CHEMOENZYMATIC SYNTHESIS OF SELENONEINE AND ITS ANALOGS
20250197902 ยท 2025-06-19
Assignee
Inventors
Cpc classification
C12N9/1294
CHEMISTRY; METALLURGY
C12Y207/09003
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
Abstract
Disclosed is a method for forming selenoneine or analogs thereof. The method may include phosphorylating sodium selenide to a selenophosphate, using adenosine triphosphate (ATP) and at least a first protein, generating a selenosugar by converting the selenophosphate using at least a second protein in the presence of a common sugar donor, and forming selenoneine or an analog thereof by combining the selenosugar with N,N,N-trimethyl-L-histidine or analogs thereof using at least a third protein. The method may include combining SenA, SenB, and SenC in an aqueous buffer at neutral pH and ambient temperature, and allowing SenA, SenB, and SenC to form selenoneine or an analog thereof in the presence of ATP, a common sugar donor, and sodium selenide.
Claims
1. A method for forming selenoneine or analogs thereof, the method comprising: phosphorylating sodium selenide to a selenophosphate, using adenosine triphosphate (ATP) and at least a first protein; generating a selenosugar by converting the selenophosphate using at least a second protein in the presence of a common sugar donor; and forming selenoneine or analog thereof by combining the selenosugar with N,N,N-trimethyl-L-histidine or analog thereof using at least a third protein.
2. The method according to claim 1, wherein the common sugar donor is UDP-glucose.
3. The method according to claim 1, wherein the selenosugar is 1-seleno-N-acetyl--D-glucosamine.
4. The method according to claim 1, wherein the first protein is coded by a selD homolog, the second protein is a glycosyltransferase, and the third protein is coded by an egtB homolog.
5. The method according to claim 1, wherein the first protein is SenC, the second protein is SenB, and the third protein is SenA.
6. The method according to claim 1, wherein forming selenoneine or an analog thereof by combining the selenosugar with N,N,N-trimethyl-L-histidine includes forming hercyncyl-SeGlcNAc selenoxide (GlcNAc-SEN=O), and allowing hercyncyl-SeGlcNAc selenoxide (GlcNAc-SEN=O) to spontaneously convert to selenoneine or be reduced to hercynyl-SeGlcNAc seleno-ether (GlcNAc-SEN).
7. The method according to claim 1, further comprising purifying the selenoneine or analog thereof.
8. The method according to claim 1, wherein the first protein, second protein, and/or third protein are fused to an affinity tag.
9. A method for forming selenoneine or an analog thereof, the method comprising: combining SenA, SenB, and SenC in an aqueous buffer at neutral pH and ambient temperature; and allowing SenA, SenB, and SenC to form selenoneine or an analog thereof in the presence of ATP, a common sugar donor, and sodium selenide.
10. A kit comprising: one or more vectors, comprising: a first gene coding for at least SenC; a second gene coding for at least SenB; a third gene coding for at least SenA; optionally adenosine triphosphate; optionally a common sugar donor; optionally sodium selenide; and/or optionally hercynine or an analog thereof.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0011] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the present invention and, together with a general description of the invention given above, and the detailed description of the embodiments given below, serve to explain the principles of the present invention.
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023] It should be understood that the appended drawings are not necessarily to scale, presenting a somewhat simplified representation of various features illustrative of the basic principles of the invention. The specific design features of the sequence of operations as disclosed herein, including, for example, specific dimensions, orientations, locations, and shapes of various illustrated components, will be determined in part by the particular intended application and use environment. Certain features of the illustrated embodiments have been enlarged or distorted relative to others to facilitate visualization and clear understanding. In particular, thin features may be thickened, for example, for clarity or illustration.
DETAILED DESCRIPTION
[0024] The following description and drawings merely illustrate the principles of the invention. It will thus be appreciated that those skilled in the art will be able to devise various arrangements that, although not explicitly described or shown herein, embody the principles of the invention and are included within its scope. Furthermore, all examples recited herein are principally intended expressly to be only for illustrative purposes to aid the reader in understanding the principles of the invention and the concepts contributed by the inventor(s) to furthering the art and are to be construed as being without limitation to such specifically recited examples and conditions. Additionally, the term, or, as used herein, refers to a non-exclusive or, unless otherwise indicated (e.g., or else or or in the alternative). Also, the various embodiments described herein are not necessarily mutually exclusive, as some embodiments can be combined with one or more other embodiments to form new embodiments.
