Mutant strains of <i>Trichoderma reesei</i>

Abstract

The invention relates to a method for producing a protein in a filamentous fungus cell, comprising the overexpression of the TrAZF1 gene or of one of the variants thereof in said cell.

Claims

1. A method of increasing the expression of a cellulase enzyme in a strain of a filamentous fungus, comprising culturing a strain overexpressing a TrAZF1 gene, and collecting supernatant containing the cellulase enzyme from the strain culture; wherein the strain genome contains a cassette comprising: (a) at least one constitutive promoter which induces overexpression of SEQ ID NO:1 or SEQ ID NO:3 during strain culture; (b) a nucleotide sequence of SED ID NO:1 or SEQ ID NO:3; and (c) optionally, a terminator.

2. The method as claimed in claim 1, wherein the cellulase enzyme is chosen from the group consisting of cellulases and hemicellulases.

3. The method as claimed in claim 1, wherein the filamentous fungus is chosen from the group consisting of orbiliomycetes, pezizomycetes, dothideomycetes, eurotiomycetes, lecanoromycetes, leotiomycetes, sordariomycetes and saccharomyces.

4. A strain of Trichoderma reesei, transformed with a cassette comprising: (a) at least one constitutive promoter; (b) a nucleotide sequence of SED ID NO:1 or SEQ ID NO:3; and (c) optionally, a terminator.

5. The strain of claim 4, wherein said strain expresses a cellulolytic enzyme.

Description

FIGURES

(1) FIG. 1: Representation of the pRS426 plasmid.

(2) FIG. 2: Position of the primers used to verify the presence of the cassette for overexpression of the transformed strains.

(3) FIG. 3: Production of extracellular proteins by the RutC30 strains transformed according to the invention and a RutC30 strain of T. reesei which has not been modified, after 7 days of culture.

(4) FIG. 4: Production of extracellular proteins by the Cl847 strains transformed according to the invention and a Cl847 strain of T. reesei which has not been modified, after 7 days of culture.

(5) FIG. 5: Specific production rate of the Cl847 strain and two transformants under fed flask culture conditions.

EXAMPLES

Example 1: Lactose-Induction Transcriptomic Studies of the Trichoderma reesei Strains ATCC 56767 and ATCC 56765

(6) In this study, the inventors used the following Trichoderma reesei strains: ATCC 56767 (NG14), and ATCC 56765 (RUTC30).

(7) The RutC30 strain is derived by mutagenesis of the NG14 strain and has an increased cellulase production.

(8) The TrAZF1 gene (ID 103275) is a transcription factor (protein involved in the regulation of other genes) identified as differentially expressed during kinetics of induction on lactose (Poggi-Parodi et al. 2014). More specifically, the transcriptomic study shows that the expression of TrAZF1 decreases during induction in the NG14 strain, whereas, in RutC30, its expression does not vary.

Example 2: Construction of an Overexpression Cassette for the TrAZF1 Gene

(9) The overexpression cassette is made up of three DNA fragments: the promoter region of the glyceraldehyde-3-phosphate dehydrogenase gene (GPDp) of T. reesei. The size of the promoter region was defined in the article by Li et al. 2012 (SEQ ID NO: 141); the coding region of the gene of interest (TrAZF1) (SEQ ID NO: 3); the terminator region of the glyceraldehyde-3-phosphate dehydrogenase gene (GPDt) of T. reesei. The size of the promoter region was defined in the article by Li et al. 2012 (SEQ ID NO: 142).

(10) In order to be able to select the transformants, a cassette called HygroR (SEQ ID NO: 143) containing the Hph gene is fused with the overexpression cassette. The Hph gene encodes hygromycin B phosphotransferase responsible for resistance to hygromycin B. It was isolated from Escherichia coli. For the expression of the gene in Trichoderma reesei, the Hph gene is placed under the control of the promoter of the cpc-1 gene of Neurospora crassa (NCU04050) and the terminator of the trpC gene of Aspergillus nidulans (ANID_00648).

