Method for selecting seed size in watermelon and generating modifications in the tomato-seed size gene
12336470 ยท 2025-06-24
Assignee
Inventors
- Richard Bernard BERENTSEN (Paterna, ES)
- Courtney HU (Sacramento, CA, US)
- Elena CHIAPPARINO (Sant Agata Bolognese Emilia-Romagna, IT)
Cpc classification
International classification
A01H1/04
HUMAN NECESSITIES
Abstract
The disclosure provides methods for selecting watermelon plants for genetic elements on chromosome 2 and 6 which genetic elements predict the average seed size produced in the fruits of said plants and watermelon plants and plant parts comprising modifications in the tomato-seed size gene (Ts-gene) on chromosome 2, and methods of producing seeds and plants.
Claims
1. A method of producing F1 hybrid seed, comprising crossing a first parent line being homozygous for a haplotype for a gene named Ts-gene selected from: a) a deletion of all or part of the Ts-gene, or a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein (chromosome 2 haplotype NO); b) a mutant allele of the Ts-gene, which mutant allele encodes a mutant Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type Ts-protein, said mutant Ts-protein having reduced function compared to the wild type Ts-protein (chromosome 2 haplotype RE); or c) a wild type allele of the Ts-gene, encoding a functional Ts-protein (chromosome 2 haplotype WT); and being homozygous for a haplotype for SNP_01 and INDEL_02 selected from i) the combination of SEQ ID NO: 4 and SEQ ID NO: 6, or ii) the combination of SEQ ID NO: 4 and SEQ ID NO: 7 or the combination of SEQ ID NO: 5 and SEQ ID NO: 6 or iii) the combination of SEQ ID NO: 5 and SEQ ID NO: 7; with a second parent line being homozygous for a haplotype for the Ts-gene selected from: a) a deletion of all or part of the Ts-gene, or a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein (chromosome 2 haplotype NO), b) a mutant allele of the Ts-gene, which mutant allele encodes a mutant Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type Ts-protein, said mutant Ts-protein having reduced function compared to the wild type Ts-protein (chromosome 2 haplotype RE); or c) a wild type allele of the Ts-gene, encoding a functional Ts-protein (chromosome 2 haplotype WT); and being homozygous for a haplotype for SNP_01 and INDEL_02 selected from i) the combination of SEQ ID NO: 4 and SEQ ID NO: 6, or ii) the combination of SEQ ID NO: 4 and SEQ ID NO: 7 or the combination of SEQ ID NO: 5 and SEQ ID NO: 6 or iii) the combination of SEQ ID NO: 5 and SEQ ID NO: 7; and obtaining the F1 hybrid seeds, optionally cleaning, drying and packaging the F1 hybrid seeds, wherein said Ts-gene is the gene which encodes a wild type, functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 95% sequence identity to SEQ ID NO: 1.
2. A watermelon plant or seed or plant part comprising at least one copy of a mutant allele of a gene named Ts-gene or comprises a deletion of all or part of the Ts-gene, said Ts-gene encodes a functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 95% sequence identity to SEQ ID NO: 1, wherein the mutant allele has reduced expression or no expression compared to the wild type allele of the Ts-gene, or wherein the mutant allele encodes a mutant Ts-protein having reduced function or loss of function compared to the wild type Ts-protein of SEQ ID NO: 1 or compared to a wild type Ts-protein comprising at least 95% sequence identity to SEQ ID NO: 1, wherein said deletion is not a deletion of SEQ ID NO: 8 but a different deletion of all or part of the Ts-gene and wherein said mutant allele does not encode a mutant Ts-protein in which the Aspartic acid (D) at amino acid 204 of SEQ ID NO: 1 is replaced by a Tyrosine (Y).
3. The watermelon plant or seed or plant part according to claim 2, wherein the mutant allele of the Ts-gene encodes a reduced function Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type protein of SEQ ID NO: 1.
4. The watermelon plant or seed or plant part according to claim 2, wherein said plant or seed or plant part is homozygous for said mutant allele of the Ts-gene or for the deletion of all or part of the Ts-gene.
5. The watermelon, plant or seed or plant part according to claim 2, wherein the plant or seed is an inbred line or an F1 hybrid.
6. The method according to claim 1, wherein the selection of said first parent line and/or of said second parent line is made based on said genotype information of watermelon lines stored in a database.
7. The method according to claim 1, wherein the selection of inbred lines said first parent line and/or said second parent line is made based on information obtained by genotyping inbred lines for the chromosome 2 and chromosome 6 haplotypes, or by analyzing whole genome sequence information for the chromosome 2 and chromosome 6 haplotypes.
8. The method according to claim 7, wherein the selection of said first parent line and/or said second parent line comprises using molecular methods to determine the haplotype or genotype of inbred watermelon lines, and thereafter selecting said inbred watermelon line based on the haplotype or genotype determined by said molecular methods.
9. The method according to claim 8, wherein the molecular methods comprise sequencing, genotyping methods, PCR based methods or hybridization based methods.
Description
FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8) Description of Sequences
(9) SEQ ID NO: 1wild type Ts-protein of watermelon (genome 97103 v1 and v2) SEQ ID NO: 2genomic DNA encoding the wild type Ts-protein of SEQ ID NO: 1 SEQ ID NO: 3cDNA encoding the wild type Ts-protein of SEQ ID NO: 1 SEQ ID NO: 4chromosome 6 SNP 01 marker comprising a Guanine (G) at nucleotide 61 SEQ ID NO: 5chromosome 6 SNP 01 marker comprising a Thymine (T) at nucleotide 61 SEQ ID NO: 6chromosome 6 INDEL marker comprising a deletion of 46 nucleotides SEQ ID NO: 7chromosome 6 INDEL marker not comprising a deletion/i.e., comprising an insertion of 46 nucleotides compared to SEQ ID NO: 6 SEQ ID NO: 8large, genomic deletion on chromosome 2 found to comprise the genomic DNA of SEQ ID NO: 2; SEQ ID NO: 8 is deleted/absent in chromosome 2 of variety WH9716, a representative sample of seeds having deposited under Accession number NCIMB42704.
(10) A representative sample of seeds of NCIMB42704 have been deposited at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland, UK) under the Budapest Treaty by Nunhems B. V. on 12 Dec. 2016 and may be used as described herein.
(11) Mutations in the Ts-Gene of Watermelon
(12) As the Ts-gene has been identified on chromosome 2, mutant alleles of the Ts-gene can be generated de novo in watermelon. This can be done by e.g., non-targeted mutagenesis techniques (chemical or radiation induced mutations) or targeted mutagenesis techniques or gene editing techniques, such as Crispr based techniques (CrisprCas9, CrisprCpfI, etc.).
(13) The Ts-gene has been identified in watermelon and it encodes the wild type Ts-protein of SEQ ID NO: 1. However, allelic variants of the Ts-gene may be present in other watermelon lines or varieties or in wild relatives of watermelon, e.g., alleles encoding functional Ts-proteins comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more amino acid sequence identity to SEQ ID NO: 1. Mutant alleles of such allelic variants of the Ts-gene can be generated and/or identified, which result in a reduced seed size in watermelon plants homozygous for the mutant allele, compared to a plant homozygous for the wild type allele.
(14) Mutant alleles can affect the expression of the Ts-gene, e.g., knock-down expression of the endogenous Ts-gene or knock-out expression of the gene, leading to a reduced amount of the functional, wild type Ts-protein being present in the plant in tissues and under conditions when the Ts-gene is expressed, or even no wild type Ts-protein being present in the plant, at least when such a mutant allele is in homozygous form. Such mutant alleles can be generated by mutations in the regulatory elements of the Ts-gene, in particular the promoter of the Ts-gene.
(15) The decrease in the expression of an Ts-gene or ts-allele can, for example, be determined by measuring the quantity of RNA transcripts encoding Ts proteins (e.g., mRNA), e.g., using Northern blot analysis or RT-PCR. Here, a reduction preferably means a reduction in the amount of transcripts by at least 10%, 20%, 30%, 40%, 50%, in particular by at least 60% or 70%, preferably by at least 80% or 85% or by at least 90% or 95% or 100%, compared to the wild type allele. If the decrease is 100% this is a knock-out of the ts-allele, otherwise it is referred to as a knock-down.
(16) The decrease in the amount of Ts protein, which results in a reduced activity of these proteins in the plant cells or plants concerned, can, for example, be determined by immunological methods such as Western blot analysis, ELISA (Enzyme Linked Immuno Sorbent Assay) or RIA (Radio Immune Assay). Here, a decrease preferably means a reduction in the amount of Ts proteins by at least 10%, 20%, 30%, 40%, 50%, in particular by at least 60% or 70%, or by at least 80%, 85%, 90% or by at least 95% or 100% compared to the protein made by the wild type allele.
(17) Alternatively, mutant alleles can affect the activity of the Ts-protein encoded by the is-gene, e.g., the mutant allele may be expressed normally (ts-gene expression level being the same as the wild type allele), but the protein made may comprise one or more amino acids inserted, deleted and/or replaced compared to the wild type, functional Ts-protein. Such a mutant Ts-protein may therefore have reduced function or even no activity at all (loss-of-function) in the plant compared to the wild type protein of SEQ ID NO: 1, or compared to a functional variant comprising at least 90% amino acid identity to SEQ ID NO: 1. The mutation(s) may for example change the 3-dimensional structure of the protein, or change its ability to bind certain ligands and carry out its normal function. Provean analysis can, for example, predict whether an amino acid change has an effect on the function of the protein. Of course, whether the prediction is correct should to be tested in vivo, by e.g., comparing the phenotype between a line homozygous for the mutant allele to the phenotype of a line homozygous for the wild type allele. Also 3-dimensional structure predictions can be made, using e.g. RaptorX.
(18) In one aspect herein, a reduced function Ts-protein is therefore a protein in which one or more amino acids are replaced by one or more other amino acids, especially by one or more disfavourable amino acids. In one aspect the predicted 3-dimension structure of the mutant protein deviates from the predicted structure of the wild type protein.
(19) As the present inventors have found a difference in phenotype regarding average seed size in inbred watermelon plants, dependent on the presence of either a) a functional, wild type Ts-protein (large seed size), or b) a reduced function Ts-protein (medium seed size) or c) no functional Ts-protein (small seed size), as shown in
(20) Various technologies exist which can be used to introduce mutations into a Ts-allele, such as targeted mutagenesis or random mutagenesis (using e.g., chemical mutagens, radiation, etc.). For example a population of mutagenized watermelon plants, such as an M2 population, can be screened for mutations in the endogenous Ts-gene being present. This can for example be done using TILLING (Targeting Induced Local Lesions IN Genomes), which has been described by McCallum et al. (2000, Plant Physiology 123, 439-442). Such a method of identifying mutants in the Ts-allele are encompassed herein, as are plants and plant parts comprising such mutant ts-alleles.