[0025] The numerous innovative teachings of the present application will be described with particular reference to the presently preferred exemplary embodiments. However, it should be understood that this class of embodiments provides only a few examples of the many advantageous uses of the innovative teachings herein. In general, statements made in the specification of the present application do not necessarily limit any of the various claimed inventions. Moreover, some statements may apply to some inventive features but not to others. Those skilled in the art and informed by the teachings herein will realize that the invention is also applicable to various other technical areas or embodiments.
[0026] Disclosed is chemoenzymatic synthesis of selenoneine and its analogs. Disclosed and identified herein are the genes required for selenoneine production in diverse microbes. Using these, a facile, green, cell-free chemoenzymatic synthesis of selenoneine can be shown.
[0027] The disclosed process can be used to generate large amounts of selenoneine and its analogs. The process is green in that it uses enzymes for key transformations rather than harsh chemicals. With this approach, variants of selenoneine may be generated and tested in diverse assays.
[0028] Using a computational approach, microbial genome sequences were searched for possible genes that may be involved in selenoneine biosynthesis. Clusters of 3-5 genes (depending on the organism) were identified, which have been named the sen cluster. It was shown that the sen cluster generates selenoneine using two heretofore unknown carbon-selenium bond-forming reactions. The minimal cluster encodes the enzymes SenA, SenB, and SenC. SenC is a SelD analog; it uses ATP to convert sodium selenide to selenophosphate. Next, SenBa protein belonging to a novel and previously uncharacterized family of enzymes-uses selenophosphate to generate 1-seleno--D-glucose, the first biosynthetic pathway for the production of a selenosugar. Other products include 1-seleno-N-acetyl--D-glucosamine, or 1-seleno-N-acetyl--D-galactosamine. Finally, in another heretofore unknown and unusual reaction, SenA combines the selenosugar (i.e. 1-seleno-N-acetyl--D-glucosamine) with N,N,N-trimethyl-L-histidine to produce selenoneine. SenC, SenB, and SenA were used in a one-pot reaction to complete selenoneine synthesis in vitro in aqueous buffer at neutral pH and ambient temperature.
[0029] In various aspects, a method for producing selenoneine or an analog thereof may be provided. Referring to
[0030] The first protein may be encoded by a selD homolog. As used herein, the term homolog refers to a gene (or a nucleic acid sequences derived therefrom or comprised by said gene) related to a second gene (or such nucleic acid sequence) by descent from a common ancestral DNA sequence. The term, homolog includes genes separated by the event of speciation (ortholog) and genes separated by the event of genetic duplication (paralog). With respect to sequence homology, in some embodiments, sequences may be homologs if they are at least 60%, preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% identical, more preferably at least 97% identical, or more preferably at least 99% identical.
[0031] The selD homolog may code for SenC [SEQ ID NO. 1] or a homolog thereof. The first protein may be fused to an affinity tag. Any appropriate affinity tag may be used here. As used herein, the term affinity tag refers to a peptide enabling a specific interaction with a specific ligand. In some embodiments, the affinity tag is linked to a molecule said combination being referred to herein as a fusion molecule or fusion construct. Accordingly, the present invention relates to a fusion molecule comprising the affinity tag as described herein. The affinity tag can be linked directly or indirectly to said molecule. The tag can be linked to any site of the molecule, e.g. to or near the end or terminus of the molecule, to one or more internal sites, attached to a side chain, or to the amino-terminal amino acid (N-terminal) or to the carboxy-terminal amino acid (C-terminal). Also more than one affinity tag can be linked to the molecule.
[0032] In some embodiments, a DNA sequence encoding the first protein and an affinity tag may be, e.g., 6His-senC [SEQ ID NO. 2] or a homolog thereof.
