprises at least 95%, 96%, 97%, 98%, 99%, or 100% of the carotenoids produced in the microorganism.
[0048] Also provided are methods of making a protein-rich biomass comprising culturing the provided lipid-producing eukaryotic microorganisms in a heterotrophic medium and isolating the protein-rich biomass. Optionally, the method further comprises incorporating the protein-rich biomass into a foodstuff. Optionally, the foodstuff is pet food, a livestock feed, or an aquaculture feed. Optionally, the eukaryotic microorganism as used in the present methods produces a biomass of at least about 20% protein, at least about 40%, or at least about 20 to 40% protein. Optionally, the eukaryotic microorganism produces at least about 10% C22:6n-3 (DHA) in the triglycerides in the total fatty acids.
[0049] Optionally, the lipids produced according to the methods described herein can be incorporated into a final product (e.g., a food or feed supplement, an infant formula, a pharmaceutical, a fuel, and the like). Thus, provided is a method of using the lipid composition made according to the methods described herein, wherein the method of use comprises incorporating the lipid composition into a foodstuff.
[0050] Further, the provided protein-rich biomass can be incorporated into a final product (e.g., food or feed supplement, biofuel, etc.). Thus, provided is a method of using the protein-rich biomass comprising incorporating the protein-rich biomass into a foodstuff (e.g., a pet food, a livestock feed, or an aquaculture feed).
[0051] Suitable food or feed supplements into which the lipids can be incorporated include beverages such as milk, water, sports drinks, energy drinks, teas, and juices; confections such as candies, jellies, and biscuits; fat-containing foods and beverages such as dairy products; processed food products such as soft rice (or porridge); infant formulae; breakfast cereals; or the like. Optionally, one or more produced lipids can be incorporated into a dietary supplement, such as, for example, a vitamin or multivitamin. Optionally, a lipid produced according to the method described herein can be included in a dietary supplement and optionally can be directly incorporated into a component of food or feed (e.g., a food supplement).
[0052] Examples of feedstuffs into which lipids produced by the methods described herein can be incorporated include pet foods such as cat foods; dog foods; feeds for aquarium fish, cultured fish or crustaceans, etc.; feed for farm-raised animals (including livestock and fish or crustaceans raised in aquaculture). Food or feed material into which the lipids produced according to the methods described herein can be incorporated is preferably palatable to the organism which is the intended recipient. This food or feed material can have any physical properties currently known for a food material (e.g., solid, liquid, soft).
[0053] Optionally, one or more of the produced compounds (e.g., PUFAs) can be incorporated into a nutraceutical or pharmaceutical product. Examples of such a nutraceuticals or pharmaceuticals include various types of tablets, capsules, drinkable agents, etc. Optionally, the nutraceutical or pharmaceutical is suitable for topical application. Dosage forms can include, for example, capsules, oils, granula, granula subtilae, pulveres, tabellae, pilulae, trochisci, or the like.
[0054] The oil or lipids produced according to the methods described herein can be incorporated into products in combination with any of a variety of other agents. For instance, such compounds can be combined with one or more binders or fillers, chelating agents, pigments, salts, surfactants, moisturizers, viscosity modifiers, thickeners, emollients, fragrances, preservatives, etc., or any combination thereof.
[0055] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules including the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.
[0056] Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties.
[0057] The examples below are intended to further illustrate certain aspects of the methods and compositions described herein, and are not intended to limit the scope of the claims.
EXAMPLES
Example 1. Identification and Preliminary Analysis of Thraustochytrid-Like Strain G3-1.
[0058] After two days of incubation strain G3-1 showed significant accumulation of biomass. In contrast, other thrasutochytrids, under the conditions employed, required at least three days of incubation to achieve a similar level of biomass accumulation. Preliminary analysis also indicated that thraustochytrid-like strain G3-1 was able to accumulate high concentrations of oil rich in docosahexaenoic acid (DHA) and palmitic acid (C16:0). DHA is a fatty acid of high value due to use in human and animal nutrition. Palmitic acid is also of value when employed as a feedstock for biofuel production. Furthermore, with the application of animal nutrition in mind and aquaculture in particular thraustochytrid-like strain G3-1 has been shown to accumulate protein to a level that composes around 30% of its biomass dry weight. Due to these properties thraustochytrid-like strain G3-1 was selected to develop a method to produce biomass rich in DHA, palmitic acid and protein in a short period of time.
Example 2. Evaluation of Strain G3-1 in Two Media Compositions.
[0059] To evaluate the thraustochytrid-like strain G3-1, it was cultivated under two conditions, full fermentation (FF) media and Basal (B) media. FF media is a complex media and B media is a minimal media used in the analysis and development of different processes, strains and conditions.
[0060] A comparison of G3-1 productivity in FF vs B media demonstrated that biomass content was higher in B media with G3-1 producing 53% more biomass (Table 1). Also total fatty acid (TFA) yield increased on a volumetric basis by 49%, owed to higher biomass accumulation. Moreover, on a dry cell weight basis TFA production also increased. In FF media fatty acids composed 289 mg g.sup.1 biomass while in B media this increased to 312 mg g.sup.1 biomass, an increase of 8% (Table 1). The obtained results suggest that strain G3-1 may be sensitive to the osmotic pressure imposed high concentration of glucose in FF media. Protein content was also analyzed revealing that up to 30% of dry cell weight is attributed to protein.
Experimental Details
[0061] Growth and cultivationSeed cultures were produced by either adding 1 mL of the ASW containing pure strain G3-1 culture or two loops of pure colonies taken from an agar plate, to 30 mL aliquots of B media in 150 mL baffled Erlenmeyer flasks. Flasks were incubated at 25 C. and 200 rpm for 2 days. 5 mL aliquots of seed cultures (previously adjusted with sterile fresh B media to OD600nm=1.5) were taken under aseptic conditions and added to 95 mL of sterile test media in 500 mL Erlenmeyer flasks. Test media composition and culture conditions for these flasks were evaluated using a B media (described above) and FF media, which was composed of 60 g L.sup.1 glucose, 2 g L.sup.1 sea salt, 4 g L.sup.1 soy peptone, 1 g L.sup.1 yeast extract, 4 g L.sup.1 magnesium sulfate, 2 g L.sup.1 sodium chloride, 5 mg L.sup.1 ferric chloride, 3 mg L.sup.1 copper sulfate, 2 mg L.sup.1 sodium molybdate, 3 mg L.sup.1 zinc sulfate, 2 mg L.sup.1 cobalt (II) chloride, 2 mg L.sup.1 manganese chloride, 2 mg L.sup.1 nickel sulfate, 1.6 g L.sup.1 potassium phosphate monobasic, 1.75 g L.sup.1 potassium phosphate dibasic, 6.8 g L.sup.1 ammonium sulfate, 0.1 g L.sup.1 calcium chloride dehydrate, 0.01 g L.sup.1 cobalamin, 0.01 g L.sup.1 biotin and 2 g L.sup.1 thiamin hydrochloride. After two days of fermentation, broth samples were taken from each flask and cells were harvested by centrifugation at 4150 rpm for 20 min at 2 C. The pellet was rinsed with distilled water to remove the salts and residual substrate, and then re-centrifuged. Pellets were frozen at 80 C., freeze-dried and stored at 20 C. prior to biomass and fatty acid analysis. The freeze-dried cell pellets were weighed to determine the biomass of strain G3-1 culture and reported as dry weight of cells per unit volume of media (g L.sup.1). A direct one step transesterification method was carried out to prepare fatty acid methyl esters (FAMEs) from freeze-dried biomass to estimate the oil content inside the cells.