(21) When a plant comprising a mutant ts-allele, such as an allele encoding a protein comprising one or more amino acids being inserted, deleted or replaced compared to the wild type Ts protein encoded by the wild type Ts-allele, has been identified, the plants can be selfed to generate a plant homozygous for the mutant allele and such plants can then be grown and phenotyped for average seed size of the seeds produced in the fruits of the plants (after self-pollination). Thus, mature fruits can be harvested and the seeds can be weighed. The average seed weight of e.g., at least three measurements of 10 seeds of a seedlot can then be compared to the average seed weight of the control plant in which the wild type Ts-allele is present (e.g., the non-mutated starting line). Preferably, several plants (e.g., at least 3, 4, 5 or more) comprising the mutant allele and several control plants are grown under the same environment in order to compare the phenotypes (average seed size in the fruits). Preferably the average seed size is determined by taking three (or more) weight measurements of 10 seeds of a seedlot. A seedlot is preferably composed of the seeds of several fruits (e.g., three or more) of several plants (e.g., three or more) of a line. If the average seed size of the plant comprising the mutant allele is significantly reduced compared to the average seed size of the control, then a mutant allele has been identified which can be used for watermelon breeding.
(22) Thus, in one aspect, the mutant allele encodes a mutant Ts-protein which comprises one or more amino acids inserted, deleted or replaced compared to the functional wild type Ts-protein. In principle, any amino acid insertion, deletion and/or replacement compared to the functional wild type protein may lead to the mutant protein having reduced function or no function, i.e., resulting in a reduction in seeds size when the mutant allele is in homozygous form.
(23) One embodiment of the disclosure, therefore, concerns watermelon plant cells, plant parts or plants comprising a mutant allele of a Ts-protein-encoding gene characterized in that the mutant allele comprises or effects one or more of the mutations of: a) a deletion, truncation, insertion, point mutation, nonsense mutation, missense or non-synonymous mutation, splice-site mutation, frame shift mutation in the genomic sequence; b) a mutation in one or more regulatory sequences; c) a deletion, truncation, insertion, point mutation, nonsense mutation, missense or non-synonymous mutation, splice-site mutation, frame shift mutation in the coding sequence; d) a deletion, truncation, insertion, point mutation, nonsense mutation, missense or non-synonymous mutation, splice-site mutation, frame shift mutation in the pre-mRNA or mRNA; and/or e) a deletion, truncation, insertion or replacement of one or more amino acids in the Ts-protein.
(24) In one aspect, the mutant allele results in reduced expression or no expression of the is-gene or the mutant allele encodes a mutant Ts-protein having a decreased function or a loss-of-function.
(25) Therefore, in one aspect, a watermelon plant or plant part is provided comprising at least one copy of a mutant allele of a gene name Ts-gene, wherein said mutant allele results in reduced expression or no expression of the Ts-gene, said gene encoding a wild type, functional Ts-protein of SEQ ID NO: 1 or a functional protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, or wherein said mutant allele encodes a mutant Ts-protein having a decreased function or a loss-of-function compared to the wild type Ts-protein.
(26) A watermelon plant or plant part is provided comprising at least one copy of a mutant allele of a gene named Ts-gene, said Ts-gene encodes a functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, wherein the mutant allele has reduced expression or no expression compared to the wild type allele of the Ts-gene, or wherein the mutant allele encodes a mutant Ts-protein having reduced functioned or loss of function compared to the wild type Ts-protein of SEQ ID NO: 1 or the wild type Ts-protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1.
(27) Thus, a watermelon plant or plant part is encompassed herein comprising at least one copy of a mutant allele of a gene named Ts-gene, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a (functional) protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1 (i.e., a functional variant of the protein of SEQ ID NO: 1), wherein the mutant allele has reduced expression or no expression compared to the wild type allele of the Ts-gene, or wherein the mutant allele encodes a mutant Ts-protein having reduced functioned or loss of function compared to the wild type Ts-protein.
(28) Functional variants of the Ts-protein may exist in different watermelon lines or varieties or even wild watermelon plants or wild relatives of watermelon. Such functional variants can be identified by e.g., sequencing or RT-PCR to analyze the mRNA transcripts and aligning the amino acid sequence with SEQ ID NO: 1 or the genomic sequences with SEQ ID NO: 2. Such an alignment is preferably done using pairwise alignment methods, such as the program Emboss Needle (using the default parameters). The phenotype of the allele can be analyzed in a line homozygous for the variant Ts-allele and from the phenotype one can also conclude whether or not the Ts-allele encodes a functional Ts-protein, by looking at the average seed size of the fruits produced by the plant. If such a variant allele is present in wild material, it may first need to be crossed into a cultivated watermelon line before determining the phenotype and functionality. Mutant alleles of such functional variants can be made in the same way as described herein for making mutant alleles for SEQ ID NO: 1 (e.g. by mutagenesis techniques or gene editing techniques).
(29) The mutant allele reduces the average seed size in the fruits of said plant when the mutant allele is in homozygous form compared to the average seed size in the fruits of plants comprising the wild type Ts-allele in homozygous form. To compare the average seed size of a plant comprising the mutant allele in homozygous form to a plant comprising the wild type allele in homozygous form, both plants preferably comprising the same seed size haplotype on chromosome 6, i.e., both comprise the S, M or L haplotype for chromosome 6.
(30) Reduced expression or no expression of a mutant ts-allele means that there is a mutation in a regulatory region of the Ts-gene, such as the promoter, whereby reduced mRNA transcript or no mRNA transcript of the ts-allele is being made, compared to plants and plant parts comprising a wild type Ts-allele. The decrease in the expression can, for example, be determined by measuring the quantity of mRNA transcripts encoding Ts-protein, e.g., using Northern blot analysis or RT-PCR. For example the mutant allele may result in a reduction in the amount of mRNA transcripts by at least 10%, 20%, 30%, 40%, 50%, in particular by at least 60% or 70%, optionally by at least 80% or 85% or by at least 95%, or even by 100% compared to the plant or plant part comprising a wild type Ts-gene. Such a mutant allele may comprise a mutation in the regulatory sequence, e.g., in the promoter. The expression can be easily measured by e.g., measuring the amount of mRNA/cDNA being produced, e.g., in the fruit flesh during fruit development. The cDNA sequences encoding the Ts-protein of SEQ ID NO: 1 is depicted in SEQ ID NO: 3. The expression of cDNA sequences encoding functional variants comprising at least 90% sequence identity to SEQ ID NO: 1 can equally be analyzed and/or the expression quantified. The mutant allele will thus result in a reduced amount of wild type Ts-protein (of SEQ ID NO: 1 or a functional variant protein comprising at least 90% identity to SEQ ID NO: 1) being made in the plant or even no wild type Ts-protein being made. Therefore, also the amount of wild type Ts-protein being made can be measured in the plant or plant part and compared to the control plant or plant part (comprising the wild type allele).
(31) As mentioned, in one aspect, the Ts-protein comprises one or more amino acids replaced, inserted or deleted compared to the wild type protein and is, therefore, referred to as mutant Ts-protein. Thus, for watermelon, one or more amino acids are inserted, deleted or replaced compared to the wild type Ts protein of SEQ ID NO: 1 or compared to a wild type (functional variant) Ts-protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% sequence identity to SEQ ID NO: 1, whereby the mutant protein has reduced function or loss of function compared to the wild type protein and thus results in a reduction in average seed size when the mutant allele is present in homozygous form in a diploid watermelon plant, compared to a diploid plant homozygous for the wild type allele.
(32) It is for example disclosed herein that the replacement of amino acid 204 of SEQ ID NO: 1 (D204), or the equivalent amino acid in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% sequence identity to SEQ ID NO: 1, leads to a reduced function Ts-protein.
(33) An equivalent amino acid in a protein comprising at least 90% sequence identity to the wild type Ts protein can be easily identified by aligning the two protein sequences pairwise (e.g. using the program Needle). The equivalent amino acid of the D204 of SEQ ID NO: 1 may for example be at position 205 or 203 in a sequence comprising at least 90% sequence identity to SEQ ID NO: 1.
(34) An effect on reducing protein function, or abolishing protein function, may be seen for a replacement of any one or more amino acid of the wild type Ts protein, or for mutant proteins having one or more amino acids inserted or deleted compared to the functional Ts protein. As mentioned, the effect on protein function can be analyzed in vivo, in plants homozygous for the mutant allele.
(35) In one aspect one or more amino acids of the wild type Ts-protein are replaced by one or more disfavourable amino acids in the mutant protein, reducing the function of the mutant protein. In one aspect the replacement of one or more amino acids by disfavourable amino acids is outside of the Acetyl transferase domain, so that the Acetyl transferase domain remains functional. In another aspect the replacement of one or more amino acids by disfavourable amino acids is within the Acetyl transferase domain, so that the Acetyl transferase domain becomes non-functional.
(36) In one aspect the predicted effect of the mutant protein on protein function can be analyzed by determining the 3-dimensional predicted structure of the wild type and of the mutant protein e.g. by RaptorX Contact Prediction, to see if the predicted structure is changed. Ultimately, the effect of the mutant allele on the phenotype conferred by the gene should be determined, preferably in watermelon lines having similar genetic backgrounds (such as near isogenic lines).
(37) Preferably, the phenotype regarding seed size is compared in plants having a genetic background whereby the seed size haplotypes for chromosome 6 are identical, either S, M or L, so that the effect of the mutant allele on chromosome 2 is not influenced by the haplotype on chromosome 6.
(38) The N-acetyltransferases (NAT) (EC 2.3.1.-) are enzymes that use acetyl coenzyme A (CoA) to transfer an acetyl group to a substrate. In one aspect, the wild type Ts protein comprises a conserved Acetyl transferase domain (Pfam domain PF00583, Acetyltransf_1), i.e., a domain comprising 95%, 96%, 97%, 98%, 99% or 100% amino acid identity to amino acids 54 to 146 of SEQ ID NO: 1. Thus, in one aspect, the wild type Ts-gene encodes a wild type Ts-protein comprising a Acetyl transferase domain which is 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 54 to 146 of SEQ ID NO: 1.
(39) In one aspect, the mutant ts-allele comprises a mutation whereby one or more amino acids in said Acetyl transferase domain are replaced, inserted or deleted. As the Acetyl transferase domain is required for the in vivo N-acetyltransferase function of the protein, any amino acid insertion, replacement or deletion will likely reduce or abolish the proper in vivo function of the protein, as can be verified by determining e.g., the phenotype (average seed size) as described herein.