[0033] The method may include generating 120 a selenosugar by converting the selenophosphate (from the phosphorylating step) using at least a second protein in the presence of a common sugar donor.
[0034] The second protein may be a glycosyltransferase. As used herein, the term glycosyltransferase refers to an enzyme capable of catalyzing the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. A classification of glycosyltransferases using nucleotide diphospho-sugar, nucleotide monophospho-sugar and sugar phosphates and related proteins into distinct sequence-based families has been described (Campbell et al., Biochem. J. 326, 929-939 (1997)) and is available on the CAZy (CArbohydrate-Active EnZymes) website (www.cazy.org). In some embodiments, the glycosyltransferase may be SenB [SEQ ID NO. 3] or a homolog thereof. In some embodiments, the second protein may be fused to an affinity tag as disclosed herein. In some embodiments, a DNA sequence encoding the second protein and an affinity tag may be, e.g., 6His-senB [SEQ ID NO. 4] or a homolog thereof.
[0035] The common sugar donor may be any non-GDP-based common sugar donor, and is preferably a UDP-based common sugar donor. Non-limiting examples of such donors include, e.g., uridine diphospho-D-glucose (UDP-glucose or UDP-Glc), uridine diphospho-D-galactose (UDP-galactose or UDP-Gal), uridine diphospho-D-xylose (UDP-Xyl), uridine diphospho-N-acetyl-D-glucosamine (UDP-GlcNAc), uridine diphospho-N-acetyl-D-galactosamine (UDP-GalNAc), uridine diphospho-D-glucuronic acid (UDP-GlcA), and uridine diphospho-D-galactofuranose (UDP-Galf).
[0036] Non-UDP common sugars that may function include cytidine monophospho-N-acetylneuraminic acid (CMP-Neu5Ac), and cytidine monophospho-2-keto-3-deoxy-D-mannooctanoic acid (CMP-Kdo).
[0037] The selenosugar may be, e.g., 1-seleno-N-acetyl--D-glucosamine.
[0038] The method may include forming 130 selenoneine or an analog thereof by combining the resulting selenosugar from the previous step with N,N,N-trimethyl-L-histidine or an analog thereof using at least a third protein. As used herein, the term analog refers to a chemical compound that is structurally similar to another but differs slightly in composition (as in the replacement of one atom by an atom of a different element or in the presence of a particular functional group, or the replacement of one functional group by another functional group). Thus, an analog is a compound that is similar to or comparable in function and appearance to the reference compound.
[0039] The third protein may be encoded by an egtB homolog. In some embodiments, the egtB homolog may code for SenA [SEQ ID NO. 5] or a homolog thereof. In some embodiments, the third protein may be fused to an affinity tag as disclosed herein. In some embodiments, a DNA sequence encoding the second protein and an affinity tag may be, e.g., 6His-senA [SEQ ID NO. 6] or a homolog thereof.
[0040] In some embodiments, this third step may include forming hercyncyl-SeGlcNAc selenoxide (GlcNAc-SEN=O), and allowing hercyncyl-SeGlcNAc selenoxide (GlcNAc-SEN=O) to spontaneously convert to selenoneine (see
[0041] In various aspects, a particular method for forming selenoneine or an analog thereof may be provided. Referring to
[0042] The method may include introducing 214 adenosine triphosphate (ATP), a common sugar donor, and sodium selenide to the buffer. This step may also include introducing hercynine or an analog thereof to the buffer. As will be understood, the combination steps can be performed in any order. The method may include allowing 220 SenA, SenB, and SenC to form selenoneine or an analog thereof in the presence of adenosine triphosphate (ATP), a common sugar donor, and sodium selenide.
[0043] In various aspects, a kit may be provided. The kit may include one or more vectors comprising (i) a first gene coding for at least SenC; (ii) a second gene coding for at least SenB; and (iii) a third gene coding for at least SenA. The kit may optionally include adenosine triphosphate, a common sugar donor, sodium selenide, and/or hercynine or an analog thereof.