TABLE-US-00001 TABLE 1 Biomass and TFA production by strain G3-1 in liquid media. Media Biomass (g L.sup.1) TFA (g L.sup.1) Full fermentation (FF) 6.9 0.3 2.0 0.1 Basal (B) 13.1 0.3 4.1 0.3
[0062] This investigation also demonstrated that media composition was able to modify the fatty acid profile of the oil produced by G3-1 (
TABLE-US-00002 TABLE 2 Effect of media composition on fatty acid profile of the intracellular oil of strain G3-1: basal (B), full fermentation media (FF). Fatty FF B FF B acids mg/g mg/g % % C14:0 6.4 0.4 6.6 0.4 2.2 0.0 2.1 0.0 C15:0 2.3 0.1 47.1 0.7 0.8 0.1 15.1 0.9 C16:0 105.2 6.6 63.1 4.5 36.7 0.3 20.1 0.6 C17:0 1.0 0.1 9.5 0.1 0.4 0.0 3.0 0.1 C18:0 3.2 0.2 1.9 0.1 1.1 0.0 0.6 0.0 C20:4-6 1.2 0.3 2.2 0.1 0.4 0.1 0.7 0.0 EPA 1.1 0.3 0.8 0.0 0.4 0.1 0.3 0.0 C22:5n-6 29.8 1.9 31.0 1.4 10.4 0.1 9.9 0.0 DPA DHA 134.9 9.4 146.9 7.4 47.1 0.2 46.9 0.3 TFA 285.1 309.1
[0063] To analyze the protein content of strain G3-1 biomass a hot-TCA method was adapted from the literature and optimized using G3-1 culture aged at 16 h and 22 h. Four combinations of hot-TCA conditions were evaluated and the resultant protein content is shown in
Example 3. Nutritional Requirements for Enhanced Biomass Production and Lipid Accumulation by Thraustochytrid-Like Strain G3-1.
[0064] Previous analysis comparing FF and B media demonstrated that the nutritional requirements of G3-1 differ to those of other thrasutochytrids. A series of experiments were designed to better understand what aspects of B media affect growth and lipid production for G3-1. To do this, a standard factorial design experimental approach was applied, also called a Plackett-Burman.
[0065] The results show that the nutrient requirements of strain G3-1 differ from those of other thraustochytrids, that G3-1 has the capacity to produce short chain saturated fatty acids (palmitic acid) and long chain polyunsaturated fatty acids (DHA), likely through independent pathways, a classic elongation and desaturation pathway plus an independent polyketide synthase pathway. They also demonstrate that soy peptone and sea salt together have a significant impact on G3-1 productivity.
Experimental Details.
[0066] An irregular fraction factorial design (24*3/4) was used to explore the significance of four independent variables, B media components, on biomass and fatty acid production. Independent variables were tested at a high (+1) and low (1) concentrations (Table 3). A total of twelve experimental runs were completed in duplicate, as described in Table 4.
TABLE-US-00003 TABLE 3 Independent variables and their levels used in the irregular fraction factorial design. Coded level Variables Coded Xi 1 +1 Glucose (g L.sup.1) X1 20 40 Soy peptone (g L.sup.1) X2 4 20 Yeast extract (g L.sup.1) X3 1 5 Sea salt (g L.sup.1) X4 2 9
TABLE-US-00004 TABLE 4 Irregular fraction factorial design matrix. Coded Variable Process Variable Run Block X1 X2 X3 X4 X1 X2 X3 X4 1 1 1 1 1 1 20 4 1 2 2 1 1 1 1 +1 20 4 1 9 3 1 1 1 +1 1 20 4 5 2 4 1 1 1 +1 +1 20 4 5 9 5 1 1 +1 1 1 20 20 1 2 6 1 1 +1 1 +1 20 20 1 9 7 1 1 +1 +1 1 20 20 5 2 8 1 1 +1 +1 +1 20 20 5 9 9 1 +1 1 1 +1 40 4 1 9 10 1 +1 1 +1 1 40 4 5 2 11 1 +1 +1 1 1 40 20 1 2 12 1 +1 +1 +1 +1 40 20 5 9
[0067] This experiment demonstrated that soy peptone concentration (X2) and the interaction between soy peptone and sea salt concentration (X2*X4) had a significant effect (p<0.05) on the ability of G3-1 to produce biomass. Additionally, the amount of intracellular fatty acids accumulated by strain G3-1 was significantly (p<0.05) affected by soy peptone (X2), yeast extract (X3) and sea salt concentration (X4), and the interaction between glucose and sea salt concentration (X1*X4). In addition to affecting biomass and lipid productivity, fatty acid profile was also influenced by the changes imposed (
TABLE-US-00005 TABLE 5 Fatty acid profile of the intracellular oil of strain G3-1 under the different liquid media compositions tested using an irregular fraction factorial design. Fatty Acids (%) C18:1 C18:1 C20:4 Run C14:0 C15:0 C16:0 C16:1 C17:0 C18:0 Ole Vac C20:0 n-6 EPA 1 2.9 6 41.1 0.3 1.7 1.1 0.1 0.4 0.2 1.7 0.5 2 3.6 5.1 39.7 0.3 1.3 1.1 0.1 0.4 0.3 1.6 0.5 3 3 6.7 37.3 0.3 1.6 1 0.2 0.5 0.2 1.4 0.4 4 3.9 12 30.5 0.3 2.3 0.9 0.2 0.5 0.2 1.4 0.5 5 1.7 29.1 11.1 0.2 4.6 0.3 0.3 0.3 0 1 0.4 6 1.2 20.5 12.3 0.2 5 0.3 0.5 1.1 0 1.3 0.6 7 1 18.4 11.9 0 4.5 0.1 0.7 0.9 0 1.4 0.6 8 1.1 17 12.9 0 4.8 0.2 0.6 1.2 0 1.4 0.7 9 3.5 4.2 40.9 0.2 1.1 1.1 0.1 0.3 0.2 1.1 0.4 10 2.8 26.9 15.1 0.4 4.4 0.4 0.4 0.9 0 1.7 0.8 11 1.9 21.9 11.9 0.5 4.3 0.4 0.7 1.1 0 1.7 0.8 12 1.2 18 15.2 0 5 0.5 0.3 0.5 0 0.9 0.5 Fatty Acids (%) C22:5 n-6 Biomass TFA Run DPA DHA SFA MUFA PUFA (g/L) (g/L/d) 1 4.5 38.7 53 0.8 45.4 5.1 0.09 2.26 0.08 2 5.6 40.2 51.1 0.8 47.9 5.7 0.12 2.59 0.04 3 5.7 41 49.8 1 48.5 5.3 1.00 1.82 0.34 4 6 40.6 49.8 1 48.5 5.9 0.12 1.89 0.06 5 7.7 42.1 46.8 0.8 51.2 7.6 0.43 1.27 0.06 6 8.3 47.8 39.3 1.8 58 6.0 0.50 0.64 0.08 7 8.7 51 35.9 1.6 61.7 7.2 0.85 0.71 0.04 8 8.9 50.5 36 1.8 61.5 6.6 1.05 0.69 0.11 9 6.5 40 51 0.6 48 5.8 0.69 3.02 0.47 10 4.6 40.4 49.6 1.7 47.5 5.0 0.66 0.90 0.13 11 6.9 46 40.4 2.3 55.4 6.8 0.81 0.68 0.07 12 9.1 47.7 39.9 0.8 58.2 7.8 0.27 0.90 0.02
Example 4. Evaluation of Thraustochytrid-Like Strain G3-1 in Lab Fermenters.
[0068] Basal (B) media formulation from run 8, described above, was selected to carry out fermentations using 2L fermenters to evaluate the potential of the strain G3-1 to produce biomass rich in DHA and palmitic acid.
[0069] In an 88 hour fermentation thraustochytrid-like strain G3-1 produced 51.8 g L.sup.1 biomass composed of 67.3% TFA. DHA and palmitic acid constituted 38.8% and 44.7% of TFA, respectively. TFA productivity was 0.398 g L.sup.1 hr.sup.1 which exceeded published examples by >32%.
Experimental Details
[0070] G3-1 was pre-cultured in Erlenmeyer flasks containing 500 mL of liquid media (20 g L.sup.1 glucose, 20 g L.sup.1 soy peptone, 5 g L.sup.1 yeast extract and 9 g L.sup.1 sea salts). Flasks were incubated under agitation at 25 C. and 200 rpm for 2 days. After the incubation period, 200 mL of the pre-culture was transferred into 1.8 L of the same media, in a 2-L fermentation vessel. Batch culture conditions were applied as follows: 25 C., agitation starting at 400 rpm and reaching 600 rpm, aeriation at 0.3 VVM with atmospheric air, and pH 6.8. Cells were collected at 10-15 h intervals and growth, oil (TFA) and DHA content examined.
