Tobamovirus resistant <i>Solanaceae </i>plant

11659806 · 2023-05-30

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are plants belonging to the family of the Solanaceae such as plants of the genus Petunia and/or Calibrachoa and especially to Petunia plants which plants are resistant to the plant pathogen Tobamovirus amongst which the plant pathogens Tobacco mosaic virus, Tomato mosaic virus, Tobacco mild green mosaic virus and Pepper mild mottle virus. Further provided herein are methods for identifying Tobamovirus resistant plants of the Solanaceae family. Specifically, the present invention relates to plants belonging to the Solanaceae family, which plants are resistant to Tobamovirus and which plants comprise in its genome SEQ ID No. 1 and/or SEQ ID No. 3.

Claims

1. A plant selected from the group consisting of Petunia alpicola, Petunia axillaris, Petunia bajeensis, Petunia bonjardinensis, Petunia exserta, Petunia guarapuavensis, Petunia inflata, Petunia integrifolia, Petunia interior, Petunia ledifolia, Petunia littoralis, Petunia mantiqueirensis, Petunia occidentalis, Petunia patagonica, Petunia reitzii, Petunia riograndensis, Petunia saxicola, Petunia scheideana, Petunia villadiana, Petunia violaceae and hybrids thereof, wherein said plant is resistant to Tobamoviruses and comprises in its genome SEQ ID No. 1 and SEQ ID No. 3, and wherein said resistance is semi-dominant Tobamovirus resistance as found in deposit NCIMB 42982.

2. The plant according to claim 1, wherein said plant is Petunia hybrida.

3. The plant according to claim 1, wherein said plant was deposited under accession number NCIMB 42982.

4. The plant according to claim 1, wherein the resistance to Tobamovirus is selected from one or more of the group consisting of Tobacco mosaic virus resistance, Tomato mosaic virus resistance, Tobacco mild green mosaic virus resistance, and Pepper mild mottle virus resistance.

5. The plant according to claim 1, wherein the resistance to Tobamovirus is Tobacco mosaic virus resistance.

6. The plant according to claim 1, wherein said plant does not comprise in its genome SEQ ID No. 2 and/or SEQ ID No. 4.

7. The plant according to claim 1, wherein said plant is a Petunia hybrida and said Tobamovirus is Tobacco mosaic virus.

8. The plant according to claim 1, wherein said Tobamovirus resistance is encoded by a semi-dominant gene homozygously present in said plant.

9. A method for identifying a Tobamovirus resistant plant, comprising detecting the presence of SEQ ID No. 1 and SEQ ID No. 3 in the genome of said plant, wherein said plant is selected from the group consisting of Petunia alpicola, Petunia axillaris, Petunia bajeensis, Petunia bonjardinensis, Petunia exserta, Petunia guarapuavensis, Petunia inflata, Petunia integrifolia, Petunia interior, Petunia ledifolia, Petunia littoralis, Petunia mantiqueirensis, Petunia occidentalis, Petunia patagonica, Petunia reitzii, Petunia riograndensis, Petunia saxicola, Petunia scheideana, Petunia villadiana, Petunia violaceae, and hybrids thereof.

10. The method according to claim 9, wherein said method further comprises detecting the absence in the genome of said plant of SEQ ID No. 2 and/or SEQ ID No. 4.

11. The method according to claim 9, wherein said detecting comprises nucleic amplification and subsequent analysis of the amplification products.

12. The method according to claim 9, wherein the resistance to Tobamovirus to be identified is selected from one or more of the group consisting of Tobacco mosaic virus resistance, Tomato mosaic virus resistance, Tobacco mild green mosaic virus resistance, and Pepper mild mottle virus resistance.