Example
[0044] A metabolomic analysis was performed of two species that harbor the selD-egtB-tigr04348 cluster. The actinomycete Amycolatopsis palatopharyngis DSM 444832 and the -proteobacterium Variovorax paradoxus DSM 30034 were grown in the presence of sodium selenite (see
[0045] The cells were then pelleted and analyzed by HPLC-MS, revealing the production of ergothioneine and its selenium-analog, selenoneine, by both bacteria.
[0046] Specifically, for various tested species, ISP Medium 2 agar plates and tryptic soy broth were used for general maintenance and liquid cultures of Amycolatopsis palatopharyngis DSM 44832 and Streptomyces rimosus ATCC 10970. Nutrient agar plates and nutrient broth were used for general maintenance and liquid cultures of Variovorax paradoxus DSM 30034. LB agar and broth (supplemented with 50 mM MOPS, pH 7.0) were used for general maintenance and liquid cultures of Burkholderia thailandensis E264.
[0047] For each strain, a single colony from an agar plate was inoculated into a sterile culture tube containing 5 mL of liquid medium and incubated at 30 C./250 rpm. The starter cultures were then used to inoculate 5 mL liquid cultures supplemented with 100 M of filter-sterilized Na.sub.2SeO.sub.3 and incubated at 30 C./250 rpm. Production cultures of B. thailandensis were grown for 24 hours, V. paradoxus and S. rimosus for 48 hours, and A. palatopharyngis for 72 hours. Following incubation, 2 mL of each culture was transferred to an Eppendorf tube, pelleted by centrifugation, and supernatants were removed. Cell pellets were resuspended in 0.4 mL of ddH.sub.2O and subjected to hot-water extraction by heating to 95 C. for 15 minutes. After cooling to room temperature, the mixtures were pelleted by centrifugation and supernatants were analyzed by HPLC-MS. Analytes were separated on a Synergi Fusion-RP HPLC column (from Phenomenex, 1004.6 mm, 4 m) with a flow rate of 0.5 mL/min and an elution program consisting of 0% solvent B wash for 5 min, a linear gradient from 0-100% B over 10 min, followed by a hold at 100% B for 3 min.
[0048] Upon further genomic examination, both strains were found to harbor a canonical ergothioneine BGC (egt) in addition to the putative selenometabolite BGC. To examine whether selenoneine may be the product of nonspecific Se incorporation by the egt cluster, two relatives of the producing strains, the actinomycete Streptomyces rimosus ATCC 10970 and the -proteobacterium Burkholderia thailandensis E264, which encode a canonical egt cluster but lack the putative selenometabolite cassette, were analyzed in the same fashion, revealing exclusive production of ergothioneine, and not selenoneine. These observations are consistent with prior reports of the inability of the bacterial ergothioneine biosynthetic machinery to generate selenoneine in vitro. These results suggest that selenoneine may in fact be the product of the new cluster, which is herein termed sen, with senA, senB, and senC coding for an egtB homolog, the putative glycosyltransferase, and a selD homolog, respectively (see
[0049] This indicates two distinct biosynthetic routes to ergothioneine and selenoneine. Ergothioneine is produced by egtABCDE. Early steps involve EgtA-catalyzed isopeptide bond formation between cysteine and glutamic acid, and S-adenosylmethionine (SAM)-dependent trimethylation of histidine by EgtD [SEQ ID NO. 7]. See
[0050] In contrast, the sen cluster contains only three genes. It is believed that SenB utilizes SeP (generated by SenC) to generate a new selenometabolite. SenA then catalyzes CSe bond-formation between this new species and hercynine, followed by CSe bond-cleavage to give selenoneine. Hercynine would likely be siphoned from the canonical ergothioneine pathway, though a small subset of sen clusters feature a co-localized egtD gene.
[0051] To evaluate this proposal and conclusively link the production of selenoneine to the sen cluster, the entire biosynthetic pathway was reconstructed in vitro. SenA, SenB, SenC, and EgtD were cloned from V. paradoxus and isolated as soluble, His-tagged proteins through heterologous expression in E. coli. For example, 6His-EgtD [SEQ ID NO. 8] was generated to encode for EgtD [SEQ ID NO. 7] fused to a his-tag. See Tables 1 and 2, below.