(11) The pRS426 plasmid (ATCC 77107) was used as vector for the construction of the deletion cassette via in vivo recombination in S. cerevisiae according to a method based on the literature (Schuster et al. 2012). To do this, the plasmid was digested with EcoRI and XhoI (New England Biolabs) and purified by gel electrophoresis using the QIAquick Gel Extraction Kit (Qiagen). The pRS426 plasmid is represented in FIG. 1.

(12) The parts of primers specific for the TrAZF1 gene of interest were designed on the basis of the ORF prediction in the version v2.0 of the genome (genome.jgi-psf.org/Trire2/Trire2.home.html).

(13) Amplification of the Promoter Region of the Glyceraldehyde-3-Phosphate Dehydrogenase Gene of T. reesei GPDp

(14) The primers used for the amplification of the promoter region GPDp from the DNA of the RutC30 strain are described below: The forward primer consists of two parts: a part of 20 nucleotides (nt) which is a homolog of the pRS426 vector sequence (FIG. 1) in the vicinity of the XhoI restriction site and a part of 20 nt which is homologous to the 5 end of GPDp (SEQ ID NO: 141), the whole forming the sequence SEQ ID NO: 144 (ATTGGGTACCGGGCCCCCCCGACGCAGAAGAAGGAAATCG). The reverse primer consists of two parts: a part of 10 nt homologous to the 5 end of the coding region of the TrAZF1 gene (SEQ ID NO: 3) and a part of 20 nt homologous to the 3 end of GPDp (SEQ ID NO: 141), the whole forming the sequence SEQ ID NO: 145 (CGAGGGCCATTTTGTATCTGCGAATTGAGC).
Amplification of the Coding Region of the TrAZF1 Gene of Interest

(15) The primers used for the amplification of the TrAZF1 gene of interest from the DNA of the RutC30 strain are described below: The forward primer consists of two parts: a part of 10 nt which is a homolog of the 3 end of GPDp (SEQ ID NO: 141) and a part of 20 nt homologous to the 5 coding region of the TrAZF1 gene (SEQ ID NO: 3), the whole forming the sequence SEQ ID NO: 146 (CAGATACAAAATGGCCCTCGCAGCTCAACA). The reverse primer consists of two parts: a part of 10 nt homologous to the 5 end of the GPDt region (SEQ ID NO: 142) and a part of 20 nt homologous to the 3 coding region of the TrAZF1 gene (SEQ ID NO: 3), the whole forming the sequence SEQ ID NO: 147 (AACACAGCACTCAGGATAGGTGGCTCGCAATG).
Amplification of the Terminator Region of the Glyceraldehyde-3-Phosphate Dehydrogenase Gene of T. reesei GPDt

(16) The primers used for the amplification of the terminator region GPDp from the DNA of the RutC30 strain are described below: The forward primer consists of two parts: a part of 10 nt homologous to the 3 end of the coding region of the TrAZF1 gene (SEQ ID NO: 3) and a part of 20 nt homologous to the 5 end of GPDt (SEQ ID NO: 142), the whole forming the sequence SEQ ID NO: 148 (CCTATCCTGAGTGCTGTGTTCCTCAGAATG). The reverse primer consists of two parts: a part of 10 nt homologous to the 5 end of the HygroR cassette (SEQ ID NO: 143) and a part of 20 nt homologous to the 3 end of GPDt (SEQ ID NO: 142), the whole forming the sequence SEQ ID NO: 149 (GGTACACTTGTTACGGATCTGATCACTCGG).
Amplification of the HygroR Cassette

(17) The primers used for the amplification of the HygroR cassette are described below: The forward primer consists of two parts: a part of 10 nt homologous to the 3 end of GPDt (SEQ ID NO: 142) and a part of 20 nt homologous to the 5 end of the HygroR cassette (SEQ ID NO: 143), the whole forming the sequence SEQ ID NO: 150 (AGATCCGTAACAAGTGTACCTGTGCATTCTG). The reverse primer consists of two parts: a part of 20 nt homologous to the pRS426 vector sequence in the vicinity of the EcoRI restriction site and a part of 20 nt homologous to the 3 end of the HygroR cassette (SEQ ID NO: 143), the whole forming the sequence SEQ ID NO: 151 (TGGATCCCCCGGGCTGCAGGGGCAGTGCTAGTGTGTGTAC).