[0071] Glucose in the media was completely consumed after 20 h of fermentation. Fed-batch cultures were carried out for a total of 88 h. After 65 h of fed-batch fermentation, G3-1 produced 34.7 g L.sup.1 of biomass and 77.1% TFA. DHA (40.6%) and palmitic acid (42.7%) where the main fatty acids found in the lipid produced by this strain. After 88 h of fermentation, the total biomass accumulated was 51.8 g L.sup.1. At the end of the fermentation, 88 hours, dry biomass, TFA and DHA measured 51.8 g L.sup.1, 70% and 38.8%, respectively. Thus, for this fermentation total fatty acid productivity was 0.396 g L.sup.1 h.sup.1 and DHA productivity was 0.154 g L.sup.1 h.sup.1. Table 6 and
TABLE-US-00006 TABLE 6 Oil production and fatty acid profile of the intracellular oil of strain G3-1. Cells were cultured in 2-L fermenters using a selected basal media. Fatty acids (%) C20:5 C22:5 C22:6 Time TFA (n-3) (n-6) (n-3) Biomass TFA Productivity (g L.sup.1 h.sup.1) (h) (%) C14:0 C15:0 C16:0 C18:0 EPA DPA DHA (g/L) (mg/g) Biomass TFA DHA C16:0 Seed 19.6 2.8 10.6 26.3 0.9 1.7 5.6 44.3 13.1 196.3 21.34 24.0 2.7 15.5 25.7 0.8 0.5 7.9 42.4 14.7 240.2 40.28 49.5 2.9 3.9 35.8 1.0 0.3 8.4 45.5 28.1 495.4 47 55.6 3.1 3.1 38.3 1.1 0.3 8.2 43.9 34.8 555.7 65 77.1 3.8 2.1 42.7 1.1 0.3 7.7 40.6 34.7 770.9 71 74.2 3.9 2.0 44.1 1.1 0.3 7.5 39.5 36.9 742.0 88 67.3 3.9 2.0 44.7 1.1 0.4 7.4 38.8 51.8 672.6 0.589 0.396 0.154 0.177
Example 5. Improving the Process Through the Use of a Modified Full Fermentation Media.
[0072] In order to achieve higher biomass productivity, the effect of a modified full fermentation (MFF) media was assessed for impact on biomass and fatty acid accumulation with respect to strain G3-1. The modified fermentation (MFF) media is a complex media rich in minerals and vitamins that is identical to that employed previously, i.e., FF, except that glucose was reduced from 60 g L.sup.1 to 20 g L.sup.1 to reduce osmotic pressure. 2 L fed-batch fermentations were carried out and changes in biomass and fatty acid content monitored. In this 115 hour fermentation thraustochytrid-like strain G3-1 produced 85.4 g L.sup.1 biomass composed of 63.6% TFA. DHA and palmitic acid constituted 43.4% and 41.0% of TFA, respectively. TFA productivity was 0.471 g L.sup.1 h.sup.1, which exceeded published examples by >56%.
Experimental Details
[0073] A modified full fermentation media (MFF) was used to culture strain G3-1 in a 2-L fermenter for enhanced biomass and fatty acid production. G3-1 was pre-cultured in Erlenmeyer flasks containing 500 mL of the selected basal media (20 g L.sup.1 glucose, 20 g L.sup.1 soy peptone, 5 g L.sup.1 yeast extract and 9 g L.sup.1 sea salts). Flasks were incubated under agitation at 25 C. and 200 rpm for 2 days. After the incubation period, 200 mL of the pre-cultured cells were transferred into 1.8 L of MFF media (20 g L.sup.1 glucose, 2 g L.sup.1 sea salt, 4 g L.sup.1 soy peptone, 1 g L.sup.1 yeast extract, 4 g L.sup.1 magnesium sulfate, 2 g L.sup.1 sodium chloride, 5 mg L.sup.1 ferric chloride, 3 mg L.sup.1 copper sulfate, 2 mg L.sup.1 sodium molybdate, 3 mg L.sup.1 zinc sulfate, 2 mg L.sup.1 cobalt (II) chloride, 2 mg L.sup.1 manganese chloride, 2 mg L.sup.1 nickel sulfate, 1.6 g L.sup.1 potassium phosphate monobasic, 1.75 g L.sup.1 potassium phosphate dibasic, 6.8 g L.sup.1 ammonium sulfate, 0.1 g L.sup.1 calcium chloride dehydrate, 0.01 g L.sup.1 cobalamin, 0.01 g L.sup.1 biotin and 2 g L.sup.1 thiamin hydrochloride) and batch cultured in 2-L fermenters under the conditions of 25 C., agitation starting at 450 rpm and reaching 500 rpm, aeriation at 0.3 VVM with atmospheric air, and pH 6.8. Cells were collected at 10-15 hr intervals and the biomass, TFA and DHA were measured. Glucose in the media was completely consumed after 18-20 h of fermentation and at that time. The culture was then batch fed with 75% (w/v) glucose, until 115.38 h when the fermentation was ended. At the end of the fermentation (115.38 h) biomass, TFA and DHA measured 85.4 g L.sup.1, 63.6% and 43.4% DHA (Table 7,
TABLE-US-00007 TABLE 7 Oil production and fatty acid profile of the intracellular oil of MARA G3-1. Cells were cultured in 2-L fermenters using a modified full fermentation media. Fatty Acids (%) C20:5 C22:5 C22:6 Time TFA (n-3) (n-6) (n-3) Biomass TFA Productivity (g/L/h) (h) (%) C14:0 C15:0 C16:0 C18:0 EPA DPA DHA (g/L) (mg/g) Biomass TFA DHA C16:0 18.25 13.8 1.7 2.0 30.2 0.8 0.9 10.1 52.2 16.6 137.5 40.36 46.2 3.4 0.5 37.6 1.0 0.4 9.1 46.7 42.0 462.3 46.22 50.1 3.4 0.4 37.4 1.0 0.3 9.0 47.0 49.3 501.1 70.43 60.3 3.8 0.3 38.7 1.0 0.4 8.7 45.6 67.5 603.1 96.45 66.0 4.0 0.3 39.4 1.0 0.4 8.3 45.0 80.4 659.9 115.38 63.6 4.2 0.3 41.0 1.0 0.4 8.1 43.4 85.4 636.3 0.740 0.471 0.204 0.193
[0074] Biomass production was successfully enhanced when an MFF media was used to culture G3-1 in 2L-fermenters. However, after 115.38 h of fed-batch fermentation TFA reached 63.6% of biomass dry weight. A possible explanation for this is that MFF contained less soy peptone and sea salt than B media. Components that were found to be important in the initial factorial design experiment.
Example 6. The Effect of Nitrogen Limitation on the Oil Accumulation by Thraustochytrid-Like Strain G3-1.
[0075] The modified full fermentation media (MFF), described above, was adjusted to reduce the concentration of inorganic nitrogen (in the form of ammonium sulphate) in the liquid media by 50%. Strain G3-1 was cultured in 2L-fermenters. Glucose consumption was monitored and, when the cells showed signs of starvation, fermentations were fed-batch with 75% (w/v) glucose.
[0076] In this 112 hour fermentation, thraustochytrid-like strain G3-1 produced 79.5 g L.sup.1 biomass composed of 77.4% TFA. DHA and palmitic acid constituted 36.9% and 48.2% of TFA, respectively. TFA productivity was 0.548 g L.sup.1 h.sup.1, which exceeds published examples by >82%.
Experimental Details
[0077] G3-1 was pre-cultured following the same conditions described previously. 200 mL of pre-cultured cells were transferred to 1.8 L MFF media with half the normal amount of inorganic nitrogen (2-L vessel fermenter). Media was formulated using 3.4 g L.sup.1 of ammonium sulphate and all the other ingredients were maintained at the same concentration as described previously. Culture conditions were 25 C., agitation started at 480 rpm and increased 500 rpm over the course of the fermentation, aeriation was maintained at 0.3 VVM with atmospheric air, and pH 6.8 was maintained. Cells were collected at 10-15 hr intervals and biomass, TFA and DHA contents were analysed.