13. The method according to claim 9, wherein said plant is Petunia hybrida and said Tobamovirus is Tobacco mosaic virus.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The present invention will be further detailed in the following example. In the example, reference is made to figures wherein:

(2) FIG. 1: shows symptoms of TMV infection. −) no lesions on inoculated leaf; +) small local lesions on inoculated leaf; ++) big local lesions, partly black vein; +++) heavy local lesions, veins infected and necrotic leaf; systemic head symptoms showing necrotic spots in top leaf, mosaic pattern; curling of the top leaves;

(3) FIG. 2: shows the proportion of plants with ELISA positive results 2 weeks after inoculation (2WAI) in bio-assay 2 as function of temperature for the TMV-A isolate and TMV-U isolate separately. F1 genotypes were grouped based timing of TMV detection by ELISA in bio-assay 1;

(4) FIGS. 3A-3B: show graphs showing the number of ELISA negative and ELISA positive plants for each of the 20 most significantly associated SNP on the SNP chip with a unique segregation pattern in population 1. Results are ordered from left to right and top to bottom based on a decreasing order of the strength of their association in the marker-trait analysis.

DETAILED DESCRIPTION

EXAMPLE

(5) Introduction

(6) The present example discloses the number, effect sizes and genetic positions of quantitative trait loci (QTLs) underlying TMV resistance in a segregating diploid F1 population of Petunia hybrida. Disclosed is a major effect QTL on one linkage group, indicative of a monogenic inheritance. The association with resistance was strong, as 70% of all individuals of one genotype were tested negative for systemic TMV infection using ELISA 2 weeks after inoculation (2WAI) and 98% of individuals carrying the other susceptible genotype were tested positive for TMV infection 2 WAI. The quantitative resistance is temperature dependent, such that resistance is higher when plants are maintained at lower temperatures (21° C.) than at higher temperatures (31° C.).

(7) Methods

(8) Population Development

(9) Two cuttings of accession TT-0115 were tested for TMV resistance using mechanical inoculation. One cutting did show clear symptoms and was tested positive 5 weeks after inoculation. The other cutting was symptomless 7 weeks after inoculation. A mother plant was established and coded TT15-001414-001. Four cuttings from this mother plant were again inoculated and remained symptomless for 5 weeks, confirmed with negative ELISA results.

(10) New cuttings from the mother plant were used as parent for crosses with two susceptible varieties: TT07-005643-044 and TT08-003356-033.

(11) Bio-Assays

(12) Bio-Assay 1: Screening of the Mapping Populations

(13) Fresh cuttings taken from mother stock plants derived from F1-plants derived from above mentioned crosses were stuck in coconut peat plugs and grown for two weeks for root establishment. Five cuttings were stuck, of which four were inoculated and one was used as negative control. Cuttings were rooted in 28-well trays for 2 weeks, with one label for each four plants for the inoculated material. Control plants were labelled individually. One week after transplanting to 10 cm pots, plants were inoculated with TMV-A. Nicotiana rustica, an experimental host for TMV, was used as control plant to confirm infectiousness of the TMV inoculum used. Greenhouse conditions were 20° C./18° C. D/N with day length of 14 hours. F1-population size was 208 and 295 for ♀ TT15-001414-001×♂ TT07-005643-044 (as well as the reciprocal cross, hereafter referred to as Population 1) and TT15-001414-001×TT08-003356-033 (as well as the reciprocal cross, hereafter referred to as Population 2), respectively. Seven susceptible genotypes (including both susceptible parents), resistant parent and resistant grand-parent were used as references.

(14) The original source of TMV was an infected Petunia 1820 found in 2012 in a greenhouse in the Netherlands. The virus was maintained in-house on susceptible Petunia 1820. The isolate was named TMV-A. Leaves from infected inoculum plants were collected and ground together with inoculation buffer (NaH.sub.2PO.sub.4) Filtered inoculum was kept on ice during inoculation.

(15) Prior to inoculation, carborundum powder was dusted onto the leaves of the plants. Plants were inoculated by dipping a finger (with gloves) into inoculum and rubbing two fully expanded leaves 5-7 times each. After each leaf, finger was dipped again in the inoculum.