(18) The PCRs carried out using the above primers gave rise to DNA fragments with homologous ends. A competent Saccharomyces cerevisiae strain W303 was transformed with these DNA fragments and also the digested pRS426 plasmid. The pRS426 plasmids containing the overexpression cassette for the TrAZF1 gene and the HygroR cassette were extracted from S. cerevisiae and used as template for PCR amplification of the overexpression cassette fused to the HygroR cassette (SEQ ID NO: 154) using the forward primer (SEQ ID NO: 152) and the reverse primer (SEQ ID NO: 153).

Example 3: Transformation of the T. reesei Strains RutC30 and Cl1847 with the TrAZF1 Overexpression Cassette

(19) The T. reesei RutC30 (ATCC 56765) and Cl847 strains were then transformed with the PCR product (SEQ ID NO 154) (Durand et al., 1988). The transformants were selected on the basis of the Hph selectable marker gene function. The transformants were purified from the colonies resulting from individual spores. The ectopic integration of the cassette was confirmed by three PCR amplifications. The position of the primers used and also the fragments amplified are indicated in FIG. 2. The primers used for the PCRs are described below:

(20) TABLE-US-00002 Primersforverificationamplification1: AforwardprimerintheGPDppromoter (SEQIDNO:155): GTCAGAAACGACCAAGCTAAG. AreverseprimerintheTrAZF1gene (SEQIDNO:156): GCCTGAGAATGGTGTCGATC. Primersforverificationamplification2: AforwardprimerintheTrAZF1gene (SEQIDNO:157): TCGTGGGCCTCAAGATTC. AreverseprimerintheGPDtterminator (SEQIDNO:158): GACGCCTGAGAGGTCCTA. Primersforverificationamplification3: AforwardprimerintheGPDtterminator (SEQIDNO:159): CCTTCTTAGAGAGCTCTCGG. AreverseprimerintheHygroRcassette (SEQIDNO:160): CGGGTTTACCTCTTCCAGAT.

(21) The amplifications were carried out from the genomic DNA of the purified transformants: four transformants were selected for each strain.

Example 4: Culture of the T. reesei Strain RutC30 with the TrAZF1 Overexpression Cassette and Analysis of the Cultures for Protein Production

(22) The spores originating from four transformants of the RutC30 strain which exhibit ectopic integration of the TrAZF1 overexpression cassette were used to inoculate a 24-well culture plate containing 2 ml of culture medium per well.

(23) The medium was composed of K.sub.2HPO.sub.4 8.7 g.l.sup.1; (NH.sub.4).sub.2SO.sub.4 4.2 g.l.sup.1; MgSO.sub.4.7H.sub.2O 0.3 g.l.sup.1; cornsteep 1.5 g.l.sup.1; lactose 10 g.l.sup.1; cellulose 10 g.l.sup.1; maleic acid 11.6 g.l.sup.1; CaCl.sub.2 0.3 g.l.sup.1; FeSO.sub.4.7H.sub.2O 5.0 mg.l.sup.1; MnSO.sub.4.H.sub.2O 1.6 mg.l.sup.1; ZnSO.sub.4.7H.sub.2O 1.4 mg.l.sup.1; CoCl.sub.2.6H.sub.2O 2.0 mg.l.sup.1; pH 6.

(24) The culture was carried out at 30 C. with shaking at 150 rpm, in duplicate.