[0078]
[0079] In this investigation, TFA increased from 18.3 to 75.9% (maximally) of dry cell weight, as a percentage of TFA palmitic acid increased from around 45% to 48% over the course of the fermentation. Over the same time period DHA reduced slightly from 45% to 36.9% (Table 8). This corresponds to the biosynthesis of 372.7 mg g.sup.1 palmitic acid and 285.3 mg g.sup.1 DHA. Production rate for these two fatty acids is 0.264 g L.sup.1 h.sup.1 palmitic acid and 0.202 g L.sup.1 h.sup.1 DHA. The observed increase in palmitic acid biosynthesis is not surprising because nitrogen stress is known to induce the expression of genes in the classic fatty acid synthesis pathway responsible for palmitic acid production. However, it is reassuring to see that DHA production remains approximately the same irrespective of nitrogen stress.
TABLE-US-00008 TABLE 8 Oil production and fatty acid profile of the intracellular oil of strain G3-1. Cells were cultured in 2-L fermenters using half concentration of ammonium sulphate in a modified full fermentation media. Fatty acids (%) C20:5 C22:5 C22:6 Time TFA (n-3) (n-6) (n-3) Biomass TFA Productivity (g/L/h) (h) (%) C14:0 C15:0 C16:0 C18:0 EPA DPA DHA (g/L) (mg/g) Biomass TFA DHA C16:0 16 18.3 2.6 1.2 37.1 1.0 0.7 9.0 45.2 16.41 183.5 23.16 37.7 3.4 0.7 46.0 1.2 0.4 7.7 38.7 23.7 376.9 40.00 59.0 4.8 0.4 45.2 1.1 0.3 7.2 38.7 37.8 589.8 47.07 62.5 4.9 0.4 45.2 1.1 0.3 7.2 38.8 44.0 624.6 64.18 70.1 5.0 0.3 45.5 1.1 0.3 7.2 38.6 55.9 700.8 70.15 73.1 4.8 0.3 46.0 1.1 0.3 7.1 38.2 58.5 730.9 88.09 73.8 4.8 0.2 46.8 1.1 0.3 7.1 37.7 70.0 738.0 94.45 75.9 4.7 0.2 47.0 1.1 0.3 7.1 37.6 73.5 759.1 112.19 77.4 4.6 0.2 48.2 1.1 0.3 7.0 36.9 79.5 773.5 0.709 0.548 0.202 0.264
Example 7. Taxonomic Characterization of the Thraustochytrid-Like Strain G3-1.
[0080] A standard approach to characterize strain G3-1 was applied. The 18S rDNA sequence was amplified from G3-1 genomic DNA using Taq DNA polymerase and primers JBo119 (5-CAACCTGGTTGATCCTGCCAGTA-3 (SEQ ID NO:2)) and JBo120(5-TCACTACGGAAACCTTGTTACGAC-3 (SEQ ID NO:3)). The 50 l PCR reaction contained 1.25 Units Taq DNA polymerase (New England Biolabs, M0273 (IpSwich, MA)), 1standard reaction buffer, 200 M of each dNTP (A,G,C,T), 0.2 M of each primer (JBo119 and JBo120), and 3% DMSO. This PCR reaction was incubated at 95 C. for 4 min., then subjected to 35 cycles of 95 C. for 30 sec., 52 C. for 30 sec., and 68 C. for 1:45 min., followed by a final incubation at 68 C. for 30 min., before being held at 4 C. The 1.7 kb amplicon was gel purified and this pool of amplified fragments was cloned into pCR2.1 vector by TA cloning to produce the plasmid pJB84. Ten individual clones of pJB84 (#1, 2, 5, 6, 7, 10, 12, 13, 14, and 15) were isolated and sent to Genewiz (South Plainfield, NJ) for sequencing. The 18S rRNA sequence of each clone are provided in SEQ ID NOs:10, 11, 12, 13, 14, 15, 16, 17, 18, and 19. Each clone was sequenced with 8 primers in total: 4 forward primers and 4 reverse primers. Two of the sequencing primers, M13R and T7, are universal primers that bind vector sequences flanking the TA cloning site and were provided by Genewiz. The other 6 primers, including JBo119 and JBo120 used to amplify the 18S rDNA, bind within the 18S rDNA sequence and were designed based on previously reported primer sequences (Burja, A. M., Radianingtyas, H., Windust, A., and Barrow, C. J. (2006). Isolation and characterization of polyunsaturated fatty acid producing Thraustochytrium species: screening of strains and optimization of omega-3 production. Appl. Microbiol. Biotechnol. 72, 1161-1169; Mo, C., J., D., and B., R. (2002). Development of a PCR strategy for thraustochytrid identification based on 18S rDNA sequence. Mar. Biol. 140, 883-889). The 8 primer sequences are:
TABLE-US-00009 M13R (SEQIDNO:4) 5-CAGGAAACAGCTATGAC-3(universalprimer) T7 (SEQIDNO:5) 5-TAATACGACTCACTATAGGG-3(universalprimer) JBo119 (SEQIDNO:2) 5-CAACCTGGTTGATCCTGCCAGTA-3(Burjaetal.2006) JBo120 (SEQIDNO:3) 5-TCACTACGGAAACCTTGTTACGAC-3(Burjaetal.2006) JBo121 (SEQIDNO:6) 5-GTCTGGTGCCAGCAGCCGCG-3(Moetal.2002) JBo122 (SEQIDNO:7) 5-CTTAAAGGAATTGACGGAAG-3(Moetal.2002) JBo123 (SEQIDNO:8) 5-AGCTTTTTAACTGCAACAAC-3(Moetal.2002) JBo124 (SEQIDNO:9) 5-GGCCATGCACCACCACCC-3(Moetal.2002)
[0081] The 8 sequencing reactions for each clone were trimmed by deleting the 5 and 3 sequences containing N's (ambiguous nucleotides) leaving only the successful portions of each sequencing read. These were assembled into a single contig for each clone using ChromasPro software (Technelysium Pty Ltd, South Brisbane, Australia). These contigs contained the 18S rDNA sequences as well as flanking vector sequences. The vector sequences were trimmed from the contig leaving only the 18S rDNA sequence amplified by JBo119 and JBo120. Any ambiguous nucleotides indicated by ChromasPro were manually determined, but there were very few, if any of these. In all cases the 18S rDNA sequence was covered by at least 2 sequencing reads over its entire length, but had at least 3 reads coverage for the vast majority of its length, with >3 reads covering some shorter spans. All 10 sequences were at least 98% identical to each other. The largest variability between any pair of clones is between #5 and #6 which are 98.19% identical. There are two pairs of clones that are 100% identical, #1 and 7, and #12 and 13, and these identical pairs are 98.98% identical to each other. A consensus sequence was created. G3-1 18S rDNA consensus sequence based on 10 individually sequenced clones is shown below. Degenerate nucleotides were manually curated using the standard IUPAC annotation (A, Adenine; C, Cytosine; G, Guanine; T, Thyamine; W, A or T; S, C or G; M, A or C; K, G or T; R, A or G; Y, C or T; B, not A; D, not C; H, not G; V, not T; N, any Nucleotide).