(40) Regarding mutations in the conserved Acetyl transferase domain (or in other parts of the protein), in one aspect especially mutations which lead to amino acid replacements, whereby the properties of the wild type amino acid and the replaced amino acid are different, e.g. replacement by disfavoured amino acids, are one aspect herein, as such different amino acid properties will reduce or abolish the proper protein folding (resulting in e.g. a deviant 3-dimensional structure from the wild type) and/or the normal function of the protein or of the domain. So, for example a replacement of a non-polar amino acid by a polar amino acid (comprising a hydrophilic side chain), or vice versa, or the replacement of an amino acid having a charged side chain with a non-charged or differently charged side-chain.
(41) Thus, in one aspect any one (or more) of the amino acids of the conserved Acetyl transferase domain are replaced by one or more disfavored amino acids. The resulting mutant allele can then be tested for its predicted 3-dimensional structure and/or for its function by generating a plant homozygous for the mutant allele and analysing the phenotype.
(42) In another aspect any one (or more) of the amino acids outside of the conserved Acetyl transferase domain are replaced by one or more disfavored amino acids. The resulting mutant allele can then be tested for its predicted 3-dimensional structure and/or for its function by generating a plant homozygous for the mutant allele and analysing the phenotype.
(43) When amino acids from one amino acid to another amino acid are mentioned herein this includes the start/first and end/last amino acid mentioned.
(44) In another aspect, the Ts protein comprises one or more amino acids inserted, replaced or deleted compared to the wild type Ts-protein, whereby the mutant Ts-protein has reduced function or a loss of function, whereby the amino acid insertion, replacement or deletion is in the N-terminal part of the protein, from amino acid 6 to 180, or from amino acid 4 to 371, or from amino acid 4 to 154, or from amino acid 54 to 146, or from amino acid 1 to 300, or from amino acid 1 to 250, or from amino acid 1 to 154 of SEQ ID NO: 1, or the equivalent amino acid(s) in a variant protein comprising at least 90% sequence identity to SEQ ID NO: 1. The N-terminal part of the protein appears to be the conserved part of the protein, required for in vivo function. For example, from amino acid 4 to 371 several helix structures and beta sheets are present in the 3-dimensional structure of the protein, more particularly from amino acid 4 to 154 (comprising the Acetyl transferase domain from amino acid 54 to 146) such 3-dimensional structures are present, which indicates that the N-terminal part plays a significant role in the functionality.
(45) In one aspect, the insertion, deletion and/or replacement of one or more amino acids is predicted by e.g., Provean analysis to result in reduced or abolished protein function, i.e., the Provean analysis can be used to predict if the insertion, replacement or deletion has a deleterious effect. In one aspect, the insertion, deletion and/or replacement of one or more amino acids is predicted by 3-dimensional structure prediction to result in a deviant 3-ensional structure and/or a reduced or abolished protein function.
(46) However, also the insertion, replacement or deletion of one or more amino acids in other parts of the Ts-protein can reduce the in vivo function or even abolish the in vivo function. This is illustrated by the mutant Ts-protein in which amino acid 204 is replaced, resulting in a reduced in vivo function of the protein.
(47) In one aspect it is preferred that the plant comprises a mutant ts-allele, whereby some Ts-protein function remains in the plant, so that average seed size is reduced compared to the plant which is homozygous for the wild type allele, but seed size is larger than in a plant which is homozygous for a knock-out or deletion of the ts-allele or a mutant allele encoding a non-functional Ts-protein.
(48) To achieve the presence of some Ts-protein function in the plant (thus, a reduced Ts-protein function but not an abolished function), either gene expression of the mutant allele may be reduced compared to the wild type allele or the encoded mutant Ts-protein may have reduced function compared to the wild type protein. So for example the mutant allele is modified in the promoter so that gene expression is equal to or less than 90%, 80%, 70%, 60%, 50% or 40%, 30%, 20% or 10% of the wild type level of gene expression. Or the mutant allele encodes a mutant protein which has some functionality in vivo, i.e. a reduced function Ts-protein.
(49) In one aspect a reduced function Ts-protein comprises an intact/functional (wild type) Acetyl transferase domain (e.g. having an amino acid sequence identical to the Acyl transferase domain in the wild type protein, from amino acid 54 to 146 of SEQ ID NO: 1), but it has a reduced in vivo function due to one or more amino acids being inserted, deleted and/or replaced outside of the Acetyl transferase domain, e.g. any amino acid starting at amino acid 147 and ending at amino acid 412, or starting at amino acid 147 and ending at amino acid 400, or starting at amino acid 150 and ending at amino acid 390, especially starting at amino acid 155 and ending at amino acid 265. Replacement one or more (e.g. 2, 3, 4, 5) amino acids in the middle region of the Ts protein, i.e. from amino acid 155 to 265 of SEQ ID NO: 1 (or the equivalent amino acids in a protein comprising at least 90% sequence identity to SEQ ID NO: 1) is likely to reduce protein function without abolishing the function altogether. The mutant protein in one aspect comprises one or more amino acid replacements whereby amino acids are replaced with disfavoured amino acids, such as a polar amino acid being replaced by a non-polarpolar amino acid. For example, D (Asp) is a polar amino acid, which may be replaced by Y (Tyr), which is another polar amino acid.
(50)
(51) In a specific aspect, amino acid 204 of SEQ ID NO: 1, or the equivalent amino acid of a functional variant of SEQ ID NO: 1 (i.e., a functional Ts protein comprising at least 90% sequence identity to SEQ ID NO: 1), is deleted or replaced by a different amino acid, rendering the mutant Ts-protein to have a reduced function. In one aspect, D204 (Asp 204) is replaced by Y (Tyr) or by another polar amino acid. In a further aspect, D204 (Asp 204) is replaced by any amino acid, except for Y (Tyr), e.g., by N (Asn), H (His), V (Val), G (Gly), A (Ala) or E (Glu).
(52) Thus, in one aspect the plant, plant part or plant cell comprises a mutant allele of the is-gene, whereby the above amino acid insertions, replacements or deletions are encoded by the allele.
(53) In yet another aspect, the mutant Ts-protein comprises one or more amino acids deleted compared to the wild type Ts-protein, whereby the mutant protein has reduced function or a loss of function. For example, the mutation may lead to a premature STOP codon in the coding sequence and/or to a frame shift in the coding sequence or to a splice variant, whereby one or more amino acids are deleted. The mutant allele may thus encode e.g., a truncated Ts-protein, whereby part of the C-terminal (the end of the protein) is deleted. In one aspect, the mutant allele encodes a mutant Ts protein lacking at least 30, 40, 50, 60, 70, 80, 90, 100 or more of the C-terminal amino acids of SEQ ID NO: 1 or of a functional variant protein comprising at least 90% sequence identity to SEQ ID NO: 1. A frame-shift mutation may also result in a truncated Ts-protein. Even if certain amino acids of the wild type protein are replaced by other amino acids due to the frame shift, the protein is still regarded as being truncated, as the wild type amino acids are not present following the frame shift.
(54) Also encompassed herein are mutant alleles, wherein all or part of the wild type Ts-allele is deleted, e.g., all or part of the genomic sequence, all or part of the promoter sequence or other regulatory elements, or even the entire allele may be deleted. In one aspect, SEQ ID NO: 8 is deleted. In another aspect, the deletion is not the deletion of SEQ ID NO: 8, but a different deletion comprising the Ts-allele, preferably a smaller deletion of genomic DNA comprising all or part of the Ts-allele. The large deletion in the original Sugar Baby mutant is almost 14000 bases (as shown in SEQ ID NO: 8) and contained maybe other genes or other genomic DNA which is preferably not deleted along with the Ts-gene, or with part of the Ts-gene. The genomic sequence of the Ts-gene is 1982 (SEQ ID NO: 2) bases long. The upstream regulatory elements, such as the promoter, are present in the 1000 to 2000 base region upstream of the genomic sequence. Thus, in one particular aspect, the deletion of all or part of the Ts-allele is any deletion, but not the same deletion as present in the original Sugar Baby mutant and as present in variety WH9716, i.e., it is not the deletion of SEQ ID NO: 8, but a different deletion. A deletion of all or part of the Ts-allele can for example be generated by Crispr based methods or other targeted genome editing methods such as TALEN. In Liu, Y., Gao, Y., Gao, Y. et al. (Targeted deletion of floral development genes in Arabidopsis with CRISPR/Cas9 using the RNA endoribonuclease Csy4 processing system. Hortic Res 6, 99, 2019) specific exons were deleted, leading to loss-of-function mutations. Such deletions are encompassed herein for the Ts-allele, whereby all or part of the allele is deleted, resulting in no functional Ts protein being made anymore.
(55) In another aspect, an insertion of DNA into the Ts-allele is encompassed, rendering the Ts-allele to have reduced expression or no expression compared to the wild type allele or rendering the encoded Ts-protein to have reduced function or no function. For example, a transposable element inserted into the allele can render the allele to be a knock out allele, but also targeted genome editing can insert nucleotides into the allele.
(56) In one aspect, a mutant ts-allele as described herein, or the deletion of all or part of the Ts-allele as described herein, is heterozygous in a diploid watermelon plant cell, plant part or plant or seed, i.e., only one chromosome 2 comprises the mutant allele or the deletion. In another aspect, the mutant ts-allele, or the deletion of all or part of the Ts-allele, is homozygous in a diploid plant cell, plant part or plant or seed, i.e., both chromosomes 2 comprise the mutant allele or the deletion.
(57) The plant cells, parts and plants are preferably cultivated plants, such as elite breeding lines or varieties, and not wild plants. The watermelon plant may be any type of watermelon plant. In a preferred aspect, it is an inbred watermelon line, which e.g., can be used as a parent line to make F1 hybrid watermelon seeds and F1 hybrid plants that can be grown from the seeds. In a further aspect, F1 hybrid watermelon seeds comprising at least one copy of a mutant ts-allele (or the deletion of all or part of the Ts-allele) are also an embodiment herein. Preferably, the F1 hybrid seeds and plants comprise two copies of a mutant ts-allele (or the deletion of all or part of the Ts-allele on both chromosomes) as described herein.
(58) Watermelon plants, and parts thereof, which comprises at least one copy of the mutant ts-allele, or a deletion of all or part of the Ts-allele, may be diploid, tetraploid or triploid. A tetraploid plant comprising, in one aspect, four copies of the mutant ts-allele or of the deletion of all or part of the Ts-allele, and a triploid plant three copies.
(59) In one aspect, the diploid plant comprising the mutant ts-allele (or the deletion of all or part of the Ts-allele) in homozygous form is a double haploid plant (DH), e.g., a double haploid watermelon plant or plant cell or plant part.
(60) Seeds from which any of the watermelon plants described can be grown are also encompassed herein, as are parts of such a plant, such as fruits, flowers, cells, roots, rootstocks, scions, leaves, stems, vegetative propagations, cuttings, seed propagations (e.g., selfings) and also in vitro cell- or tissue cultures, as well as pollen, ovaries, etc. are encompassed herein.