TABLE-US-00001 TABLE1 Primersusedinthisexample. Primer Sequence(5->3) Purpose Vpa-SenC-F tggtgccgcgcggcagccatatg Amplification aacgctgccctccc ofsenCfor [SEQIDNO.9] assemblyinto Vpa-SenC-R agtggtggtggtggtggtgctca pET-28b(+) gcggatcaccagcc [SEQIDNO.10] Vpa-EgtD-F tggtgccgcgcggcagccatatg Amplification cgcaatccaagctcc ofegtDfor [SEQIDNO.11] assemblyinto Vpa-EgtD-R agtggtggtggtggtggtgctca pET-28b(+) agcccccaaccaatg [SEQIDNO.12]
TABLE-US-00002 TABLE 2 Plasmids used or generated in this example. Plasmid Purpose Source pET-28b(+) KanR, Expression vector Novagen pET-28b(+) 6xHis-SenA Expression of 6xHis-SenA This example pET-28b(+) 6xHis-SenB Expression of 6xHis-SenB This example pET-28b(+) 6xHis-SenC Expression of 6xHis-SenC This example pET-28b(+) 6xHis-SenD Expression of 6xHis-EgtD This example
[0052] For the plasmids, genomic DNA from Variovorax paradoxus DSM 30034 was isolated using the WIZARD Genomic DNA Purification Kit (from Promega) following the manufacturer's instructions. From genomic DNA, senC and egtD genes were PCR-amplified using Q5 High Fidelity DNA polymerase (NEB) with primers Vpa-SenC-F/R and Vpa-EgtD-F/R, respectively, which have overhangs that allowed for assembly into pET28b (+) (Table S3). SenA and senB from Variovorax paradoxus DSM 30034 were obtained as synthetic DNA fragments, codon-optimized for expression in E. coli and with overhangs to allow assembly into pET28b (+). Protein expression plasmids were assembled from gene fragments and vector pET28b (+), linearized with NdeI and XhoI (from NEB), using NEBUILDER HiFi DNA Assembly Master Mix (from NEB) following the manufacturer's instructions. Ligation mixtures were transformed into chemically-competent E. coli DH5 by heat-shock and plated onto LB agar containing 50 mg/L kanamycin. After confirmation by Sanger sequencing, assembled plasmids were transformed into E. coli BL21 (DE3) for protein expression.
[0053] For expression and purification of 6His-tagged SenA, SenB, SenC, and EgtD proteins, all four proteins were produced separately in E. coli BL21 (DE3) cells grown in two 4 L flasks, each containing 2 L Terrific Broth supplemented with 50 mg/L kanamycin at 37 C./170 rpm. Small cultures were prepared by inoculating 40 mL of LB medium containing 50 mg/L Kan with a single colony of E. coli BL21 (DE3) carrying the desired plasmid. After overnight growth at 37 C./170 rpm, 4 L of TB medium plus 50 mg/L Kan were inoculated with the 40 mL small culture and incubated at 37 C./170 rpm. At OD600=0.5-0.6, protein expression was induced with 0.2 mM IPTG, and cultures were incubated at 37 C./170 rpm for an additional 12-24 hours. Cells were pelleted by centrifugation (8,000 g, 15 min, 4 C.), yielding 7 g of cell paste per L. The cell pastes were stored at 80 C. until purification.