(16) Two weeks after inoculation (WAI), plants were phenotypically scored, using two visual scoring scales. The inoculated leaves were scored based on their local lesions in four different classes and top part of the plant was scored based on presence of systemic head symptoms and curling of top leaves (FIG. 1). After visual screening, plants were sampled for serological tests using ELISA. For this test, 4 plants of each genotype were bulked and tested as one sample. There were four possible outcomes of a serological ELISA test based on the OD.sub.405NM-values, which were corrected for the negative controls (Table 1).

(17) TABLE-US-00001 TABLE 1 Overview of the how ELISA scores are classified based on OD.sub.405NM- values corrected for blanked data. Negative <0.100 Inconclusive 0.101-0.200 Positive >0.200 No result No result

(18) Four (Pop 2) and five weeks (Pop 1) after inoculation, plants were scored again for head symptoms and sampled for ELISA testing. For each genotype that was tested negative by ELISA, one plant was kept for a prolonged assay which was maintained until 27 weeks after sticking or discarded earlier when tested positive by ELISA. All resistant and susceptible references that were included in the bio-assay were also kept if plants were still sufficiently viable. Plants were trimmed and potted in 13 cm pots. Nine (Pop 2) and ten weeks (Pop 1) after inoculation, individual plants were scored again for head symptoms and positive plants were discarded. Symptomless plants were inoculated again, using the same method as the initial inoculation method.

(19) The plants were scored for local lesions on inoculated leaves and on head symptoms 2 weeks after re-inoculation. Plants were tested for the presence of viral antigen using ELISA 2 times, namely 17 WAI and 22 WAI.

(20) Bio-Assay 2: Determining the Effect of Temperature on TMV Resistance

(21) After initial phenotyping, a trial was performed to assess temperature-dependency of resistance. Genotypes from 4 different groups of pop 2 were used: 1) Positive ELISA 2 WAI; 2) positive ELISA 17 WAI; and 3) ELISA negative throughout the experiment (N=15, 3, 16 and 9 genotypes respectively). The resistant grandparent (TT-0115), the resistant parent (TT15-001414-001) and the susceptible parent (TT08-003356-033) were included as controls. Two day/night temperature regimes were applied: 21° C./19° C. and 31° C./25° C. Two TMV isolates were used, the original Petunia isolate (TMV-A) and one isolated from tomato (TMV-WU). For each temperature/TMV isolate combination, two plants per genotype were inoculated. In each temperature regime, there was a mock-inoculated control plant for each genotype. Each plant was individually labeled, scored and sampled.

(22) Plants were scored with same scoring scale mentioned above (FIG. 1) and were sampled two and four weeks after inoculation on an individual basis.

(23) 2 WAI ELISA was performed and data coded as 1 for ELISA negative and 0 for ELISA positive was analyzed in a mixed model using the glmmPQL function in the R package MASS. Fixed effects included in the model were temperature, resistance grouping in bio-assay 1 and virus isolate. Pedigree Item was fitted as a random effect to take into account the repeated measures for each genotype and a binomial error structure was used.

(24) Prior Art Screening

(25) SEQ ID Nos disclosed in WO 2007/097574 and a panel consisting of the resistant source and 3 Petunia genotypes that were tested ELISA positive for TMV and/or ToMV were tested. Two PCR reactions were performed for two separate primer pairs. The first reaction was run using disclosed Seq ID 6 and Seq ID 8, and the second was run using disclosed Seq ID 9 and Seq ID 10. Red pepper was used as a positive control. If resistance in the present plants would correspond with the disclosure of WO 2007/097574 fragment length of the amplicons would differ between the resistant and susceptible Petunia accessions.