(61) The mutant ts-allele, or the deletion of all or part of the wild type Ts-allele, may be present in a watermelon plant in combination with any of the chromosome 6 haplotypes described herein, i.e., either with the Small, Medium or Large haplotype for chromosome 6. Preferably, the mutant ts-allele (or the deletion of all or part of the wild type Ts-allele) and the chromosome 6 haplotype are both in homozygous form. Thereby, any of the combinations of the chromosome 2 haplotype NO or RE of
(62) Plants comprising the mutant ts-allele, or the deletion of all or part of the wild type Ts-allele, according to the disclosure may thus be used in the seed size prediction models and methods for identification and/or selection of plants described elsewhere herein and illustrated in
(63) Variety SP-4 is a commercial pollinizer described in e.g. U.S. Pat. No. 7,550,652B2. Obviously, the same or other ts-mutant alleles can be generated de novo as described herein.
(64) As the fruits produced on plants which are homozygous for the mutant is allele (or deletion of all or part of the Ts-allele) produce significantly smaller seeds than the fruits of plants which are homozygous for the wild type Ts-allele, such fruits and parts of fruits (e.g., cut pieces) are also an embodiment herein. Fruits may be harvested, optionally placed in containers or packages. Fruits may also be processed. The fruits and parts thereof can be easily distinguished by the presence of the mutant ts-allele (or the deletion of all or part of the Ts allele) in their genomic DNA. So the DNA of e.g., the fruit flesh may be analyzed for the presence of the mutant ts-allele (or the deletion of all or part of the Ts allele). Fruits may be processed, e.g., cut, sliced, cubed, etc. for e.g., fresh consumption. Thus, also parts of fruits are encompassed herein.
(65) Also fruits of plants heterozygous for a mutant ts-allele (or the deletion of all or part of the Ts allele) as described herein are an aspect of the disclosure.
(66) Likewise, plant parts comprising at least one copy of a mutant ts-allele (or the deletion of all or part of the Ts allele) are encompassed herein, such as a cell, a flower, a leaf, a stem, a cutting, an ovule, pollen, a root, a rootstock, a scion, a fruit, a protoplast, an embryo, an anther.
(67) In a further aspect, a vegetatively propagated plant propagated from a plant part according to the disclosure is provided.
(68) Also propagating and non-propagating cells comprising at least one copy of a mutant ts-allele (or the deletion of all or part of the Ts allele) are provided herein. It is understood that such propagating or non-propagating cells can be part of a plant organ or of an entire plant, or they can be isolated, e.g., in a cell culture or tissue culture. In one aspect, the term plant part refers to plant cells, or plant tissues or plant organs that comprise one or more of the mutant ts-alleles (or the deletion of all or part of the Ts allele) described herein. In one aspect a plant part can grow into a plant and/or live on photosynthesis (i.e., synthesizing carbohydrate and protein from the inorganic substance, such as water, carbon dioxide and mineral salt). In another aspect, a plant part cannot grow into a plant and/or live on photosynthesis (i.e., synthesizing carbohydrate and protein from the inorganic substance, such as water, carbon dioxide and mineral salt). Thus, a plant part can be propagating or non-propagating.
(69) Apart from watermelon plants and plant parts comprising a mutant ts-allele, also methods for generating mutations in the Ts-gene and methods for identifying or selecting plants comprising a mutant ts-allele are encompassed herein.
(70) In one aspect a method for modifying the endogenous Ts-gene on chromosome 2 of the watermelon genome is provided, comprising using a targeted gene editing method, such as a Crispr based method, to introduce mutations, such as nucleotide additions or deletions, into the endogenous Ts-allele and selecting plants comprising the mutant Ts-allele, wherein the endogenous Ts-gene is the gene encoding the protein of SEQ ID NO: 1 or a protein comprising at least 90% sequence identity to SEQ ID NO: 1.
(71) In another aspect a method for modifying the endogenous Ts-gene on chromosome 2 of the watermelon genome is provided, comprising using a random mutagenesis method, such as treatment of seeds or plant parts with a mutagenic chemical agent or mutagenic radiation, to introduce mutations, such as nucleotide additions or deletions, into the endogenous Ts-allele and selecting plants comprising the mutant Ts-allele, wherein the endogenous Ts-gene is the gene encoding the protein of SEQ ID NO: 1 or a protein comprising at least 90% sequence identity to SEQ ID NO: 1.
(72) A further embodiment of the disclosure concerns a method for production of a plant comprising the steps of a) providing a mutated or genetically modified plant (or seed) or a population of mutated or genetically modified watermelon plants (or seeds), b) determining if a plant (or seed) of a) has a mutation in an allele of a Ts protein-encoding gene (i.e., comprises a mutant ts-allele) and/or comprises a deletion of all or part of the wild type Ts allele, optionally c) growing/cultivating the plants obtained under b).
(73) In one aspect, the disclosure provides a method for production of a plant comprising the steps of a) introducing mutations or genetic modifications in a plant (or seed) or in a population of plants (or seeds) and optionally selfing the plants, b) determining if the plant (or seed) under a) has a mutation in an allele encoding a Ts protein-encoding gene (i.e., comprises a mutant ts-allele) and/or comprises a deletion of all or part of the wild type Ts allele and selecting a plant comprising such a mutant allele or deletion of all or part of the allele, and optionally c) growing/cultivating the plants obtained under b).
(74) Mutations can be introduced by e.g., chemical or radiation treatment or genome editing techniques. Other genetic modifications may be introduced by targeted gene editing techniques, such as Crispr based techniques.
(75) The mutant allele in one aspect encodes a mutant Ts-protein, comprising reduced function or loss of function, whereby the plant homozygous for the mutant Ts-allele produces in its fruits seeds having an average seed size which is significantly smaller than the average seed size produced in fruits of plants which are homozygous for the wild type Ts-allele.
(76) Any method for mutating or genetically modifying or targeted genome editing of the Ts-gene is encompassed herein.
(77) However, in one aspect, the order of the steps can also be different, comprising: a) providing a mutant plant (or seed) or a population of mutant plants (or seeds) or a genetically modified plant (or seed) or a population of genetically modified plants (or seeds), b) determining if a plant (or seed) of a) has a mutation in an allele of a Ts protein-encoding gene (i.e., comprises a mutant ts-allele) and/or comprises a deletion of all or part of the wild type Ts allele, optionally c) selecting a plant comprising a mutation in an allele of a Ts-protein encoding gene (i.e., comprises a mutant ts-allele) and/or comprises a deletion of all or part of the wild type Ts allele, and optionally d) selfing the plant of b) or c) to generate a plant comprising the mutant allele or the deletion in homozygous form, and optionally e) determining the average seed size produced in the fruits of the plant of step c) or d).
(78) Or the steps may comprise: a) introducing mutations in a population of plants (or seeds) (and optionally selfing the plants) b) determining if a plant (or seed) of a) has a mutation in an allele encoding a Ts protein-encoding gene (i.e., comprises a mutant ts-allele) and/or comprises a deletion of all or part of the wild type Ts-allele and, optionally, c) selecting a plant comprising such a mutation or deletion, and optionally d) selfing the plant of b) or c) to generate a progeny plant comprising the mutant allele or deletion in homozygous form, and, optionally, e) determining the average seed size produced in the fruits of the plant of step c) or d).
(79) Also provided is a method of targeted gene editing of the endogenous Ts-gene of watermelon, comprising generating one or more nucleotide insertions, deletions or replacements in the endogenous watermelon Ts-allele, e.g. in the promoter sequence or the coding sequence. This can for example be done by targeted gene editing methods, such as Crispr based methods, whereby the Ts-gene is the target gene. The Crispr construct is removed/crossed out after editing and the non-gmo progeny plant comprising the mutant ts-allele is selected and optionally used in further breeding.
(80) Furthermore a method of generating and/or identifying a plant comprising a mutant allele of the endogenous Ts-gene of watermelon is provided, comprising generating one or more nucleotide insertions, deletions or replacements in the endogenous watermelon Ts-allele, e.g. in the promoter sequence or the coding sequence, by mutagenesis techniques (such as treatment of plants or parts with radiation or chemical agents to induce random mutations). This can for example be done by treating seeds with a mutagenic agent and identifying progeny plants/seeds comprising a mutant ts-allele.
(81) In a different aspect, a method of producing watermelon fruits comprising at least one copy of a mutant ts-allele (or the deletion or all of part of the Ts-allele), preferably two copies, is provided said method comprising growing a watermelon plant comprising the mutant allele (or the deletion of all or part of the Ts-allele) and optionally harvesting the fruits produced by said plants.
(82) A method for generating a watermelon plant comprising a mutant allele of a gene named Ts-gene, or a deletion of all or part the Ts-gene, is provided, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, comprising identifying and/or selecting a mutant plant from e.g., a population of mutant plants, or progeny thereof obtained by selfing, comprising a mutant Ts-gene allele or a deletion of all or part the Ts-gene, or generating a watermelon plant comprising a mutant Ts-gene allele using a genome editing technique.
(83) A method for determining whether a watermelon plant or plant part comprises at least one copy of a mutant allele of a gene named Ts-gene or a deletion or all of part of the Ts-gene, is provided, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, said method comprising analyzing the genomic DNA sequence, gene expression or protein amount or amino acid sequence of the Ts-gene of the plant or plant part.
(84) A method of using the nucleotide sequence (e.g., all or part of the genomic sequence or molecular markers linked thereto or all or part of the mRNA/cDNA sequence) or protein sequence of the Ts-gene, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, in selecting watermelon plants or plant parts.
(85) As the sequences of the Ts-gene are now disclosed and the location on chromosome 2 is disclosed, these sequences can be used in breeding of watermelon plants, such as marker assisted selection of Ts alleles (wild type or mutant alleles). Therefore, also a method for using the Ts-gene, or any markers physically linked thereto, in breeding, e.g., in marker assisted selection, is provided herein.
(86) A method for selection a watermelon plant or plant part comprising a) detecting the presence of a wild type Ts allele or a mutant ts-allele or a deletion of all or part of the Ts allele and b) selecting the plant based on step a). This can be done by e.g., method which are commonly used to detect alleles, such as molecular markers linked to an allele or markers within an allele or DNA differences between the alleles and the like. Thus, allele specific detection methods can easily be developed by the skilled person.
(87) The disclosure also provides for the use of any of SEQ ID NO: 1, 2, 3 and/or 8 or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NO: 1, 2, 3 and/or 8 for selecting a plant or plant line or plant part.
