Nano-antibody and its application based on SARS-CoV-2 S protein S1 subunit

Abstract

A nanobody and its application based on SARS-CoV-2 S protein S1 subunit are provided, and the present disclosure relates to biomedical technology. The present disclosure chooses the Spike RBD of SARS-CoV-2 as a target, and screens the nanobody targeting SARS-CoV-2 by using a nanobody library. After an ELISA test, the Spike RBD target of SARS-CoV-2 can be specifically identification while a SPIKE S1+S2 ECD target is identification, and a binding signal is relatively strong. The corresponding nanobody sequence is constructed into a prokaryotic expression vector for expression and purification to express the target nanobody successfully. After purification, the purity is greater than 90%. The ELISA test of VHH nanobody showed that the purified nanobody has higher affinity to the two targets.

Claims

1. A nanobody targeting SARS-CoV-2 S protein S1 subunit, comprising: a single domain antibody protein, sdAb, fragment, wherein an amino acid sequence of the sdAb fragment is SEQ ID NO.5.

2. The nanobody targeting SARS-CoV-2 S protein S1 subunit according to claim 1, wherein the nucleotide sequence of the sdAb fragment is SEQ ID NO.6.

3. An expression vector, comprising the nucleotide sequence of claim 2.

4. The expression vector according to claim 3, wherein an amino acid sequence of the expression vector is SEQ ID NO.2.

5. The expression vector according to claim 3, wherein a nucleotide sequence of the expression vector is SEQ ID NO.1.

6. A host expression strain, comprising the expression vector of claim 3, wherein the host expression strain is a bacterial strain.

7. A method for preparing the expression vector of claim 3, further comprising: inserting the nucleotide sequence encoding the nanobody between a restriction enzyme cutting site of BamHI and a restriction enzyme cutting site of XhoI of a pET28a-SUMO expression vector to obtain the expression vector; transforming the expression vector into a bacterial strain of E. coli BL21, and selecting monoclonal colonies for large-scale cultivation; collecting and purifying a nanobody protein by cell breaking after an induced expression.

8. The method for preparing the expression vector according to claim 7, wherein 6×His tag is added to N terminal of the pET28a-SUMO expression vector SUMO.

9. An agent for treatment and/or diagnosis of SARS-CoV-2 infection utilizing the nanobody targeting SARS-CoV-2 S protein S1 subunit of claim 1.

10. An agent for treatment and/or diagnosis of SARS-CoV-2 infection utilizing the expression vector of claim 3.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a phagemid map of a pMECS-nanobody;

(2) FIG. 2 is an electrophoretic result of a SPIKE S1+S2 ECD protein SDS-PAGE;

(3) FIG. 3 is a result of an ELISA test of a Monoclonal phage;

(4) FIG. 4 is a map of a PET28a-SUMO-nanobody vector;

(5) FIG. 5 is an electrophoretic result of PCR amplification product of a nanobody fragment;

(6) FIG. 6 is a sequence of a nanobody;

(7) FIG. 7 is an SDS-PAGE analysis of a SUMO-nanobody sample;

(8) FIG. 8 is an experimental result of detecting neutralizing activity of the nanobody by a SARS-CoV-2 neutralizing antibody ELISA test kit.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(9) For a better understanding of the objects, technical solutions, and advantages of the present application, the disclosure is further illustrated with the following embodiments, and the equipment and reagents used in each embodiment and test with no specific explanation can be obtained from commercial channels. The specific embodiments described here are only used to explain the disclosure, and are not used to limit the application.

(10) According to the information included in the application, it is easy for the technical personnel in the field to make other modification of the precise description of the application, without deviating from the spirit and scope of the claims. Notice that the defined process, nature and component are not intended to limit the scope of the application since the embodiments and other description are only to indicatively illustrate the specific aspect of the present application. Indeed, any modification, equivalent replacement, and improvement made by the persons skilled in the field or any related fields shall be included in the protection scope of the claims.

(11) The specific descriptions of the present application are shown in the embodiments as follows.

EMBODIMENTS

(12) 1. Selection of Target Protein

(13) The target protein used in the embodiment of the application is SARS-CoV-2 Spike RBD-His Recombinant Protein purchased from Sino Biological Inc. (No: 40592-V08B, 20 kd, 293 cell expressions, code: Spike RBD).