TABLE-US-00010 (SEQIDNO:1) CAACCTGGTTGATCCTGCCAGTAGTCATATGCTCGTCTCAAAGATTAAGC CRTGCATGTGTAAGTATAAGCGATTGTACTGTGAGACTGCGAACGGCTCA TTATATCAGTAATAATTWCTTCGGTARYTTCTTTTATATGGATACCTGCA GTAATTCTGGAAATAATACATGCTGTAAGAGCCCTRTATGGGGCTGCACT TATTAGATTGAAGCCGATTTTATTGGTGAATCATGATAATTGAGCAGATT GACTWTTTTTDGTCGATGAATCGTTTGAGTTTCTGCCCCATCAGTTGTCG ACGGTAGTGTATTGGACTACGGTGACTATAACGGGTGACGGAGAGTTAGG GCTCGACTCCGGAGAGGGAGCCTGAGAGACGGCTACCATATCCAAGGATA GCAGCAGGCGCGTAAATTACCCACTGTGGACTCCACGAGGTAGTGACGAG AARYATCGATGCGAAGCGTGTATGCGTTTTGCTATCGGAATGAGARYAAT GTAAAACCCTCATCGAGGATCAACTGGAGGGCAAGTCTGGTGCCAGCAGC CGCGGTRATTCCAGCTCCRGAAGCATATGCTAAAGTTGTTGCAGTTAAAA AGCTCGTAGTTGAATTTCTGGCATGGGCGACCGGTGCTTTCCCTGAATGG GGATWGATTGTCTGTGTTGCCTTGGCCATCTTTYTCWTKYYDTTWTWGRK RWGARATCTTTCACTGTAATCAAAGCAGAGTGTTCCAAGCAGGTCGTATG ACCGGTATGTTTATTATGGGATGATAAGATAGGACTTGGGTGCTATTTTG TYGGTTTGCACGCCTGAGTAATGGTTAATAGGAACAGTTGGGGGTATTCG TATTTAGGAGCTAGAGGTGAAATTCTTGGATTTCCGAAAGACGAACTAGA GCGAAGGCATTTACMAAGCATGTTYTCATTAATCAAGAACGAAAGTCTGG GGATCGAAGATGATTAGATACCATCGTAGTCTAGACCGTAAACGATGCCR ACTTGCGATTGTTGGGTGCTTTWTTDTATGGGCCTCAGCAGCRGCACATG AGARATCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAA CTTRAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTA ATTTGACTCAACACGGGAAAACTTACCAGGTCCAGACATAGGTAGGATTG ACAGATTGAGAGCTCTTTCATGATTCTATGGGTGGTRGTGCATGGCCKTT CTTAGTTGGTGGAGTGATTTGTCTGGTTAATTCCGTTAACGAACGAGACC TCGGCCTACTAAATAGTGCGTGGTATGGCAACATAGTRCGTTTTWAACTT CTTAGAGGGACATGTCCGGTTTACGGGCAGGAAGTTCGAGGCAATAACAG GTCYGTGATGCCCTTAGATGYTCTGGGCCGCACGCGCGCTACACTGATGG GTTCATCGGGTTTTRATTYYAWTTWWTGGAATTGAGTGCTTGGTCGGAAG GCCTGGCTAATCCTTGGAACGCTCATCGYGCTGGGGCTAGATTTTYGCAA TTATTAATCTCCRACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGC ATTGAATACGTCCCTGCCCTTTGTACACAYCGCCCGTCGCACCTACCGAT TGAACGGTCCGATGAAACCATGGGATGWTTSTGTTTGGATTVATTTTTSG ACAKAGGCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCG TAACAAGGTTTCCGTAGTGA
Example 8. Carotenoid Characterization of the Thraustochytrid-Like Strain G3-1.
[0082] Analysis of the carotenoid content of G3-1 biomass and oil was performed. Carotenoid analysis, performed on biomass from three separate 2L fermentations, demonstrated that strain G3-1 synthesize and stores a small amount of carotenoids with -carotene being the main components (Table 9). This contrasts with other thraustochytrids, in which canthaxanthin is the major carotenoid, but is similar to observations published for other thraustochytrid-like strains (in Lee Chang et al., Biodiscovery of New Australian Thraustochytrids for Production of Biodiesel and Long-Chain Omega-3 Oils.).
TABLE-US-00011 TABLE 9 Summary of carotenoid content for Thraustochytrid-like strain G3-1. Carotenoid Concentration (per Dry weight (g g.sup.1)) Sample - - Day Astaxanthin Zeaxanthin Canthaxanthin Cryptoxanthin Lycopene Echinenone Carotene Replicate 1 1 0 0 0 0 0 0 20.37 7 0 0 0 0 0 0 10.37 9 0 0 5.14 0 0 0 9.26 Replicate 2 1 0 0 0 0 0 0 23.35 7 0 0 0 0 0 0 6.42 9 0 0 0 0 0 0 7.54 Replicate 3 1 0 0 0 0 0 0 10.77 7 0 0 0 0 0 0 4.68 9 0 0 0 0 0.13 0 7.37
Experimental Details
[0083] For the analysis of carotenoids, biomass was extracted using small glass beads and a bead beater, in the presence of chilled acetone: methanol (1:1 v/v) twice, followed by two extractions using hexane. The combined supernatant was dried under nitrogen and re-suspended in acetone with antioxidants (0.5% butylated hydroxyanisole (BHA) and butylated hydroxytolunene (BHT). Analysis was conducted on an Agilent HPLC using a Phenomenex 5 Luna C18 (2) column.
[0084] In summary, through four experiments, which include a single media optimization and three 2 L fermentations, conditions were identified that increased biomass productivity from 0.589 g L.sup.1 h.sup.1 to 0.740 g L.sup.1 h.sup.1, and separately increase TFA synthesis from 0.396 g L.sup.1 h.sup.1 to 0.548 g L.sup.1 h.sup.1. This alone exceed the best published TFA productivity by >80%, which is at 0.301 g L.sup.1 h.sup.1. What is more, within the produced oil DHA production is 0.202 g L.sup.1 h.sup.1 and palmitic acid is 0.264 g L.sup.1 h.sup.1. Our analysis suggests DHA productivity compares favorably to highly optimized thraustochytrid based methods, which when cultured under conditions for the production of high DHA oil, may produce around 0.3 g L.sup.1 h.sup.1.
Example 9. Identifying Key Media Ingredients for G3-1 Biomass and Lipid Accumulation in Different Media Formulations Having Monosodium Glutamate (MSG) as the Defined Organic Nitrogen Source and Evaluation of the Fatty Acid Profile of the G3-1 Lipids Synthesized Under These Conditions.
[0085] Previous examples have showed that G3-1 requires a complex source of nitrogen (soy peptone and yeast extract) to grow and accumulate biomass. However, soy peptone is not only an expensive source of complex organic nitrogen, the use of high concentrations of soy peptone in the media to grow some microalgae strains have led to the synthesis of odd chain saturated fatty acids (particularly C15:0 and C17:0) in the lipid fraction of microalgae cells. For instance, G3-1 cells accumulate 15.1% of its total fatty acids as C15:0, when 20 g soy peptone L-1 were present in the basal media that was used to grow G3-1 (Example 3). To decrease the cost of G3-1 media and to avoid having odd chain saturated fatty acids in the lipid fraction of G3-1 cells a Plackett-Burman experimental design was used to identify key ingredients that support G3-1 cell proliferation and that must be present in a media where the use of soy peptone has been replaced by MSG and yeast extract.
Experimental Details
[0086] A Plackett-Burman design was used to identify the significance of six media ingredients on G3-1 biomass and lipid accumulation. The six media ingredients (independent variables) were tested at a high (+) and a low level () (Table 10). A total of twelve different media compositions for growing G3-1 having different combinations of ingredients were tested in duplicate, as described in Table 11. Based on previous experiments and in order to favor cell proliferation and lipid synthesis, for each of the twelve media compositions tested, the concentration of glucose and sodium chloride (NaCl) were kept at 40 g L.sup.1 and 2, respectively.
[0087] 95 mL of each media tested were made following the combination of ingredients showed in Table 11 and were inoculated with 5 mL aliquots of a G3-1 seed flask. The composition of the media used for the seed flask was 20 g glucose L.sup.1, 30 g yeast extract L.sup.1 and 9 g sea salts L.sup.1.
TABLE-US-00012 TABLE 10 Independent variables and their levels used in the Plackett-Burman design. Code Coded level Variables Xi 1 +1 MSG (g L.sup.1) X1 0 1 Yeast extract (g L.sup.1) X2 0 1 KH.sub.2PO.sub.4 (g L.sup.1) X3 0.1 0.3 Trace element solution (mL L.sup.1) X4 0 1.5 FeCl.sub.3(g L.sup.1) X5 0 5 MgSO.sub.47H.sub.2O(g L.sup.1) X6 0 4
TABLE-US-00013 TABLE 11 Plackett-Burman design matrix. Coded Variable Process variable Run Block X1 X2 X3 X4 X5 X6 X1 X2 X3 X4 X5 X6 1 1 +1 1 +1 1 1 1 1 0 0.3 0 0 0 2 1 +1 +1 1 +1 1 1 1 1 0.1 1.5 0 0 3 1 1 +1 +1 1 +1 1 0 1 0.3 0 5 0 4 1 +1 1 +1 +1 1 +1 1 0 0.3 1.5 0 4 5 1 +1 +1 1 +1 +1 1 1 1 0.1 1.5 5 0 6 1 +1 +1 +1 1 +1 +1 1 1 0.3 0 5 4 7 1 1 +1 +1 +1 1 +1 0 1 0.3 1.5 0 4 8 1 1 1 +1 +1 +1 1 0 0 0.3 1.5 5 0 9 1 1 1 1 +1 +1 +1 0 0 0.1 1.5 5 4 10 1 +1 1 1 1 +1 +1 1 0 0.1 0 5 4 11 1 1 +1 1 1 1 +1 0 1 0.1 0 0 4 12 1 1 1 1 1 1 1 0 0 0.1 0 0 0
[0088] In addition to glucose (40 g L.sup.1), sodium chloride (2 g L.sup.1), yeast extract and MSG, the most significant ingredients (p<0.05) that must be added to the media to favor G3-1 cell proliferation were: MgSO.sub.4.Math.7H.sub.2O (X6), trace elements (X4) and KH.sub.2PO.sub.4 (X3). The highest biomass accumulation (13.20.1 g L.sup.1) was obtained using a media having at least 1 g yeast extract L.sup.1, 1 g MSG L.sup.1, 0.3 g KH.sub.2PO.sub.4 L.sup.1, 1.5 mL L.sup.1, 4 g MgSO.sub.4.Math.7H.sub.2O L.sup.1, 40 g glucose L.sup.1 and 2 g NaCl L.sup.1. FeCl.sub.3 did not show a significant effect (p>0.05) on G3-1 biomass accumulation, so it was eliminated from the media formulation to grow G3-1.