(26) Linkage Mapping

(27) All F1 plants and their parents were genotyped using a custom-made 45K Affymetrix SNP array containing 45,000 single nucleotide polymorphisms (SNP). For each parent, two replicates were genotyped. Quality control was performed as follows. First, only SNPs with Affy calls PHR_notPassingPSgenotypes and notPHR_notPassingPSgenotypes were retained. Then, using the check.marker function in GenABEL, loci with call rate <90%, SNPs that segregated 100% identically with another SNP and individuals with call rate <95% were removed. Individuals showing identical-by-state >99% were also removed. The resulting dataset consisted of 1,565 SNP and 920 markers for population 1 and population 2 respectively.

(28) Subsequently, a linkage map was constructed using the R package onemap for population 1 only. Only SNP markers that segregated AB×AA (source heterozygous, susceptible parent homozygous) or segregated AB×AB (both parents heterozygous) were used and prior to linkage mapping SNPs that showed Mendelian errors or severe segregation distortion (P<0.000000005) were also excluded.

(29) SNP markers were assigned to linkage groups using the group function, with LOD scores of 30 and maximum recombination frequencies of 0.4. Within linkage groups, SNP markers were ordered with the record function (LOD=10, max. rf=0.4) and the Kosambi mapping function was used. Subsequently, SNP markers that were excluded prior to linkage mapping due to their co-segregation with other SNPs were given the same linkage groups and positions.

(30) Association Mapping

(31) 2 WAI ELISA results were used as a proxy for TMV resistance and were modelled using a binomial error distribution in both populations independently. Plants with inconclusive ELISA results were omitted from the analysis. First, the proportion of phenotypic variance explained by all SNP markers that passed quality control (QC) was analyzed using the polygenic function in GenABEL with weight set to “no”. Second, residuals from this model were analyzed using the qtscore function.

(32) Marker Validation, Fine Mapping and Germplasm Screen

(33) For unique contigs spanning the QTL region, SNPs were mined that were heterozygous in the source and homozygous in all other accessions for which genome or transcriptome sequence data was available. KASP assays were designed for 24 SNP markers which were found on 17 contigs (shown in Table 2). These were run on the parents and 84 F1 plants to confirm the parental genotypes and expected segregation pattern. SNPs that did fulfill these criteria were then run on a total of 464 individuals, 195 individuals from pop 1 and 269 individuals from pop 2. The strength of the association was tested with ELISA results using Chi-square tests. 145 diverse accessions were screened representing the genetic diversity present in Petunia cultivars using the 7 most significantly associated SNPs using KASP assays.

(34) TABLE-US-00002 TABLE 2 Primers used for KASP assays of SNPs significantly associated with TMV resistance in the Petunia F1 population. The haplotype targeted by each forward  primer is shown, as well as the flanking sequence  surrounding the SNP. The haplotype marked in bold  targets the resistant haplotype. Contig No. and Primer Targeted set Nr Contig/SNP Primer haplotype Primer sequence Set 1 >PET_T310214|C62940_5790 18-0001 - Rev1 T AAGCCAAATTGTCCAACTACTCAGT (SEQ ID No. 2) 18-0002 - Rev2 C GCCAAATTGTCCAACTACTCAGC (SEQ ID No. 1) 18-0003 - Fw ATTCCAATAACCTCAGCAACACTG (SEQ ID NO: 5) Set 2 >PET_T36154|C53573_29679 18-0004 - Fw1 C CTCTGATCGTACCTGTTTCTTCGTC (SEQ ID No. 4) 18-0005 - Fw2 T CTCTGATCGTACCTGTTTCTTCGTT (SEQ ID No. 3) 18-0006 - Rev ACCTGTGAAGATAAAARTTAAGAAT AGCAC (SEQ ID No. 6)

RESULTS

(35) Results Bio-Assay 1

(36) Phenotyping was done two weeks after first inoculation (2 WAI), with sampling for ELISA in the same week. ELISA results for 2 WAI are presented in Table 3. Plants that were tested negative and inconclusive were re-inoculated and further ELISA tests were done. For population 1 this resulted in 65 plants and for population 2 there were 83 plants tested using ELISA 13 WAI of which 53 and 74 tested ELISA negative, respectively (Table 4).