(88) Likewise, the disclosure provides for the use of any of the chromosome 6 markers, i.e., SEQ ID NO: 4 and/or 5 (SNP_01) and/or SEQ ID NO: 6 and/or 7 (INDEL marker) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NO: 4, 5, 6 or 7 for selecting a plant or plant line or plant part are an embodiment herein. These markers can be used to select and/or determine the chromosome 6 haplotype of a watermelon plant or plant part.
(89) In one aspect, a method for identifying a plant or plant part or cell comprising in its genome at least one copy of a mutant allele of Ts-gene or a deletion of all or part of the Ts-allele is provided, said method comprising determining whether the plant or plant part or cell comprises in its genome at least one mutant ts-allele (or a deletion of all or part of the Ts-allele).
(90) This method may involve analyzing (directly or indirectly) the gene expression of the ts-allele, and/or the genomic nucleotide sequence of the ts-allele or linked to the ts-allele, or the mRNA nucleotide sequence of the ts-allele or the mRNA amount (expression), or the protein sequence of the Ts protein, or the protein amounts of the Ts protein of the plant or plant part or plant cell, to determine if the gene expression is knocked down or knocked out compared to the wild type plant or plant part or plant cell, or if the encoded protein comprises one or more amino acid insertions, deletions or replacements compared to the wild type Ts protein, or if all or part of the wild type Ts-allele is deleted.
(91) One method for analyzing the presence of a mutant ts-allele, is for example to assay the presence of a Single Nucleotide Polymorphism (SNP) in the genomic sequence of the ts-allele, by, for example, designing primers for the SNP and genotyping plants or plant parts for the genotype of that particular SNP. For example, in the Examples a KASP assay for the Single Nucleotide Polymorphism that changes the wild type codon GAC (coding for D, Asp, at amino acid 204 of SEQ ID NO: 1) into codon TAC (coding for Y, Tyr at amino acid 204 of SEQ ID NO: 1) can be used to detect the mutant ts-allele, which encodes the mutant Ts protein comprising a Tyrosine at amino acid 204 and having reduced function compared to the wild type Ts protein.
(92) A method for detecting the presence of a ts-allele encoding the mutant Ts protein comprising a different amino acid than Asp (D) at amino acid 204 of SEQ ID NO: 1 in a watermelon plant or plant part is therefore also an embodiment herein. The different amino acid may be Tyr (Y).
(93) Similarly, the absence in the genome of all or part of the wild type Ts-allele can be analyzed by determining the presence or absence of all or part of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and/or SEQ ID NO: 8, or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 8. Optionally, a plant is selected which lacks all or part of the wild type Ts-allele in its genome. Such a plant is also an embodiment hereon.
(94) In one aspect, a method for identifying and/or selecting a plant or plant part or cell comprising in its genome a deletion of all or part of the Ts-gene, is provided, said method comprising determining the absence of all or part of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and/or SEQ ID NO: 8, or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, 2, 3 or 8.
(95) In one aspect, a method for identifying and/or selecting a plant or plant part or cell comprising in its genome at least one copy of a mutant allele of is gene, or a deletion of all or part of the Ts-gene, is provided, said method comprising determining whether the plant or plant part or cell comprises in its genome at least one copy of a mutant allele of a gene named Ts-gene or a deletion or all of part of the Ts-gene, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, wherein the mutant allele of the Ts-gene or the deletion of all or part of the Ts-gene results in reduced or no expression of the Ts-gene compared to the wild type Ts-gene or results in a mutant Ts-protein being made having reduced function or no function compared to the wild type Ts-protein.
(96) In one aspect, a method for identifying and/or selecting a plant or plant part or cell comprising in its genome at least one copy of a mutant allele of the Ts-gene is provided, said method comprising determining whether the plant or plant part or cell comprises in its genome at least one mutant ts allele, wherein the mutant ts allele encodes a different amino acid than the wild type Asp at amino acid 204 of SEQ ID NO: 1 or wherein the encoded protein lacks at least amino acid 204. Optionally, other amino acids may be lacking, such as one or more amino acids following and/or preceding amino acid number 204.
(97) Thus, one aspect of the disclosure comprises a method for determining whether a plant, plant part or plant cell comprises one or more copies of a mutant ts-allele by a method selected from analyzing one or more nucleotides of the genomic ts-allele in a genotyping assay, analyzing the mRNA (or cDNA) expressed by the ts-allele or analyzing the Ts protein amount and/or amino acid sequence (using e.g., antibody based detection).
(98) Isolated proteins and isolated nucleotide molecules of any of SEQ ID NO: 1, 2, 3 and/or 8 or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NO: 1, 2, 3 and/or 8 are provided herein, as are fragments thereof. For example, PCR primers which amplify all or part of the ts-allele and/or detection kits comprising such primers.
(99) In one aspect the plants, plant parts and plant cells according to the invention are not exclusively obtained by means of an essentially biological process as defined by Rule 28 (2) EPC (European Patent Convention).
(100) In one aspect the plants are non-GMO (not genetically modified).
(101) In one aspect the mutant alleles are generated by mutagenesis (e.g. chemical or radiation mutagenesis) or by targeted mutagenesis, especially using the CRISPR system (e.g. Crispr/Cas9 or Crispr/CpfI or other nucleases). In one aspect the cultivated plant comprising the mutant ts-allele is not a transgenic plant, i.e. non transgenic progeny are selected which do not comprise e.g. the CRISPR construct.
(102) In one aspect the mutant allele of the Ts gene comprises a human induced mutation, i.e. a mutation introduced by mutagenesis techniques, such as chemical mutagenesis or radiation mutagenesis, or targeted mutagenesis techniques, such as Crispr based techniques.
(103) A method for targeted mutagenesis of the endogenous Ts gene in watermelon is provided herein, using any targeted gene modification method, such as CRISPR based methods (e.g. Crispr/Cas9 or Crispr/CpfI), TALENS, Zinc Fingers or other methods.
(104) In one aspect an isolated mutant Ts protein and an isolated wild type Ts protein is provided or an isolated nucleic acid molecule encoding a mutant Ts protein or a wild type Ts protein. Also an antibody able to bind a mutant or wild type Ts protein is encompassed herein.
(105) Further Detection Methods:
(106) In one aspect a screening method for identifying and/or selecting seeds, plants or plant parts or DNA from such seeds, plants or plant parts comprising in their genome a mutant allele of a Ts protein-encoding gene or a wild type allele of the Ts-gene or a deletion of all or part of the Ts-gene is provided.
(107) The method comprises screening at the DNA, RNA (or cDNA) or protein level using known methods, in order to detect the presence of the mutant allele or of the wild type allele or to detect the deletion of all or part of the Ts-allele. There are many methods to detect the presence of a mutant allele of a gene or of a wild type allele of a gene or of the deletion of all or part of the gene.
(108) Thus, a method for screening and/or selecting plants or plant material or plant parts, or DNA or RNA or protein derived therefrom, for the presence of a mutant is allele, or for the presence of a wild type Ts-allele, or for the presence of a deletion of all or part of the Ts-allele, is provided comprising one or more of the following steps: a) determining the gene expression of the endogenous Ts gene, e.g. to determine if it is reduced or abolished; b) determining the amount of wild type Ts protein, e.g. to determine if it is reduced or abolished; c) determining if a mutant or if a wild type mRNA, cDNA or genomic DNA encoding a mutant or wild type Ts protein is present; d) determining if a mutant Ts protein is present and/or of a wild type Ts protein is present; e) determining if plants or progeny thereof produce fruits having seeds with a (average) smaller seeds size than the plants homozygous for the wild type Ts-allele; f) determining whether chromosome 2 lacks all or part of the Ts-gene.
(109) Routine methods can be used, such as RT-PCR, PCR, antibody based assays, sequencing, genotyping assays (e.g. allele-specific genotyping), phenotyping, etc.
(110) The plants or plant material or plant parts may be watermelon plants or plant materials or plant parts, such as leaves, leaf parts, cells, fruits, fruit parts, ovaries, stem, hypocotyl, seed, parts of seeds, seed coat, embryo, etc.
(111) For example if there is a single nucleotide difference (single nucleotide polymorphism, SNP) between the wild type and the mutant allele, a SNP genotyping assay can be used to detect whether a plant or plant part or cell comprises the wild type nucleotide or the mutant nucleotide in its genome. For example the SNP can easily be detected using a KASP-assay (see world wide web at kpbioscience.co.uk) or other SNP genotyping assays. For developing a KASP-assay, for example 70 base pairs upstream and 70 base pairs downstream of the SNP can be selected and two allele-specific forward primers and one allele specific reverse primer can be designed. See e.g. Allen et al. 2011, Plant Biotechnology J. 9, 1086-1099, especially p097-1098 for KASP-assay method. Equally other genotyping assays can be used. For example, a TaqMan SNP genotyping assay, a High Resolution Melting (HRM) assay, SNP-genotyping arrays (e.g. Fluidigm, Illumina, etc.) or DNA sequencing may equally be used.
(112) Based on the difference between the genomic sequence of the wild type allele and the mutant allele, the skilled person can easily develop markers which can be used to detect specific alleles.
(113) Also provided herein is a method for identifying a watermelon plant (or plant part) comprising a mutant is allele, the method comprising detecting in the plant (or plant part) the presence of a mutant ts allele, wherein the presence is detected by at least one marker within the ts allele or by detecting the protein encoded by the ts allele. The method for detecting the mutant ts allele is selected from the group consisting of PCR amplification, nucleic acid sequencing, nucleic acid hybridization and an antibody-based assay (e.g. immunoassay) for detecting the Ts protein encoded by the allele.
(114) Also provided herein is a method for identifying a watermelon plant (or plant part) comprising a mutant ts allele comprising a mutation in a regulatory element, the method comprising detecting in the plant (or plant part) the reduced gene expression or absence of gene expression of the mutant ts allele, wherein the presence is detected by mRNA levels (cDNA) of the wild type Ts allele or by detecting the protein levels of the wild type Ts protein. The method for detecting the mutant ts allele is selected from the group consisting of PCR amplification (e.g. RT-PCR), nucleic acid sequencing, western blotting and an antibody based assay (e.g. immunoassay) for detecting the Ts protein encoded by the allele.
(115) Also provided is a method for determining, or detecting or assaying, whether a cell or of a watermelon plant or plant part comprises a mutant allele of a gene name Ts gene encoding a protein of SEQ ID NO: 1, or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% sequence identity to SEQ ID NO: 1, is provided herein. In one aspect the method comprises determining the expression of the allele, and/or determining the coding sequence of the allele and/or determining part of the coding sequence of the allele (e.g. a SNP genotype of the allele), and/or determining the amino acid sequence of the protein produced and/or the amount of protein produced.