[0054] All purification steps were carried out in a cold room at 4 C. Cells were resuspended in lysis buffer (5 mL/g cell paste), which consisted of 25 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, 10% glycerol, pH=7.7, supplemented with 1 L/mL Protease Inhibitor Cocktail (from Sigma) and 1 mM phenylmethylsulfonyl fluoride. Once homogenous, 0.1 mg/mL deoxyribonuclease I (from Alfa Aesar) was added, and the cells were lysed by the addition of 5 mg/mL lysozyme followed by sonication using 30% power (150 W) in 15 s on/15 s off cycles for a total of 4 min. This process was repeated twice. The lysate was then clarified by centrifugation (17,000 g, 15 min, 4 C.) and loaded onto a 5 mL Ni-NTA column pre-equilibrated in lysis buffer. The column was washed with lysis buffer and His-tagged proteins were eluted with elution buffer consisting of 25 mM Tris-HCl, 300 mM NaCl, 300 mM imidazole, 10% glycerol, pH=7.7. Eluted proteins were then buffer-exchanged using a 50 mL column of SEPHADEX G-25 medium (from Cytiva) into storage buffer consisting of 25 mM Tris-HCl, 150 mM NaCl, 10% glycerol, pH=7.7. Purified proteins were stored at 80 C. Protein concentrations were determined spectrophotometrically on a CARY 60 UV-visible spectrophotometer (from Agilent) using calculated molar extinction coefficients at 280 nm. From 4 L cultures, the following yields were obtained: 105 mg SenA, 198 mg SenB, 152 mg SenC, and 63 mg EgtD.
[0055] As expected, SenC was found to catalyze the ATP-dependent phosphorylation of sodium selenide to yield SeP. See
[0056] The selenophosphate synthetase activity of SenC was characterized according to known, conventional methods. Under anaerobic conditions, a 700 L reaction containing 2 mM dithiothreitol (DTT), 1 mM ATP, 1.5 mM Na.sub.2Se, and 20 M SenC was prepared in buffer consisting of 50 mM tricine, 20 mM KCl, 5 mM MgCl.sub.2, 10% D.sub.2O, pH=7.2. Control reactions were prepared in an identical fashion, lacking either SenC or Na.sub.2Se, or with Na.sub.2S in place of Na.sub.2Se. After a 1-hour incubation period at room temperature, the reactions were transferred to NMR tubes, removed from the glovebox, and immediately analyzed by .sup.31P-NMR. Results were consistent with previous reports of selenophosphate synthetase enzymes, with conversion to selenophosphate (SeP) only observed in the presence of all components. No production of thiophosphate was observed in the presence of Na.sub.2S.
[0057] Next, the function of SenB, the C-terminus of which shows weak homology to NDP-sugar binding domains of glycosyltransferases, was evaluated. When SenB was added to the SenC reaction along with the common sugar donor UDP-glucose, production of a new species was observed. It contained two Se atoms, as judged by the characteristic Se isotope pattern obtained by HR-MS, implying a potential diselenide-dimer. See
[0058] Specifically, in vitro reconstitution of SenB activity was performed as follows. Under anaerobic conditions, 200 L reactions containing 2 mM DTT, 2 mM ATP, 1 mM Na.sub.2Se, 20 M SenC, 20 M SenB, and 2 mM of NDP-sugar were prepared in buffer consisting of 50 mM tricine, 20 mM KCl, 5 mM MgCl.sub.2, pH=7.2. Control reactions were prepared in an identical fashion, lacking either SenB, SenC, or ATP. After a 6-hour incubation period at room temperature, reactions were removed from the glovebox and exposed to oxygen for 30 minutes to oxidize any unreacted Na.sub.2Se. Next, 50 L of each reaction mixture was quenched with 50 L of MeOH, while another 50 L was quenched with 50 L of 10 mM mBBr in MeCN. Reactions were incubated for an additional 30 min at room temperature in the dark to allow for complete derivatization with mBBr. Reactions quenched with MeOH were filtered and analyzed by LC-MS using a KINETEX Polar C18 column (from Phenomenex, 1504.6 mm, 2.6 m) with a flow rate of 0.4 mL/min and an elution program consisting of 0-20% solvent B over 5 min, followed by 20-100% solvent B over 3 min, and a final step of 3 min at 100%. This assay demonstrated the production of underivatized selenosugar diselenides. Reactions quenched with mBBr were filtered and analyzed by LC-MS using a SYNERGI Hydro-RP HPLC column (from Phenomenex, 2504.6 mm, 4 m) with a flow rate of 1 mL/min and an elution program consisting of a 5% solvent B wash for 3 min, a gradient of 5-75% solvent B over 6 min, followed by a gradient of 75-100% solvent B over 1 min, and a final hold at 100% for 5 min. The remaining 100 L of each reaction mixture was lyophilized for use as a crude selenosugar substrate in downstream assays with SenA.