[0089] On the other hand, ANOVA of the lipid accumulation data for each of the medias tested by using the Plackett-Burman design showed that MgSO.sub.4.Math.7H.sub.2O (X6), trace elements (X4) and KH.sub.2PO.sub.4 (X3) had a positive significant effect (p<0.05) on lipid accumulation expressed as total fatty acids (TFA). MSG also had a statistically significant effect on TFA concentration, however its effect on TFA was negative, which means that G3-1 synthesized less lipids when the concentration of MSG in the media was high. This was expected, because low carbon to nitrogen ratios (C/N) affect lipid biosynthesis in G3-1 cells. The best combination of media ingredients to obtain the highest TFA (789 mg g.sup.1) were: at least 1 g yeast extract L.sup.1, 0.3 g KH.sub.2PO.sub.4 L.sup.1, 1.5 mL trace elements L.sup.1, 4 g MgSO.sub.4.Math.7H.sub.2O L.sup.1, 40 g glucose L.sup.1 and 2 g NaCl L.sup.1. In addition to affecting biomass and TFA production, fatty acid profile was also influenced by the different media compositions tested by using the Plackett-Burman design (
TABLE-US-00014 TABLE 12 Fatty acid profile of the intracellular oil of strain G3-1 under different liquid media compositions tested using a Plackett-Burman design. Fatty acids (%) C22:5 C22:6 n-6 n-3 Biomass TFA Run C10:0 C14:0 C15:0 C16:0 C18:0 DPA DHA SFA MUFA PUFA (g/L) (g/Ld) 1 3.2 3.9 3.0 78.0 2.7 1.6 6.0 92.3 0 7.7 0.5 0.02 0.04 2 1.0 4.2 1.9 77.3 1.7 2.3 9.6 87.3 0.2 12.5 3.5 0.2 0.5 3 1.3 5.1 8.1 73.4 1.6 1.5 5.9 92.5 0 7.5 1.3 0.05 0.2 4 0.1 4.8 0.4 51.9 1.1 7.4 32.5 58.9 0.2 41.0 13.2 0.1 3.5 5 0.8 3.9 1.7 73.8 1. 3.3 12.6 83.2 0.3 16.5 3.5 0.1 0.4 6 1.0 6.6 1.1 85.5 2.1 0.5 2.1 97.5 0 2.5 5.8 0.01 0.9 7 0.1 4.4 1.0 53.2 1.1 7.1 31.3 60.4 0.1 39.5 9.4 0.1 2.6 8 0.4 5.2 2.4 76.8 1.5 2.5 9.3 87.6 0.1 12.2 3.3 0.1 0.6 9 0.2 5.6 0.6 67.2 1.3 3.5 18.9 75.5 0.1 24.3 6.2 0.2 1.4 10 1.2 6.2 1.0 87.5 1.9 0.3 1.0 98.6 0.2 1.3 5.9 0.2 0.9 11 3.1 6.1 3.3 82.9 2.0 ND 1.5 98.5 0 1.5 3.1 0.2 0.5 12 1.6 5.9 4.2 80.9 1.6 0.9 3.5 95.6 0 4.4 2.5 0.04 0.4 ND not detectable
Example 10. The Effect of a Complex Nitrogen Source (Yeast Extract), a Simple Organic Nitrogen Source (MSG) and a Simple Inorganic Nitrogen Source (Ammonium Sulfate, (NH4)2SO4) on G3-1 Biomass Accumulation.
[0090] G3-1 cells showed the ability to accumulate biomass in a liquid media lacking soy peptone but having MSG and yeast extract as the simple and complex organic nitrogen sources, respectively. Previous examples described in this document have demonstrated that G3-1 requires high concentrations of complex and simple organic nitrogen in order to accumulate a decent amount of biomass. Formulation of media and development of fermentation strategies to produce high concentrations of oily G3-1 biomass are imperative when developing microalgae fermentation technologies to produce value-added products, such as DHA, protein, carotenoids, etc.
Experimental Details
[0091] In this example, the effect of three different nitrogen sources (yeast extract, MSG and (NH.sub.4).sub.2SO.sub.4) on biomass accumulation by G3-1 were tested by using a two-level full factorial design (2.sup.3). The concentration of the three nitrogen sources (independent variables) were tested at a high (+) and a low level () (Table 13). A total of eight different media compositions for growing G3-1 having different combinations of yeast extract, MSG and (NH.sub.4).sub.2SO.sub.4 were tested in duplicate, as described in Table 14. Based on previous examples and in order to favor cell proliferation, for each of the eight media compositions tested, the concentration of glucose, NaCl, MgSO.sub.4.Math.7H.sub.2O, trace elements solution, KH.sub.2PO.sub.4, K.sub.2HPO.sub.4, CaCl.sub.2 and vitamin B solution were kept at .sub.40 g L.sup.1, 2 g L.sup.1, 4 g L.sup.1, 1.5 mL L.sup.1, 1.6 g L.sup.1, 1.74 g L.sup.1, 0.5 mL L.sup.1 and 1 mL L.sup.1, respectively.
[0092] 95 mL of each media tested were made following the combination of ingredients showed in Table 14 and were inoculated with 5 mL aliquots of pure washed G3-1 cultures.
TABLE-US-00015 TABLE 13 Independent variables and their levels used in the full factorial design (2.sup.3). Code Coded level Variables Xi 1 +1 Yeast extract (g L.sup.1) X1 5 15 MSG (g L.sup.1) X2 1 20 (NH.sub.4).sub.2SO.sub.4 (g L.sup.1) X3 5 10
TABLE-US-00016 TABLE 14 Full factorial 2.sup.3 design matrix and biomass results. Coded Process Variable variable Biomass Run Block X1 X2 X3 X1 X2 X3 (g/L) 1 1 1 1 1 5 1 5 11.5 0.2 2 1 +1 1 1 15 1 5 18.5 0.2 3 1 1 +1 1 5 20 5 29.5 0.6 4 1 +1 +1 1 15 20 5 32.5 0.2 5 1 1 1 +1 5 1 10 10.5 1.0 6 1 +1 1 +1 15 1 10 19.0 0.3 7 1 1 +1 +1 5 20 10 29.8 0.3 8 1 +1 +1 +1 15 20 10 30.7 0.4
[0093] The ANOVA of the biomass data showed that the most statistically significant (p<0.05) nitrogen sources influencing biomass accumulation were: MSG and yeast extract. The interaction between MSG and yeast extract was also significant (p<0.05), which means that, G3-1 cells prefers to uptake MSG first and then start to use yeast extract as the nitrogen source. The highest biomass concentration for this example (32.50.5 g L.sup.1) was obtained when G3-1 was grown in a media having 15 g yeast extract L.sup.1, 20 g MSG L.sup.1 and 5 g (NH.sub.4).sub.2SO.sub.4 L.sup.1 (run 4 Table 14). Run 8 also showed a good accumulation of biomass (30.70.4 g L.sup.1), however this media formulation requires 50% more (NH.sub.4).sub.2SO.sub.4 compared to run 4.