(25) After 7 days of culture, the supernatant was collected in order to measure the protein concentration in the medium (Folin method). The extracellular-protein production of the cultures is presented in FIG. 3. This figure shows an increase in the protein production for the transformants compared with the unmodified T. reesei strain.

Example 5: Culture of the T. reesei Strain Cl847 with the TrAZF1 Overexpression Cassette and Analysis of the Cultures for Protein Production

(26) The spores originating from four transformants of the Cl847 strain which exhibit an ectopic integration of the TrAZF1 overexpression cassette were used to inoculate a 24-well culture plate containing 2 ml of culture medium per well.

(27) The medium was composed of K.sub.2HPO.sub.4 8.7 g.l.sup.1; (NH.sub.4).sub.2SO.sub.4 4.2 g.l.sup.1; MgSO.sub.4.7H.sub.2O 0.3 g.l.sup.1; cornsteep 1.5 g.l.sup.1; lactose 10 g.l.sup.1; cellulose 10 g.l.sup.1; maleic acid 11.6 g.l.sup.1; CaCl.sub.2 0.3 g.l.sup.1; FeSO.sub.4.7H.sub.2O 5.0 mg.l.sup.1; MnSO.sub.4.H.sub.2O 1.6 mg.l.sup.1; ZnSO.sub.4.7H.sub.2O 1.4 mg.l.sup.1; CoCl.sub.2.6H.sub.2O 2.0 mg.l.sup.1; pH 6.

(28) The culture was carried out at 30 C. with shaking at 150 rpm, in duplicate.

(29) After 7 days of culture, the supernatant was collected in order to measure the protein concentration in the medium (Folin method). The extracellular-protein production of the cultures is presented in FIG. 4. This figure shows an increase in the protein production for the transformants compared with the unmodified T. reesei strain.

Example 6: Culture of the T. reesei Strain Cl847 with Overexpressed AZF1 in Fed Flasks and Analysis of the Cultures for Protein Production and Growth

(30) A culture of two transformants of the T. reesei strain Cl847 and also of the non-transformed strain using the cellulase production method described in patent WO 2013/026964 A1. The extracellular-protein production and also the biomass were measured over time in order to obtain a measurement of the specific rate of protein production (protein production per mg of fungal biomass per unit of time, or qP) at the end of the culture. These values are presented in FIG. 5.

(31) The data show improved qP values in the mutants compared with the unmodified T. reesei strain.

LITERATURE

(32) Durand, H., Clanet, M., & Tiraby, G. (1988). Genetic Improvement of Trichoderma reesei for large scale cellulase production. Enzyme and Microbial Technology, 10, 341-346. Li, Junxin; Wang, Juan; Wang, Shaowen; Xing, Miao; Yu, Shaowen; Liu, Gang (2012) Achieving efficient protein expression in Trichoderma reesei by using strong constitutive promoters. In: Microbial cell factories, vol. 11, p. 84. DOI: 10.1186/1475-2859-11-84. Poggi-Parodi, Dante; Bidard, Frdrique; Pirayre, Aurlie; Portnoy, Thomas; Blugeon, Corinne; Seiboth, Bernhard et al. (2014) Kinetic transcriptome analysis reveals an essentially intact induction system in a cellulase hyper-producer Trichoderma reesei strain. In: Biotechnology for biofuels, vol. 7, n 1, p. 173. DOI: 10.1186/s13068-014-0173-z. Schuster, Andr; Bruno, Kenneth S.; Collett, James R.; Baker, Scott E.; Seiboth, Bernhard; Kubicek, Christian P.; Schmoll, Monika (2012) A versatile toolkit for high throughput functional genomics with Trichoderma reesei. In: Biotechnology for biofuels, vol. 5, no 1, p. 1. DOI: 10.1186/1754-6834-5-1. WO09026716 (A1)METHOD FOR CELLULASE PRODUCTION.