(116) Therefore provided is in one aspect a watermelon plant or plant part comprising at least one copy of a mutant allele of a gene named Ts-gene or comprises a deletion of all or part of the Ts-gene, said Ts-gene encodes a functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94% or 95% sequence identity to SEQ ID NO: 1, wherein the mutant allele has reduced expression or no expression compared to the wild type allele of the Ts-gene, or wherein the mutant allele encodes a mutant Ts-protein having reduced functioned or loss of function compared to the wild type Ts-protein of SEQ ID NO: 1 or compared to a wild type Ts-protein comprising at least 90%, 91%, 92%, 93%, 94% or 95% sequence identity to SEQ ID NO: 1.
(117) The watermelon plant or plant part as e.g. described above is provided, wherein the mutant allele of the Ts-gene encodes a reduced function Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type protein of SEQ ID NO: 1.
(118) In one aspect the watermelon plant or plant part as e.g. described above is provided wherein the mutant allele of the Ts-gene does not encode a mutant Ts-protein in which the Aspartic acid (D) at amino acid 204 of SEQ ID NO:1 is replaced by a Tyrosine (Y).
(119) In one aspect the watermelon plant or plant part as e.g. described above is provided which does not comprise a deletion of SEQ ID NO: 8 but comprises a different deletion of all or part of the Ts-gene.
(120) In one aspect the watermelon plant or plant part as e.g. described above is provided, wherein said plant is homozygous for said mutant allele of the Ts-gene or for the deletion of all or part of the Ts-gene.
(121) In one aspect the watermelon plant or plant part as e.g. described above is provided, wherein said mutant allele of the Ts-gene is an induced mutant allele.
(122) In one aspect the watermelon plant or plant part as e.g. described above is provided, wherein said mutant allele encodes a protein that is truncated compared to the wild type protein.
(123) Also provided is a seed from which a plant or plant part as e.g. described above can be grown.
(124) Also provided is a fruit produced by the plant e.g. described above, wherein said fruit preferably comprises said mutant allele in homozygous form.
(125) Also provided is plant part according of a watermelon plant as e.g. described above, wherein the plant part is a cell, a flower, a pistil, a leaf, a stem, a petiole, a cutting, a tissue, a seed coat, an ovule, pollen, a root, a rootstock, a scion, a fruit, a cotyledon, a hypocotyl, a protoplast, an embryo, or an anther.
(126) Also provided is a vegetatively propagated plant propagated from a plant part of a watermelon plant as e.g. described above.
(127) Further provided is a method of crossing the plant as e.g. described above with another watermelon plant to produce a hybrid plant.
(128) Further provided is a hybrid watermelon plant or a part thereof having the plant as e.g. described above as a parent and comprising at least one copy of the mutant allele of the is-gene.
(129) Likewise a method of watermelon fruit production is provided, said method comprising growing a plant as e.g. described above comprising the mutant Ts-gene allele in homozygous form and optionally harvesting the fruits produced by said plants.
(130) Further provided is a method for generating a watermelon plant comprising a mutant allele of a gene named Ts-gene, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94% or 95% sequence identity to SEQ ID NO: 1, comprising identifying or selecting a mutant plant, for example from a population of mutant plants or progeny thereof obtained by selfing, comprising a mutant Ts-gene allele, or generating a watermelon plant comprising a mutant Ts-gene allele using a genome editing technique.
(131) In another aspect a method for determining whether a watermelon plant or plant part comprises at least one copy of a mutant allele of a gene named Ts-gene is provided, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94% or 95% sequence identity to SEQ ID NO: 1, said method comprising analyzing the Ts-gene DNA, RNA or protein of the plant or plant part.
(132) In another aspect a method for selecting watermelon plants or plant parts is provided comprising screening the DNA, RNA or protein sequence of the Ts-gene or markers linked to the Ts-gene in said watermelon plants or plant parts, said Ts-gene encodes a Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94% or 95% sequence identity to SEQ ID NO: 1, and selecting watermelon plants or plant parts.
(133) Models for Predicting Seeds Size in Inbreds and Hybrids and Methods for Selecting Parent Lines and Making Hybrids
(134) It was found that there are three seed size determining haplotypes for the Ts-gene on chromosome 2 (referred to as haplotype NO, RE and WT, as described above and shown e.g., in Table 1) and three seed size determining haplotypes on chromosome 6 (referred to as haplotype S, M and as described above and shown in e.g., Table 2).
(135) Based on the finding that parent lines homozygous for a particular haplotype on chromosome 2 and homozygous for a particular haplotype on chromosome 6 produced an actual average seed size in their fruitswhich highly correlated (see
(136) In addition, it was found that inbred parent lines which are selected based on the chromosome 2 and chromosome 6 haplotype can also be used as parent lines for F1 hybrid seed production, to produce F1 hybrid plants which produce an actual average seed size in their fruits which highly correlated (see
(137) In one aspect, the disclosure provides a method for selecting a watermelon plant which, when grown, produces in its fruits seeds of i) an average predicted seed weight falling within the range of 0.07 g/10 seeds to 0.26 g/10 seeds, comprising selecting a plant which a) does not produce a wild type, functional Ts-protein (chromosome 2 haplotype NO), and b) is either homozygous for SEQ ID NO: 4 and SEQ ID NO: 6 (chromosome 6 haplotype Small), or is homozygous for SEQ ID NO: 4 and SEQ ID NO: 7 (chromosome 6 haplotype Medium), or is homozygous for SEQ ID NO: 5 and SEQ ID NO: 6 (chromosome 6 haplotype Medium), or is homozygous for SEQ ID NO: 5 and SEQ ID NO: (chromosome 6 haplotype Large); or ii) an average predicted seed weight falling within the range of 0.15 g/10 seeds to 0.61 g/10 seeds, comprising selecting a plant which a) produces a mutant Ts-protein having reduced function, or produces a reduced amount of wild type, functional Ts-protein (chromosome 2 haplotype RE), and b) is either homozygous for SEQ ID NO: 4 and SEQ ID NO: 6 (chromosome 6 haplotype Small), or is homozygous for SEQ ID NO: 4 and SEQ ID NO: 7 (chromosome 6 haplotype Medium), or is homozygous for SEQ ID NO: 5 and SEQ ID NO: 6 (chromosome 6 haplotype Medium), or is homozygous for SEQ ID NO: 5 and SEQ ID NO: (chromosome 6 haplotype Large); or iii) an average predicted seed weight falling within the range of 0.27 g/10 seeds to 0.97 g/10 seeds, comprising selecting a plant which a) produces a wild type, functional Ts-protein (chromosome 2 haplotype WT), and b) is either homozygous for SEQ ID NO: 4 and SEQ ID NO: 6 (chromosome 6 haplotype Small), or is homozygous for SEQ ID NO: 4 and SEQ ID NO: 7 (chromosome 6 haplotype Medium), or is homozygous for SEQ ID NO: 5 and SEQ ID NO: 6 (chromosome 6 haplotype Medium), or is homozygous for SEQ ID NO: 5 and SEQ ID NO: (chromosome 6 haplotype Large);
wherein the wild type, functional Ts-protein is encoded by a gene named Ts-gene, said Ts-gene encodes wild type, functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1.
(138) Steps i) above relates to the selection of a plant that combines the genetics which result in the absence of a functional Ts-protein on chromosome 2 (haplotype NO) with either the S (Small), M (Medium) or L (Large) haplotype for chromosome 6 in the genome, whereby such a plant is predicted to produce an average seed size of 0.07 g/10 seeds to 0.26 g/10 seeds in its fruits.
(139) The chromosome 2 haplotype NO can genetically be due to a deletion of all or part of the Ts-gene, so that no functional Ts-protein is being made. For example, one or more regulatory elements of the Ts-gene may be deleted (or part thereof may be deleted) or part of the coding sequence may be deleted, or even the entire gene may be deleted, as found in plants comprising the deletion of SEQ ID NO: 8. In one aspect, plants comprising the deletion of SEQ ID NO: 8 are selected for in the methods described herein. In another aspect, plants comprising a smaller deletion than the deletion of SEQ ID NO: 8 are selected, whereby all or part of the Ts-gene is deleted. Alternatively, the chromosome 2 haplotype NO can genetically be due to the presence of a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein. See also Table 1 and elsewhere herein. For example a mutant ts-allele may comprise an insertion, replacement and/or deletion of one or more nucleotides compared to the wild type allele, whereby the allele becomes a knock-out allele or encodes a loss-of-function protein.
(140) Steps ii) in the method above relates to the selection of a plant that combines the genetics which result in the reduced function of the Ts-protein on chromosome 2 (haplotype RE) with either the S (Small), M (Medium) or L(Large) haplotype for chromosome 6 in the genome, whereby such a plant is predicted to produce an average seed size of 0.15 g/10 seeds to 0.61 g/10 seeds in its fruits.
(141) The chromosome 2 haplotype RE can genetically be due to a reduced expression of the Ts-gene encoding the wild type Ts-protein, resulting in lower amounts of Ts-protein being made in the plant homozygous for the mutant ts-allele, which may e.g., be due to mutations in one or more regulatory elements of the Ts-gene (for example in the promoter), or it can be genetically due to a mutant ts-allele being present, which produces a mutant Ts-protein that has reduced in vivo activity compared to the wild type Ts-protein. See also Table 1 and elsewhere herein. Thus, in one aspect, the plant comprises a mutant allele of the Ts gene, said mutant allele results in reduced expression of the Ts-gene or the mutant allele encodes a Ts-protein having reduced function compared to the wild type Ts-protein. Such a reduced function Ts-protein may, for example, comprise one or more amino acids inserted, deleted or replaced compared to the wild type, functional Ts-protein. One example of such a mutant ts-allele is the allele which encodes a mutant Ts-protein, wherein the Aspartic acid (D) at amino acid 204 of SEQ ID NO: 1 (or the equivalent amino acid of a functional variant which comprising at least 90% identity to SEQ ID NO: 1) is deleted or is replaced by a different amino acid, preferably by a Tyrosine (Y) or by another disfavored replacement of Aspartic Acid (D). In one aspect, plants comprising this mutant allele are selected for in the methods described herein. Other mutant alleles are described elsewhere herein and can be used in the method. It is preferred that there is some functional Ts-protein being made, but a reduced amount compared to the plant homozygous for the wild type allele, or that a reduced function Ts-protein is being made in equivalent amounts as compared to the plant homozygous for the wild type allele. So, for example the mutant allele is modified in the promoter so that gene expression is equal to or less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of the wild type level of gene expression, or the mutant allele encodes a mutant protein which has reduced function. For example the mutant Ts-protein may have a wild type/functional Acetyl transferase domain (e.g. the same as in the wild type protein, from amino acid 54 to 146 of SEQ ID NO: 1), but the mutant protein may have a reduced activity due to one or more amino acids being inserted, deleted or replaced outside of the Acetyl transferase domain, e.g. any amino acid in the region starting at amino acid 147 and ending at amino acid 412 or starting at amino acid 147 and ending at amino acid 400, or starting at amino acid 150 and ending at amino acid 390, especially in the region starting at amino acid 155 and ending at amino acid 265. Replacement one or more (e.g. 2, 3, 4, 5) amino acids in the middle region (which is from amino acid 155 to 265 of SEQ ID NO: 1 or the equivalent region in a sequence comprising at least 90% sequence identity to SEQ ID NO: 1) is likely to reduce protein function without abolishing the function altogether. Steps iii) in the method above relates to the selection of a plant that combines the genetics which result in a wild type, functional Ts-protein on chromosome 2 (haplotype WT) with either the S (Small), M (Medium) or L(Large) haplotype for chromosome 6 in the genome, whereby such a plant is predicted to produce an average seed size of 0.27 g/10 seeds to 0.97 g/10 seeds in its fruits. The plant may, for example, comprise a Ts-allele which encodes the wild type, functional Ts-protein of SEQ ID NO: 1 or a protein (functional variant) comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1.