(37) All plants tested negative and inconclusive at 13 WAI were tested again four weeks later (17 WAI). In pop one 19 out of 57 did test negative and 37 out of 77 did test negative in pop 2 (Table 5). The last ELISA test was 22 WAI. For population one 12 plants were still tested ELISA negative and for population two 18 plants remained negative (Table 6)

(38) TABLE-US-00003 TABLE 3 ELISA results of plants sampled two weeks after inoculation (2 WAI). Four plants of each genotype were bulked and tested as one sample. Population 1 208 115 69 17  7 Population 2 295 176 78 18 23 *OD.sub.405NM > 0.2 during the ELISA **OD.sub.405NM < 0.1 during the ELISA ***Inconclusive: OD.sub.405NM between 0.101 and 0.2 during the ELISA ****Plants were too small to inoculate and/or sampled for ELISA testing

(39) TABLE-US-00004 TABLE 4 ELISA results of plants sampled 13 WAI. Population 1 65 10 53 2 Population 2 83  8 74 1

(40) TABLE-US-00005 TABLE 5 ELISA results of plants sampled 17 WAI. Plants have been repotted 10 WAI and re-inoculated 14 WAI. Population 1 57 34 19 4 Population 2 75 36 37 2

(41) TABLE-US-00006 TABLE 6 ELISA results of plants sampled 22 WAI. Plants have been repotted 10 WAI and re-inoculated 14 WAI. Population 1 22 10 12 Population 2 39 19 18 2
Results Bio-Assay 2

(42) Two weeks after inoculation no difference was observed between 21° C. and 31° C. ELISA results in the susceptible group tested with the TMV-A isolate (Table 7). Almost all of the genotypes that scored positive for the ELISA 2WAI in bio-assay 1, did score positive two weeks after inoculation in bio-assay 2 and no difference between the temperature treatments or isolates was observed. However, in the groups that showed first ELISA positive results 17WAI or showed no ELISA positive results throughout the experiment of bio-assay 1, the proportion of individuals with ELISA positive results was higher at higher temperatures, indicating that resistance did not hold up in time at higher temperatures. Overall, resistance was significantly lower at 31° C. than at 21° C. (Table 7, Table 8, and FIG. 2).

(43) There was also a significant difference in plant response to TMV-A isolate (used in population screening) and TMV-WU isolate. The TMV-A isolate, which was used to inoculate the populations used for QTL mapping, showed to be able to infect more plants at both temperatures (Tables 7 and 8). Overall, using the TMV-A isolate, the proportion of F1 individuals with a single copy of the resistance allele with ELISA negative results 2WAI decreased from 75% at 21° C. to 62% at 31° C. Using the TMV-WU isolate, a substantially smaller decrease in resistance was observed in the heterozygous F1 plants (21° C.: 93% ELISA negative 2WAI; 31° C.: 92% ELISA negative 2WAI), though the interaction between temperature and isolate was not significant (results not shown).

(44) TABLE-US-00007 TABLE 7 ELISA results on individual plants for the heat dependent resistance experiment, sampled 2 weeks after inoculation (2 WAI). Summary statistics of the proportion of plants with ELISA negative results for low (21° C.) and high temperatures (31° C.) are presented for the TMV-A and TMV-WU isolates separately. 21° C. 31° C. 21° C. 31° C. Proportion Proportion Proportion Proportion Grouping ELISA ELISA ELISA ELISA based on Bio- negative negative negative negative assay 1 Genotypes Sample size 2 WAI 2 WAI 2 WAI 2 WAI ELISA 15 30 0.03 0 0.2 0 positive 2 WAI ELISA 16 32 0.63 0.41 0.91 0.94 positive 17 WAI ELISA 9 18 0.94 0.61 0.89 1 negative throughout the exp