(14) 2. Selection of the Nanobody Library:

(15) using prefabricated nanobody library

(16) 1) Brief Introduction to Display System of the Nanobody Library

(17) The nanobody library is a library constructed by M13 phage display system, which comprises pMECS phagemid vector, E. coli TG1 and M13KO7 auxiliary phage. The structure of the pMECS bacteriophage carrier is shown in FIG. 1: the previous sequence of Pst I restriction enzyme cutting site is the coding sequence of pelB secretory signal peptide and partial amino acids in the first frame domain of the nanobody, after the pelB signal peptide successfully guiding the subsequent nanobody to the periplasmic cavity, the signal peptide enzyme works on the end of AQPAMA sequence and removes the pelB signal peptide; the coding sequences of HA and 6×His tag behind Not I restriction enzyme cutting site can be used for purification or detection of fusion proteins. The following encoding sequence is phage pIII capsid protein. There is an amber termination codon between 6×His tag and the gene III sequence, 10%-20% amber terminator codon can be translated into glutamate (Glu, or E) in amber terminator codon-inhibiting strain (For example: E. coli TG1), and causes the binding of the nanobody and pIII protein. When rescued by the auxiliary phage M13KO7, the nanobody is displayed at the N-terminal of pIII protein at the tail of phage.

(18) 3. Screening and Identification of the Nanobody

(19) 1) Analysis of Target Proteins by SDS-PAGE

(20) Denaturing 3 μg SPIKE RBD, and then adding 10% SDS-PAGE gel to 3 μg SPIKE RBD for electrophoresis analysis. The results are shown in Table 2: SPIKE RBD has a main band with a molecular weight around 30 kDa; the sample does not degrade, and the purity also meets the screening requirements.

(21) 2) Screening Strategy and Potency

(22) TABLE-US-00001 TABLE 1 Screening method of the nanobody of the SPIKE RBD protein Numbers of Number of Times of phages phages Multiples of screening Screening conditions filtered in screened out enrichment first round of target protein: SPIKE RBD (10 μg) 1.0 × 10.sup.13 2.2 × 10.sup.6 4.5 × 10.sup.6 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 10 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk second round of target protein: SPIKE RBD (10 μg) 2.1 × 10.sup.12 3.1 × 10.sup.8 6.7 × 10.sup.3 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 12 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk second round of target protein: blank control group 2.1 × 10.sup.12 1.4 × 10.sup.8 1.5 × 10.sup.4 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 12 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk third round of target protein: SPIKE RBD (10 μg) 2.2 × 10.sup.12 3.3 × 10.sup.9 6.6 × 10.sup.2 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 15 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk third round of target protein: blank control group 2.2 × 10.sup.12 4.6 × 10.sup.5 4.6 × 10.sup.4 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 15 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk fourth round of target protein: SPIKE RBD (10 μg) 2.1 × 10.sup.12 4.6 × 10.sup.9 4.5 × 10.sup.2 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 20 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk fourth round of target protein: blank control group 2.1 × 10.sup.12 2.7 × 10.sup.6 7.7 × 10.sup.4 screening confining liquid: 2% Milk-PBS washing condition: 0.1% Tween20-PBS, 20 cycles elution requirement: 0.2M Glycine-HCl, pH 2.2 buffer: 2% Milk

(23) 3) ELISA Results of the SPIKE RBD Monoclonal Phage

(24) Selecting three monoclonal colonies randomly from the Output clone after the third round of screening of SPIKE RBD. After conducting the phage rescue, performing the of the monoclonal phage ELISA test for three monoclonal colonies in the ELISA wells coated with the SPIKE RBD target (200 ng/well), comparing to No Coating. The detailed results are shown in Table 2, there are three specific identification targets of SPIKE RBD in R3 clone.

(25) TABLE-US-00002 TABLE 2 ELISA results of the SPIKE RBD monoclonal phage of R3 clone Coated SPIKE Blank Clone RBD protein comparison 1 1.0034 0.0492 2 1.9415 0.048 3 1.4305 0.0525 M13KO7 0.0434 0.047 1% M-PBS 0.0436 0.0453

(26) 4) Sequence Analysis of Positive Clones

(27) Sequencing the clones of specific identification target protein screened by SPIKE RBD, and the sequencing primer is MP57 (TTATGCTTCCGGCTCGTATG). And then analyzing and arranging the sequencing sequences to obtain the unique VHH nanobody sequence. The results are shown in SEQ ID NO.6.

(28) 5) Soluble ELISA Experiment of Positive Clones

(29) Performing IPTG induced expression for the clones of the specific identification SPIKE RBD (in E. coli TG1) at 30° C., and collecting the bacterial cells after centrifugation to do extraction from periplasmic cavity. Diluting the sample extracted from periplasmic cavity 10 times with 0.5× blocker for reserve. Coating the SPIKE RBD target (200 ng/well) on the 96-well ELISA plate, and detecting the samples extracted from the diluted periplasmic cavity by ELISA, comparing to No Coating. Anti-HA mouse McAb is a secondary antibody of ELISA test, and HRP-conjugated Goat Anti-Mouse IgG (H+L) is a tertiary antibody. The results are shown in Table 3, and the clones can bind the target proteins specifically.