(142) In the above method, the plant or plants selected are preferably inbred lines, which are homozygous for the chromosome 2 and chromosome 6 haplotypes. The selection of a plant line based on the chromosome 2 and chromosome 6 haplotype can occur based on information stored in a database. The skilled person can, for example, genotype all inbred lines for the chromosome 2 and chromosome 6 haplotypes, or analyze whole genome sequence information for the chromosome 2 and chromosome 6 haplotypes, and then base the selection of inbred lines on this information. One can thereby not only select inbred lines, but also parent lines to be used to produce F1 hybrids. The selection of suitable inbred parent lines to be crossed to produce F1 hybrid seeds, whereby the plants grown therefrom produce fruits having a predicted seed size, e.g. as shown in
(143) Also encompassed herein is, therefore, a method for producing F1 hybrid watermelon seeds (whereby e.g. the plants grown from the F1 hybrid seeds produce in their fruits a predicted seed size according to the model of
(144) As it is desirable to produce F1 hybrids which produce medium seeds or small seeds, in a preferred aspect, both parent lines are selected as having a haplotype of i) or ii) to produce F1 hybrids which produce fruits upon pollination having predicted seed sizes of between 0.07 g/10 seeds and 0.61 g/10 seeds, as shown in
(145) The F1 hybrid seeds made by the above method are also encompassed herein.
(146) In a further aspect, a method for selecting a watermelon seed, plant or plant part is provided comprising: i) analyzing whether the seed, plant or plant part comprises one of the following haplotypes for a gene named Ts-gene, said Ts-gene encodes wild type, functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1: a) a deletion of all or part of the Ts-gene, or a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein (chromosome 2 haplotype NO), b) a mutant allele of the Ts-gene, which mutant allele encodes a mutant Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type Ts-protein, said mutant Ts-protein having reduced function compared to the wild type Ts-protein (chromosome 2 haplotype RE); c) a wild type allele of the Ts-gene, encoding a functional Ts-protein (chromosome 2 haplotype WT); and optionally ii) analyzing which haplotype for SNP 01 and INDEL 02 selected is present in the seed, plant or plant part selected from the combination of SEQ ID NO: 4 and SEQ ID NO: 6 (S), the combination of SEQ ID NO: 4 and SEQ ID NO: 7 (M), the combination of SEQ ID NO: 5 and SEQ ID NO: 6 (M) or the combination of SEQ ID NO: 5 and SEQ ID NO: 7 (L); and optionally iii) selecting a seed, plant or plant part comprising the desired combination of i) and ii).
(147) As mentioned, the watermelon seed, plant or plant part selected is preferably an inbred watermelon plant, plant part or seed, which is homozygous for the selected haplotypes.
(148) Furthermore, a method for selecting one or two watermelon lines to be used as parent lines for F1 hybrid seed production is provided, comprising selecting a first parent line and optionally a second parent line for i) comprising a haplotype for a gene named Ts-gene, said Ts-gene encodes wild type, functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1, selected from: a) a deletion of all or part of the Ts-gene, or a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein (chromosome 2 haplotype NO); b) a mutant allele of the Ts-gene, which mutant allele encodes a mutant Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type Ts-protein, said mutant Ts-protein having reduced function compared to the wild type Ts-protein (chromosome 2 haplotype RE); or c) a wild type allele of the Ts-gene, encoding a functional Ts-protein (chromosome 2 haplotype WT); and optionally ii) comprising a haplotype for SNP_01 and INDEL_02 selected from the combination of SEQ ID NO: 4 and SEQ ID NO: 6 (S), the combination of SEQ ID NO: 4 and SEQ ID NO: 7 (M), the combination of SEQ ID NO: 5 and SEQ ID NO: 6 (M) or the combination of SEQ ID NO: 5 and SEQ ID NO: 5 (L); and optionally iii) crossing the first parent line and the second parent line to produce F1 hybrid seeds.
(149) Also provided is a method of crossing two watermelon parent lines to produce F1 hybrid seed, comprising: crossing a first parent line being homozygous for a haplotype for a gene named Ts-gene selected from: a) a deletion of all or part of the Ts-gene, or a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein (chromosome 2 haplotype NO); b) a mutant allele of the Ts-gene, which mutant allele encodes a mutant Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type Ts-protein, said mutant Ts-protein having reduced function compared to the wild type Ts-protein (chromosome 2 haplotype RE); or c) a wild type allele of the Ts-gene, encoding a functional Ts-protein (chromosome 2 haplotype WT); and optionally being homozygous for a haplotype for SNP_01 and INDEL_02 selected from i) the combination of SEQ ID NO: 4 and SEQ ID NO: 6 (S), or ii) the combination of SEQ ID NO: 4 and SEQ ID NO: 7 or the combination of SEQ ID NO: 5 and SEQ ID NO: 6 (M) or iii) the combination of SEQ ID NO: 5 and SEQ ID NO: 7 (L);
(150) with a second parent line being homozygous for a haplotype for the Ts-gene selected from: a) a deletion of all or part of the Ts-gene, or a mutant allele of the Ts-gene, said mutant allele results in no expression of the Ts-gene or the mutant allele encodes a Ts-protein having loss-of-function compared to the wild type Ts-protein (chromosome 2 haplotype NO); b) a mutant allele of the Ts-gene, which mutant allele encodes a mutant Ts-protein comprising one or more amino acids inserted, deleted or replaced compared to the wild type Ts-protein, said mutant Ts-protein having reduced function compared to the wild type Ts-protein (chromosome 2 haplotype RE); or c) a wild type allele of the Ts-gene, encoding a functional Ts-protein (chromosome 2 haplotype WT); and optionally being homozygous for a haplotype for SNP_01 and INDEL_02 selected from i) the combination of SEQ ID NO: 4 and SEQ ID NO: 6 (S), or ii) the combination of SEQ ID NO: 4 and SEQ ID NO: 7 or the combination of SEQ ID NO: 5 and SEQ ID NO: 6 (M) or iii) the combination of SEQ ID NO: 5 and SEQ ID NO: 7 (L);
(151) and obtaining the F1 hybrid seeds, optionally cleaning, drying and packaging the F1 hybrid seeds, wherein said Ts-gene is the gene which encodes a wild type, functional Ts-protein of SEQ ID NO: 1 or a protein comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 1.
(152) The watermelon plants used herein are preferably diploid, cultivated watermelons, which produce seeded fruits upon self-pollination. Triploid watermelons produce seedless fruits.
(153) As mentioned, the haplotype or genotype selection of the lines or plants can take place on a computer, provided that molecular methods have been used to determine the haplotype or genotype of the lines or plants, such as sequencing, genotyping methods (e.g. SNP genotyping assays, such as KASP assays, etc.), PCR based methods, hybridization based methods, etc., as known in the art. If the data is stored in a database, selection according to the model of
EXAMPLES
Example 1QTL Mapping of Seed Weight
(154) In order to map QTLs for seed weight, mapping populations were generated as follows: To generate these mapping populations, two parents of different seed sizes were crossed to produce F1. The F1 were then selfed to produce F2 seed. Genome-wide markers were run on DNA samples from F2 lines and the seed produced from the F2 lines were then phenotyped. The genotypic and phenotypic data were used to map the QTL to loci on chromosomes 2 and/or 6. There were fifteen F2 populations that were used for QTL mapping (different years and locations), which were needed to capture all the combinations of the interactions of the alleles at chromosome 2 and 6 to build the model.
(155) The populations were phenotyped for average seed weight (g/10 seeds) by either measuring seed dimensions (width and length) and/or by weighing 10 seed from each line (at least three measurements from a seedlot, wherein the seedlot comprises the seeds of at least three fruits).
(156) Two QTLs were identified, one on chromosome 2 and one on chromosome 6, which together determine the final seed size of the seeds produced in the fruits, as further described in Example 3.
(157) The QTL on chromosome 2 was fine mapped to the Ts-gene, as described in Example 2.
(158) For the QTL on chromosome 6, two markers closely linked to the QTL were found. It was found that the haplotype for these two markers (shown in Table 3), in combination with the haplotype on chromosome 2 can be used to predict seed size and to select parent lines, which when crossed, will result in F1 hybrids with a predicted seed size in their fruits, as further shown in Example 3.
(159) TABLE-US-00003 TABLE3 Markername Markersequence SNP_01marker TAGATAACTCTTTGATAATCAAATCCTAAATCCCTTAGTTATTAGGGATCATACAAATTTG comprisingGat TTAATCCACATTTACCAGTTACTAAAAGGCAGCATTATTAAAAAAAGAAAAATCCCAATA nucleotide61 (SEQIDNO:4) SNP_01marker TAGATAACTCTTTGATAATCAAATCCTAAATCCCTTAGTTATTAGGGATCATACAAATTTT comprisingTat TTAATCCACATTTACCAGTTACTAAAAGGCAGCATTATTAAAAAAAGAAAAATCCCAATA nucleotide61 (SEQIDNO:5) INDEL_02marker atgtaacatatttagtccattcaactattaagtgcgttactacctcgact comprisinga aaaaaatttagtacattcaacgctcacgtactttaaaatgtttaaattta deletion gttattacacgttcaataaatcttaaaacttaaaattgctc (SEQIDNO:6) INDEL_02marker atgtaacatatttagtccattcaactattaagtgcgttactacctcgact lackingthedeletion/ aaaaaatttagtacattcaactagcaagagcgttactacttcaactaaaa comprisingan atatccatttcattttagctcacgtactttaaaatgtttaaatttagtta insertion ttacacgttcaataaatcttaaaacttaaaattgctc (SEQIDNO:7)
Example 2Identification of the Ts-Gene
(160) The is-gene mutation as originally found in the Sugar Baby is mutant plant was mapped by making five F2 populations, all sharing same male as an inbred line containing the is-gene mutant with an average seed size <=0.07 gr/10 seeds, and as female, 5 different inbred lines with an average seed size between 0.12 and 0.46 gr/10 seeds. As a result of the QTL mapping, the is-gene mutant was found to be located on chromosome 2 of the watermelon genome.