(45) TABLE-US-00008 TABLE 8 Parameter estimates of a mixed model analyzing 2WAI ELISA results as a function of temperature, virus isolate and ELISA results in bio-assay 1. Water controls were excluded from this analysis. The model shows that expression of resistance is negatively affected by temperature and that it can be influenced by the virus isolated used as well. Positive parameter estimates indicate an increased level of resistance (2WAI negative results using ELISA). Para- Stan- Degrees meter dard of T- Estimate Error Freedom value P (Intercept) −1.87 1.03 262 −1.82 0.070 Temperature −0.13 0.03 262 −3.68 <0.0001 Isolate 2.96 0.46 262 6.49 <0.0001 TMV-WU ELISA 5.57 0.76 37 7.37 <0.0001 positive 17 WAI ELISA 7.25 0.93 37 7.78 <0.0001 negative
Confirmation that the Source of Resistance is not Disclosed in WO 2007/097574

(46) For the PCR using primers Seq ID 6 and Seq ID 8, no difference in fragment length was observed between the resistant accession and the susceptible accessions. A PCR with primers Seq ID 9 and Seq ID 10 yielded no amplification in any of the Petunia samples. Fragments were observed for both primer pairs in red pepper. This unequivocally establishes that the present source of resistance is not disclosed in WO 2007/097574.

(47) Linkage Mapping

(48) A total of 1,064 uniquely segregating SNP were assigned to 16 linkage groups. Adding co-segregating SNPs to the map resulted in a linkage of 5635 segregating SNPs. Adding SNPs that were present on the SNP chip but omitted after QC resulted in a total of 10973×SNPs on 4572 unique contigs. A total of 8 LGs contained more than 200 SNPs, and the remaining linkage groups contained less than 40 SNPs.

(49) Association Mapping

(50) ELISA results (viral antigen presence) were highly heritable in population 1, as 90% of phenotypic variance was explained by SNPs. Genomic heritability was slightly lower in population 2 as 67% of phenotypic variance was explained by genotyped SNPs which can be explained by the substantially lower amount of SNPs passing quality control. The most significantly associated SNPs were all found on LG 6, and the distribution of P values showed a steep unimodal shape indicating that there is likely a single QTL affecting TMV resistance.

(51) The contig containing the SNP that showed the strongest association was shared between population 1 and 2, corroborating the results obtained in population 1 alone.

(52) The most significant SNP (positioned at 80.3 cM on LG 6) exhibited 2 genotype classes in population 1 and 71.6% of individuals with one genotype were ELISA negative, while 96.7% of individuals with the other genotype were ELISA positive. The predictive power of other SNPS was weaker, as expected based on their lower P values (FIG. 3).
Validation with KASP Assays and Fine-Mapping

(53) For 19 out of the 24 KASP assays that were designed clearly separated clusters were observed and could genotypes be called confidently. In total 464 F1 plants (of which 430 with clear TMV ELISA data and 34 with inconclusive ELISA results) were genotyped at these 19 SNPs using KASP assays: 195 individuals from population 1 and 269 individuals from population 2. 36 F2 plants were also tested to screen for individuals carrying homozygous resistant haplotypes. Three individuals with homozygous resistant haplotypes were found, which were used as additional samples to improve genotype calling. The parents from both populations were used as control samples as well as TT-0115, the resistant grandparent of the F1 populations. In all KASP assays, the resistant parent and grandparent (TT15-001414-001 and TT-0115 respectively) scored heterozygous and the susceptible parents (TT07-005643-044 and TT08-00356-033) homozygous for the susceptible haplotype.

(54) Call rate varied between KASP assays, but for each SNP between 406 up to 423 F1 plants with 2WAI ELISA data were successfully genotyped. When looking at the association between KASP genotypes and 2WAI ELISA results (viral antigen presence) an accuracy was found for predictive resistant genotypes between 58 and 66% and for susceptible genotypes between 95 and 98% (Table 9).