[0059] SenB enzymatic assays were carried out anaerobically as described above on a 10-mL scale with UDP-glucose (Glc) and UDP-N-acetylglucosamine (GlcNAc). Reactions were quenched with 3 mL of 10 mM mBBr in MeCN and incubated on a platform rocker for 1 hour in the dark to facilitate complete derivatization. SeGlc-mBBr was purified by semi-preparative HPLC using a SYNERGI Fusion-RP HPLC column (from Phenomenex, 25010 mm, 4 m) with a flow rate of 2.5 mL/min and elution consisting of a gradient of 0-40% solvent B for 15 min, followed by 40-100% solvent B for 3 min, and a final hold at 100% B for 5 min. SeGlcNAc-mBBr was purified by semi-preparative HPLC using a LUNAR C18 column (from Phenomenex, 250 10 mm, 5 m) with a flow rate of 2.5 mL/min and elution consisting of a gradient of 10-50% solvent B for 10 min, followed by a gradient of 50-100% solvent B for 10 min, followed by a hold at 100% for 3 min. Purified compounds were dissolved in DMSO-d6 and analyzed by NMR spectroscopy, confirming the presence of a selenium atom bound to the anomeric carbon, which was determined to be -configured for both selenosugars, as shown by the large axial-axial coupling constants between protons on the sugar C-1 and C-2 (9.2 Hz for SeGlc-mBBr and 10.5 Hz for SeGlcNAc-mBBr).
[0060] Control assays further confirmed the requirement of each reaction component, and in the absence of SenB, no SeGlc was formed. Controls lacking either SenC or ATP also abolished SeGlc production, verifying SeP as the source of Se for SenB. Moreover, no product was observed with sodium sulfide, suggesting SenC discriminates between Se and S, thus synthesizing only SeP for the downstream SenB-catalyzed reaction. When assayed against various nucleotide-sugar substrates, SenB was found to efficiently utilize UDP-N-acetylglucosamine (UDP-GlcNAc) and UDP-N-acetylgalactosamine (UDP-GalNAc), but not GDP-mannose or GDP-glucose, suggesting SenB may be specific for UDP-sugars.
[0061] Together, these results allow the designation of SenB as a novel selenosugar synthase, which now joins SelA and SelU as only the third bona fide SeC bond-forming enzyme characterized to date.
[0062] The remaining enzyme encoded in the sen cluster, SenA, is a distant homolog of the CS bond-forming sulfoxide synthase EgtB. Previous work by others has provided extensive characterization of this family of nonheme iron enzymes, including crystal structures that have pinpointed residues involved in iron-, hercynine-, and thiol-binding. SenA proteins bear 30-50% similarity to members of the EgtB family and share its conserved iron-binding three-His facial triad, catalytic Tyr residue, and motifs involved in hercynine-binding. See
[0063] However, a conserved Arg87/Asp416 pair implicated in thiol binding within the EgtB active site is replaced with His and Phe or Tyr, respectively, in all SenA proteins. These substitutions suggest that SenA catalyzes SeC bond-formation between hercynine and a different substrate, presumably a selenosugar, en route to selenoneine.
[0064] This hypothesis was tested by first recapitulating the activity of V. paradoxus EgtD in vitro, allowing for rapid formation of hercynine from histidine and SAM. See
[0065] For in vitro reconstitution of EgtD activity, under aerobic conditions, 100 L reactions containing 0.5 mM histidine, 2 mM S-adenosylmethionine (SAM), and 20 M EgtD were prepared in buffer consisting of 50 mM Tris-HCl, 150 mM NaCl, pH=8.0. A control reaction lacking EgtD was prepared in an identical fashion. After a 30-minute incubation period at room temperature, reactions were quenched with 100 L MeOH, filtered, and analyzed by LC-MS using a SYNERGI Hydro-RP HPLC column (from Phenomenex, 2504.6 mm, 4 m) with a flow rate of 1 mL/min and an elution program gradient consisting of a 0% solvent B wash for 3 min, a followed by a gradient to 100% solvent B over 2 min, and a hold at 100% for 5 min. Results were consistent with previous reports of EgtD enzymes, with conversion of histidine to hercynine observed only in the presence of EgtD.