[0094] Based on the results described on this example, media formulations for run 4 and 8 were named VU1 and VU2, respectively, and were selected to develop fermentation processes to obtain two different G3-1 biomass products: (1) oily biomass having at least 60% lipids and 35% C22:6n-3 (DHA) in the triglycerides in the total fatty acids, and (2) biomass having at least 18% true protein in the whole algae biomass. True protein is expressed as the sum of amino acid concentrations in the biomass sample.
Example 11. Production of Omega-3 Rich Oily Biomass.
[0095] VU1 media formulation was selected to carry out a fermentation using a 30 L fermenter to obtain omega-3 rich oily biomass with applications in aquafeed. In this 116.5 h fermentation G3-1 produced 98.4 g L.sup.1 biomass composed of 66.2% TFA and 8% true protein. DHA and palmitic acid constituted 39.4% and 46.1% of TFA, respectively.
Experimental Details
[0096] G3-1 was pre-cultured in Erlenmeyer flasks containing 500 mL of seed flask media (20 g glucose L.sup.1, 5 g yeast extract L.sup.1, 2 g NaCl L.sup.1, 4 g MgSO.sub.4 L.sup.1, 3 mg copper sulfate L.sup.1, 2 mg sodium molybdate L.sup.1, 3 mg zinc sulfate L.sup.1, 2 mg cobalt (II) chloride L.sup.1, 2 mg manganese chloride L.sup.1 and 2 mg nickel sulfate L.sup.1). Flasks were incubated under agitation at 25 C. and 200 rpm for 2 days. After the incubation period, 1 L of the pre-cultured cells were transferred into a 19 L of VU1 media. The composition of VU1 media per liter was: 15 g yeast extract, 20 g MSG, 5 g (NH.sub.4).sub.2SO.sub.4, 40 g glucose, 2 g NaCl, 4 g MgSO.sub.4, 1.6 g KH.sub.2PO.sub.4, 1.75 g K.sub.2HPO.sub.4, 3 mg copper sulfate, 2 mg sodium molybdate, 3 mg zinc sulfate, 2 mg cobalt (II) chloride, 2 mg manganese chloride, 2 mg nickel sulfate, 0.1 g calcium chloride dehydrate, 0.01 g cobalamin, 0.01 g biotin and 2 g thiamin hydrochloride. A batch fermentation was carried out in a 30 L fermenter under the following conditions: 25 C., pH 6.8, aeration at 0.5 VVM with atmospheric air, agitation starting at 357 rpm and reaching 447 rpm. Cells were collected at 10-18 h intervals and the biomass, TFA, DHA and protein were measured. The initial glucose in the media was completely depleted after 24 h of fermentation and at that time the culture was then fed with 75% (w/v) glucose, until 116.5 h when the fermentation was ended. For this fermentation productivity for biomass, TFA and DHA was: 0.84 g L.sup.1 h.sup.1, 0.56 g L.sup.1 h.sup.1 and 0.22 g L.sup.1 h.sup.1, respectively (Table 15,
TABLE-US-00017 TABLE 15 Oil production and fatty acid profile of the intracellular oil of MARA G3-1. Cells were cultured in a 30 L fermenter using VU1 media. Fatty acids (%) C20:5 C22:5 C22:6 Time TFA (n-3) (n-6) (n-3) Biomass TFA Productivity (g/L h) (h) (%) C14:0 C15:0 C16:0 C18:0 EPA DPA DHA (g/L) (mg/g) Biomass TFA DHA C16:0 22 27 2.7 0.6 43.4 1.3 0.3 6.7 42 26 269.5 48 44.1 3.3 0.4 44.5 1.3 0.4 6.7 40.4 57 441.3 72.5 57.7 2.8 0.2 42.4 1.3 0.4 7.3 42.5 87.4 577.3 96 60.6 3.2 0.2 46.7 1.4 0.4 6.7 38.6 96.8 605.9 116.5 66.2 3.1 0.2 46.1 1.4 0.5 6.7 39.4 98.4 662.2 0.84 0.56 0.22 0.26
[0097] The fermentation technology developed to produce G3-1 omega-3 rich oily biomass can easily achieve 15 g/L d productivity in biomass, 66% lipid and >39% DHA in 4.9 days. A biomass with this composition could be used to feed fish in in vivo trials to assess its suitability as a DHA rich aquafeed product for farmed fish.
Example 12. Production of Omega-3 Rich Microalgae Biomass With a Higher Protein Content
[0098] VU2 media formulation was selected to carry out a fermentation using a 30 L fermenter to obtain omega-3 rich biomass high in protein. A biomass product having high DHA and high protein while still containing 30-45% lipids has the potential to be used as an aquafeed product. In this 72 h fermentation G3-1 produced 93.4 g L.sup.1 biomass composed of 43.6% TFA, 47.8% DHA, 36.9% palmitic acid and 18.6% true protein.
Experimental Details
[0099] G3-1 was pre-cultured in Erlenmeyer flasks containing 500 mL of seed flask media (20 g glucose L.sup.1, 5 g yeast extract L.sup.1, 2 g NaCl L.sup.1, 4 g MgSO.sub.4 L.sup.1, 3 mg copper sulfate L.sup.1, 2 mg sodium molybdate L.sup.1, 3 mg zinc sulfate L.sup.1, 2 mg cobalt (II) chloride L.sup.1, 2 mg manganese chloride L.sup.1 and 2 mg nickel sulfate L.sup.1). Flasks were incubated under agitation at 25 C. and 200 rpm for 2 days. After the incubation period, 1 L of the pre-cultured cells were transferred into a 19 L of VU2 media. The composition of VU2 media per liter was: 15 g yeast extract, 20 g MSG, 10 g (NH.sub.4).sub.2SO.sub.4, 40 g glucose, 2 g NaCl, 4 g MgSO.sub.4, 1.6 g KH.sub.2PO.sub.4, 1.75 g K.sub.2HPO.sub.4, 3 mg copper sulfate, 2 mg sodium molybdate, 3 mg zinc sulfate, 2 mg cobalt (II) chloride, 2 mg manganese chloride, 2 mg nickel sulfate, 0.1 g calcium chloride dehydrate, 0.01 g cobalamin, 0.01 g biotin and 2 g thiamin hydrochloride. A batch fermentation was carried out in a 30 L fermenter under the following conditions: 25 C., aeration at 0.5 VVM with atmospheric air, agitation starting at 357 rpm and reaching 370 rpm. Finally, the pH of the culture was kept around 6.2 by using an aqueous solution of ammonium hydroxide. Cells were collected at 6-18 h intervals and the biomass, TFA, DHA and protein were measured. The initial glucose in the media was completely depleted after 22 h of fermentation and at that time the culture was then fed with 75% (w/v) glucose, until 72 h when the fermentation was ended. For this fermentation productivity for biomass, TFA and DHA was: 1.3 g L.sup.1 h.sup.1, 0.57 g L.sup.1 h.sup.1 and 0.27 g L.sup.1 h.sup.1, respectively (Table 16,
TABLE-US-00018 TABLE 16 Oil production and fatty acid profile of the intracellular oil of MARA G3-1. Cells were cultured in a 30 L fermenter using VU2 media. Fatty acids (%) C20:5 C22:5 C22:6 True Time TFA (n-3) (n-6) (n-3) Biomass TFA Productivity (g/L h) protein (h) (%) C14:0 C15:0 C16:0 C18:0 EPA DPA DHA (g/L) (mg/g) Biomass TFA DHA C16:0 (%) 24 17 1.9 0.4 37.1 1.2 0.3 8.2 47.4 27.8 170.4 42 25.8 2.5 0.3 39.6 1.2 0.4 7.7 44.9 54.2 257.8 48 30.2 2.5 0.2 37.7 1.1 0.4 8.0 46.9 62.4 302.2 66 42.7 3.0 0.2 37.3 1.0 0.4 7.5 47.5 86.0 426.6 72 43.6 2.9 0.2 36.9 1.0 0.4 7.6 47.8 93.4 435.6 1.3 0.57 0.27 0.21 18.6
[0100] The fermentation process described in this example produced a G3-1 biomass product not only rich in omega-3 DHA but also with a higher protein content compared to the product described as omega-3 rich oily G3-1 biomass. Growing G3-1 in VU2 media and using an aqueous solution of ammonium hydroxide to control the pH and also to pulse nitrogen into the vessel not only modified the C/N ratio in the fermentation broth but also, favored nitrogen metabolic pathways in the cells which in turn limited the ability of G3-1 to synthesized lipids, improving G3-1 protein content. 31.1 g/L d productivity in biomass, 43.6% lipid, >47% DHA and 18.6% true protein can easily be achieved in 3 days by following the fermentation technology described in this example.