(55) Overall, PET_T36154|C53573_29679 (at 79.584 cM) has the highest predictive power when predicting resistance across both F1 populations (65.8% of plants with the resistant genotype were ELISA negative), as well as when it comes to susceptibility (97.5% of F1 plants with susceptible genotype were ELISA positive, results shown in Table 9). This SNP was also most strongly associated with 2WAI ELISA results (logistic regression, P=1*10.sup.−42) closely followed by PET_T310214|C62940_5790 at 75.931 cM (P=2.84*10.sup.−42). Other SNPs were substantially less significantly associated, confirming the linkage map positions, and indicating that these two SNPs are likely flanking the causal gene (Table 9). The distance between PET_T36154|C53573_29679 and PET_T310214|C62940_5790 is only 3.6 cM using the linkage map genetic distance which means that either marker is in closer proximity than 1.8 cM from the causal gene

(56) TABLE-US-00009 TABLE 9 Results for the association between 2 WAI ELISA (presence of viral antigen) and individual SNPs in the QTL region using KASP assays. Genotype data from both population 1 and 2 were combined for the analyses. P values were obtained by fitting a logistic regression with ELISA results 2 WAI as a binary response variable and SNP genotype as a dependent variable. Row values represent: position (cM), Predictive accuracy resistant phenotype, Predictive accuracy resistant phenotype, sample size and P-value. SNP identifier PET_ PET_ PET_ PET_ PET_ PET_ PET_ PET_ PET_ PET_ T313921| T34820| T32405| T318744| T34003| T342254| T32747| T310214| T36154| T38438| C33345_ C40921_ C77170_ C15244_ C163871_ C2660_ C57711_ C62940_ C53573_ C65290_ 11403 6318 70332 14222 61706 1649 6706 5790 29679 10905 71.79 72.43 73.72 73.72 74.05 74.05 74.53 75.93 79.58 80.30 0.639 0.637 0.643 0.585 0.638 0.646 0.643 0.654 0.658 0.652 0.955 0.955 0.960 0.960 0.964 0.965 0.960 0.975 0.975 0.970 357 356 356 356 356 356 356 356 356 356 1.68E−36 2.48E−36 2.33E−37 1.71E−37 2.63E−38 3.64E−39 6.21E−38 2.84E−42 1.00E−42 6.68E−41 PET_ PET_ PET_ PET_ PET_ PET_ PET_ PET_ PET_ T38438| T39109| T39109| T39109| T33755| T33755| T327258| T35302| T35205| C65290_ C61248_ C61248_ C61248_ C82570_ C82570_ C21443_ C48674_ C39805_ 4524 47335 42383 40929 24205 47754 16338 26268 21235 80.30 80.98 80.98 80.98 80.98 80.98 82.72 82.72 91.47 0.642 0.642 0.642 0.642 0.619 0.642 0.631 0.631 0.615 0.969 0.964 0.964 0.964 0.965 0.964 0.949 0.949 0.949 355 356 356 356 356 356 355 355 356 7.38E−40 9.84E−39 9.84E−39 9.84E−39 1.92E−38 9.84E−39 1.43E−34 1.43E−34 3.43E−33

CONCLUSIONS

(57) Disclosed is a single genomic region explaining TMV resistance in Petunia hybrida which is different from WO 2007/097574; Disclosed is a semi-dominant gene, as in conditions where temperatures were not controlled, ca 70% of plants in population 1 and 65.8% across both F1 populations with a single copy of the resistant allele are resistant (as measured by ELISA 2 WAI) and ca 95% of individuals homozygous for the recessive allele are susceptible (positive ELISA results 2 WAI). Disclosed is that resistance is dependent on temperature and virus isolates. Individuals carrying a single copy of the resistant allele are more likely to develop a systemic infection when maintained at 31° C. (23%) than when they are maintained at 21° C. (17%).