(30) TABLE-US-00003 TABLE 3 ELISA experiment for binding the nanobody to the SPIKE RBD protein in phage Coated Blank Group SPIKE RBD comparison OD450 2.2712 0.0546

(31) 6) Performing ELISA Test for the SPIKE S1+S2 ECD Target

(32) The S protein of SARS-CoV-2 (2019-nCoV) SPIKE S1+S2 ECD-His Recombinant Protein (Item No. 40589-V08B1, full length extracellular segment, 130 kd, insect cell expression, code: Spike S1+S2 ECD), purchased from Sino Biological Inc., is used for ELISA test in the embodiment case of the application.

(33) The periplasmic cavity of the clones binding to the SPIKE S1+S2 ECD target is used to extract the samples, and detecting the SPIKE S1+S2 ECD target by ELISA. The detecting method is the same as the soluble ELISA. The results are shown in Table 4: The clones that can identify SPIKE RBD can also identify the SPIKE S1+S2 ECD target, and the binding signal is relatively strong.

(34) TABLE-US-00004 TABLE 4 ELISA experiment for binding nanobody to SPIKE S1 + S2 ECD protein in phage Coated SPIKE S1 + Blank Group S2 ECD proteins comparison OD450 2.3514 0.0715

(35) 4. The ELISA Test of the Monoclonal Phage after Screening

(36) The ELISA method

(37) coating: diluting the target protein to 2 μg/mL with 1×PBS pH 7.4, adding target protein to the ELISA plate hole 100 μL/well, and coating the ELISA plate overnight at 4° C.;

(38) blocking: washing the ELISA plate with PBST (0.1% Tween) for one time, adding to 300 μL 5% BSA each well as the confining liquid, and incubating the ELISA plate for 2 hours at 37° C.;

(39) incubating phage supernatant: washing the ELISA plate with PBST (0.1% Tween) for one time, and adding 100 μL of phage supernatant to the corresponding ELISA well, and incubating the ELISA plate for 2 hours at 37° C.;

(40) incubating and detecting the nanobody: washing the ELISA plate with PBST (0.1% Tween) for three times, and diluting anti-M13-HRP (1:5000) with 2.5% BSA. Adding anti-M13-HRP to the corresponding ELISA plate 100 μL/well, and incubating the ELISA plate for 1 hour at 37° C.;

(41) TMB color development: washing the plate with PBST (0.1% Tween) for 3 times, and washing the plate with PBS for 2 times, starting TMB color development under 100 μL/well, incubating the ELISA plate for about 30 minutes at 37° C. until 2 M H.sub.2SO.sub.4 is 50 μL/well;

(42) reading enzyme calibration: detecting light absorption value at OD450 nm by using the enzyme calibration.

(43) 2) Results of Detection

(44) The results are shown in Table 3, wherein A: the detection of the SPIKE RBD target, B: the detection of the SPIKE S1+S2 ECD target.

(45) 5. Acquisition of the Nanobody

(46) 1) Construction and Purification of the Prokaryotic Expression Vector of Positive Clones

(47) SUMO tag protein is a small ubiquitin-like modifier with a molecular weight of about 11.2 kDa. As a fusion tag for recombinant protein expression, SUMO tag can increase the weight of expression of fusion protein, with antiprotease hydrolysis, and can promote the correct folding of target protein and improve the solubility of recombinant protein. To obtain soluble expression of the nanobody, inserting the coding sequence of the nanobody between a restriction enzyme cutting site of BamHI and a restriction enzyme cutting site of XhoI of an expression vector pET28a-SUMO to make the coding sequence of the nanobody conduct fusion expression with SUMO tag, and the N terminal of SUMO, added with 6×His tag, can be used to purify the fusion protein, while the C terminal of the nanobody, added with HA tag, can be used to detect. The vector map of the pET28a-SUMO-nanobody is shown in Table 4.

(48) Inoculating the clones (pMECS in TG1) that identifies SPIKE RBD into the 2YT-AG medium and culturing the clones overnight at 37° C., the cloned bacterial solution is used as a model and SUMOVHH-F and SUMOVHH-R are used as primers.