Example 13. Production of G3-1 Biomass Low in Lipids and Enhancement of DHA and EPA (Expressed as Percentage of Total Fatty Acids) by Using Crude Glycerol From Biodiesel Production.
[0101] The potential use of crude glycerol to cultivate oleaginous microorganisms has grown in popularity, essentially to reduce cultivation costs. Simultaneously, the need to valorize glycerol as a co-product of biodiesel has arisen as a result of the biofuel boom. Depending on the feedstock and the process used to produce biodiesel, the contaminants present in crude glycerol vary. The most common ones are methanol and soap, but also high salinity. As a consequence, tons of raw glycerol need to be valorized or classified as industrial waste. The high salinity of crude glycerol has undesired effects on many organism, however, it favors the use of marine microalgae. Fermentation processes based on crude glycerol as the carbon source aiming to obtain higher quantities of value-added metabolites, such as PUFAs, particularly EPA and DHA are the ones with the highest value (Abad and Turon, Mar. Drugs. 13:7275 (2015)). Previous efforts to use crude glycerol in marine microalgae fermentation bioprocesses have focused on the production of high concentrations of intracellular lipids, however, there is little information regarding the use of a fermentation process to delay oil accumulation in oleaginous microorganisms while using crude glycerol as the carbon source. In this example, a crude glycerol feedstock having 1120 g glycerol L.sup.1 was used in combination with a liquid media formulation called VU3 to grow G3-1 under heterotrophic conditions. In this 118.5 h fermentation G3-1 produced 61.7 g L.sup.1 biomass composed of 15.6% TFA, 55% DHA, 19.7% palmitic acid and 4.1% EPA.
Experimental Details
[0102] G3-1 was pre-cultured in Erlenmeyer flasks containing 250 mL of seed flask media (20 g glucose L.sup.1, 5 g yeast extract L.sup.1, 2 g NaCl L.sup.1, 4 g MgSO.sub.4 L.sup.1, 1 g MSG L.sup.1, and 3 mg copper sulfate L.sup.1, 2 mg sodium molybdate L.sup.1, 3 mg zinc sulfate L.sup.1, 2 mg cobalt (II) chloride L.sup.1, 2 mg manganese chloride L.sup.1 and 2 mg nickel sulfate L.sup.1). Flasks were incubated under agitation at 25 C. and 200 rpm for 2 days. After the incubation period, 0.14 L of the pre-cultured cells were transferred into 1.26 L of VU3 media. The composition of VU3 media per liter was: 2 g yeast extract, 5 g MSG, 10 g (NH.sub.4).sub.2SO.sub.4, 66 g crude glycerol, 2 g NaCl, 4 g MgSO.sub.4, 1.6 g KH.sub.2PO.sub.4, 1.75 g K.sub.2HPO.sub.4, 3 mg copper sulfate, 2 mg sodium molybdate, 3 mg zinc sulfate, 2 mg cobalt (II) chloride, 2 mg manganese chloride, 2 mg nickel sulfate, 0.1 g calcium chloride dehydrate, 0.01 g cobalamin, 0.01 g biotin and 2 g thiamin hydrochloride. A batch fermentation was carried out in a 2 L fermenter under the following conditions: 25 C., aeration at 1 VVM with atmospheric air, agitation starting at 550 rpm and reaching 710 rpm. During the first 65.75 h of fermentation the pH of the culture was kept around 6.16-6.26 by using an aqueous solution of ammonium hydroxide. Then the ammonium hydroxide solution was swapped by 5 M NaOH to keep the pH around 6.05 up to 188.5 h of fermentation. Cells were collected at 6-18 h intervals and the biomass, TFA, palmitic acid, DHA and EPA were measured. The initial glucose in the media was completely depleted after 40 h of fermentation and at that time the culture was then fed with 1120 g crude glycerol L.sup.1, until 188.5 h when the fermentation was stopped. At the end of the process productivity for biomass and TFA was 0.33 g L.sup.1 h.sup.1 and 0.05 g L.sup.1 h.sup.1. On the other hand, DHA and EPA content (expressed as % of TFA) was 55% and 4.1%. In previous examples G3-1 has shown a poor ability to accumulate EPA in its lipid fraction with contents ranging from 0.5 to 1% of TFA when glucose was used as the carbon source, however under the conditions described in this example, the amount of EPA synthesized by G3-1 was 3 times higher (Table 17,
TABLE-US-00019 TABLE 17 Oil production and fatty acid profile of the intracellular oil of MARA G3-1. Cells were cultured in a 2 L fermenter using VU3 media and crude glycerol as the carbon source. Fatty acids (%) C20:5 C22:5 C22:5 C22:6 Time TFA C18:1 (n-3) (n-6) (n-3) (n-3) Biomass TFA Productivity (g/L h) (h) (%) C14:0 C16:0 C18:0 oleic EPA DPA DPA DHA (g/L) (mg/g) Biomass TFA DHA C16:0 40.5 17.9 2.0 30.8 1.1 0.2 0.8 9.5 0.3 51.7 36.9 178.7 65.75 12.4 1.0 20.8 0.7 0.2 2.8 11.6 0.8 58.8 27.8 124.2 92.50 13.3 1.6 24.1 0.8 0.7 3.5 10.9 1.0 53.0 47.6 132.7 113.5 14.4 1.4 22.6 0.8 1.1 3.8 11.0 1.1 53.2 53.9 143.5 137 15.1 1.3 21.7 0.8 1.2 4.0 11.1 1.2 53.6 57.4 151.0 163.75 15.1 1.2 20.3 0.8 1.2 4.1 11.4 1.3 54.6 59.8 151.3 188.5 15.6 1.2 19.7 0.8 1.2 4.1 11.5 1.4 55.0 61.7 155.9 0.33 0.05 0.03 0.01
[0103] 74.5 mL of an ammonium hydroxide solution were pulsed into the 2 L vessel during the first 65.75 h of fermentation. From 65.75 h to 188.5 h the ammonium hydroxide solution was swapped for a solution of NaOH 5 M to keep pH around 6.05 and push G3-1 cells to accumulate lipids. As seen on Table 17 pulsing nitrogen in the form of ammonium hydroxide helped to increase the biomass content, however, swapping ammonium hydroxide solution for NaOH 5 M and keeping the fermentation running for an extra five days did not favor lipid accumulation in G3-1 cells. G3-1 cells uptake nitrogen in the form of ammonium hydroxide but it seems that catabolism of ammonium hydroxide interferes with the lipid biosynthesis pathways in G3-1. On the other hand, not only ammonium sulfate but the crude glycerol used as a carbon feedstock could have stressed G3-1 cells. The crude glycerol used in the present example, contains 0.8% methanol and a high salinity, these impurities act as stress factors even for marine microalgae that can tolerate high salinity environments. It has been reported that abiotic stress often causes amino acids, which serve as potential stress mitigators, to accumulate. In addition to being the building blocks of proteins, amino acids serve as the precursors of N-containing molecules such as nucleic acids, polyamines, quaternary ammonium compounds, and some hormones. Under environmental stress, de novo protein synthesis is generally inhibited and protein turnover and proteolytic activity are increased, resulting in an increase of total free amino acids. N and C metabolisms are closely connected; N assimilation and amino acid biosynthesis require reducing equivalents from carbon metabolism (e.g., glucose, glycerol, etc.) and C skeletons from the tricarboxylic acid (TCA) cycle (Chen et al., Biotechnol. Biofuels 10:153 (2017)). At the end of the fermentation (e.g., at 188.5 h) G3-1 cells accumulated 15.6% of intracellular lipids (Table 17) even though G3-1 cells consumed 160.5 g of crude glycerol. It seems that the energy and C skeletons generated from the crude glycerol metabolism were not used for lipid accumulation but were redirected to different metabolic pathways in G3-1 cells.