[0066] For in vitro reconstitution of SenA activity, under aerobic conditions, crude selenosugar substrates from lyophilized SenBC assay mixtures were first dissolved in buffer consisting of 50 mM Tris-HCl, 150 mM NaCl, pH=8. Next, 0.5 mM histidine, 2 mM S-adenosylmethionine (SAM), 2 mM DTT, 0.2 mM (NH.sub.4).sub.2Fe(SO.sub.4).sub.2, 20 M EgtD, and 20 M SenA were added to a final volume of 100 L. Control assays were prepared in an identical fashion, except lacking either EgtD or SenA. Assays containing sodium -D-thioglucose (from Fisher) in place of selenosugar substrate were also prepared in a similar fashion. However, thioglucose was found to be a very poor substrate for SenA, and thus 80 M enzyme was used to facilitate appreciable conversion. After a 7-hour incubation period at room temperature, 50 L of each reaction mixture was quenched with 50 L of MeOH, while another 50 L was quenched with 50 L of 10 mM mBBr in MeCN. Reactions were incubated for an additional 30 minutes at room temperature in the dark to allow for complete derivatization with mBBr. The samples were then filtered and analyzed by LC-MS using a SYNERGI Hydro-RP HPLC column (from Phenomenex, 2504.6 mm, 4 m) with a flow rate of 1 mL/min and elution consisting of 5% solvent B for 3 min, a gradient of 5-75% solvent B over 6 min, followed by a gradient of 75-100% over 1 min, and a hold at 100% for 5 min.
[0067] For structural characterization of SenA products, a large-scale SenA enzymatic assay was carried out aerobically as described above using a crude SeGlcNAc substrate from a lyophilized, 10-mL SenBC reaction mixture. Reactions were quenched with 5 mL of 10 mM mBBr in MeCN and incubated on a platform rocker for 1 hour in the dark to facilitate complete derivatization. Selenoneine-mBBr (SEN-mBBr) was purified by semi-preparative HPLC using a LUNA C18 HPLC column (from Phenomenex, 25010 mm, 5 m) with a flow rate of 2.5 mL/min and an elution program consisting of a gradient of 7.5-80% solvent B for 12 min, followed by a hold at 80% for 4 min. Purified SEN-mBBr was dissolved in D.sub.2O and analyzed by NMR spectroscopy. The selenium atom was confirmed to be positioned at the imidazole C2 carbon, as evidenced by the absence of an imidazole C-2 proton and diagnostic H-13C HMBC correlations. The structures of other SenA products (hercynyl-SeGlcNAc selenoether [GlcNAc-SEN], hercynyl-SeGlc selenoether [Glc-SEN], hercynyl-thioglucose sulfoxide [Glc-EGT=O], and selenoneine [SEN]) were confirmed by tandem HR-MS/MS analysis.
[0068] Upon incubation of SenA with hercynine (generated in situ with EgtD, His, and SAM), various selenosugars, dithiothreitol (DTT), and Fe(II), followed by derivatization with mBBr, a new species was observed containing a single Se atom and a high-resolution mass consistent with that of selenoneine-mBBr. The structure was confirmed by NMR spectroscopy upon purification of the product from large-scale reactions with SeGlcNAc, the substrate for which SenA showed the greatest preference. More importantly, in the absence of mBBr, selenoneine itself was directly observed in the product mixture as evidenced by HR-MS and HR-MS/MS analysis, thus completing reconstitution of the entire selenoneine biosynthetic pathway in vitro and confirming that the sen cluster is responsible for building this unusual natural product.
[0069] In ergothioneine biosynthesis, the EgtB reaction yields hercynyl-GGC sulfoxide, which is further processed by EgtC and EgtE to produce ergothioneine. See
[0070] As seen, the process disclosed herein utilizes neutral-pH aqueous buffer and ambient temperature for the production of selenoneine. The disclosed approach could therefore be used for rapid, green production of selenoneine and its analogs.