(49) TABLE-US-00005 TABLE PCR system PCR system Model 1-2 μL 10 X NovaTaq confining liquid, contains 5 μL MgCl.sub.2 SUMOVHH-F (5 pmol/μL) 1 μL SUMOVHH-R (5 pmol/μL) 1 μL 10 mM: dATP, dCTP, dGTP, dTTP 1 μL DNA polymerase 1.25 U PCR reaction condition reaction condition 95° C. 5 min 1 cycle 94° C. 50 s 55° C. 1 min {close oversize brace} 35 cycles 72° C. 1 min 72° C. 6 min 1 cycle

(50) Amplifying the gene fragment of the nanobody by PCR, the agarose gel electrophoresis results of PCR product are shown in Table 5: the fragment is effectively amplified, and the size of the fragment is about 400 bp, the results are consistent with expectation. Adding the PCR product to 1.2% agarose gel for electrophoresis separation respectively, and purifying the target fragment by gel cutting and recovering the target fragment by using a gel extraction kit.

(51) TABLE-US-00006 SUMOVHH-F: cacagagaacagattggtggatccCAGGTGCAGCTGCAGG, as seen in SEQ ID NO. 3. SUMOVHH-R: cagtggtggtggtggtggtgctcgagtcaGGAACCGTAGTCCGGAAC, as seen in SEQ ID NO. 4.

(52) Synthesizing the nanobody into pET28a-SUMO expression plasmid.

(53) The expression cassette sequence of SUMO-nanobody is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2; as shown in Table 6, the structural domains of His, SUMO, the nanobody and HA tag are distinguished by using different gray intensity and underscores, and correspond to the gray intensity and underscores of the names.

(54) Transforming the expression vector of the SPIKE RBD SUMO-nanobody into E. coli BL21 (DE3) strain, and coating the Kan-resistant plate. After overnight culture, picking out the monoclonal colonies and inoculating it into the 200 mL 2YT-K medium, and culturing the plate until the middle of the logarithmic growing period, then adding 1 m M final density of IPTG solution, and inducing the plate overnight at 30° C. Collecting the bacterial precipitation by centrifugation, and after breaking the bacterial cells by ultrasonic wave, purifying SUMO-nanobody by Ni ion affinity chromatography column, concentrating the sample by Millipore concentration tube and placing the buffer into PBS (pH7.4). Filtering the bacteria with the 0.22 μm filter membrane, adding 5% the final density of the sterile glycerol, freezing the sample after packing. Conducting quantitative analysis for the sample of purified SUMO-nanobody through using Nanodrop, the results are shown as Table 6. Finally, detecting the above sample by SDS-PAGE electrophores, the results are shown as Table 5: the purified sample of SPIKE RBD ECD SUMO-nanobody only has a target band near 28 kDa, the purity is greater than 90%.

(55) TABLE-US-00007 TABLE 5 Information of the sample density Item Description Volume Concentration Quantity 1 SPIKE RBD nanobody 2.9 ml 1.35 mg/mL 3.92 mg

(56) 6. ELISA Test of VHH Nanobody

(57) Coating the SPIKE S1+S2 ECD target and the SPIKE RBD target (200 ng/well) respectively on the 96-well ELISA plate to verify the specificity and affinity of SPIKE RBD SUMO-nanobody, comparing to No Coating, and conducting concentration gradient ELISA test for SPIKE RBD SUMO nanobody, Anti-HA mouse McAb is the secondary antibody of ELISA test, and HRP-conjugated Goat Anti-Mouse IgG (H+L) is the third antibody. The results are shown as Table 6: SUMO-nanobody has the binding activity to both targets (SPIKE S1+S2 ECD and SPIKE RBD).

(58) TABLE-US-00008 TABLE 6 Results of the ELISA test for SUMO-nanobody Nanobody density(ng/mL) 3000 1000 333.333 0 SPIKE RBD SPIKE S1 + 0.3381 0.211 0.1783 0.0821 S2 ECD SPIKE RBD 0.5639 0.2903 0.2113 0.0675 No Coating 0.0812 0.0641 0.0663 0.056

(59) 7. Detecting the Experiment on the Neutralizing Activity of the Nanobody by a SARS-CoV-2 Neutralizing Antibody ELISA Test Kit

(60) Using the SARS-CoV-2 neutralizing antibody ELISA test kit from Jiangsu GenScript Biotechnology Co., Ltd. to detect the experiment on the neutralizing activity of the nanobody in the embodiment. The specific operations are as follows:

(61) Mixing positive control, negative control and the samples with the solution respectively in advance at 1:1 volume ratio (The positive control is the neutralizing antibody of SARS-CoV-2 carried by L00847 SARS-CoV-2 Surrogate Virus neutralization ation Test Kit from GenScript Biotechnology Co., Ltd.; negative control is the human's IgG). For example, adding 60 μL HRP-RBD solution to 60 μL positive control and incubating the HRP-RBD solution at 37° C. for 30 minutes. Adding 100 μL mixed solutions of positive control, negative control and sample to the enzyme standard plate. After covering with a film of cover plate, incubating the plate for 15 minutes at 37° C. Removing the film and washing the cover plate with 260 μL 1× cleansing solution for 4 times. After washing, removing the remaining liquid from the hole in the cover plate by using paper towel. Adding 100 μL TMB Solution to each well of the enzyme label plate, and incubating the plate for 10-15 minutes at 20-25° C. in a dark place (start from adding to TMB Solution). Removing the film, and adding 50 μL stopping solution to each well. After stopping, measuring light absorption value at 450 nm by the enzyme calibration immediately.

(62) Result: according to the detecting results of L00847 SARS-CoV-2 Surrogate Virus Neutralization Test Kit, it shows that nanobody has neutralizing activity. The data is shown as Table 8.

(63) 8. Detecting the experiment on the neutralizing activity of nanobody by SARS-CoV-2 pseudovirus

(64) The pseudovirus is constructed and provided by Li Chengyao of Southern Medical University. The specific operations are as follows:

(65) 1) preparing sample: the prepared nanobody determination concentration;

(66) 2) adding DMEM complete medium to 100 μL/well of the plate in column 1 (cell control CC), adding DMEM complete medium to 50 μl/well of the plate in column 2 (virus control VC), adding DMEM complete medium to 90 μl/well of the plate in the third column, and adding 50 μl DMEM complete medium to the rest well;

(67) 3) adding 10 μL the nanobody sample to be tested;

(68) 4) sucking and blowing the liquid in the third column gently and repeatedly for 6-8 times, then transferring 50 μl liquid to the corresponding well, after that, all wells are diluted for twice;

(69) 5) diluting the SARS-CoV-2 pseudovirus to 1.28×10.sup.4 TCID.sub.50/mL with DMEM complete medium, and adding 50 μl liquid to each well in columns 3-11, namely 640 TCID.sub.50 per well;

(70) 6) incubating the 96-well plate in a cell incubator (37° C., 5% CO.sub.2) for 1 hours;

(71) 7) digesting ACE2-293T cells, and diluting the ACE2-293T cells to 3×10.sup.5 cells/mL after incubation for 30 minutes;

(72) 8) adding 100 μl cells to each well to make 3×10.sup.4 cells per well after the end of incubation;

(73) 9) culturing the plate in 5% CO.sub.2 incubator at 37° C. for 48 hours;

(74) 10) sucking and discarding 100 μl supernatant after the end of cultivation, and adding 100 μl Bright-Glo™ luciferase detection reagent (promega); blowing the plate repeatedly and transferring the 200 μl liquid of the plate to the whiteboard after dark reaction at room temperature for 5 minutes;

(75) 11) reading Relative Light Unit (RLU) by using the PerkinElmer EnSight multifunctional imaging enzyme-labeling instrument;

(76) 12) calculating the neutralizing inhibition rate:

(77) $\left(\mathrm{Inhibition}\mathrm{rate}=1-\frac{\begin{array}{c}\begin{array}{c}\mathrm{Mean}\mathrm{value}\mathrm{of}\mathrm{light}\mathrm{intensity}\\ \mathrm{of}\mathrm{the}\mathrm{sample}\mathrm{group}-\mathrm{CC}\end{array}\\ \mathrm{mean}\mathrm{value}\mathrm{of}\mathrm{blank}\mathrm{control}\end{array}}{\begin{array}{c}\mathrm{VC}\mathrm{mean}\mathrm{value}-\\ \mathrm{CC}\mathrm{mean}\mathrm{value}\end{array}}\right)\times 100\%$

(78) When the nanobody concentration corresponding to the neutralizing nanobody titer inhibition rate of 50%, calculating the corresponding neutralizing nanobody titers based on the initial concentration of the nanobody and its addition amount.

(79) Result: the nanobody has neutralizing activity to pseudovirus, and the inhibition rate of pseudovirus increases with the growth of concentration. The results are shown in the table below.

(80) TABLE-US-00009 TABLE 7 Inhibition rate of the nanobody targeting pseudovirus Diluted concentration (μg/ml) Inhibition rate % 262.96 80.05 131.48 77.13 65.74 73.24 32.87 71.66 16.43 69.68 8.22 64.76 4.11 54.16 2.05 49.32

(81) The above is only some better embodiments of the application and does not limit the invention. Any modification, equivalent replacement or improvement made within the spirit and principles of the application shall be covered by the protection of the application.