(161) It was found that the is-gene mutant plant contained a large deletion in chromosome 2 in homozygous form and that this deletion caused the reduction in seed length when the deletion was present in homozygous form (i.e., deletion on both chromosomes). The sequence deleted is shown in SEQ ID NO: 8.
(162) As shown in Table 4, the plants homozygous for the deletion of SEQ ID NO: 8, had the average seed weight (expressed in g/10 seeds) reduced and the average seed length reduced compared to plants lacking the deletion of SEQ ID NO: 8.
(163) TABLE-US-00004 TABLE 4 Average Presence of Seed g/10 deletion of length seeds SEQ ID NO: 8 WH9716 5.25 mm 0.13 g Homozygous Female parent of WH9716 0.12 Homozygous male parent of WH9716 0.11 Homozygous Sugar Baby ts mutant plant 4.2 mm* 0.06 g Homozygous Sidekick 10 mm 0.57 g Not deleted *according to Zhang 1996, Cucurbit Genetics Cooperative Report 19: 67-69
(164) To measure gram per 10 seeds (g/10 seeds), three measurements of a seedlot per genotype were done and the average of the three measurements is indicated.
(165) A BLAST was carried out on the website cucurbitgenomics.org using SEQ ID NO: 8.
(166) SEQ ID NO: 8 is present on the watermelon 97103v1 genome on chromosome 2 starting at nucleotide 29916076 and ending at nucleotide 29902113. Likewise, the reverse complement of SEQ ID NO: 8 is present on the watermelon 97103v1 genome starting at nucleotide 29902113 and ending at nucleotide 29916076.
(167) Upon further analysis of the deleted sequence on chromosome 2, two genes were found to be in the deleted region, as well as several ESTs (Expressed Sequence Tags). Cla013377 was on the minus strand of the watermelon 97103 v1 genome and Cla013376 was on the plus strand. Cla013376 was indicated to encode a BCL-2 binding anthanogene-1 protein, indicated as being an apoptosis regulator protein. Cla013377 on the other hand (located on the minus strand from nucleotide 29904246 to 29906227) encoded an Acetyltransferase GNAT family protein. It was therefore hypothesized, based on the putative function of these proteins, that the deletion of Cla013377 is causal for the reduced seed length and reduced seed weight of seeds produced in fruits of plants homozygous for the deletion of SEQ ID NO: 8. This was later confirmed, as shown in the further examples.
(168) Cla013377 was thus the wild type Ts gene, which when deleted resulted in a reduction in seed weight and length. It encodes the wild type, functional protein of SEQ ID NO: 1. In the genome of Charleston Grey, the encoded wild type Ts-protein was indicated to contain several additional amino acids at the C-terminal end, which is however due to an error in annotation of introns and exons. The genomic sequences are identical and both encode the protein of SEQ ID NO: 1. The wild type Ts-gene is called C1CG02G019400 in the Charleston Grey genome and Cla013377 in the 97103 v1 genome.
(169) To confirm this hypothesis, various watermelon lines were screened for the Ts gene. Interestingly, one variety was found, SP-4, which contained a Ts protein wherein a single amino acid was changed, compared to the wild type protein. The D (Asp) at position 204 of SEQ ID NO: 1 was changed to Y (Tyr), see
Example 3Development of Seed Size (SSZ) Selection and Breeding Methods
(170) About 200 watermelon inbred lines were genotyped for the chromosome 2 and chromosome 6 haplotypes and were phenotyped for average seed size (g/10 seeds) in their fruits.
(171) For phenotyping 3-5 plants per inbred lines were grown in the field in a completely randomized design. Average seed size was measured by three times weighing 10 seed of bulk seeds harvested from at least 3 fruits to get an average of three measurements.
(172) Genotyping was done in the following way for the chromosome 2 locus and for the two chromosome 6 loci.
(173) For the chromosome 2 locus, the three haplotypes NO, RE and WT were distinguished in the following way
(174) TABLE-US-00005 In the results below Chromosome 2 haplotype this is indicated as NOno functional Ts protein SEQ ID NO: 8 is absent D (Deletion) RETs protein has reduced The Ts protein is a mutant A function protein, comprising Y at amino Adenine nucleotide (ATG acid 204 of SEQ ID NO: 1 codon on the minus strand; TAC codon on the plus strand; encoding amino acid Y) WTwild type Ts protein is The Ts protein is the wild type C present protein, comprising D at amino (Cytosine) nucleotide acid 204 of SEQ ID NO: 1 (CTG codon on the minus strand or a GAC codon on the plus strand; encoding amino acid D)
(175) For the two chromosome 6 loci, SNP analysis for the SNP 01 marker (nucleotide G or T) was done and an analysis of the genotype for INDEL 02 marker (indicated as D for deletion, or I for insertion). Lines were genotyped with four KASP assays designed to differentiate the three alleles at the locus on chromosome 2 and 6.
(176) In addition, a model was developed (shown in
(177) Genotyping and Phenotyping Results for Inbred Lines (Homozygous)
(178) TABLE-US-00006 Predicted Actual Deviation SSZ SSZ from actual Chr 6 Chr 6 (g per (g per (g per 10 Chr_02 SNP_01 SNP_02 Index 10 seed) 10 seed) seed) DD GG DD 1 0.07 0.04 0.03 DD GG DD 1 0.07 0.04 0.03 DD GG DD 1 0.07 0.05 0.03 DD GG DD 1 0.07 0.06 0.01 DD GG II 2 0.13 0.07 0.06 DD GG DD 1 0.07 0.07 0.00 DD GG DD 1 0.07 0.07 0.00 DD GG DD 1 0.07 0.07 0.00 DD GG DD 1 0.07 0.07 0.00 DD GG II 2 0.13 0.07 0.06 DD GG DD 1 0.07 0.08 0.00 DD GG DD 1 0.07 0.08 0.01 DD GG II 2 0.13 0.08 0.05 DD GG DD 1 0.07 0.08 0.01 DD GG II 2 0.13 0.09 0.05 DD GG II 2 0.13 0.09 0.05 DD GG DD 1 0.07 0.09 0.02 DD GG II 2 0.13 0.09 0.04 DD GG II 2 0.13 0.09 0.04 DD GG II 2 0.13 0.09 0.04 DD GG II 2 0.13 0.09 0.04 DD GG II 2 0.13 0.09 0.04 DD GG II 2 0.13 0.10 0.04 DD GG II 2 0.13 0.1 0.03 DD GG II 2 0.13 0.1 0.03 DD GG II 2 0.13 0.1 0.03 DD GG II 2 0.13 0.11 0.02 DD GG II 2 0.13 0.11 0.02 DD GG II 2 0.13 0.11 0.02 DD GG II 2 0.13 0.11 0.02 DD GG II 2 0.13 0.11 0.02 DD GG II 2 0.13 0.11 0.02 DD GG DD 1 0.07 0.12 0.04 DD GG DD 1 0.07 0.12 0.04 DD GG II 2 0.13 0.12 0.01 DD GG DD 1 0.07 0.12 0.05 DD GG DD 1 0.07 0.12 0.05 DD GG II 2 0.13 0.13 0.01 DD GG DD 1 0.07 0.13 0.05 DD GG DD 1 0.07 0.13 0.06 DD GG II 2 0.13 0.13 0.00 DD GG DD 1 0.07 0.13 0.06 DD GG II 2 0.13 0.13 0.00 DD GG II 2 0.13 0.13 0.00 DD GG II 2 0.13 0.13 0.00 DD GG II 2 0.13 0.13 0.00 DD GG DD 1 0.07 0.13 0.06 DD GG II 2 0.13 0.13 0.00 DD GG II 2 0.13 0.14 0.01 DD GG II 2 0.13 0.14 0.01 DD GG II 2 0.13 0.14 0.01 DD GG II 2 0.13 0.16 0.03 DD GG II 2 0.13 0.16 0.03 AA GG DD 4 0.15 0.07 0.08 AA GG DD 4 0.15 0.11 0.04 AA GG II 5 0.30 0.11 0.19 AA GG DD 4 0.15 0.12 0.04 AA GG DD 4 0.15 0.13 0.03 AA GG DD 4 0.15 0.13 0.02 AA GG DD 4 0.15 0.13 0.02 AA GG DD 4 0.15 0.13 0.02 AA GG DD 4 0.15 0.13 0.02 AA GG DD 4 0.15 0.14 0.02 AA GG DD 4 0.15 0.14 0.02 AA GG DD 4 0.15 0.14 0.02 AA GG DD 4 0.15 0.14 0.01 AA GG DD 4 0.15 0.14 0.01 AA GG DD 4 0.15 0.14 0.01 AA GG DD 4 0.15 0.14 0.01 AA GG DD 4 0.15 0.15 0.01 AA GG DD 4 0.15 0.15 0.01 AA GG DD 4 0.15 0.15 0.01 AA GG DD 4 0.15 0.15 0.01 AA GG DD 4 0.15 0.15 0.01 AA GG DD 4 0.15 0.15 0.00 AA GG DD 4 0.15 0.15 0.00 AA GG DD 4 0.15 0.15 0.00 AA GG DD 4 0.15 0.16 0.00 AA GG DD 4 0.15 0.16 0.00 AA GG DD 4 0.15 0.16 0.00 AA GG DD 4 0.15 0.16 0.00 AA GG DD 4 0.15 0.16 0.00 AA GG DD 4 0.15 0.17 0.02 AA GG DD 4 0.15 0.17 0.02 AA GG DD 4 0.15 0.18 0.02 AA GG DD 4 0.15 0.18 0.02 AA GG DD 4 0.15 0.18 0.03 AA GG II 5 0.30 0.19 0.11 AA GG DD 4 0.15 0.21 0.06 AA GG DD 4 0.15 0.21 0.06 AA GG II 5 0.30 0.22 0.08 AA GG II 5 0.30 0.23 0.07 AA GG II 5 0.30 0.23 0.07 AA GG II 5 0.30 0.27 0.03 AA GG II 5 0.30 0.28 0.02 AA GG II 5 0.30 0.28 0.02 AA GG II 5 0.30 0.30 0.00 AA GG II 5 0.30 0.31 0.01 AA GG II 5 0.30 0.32 0.02 AA GG II 5 0.30 0.35 0.05 AA GG II 5 0.30 0.4 0.10 AA GG II 5 0.30 0.4 0.10 CC GG DD 7 0.27 0.13 0.14 CC GG DD 7 0.27 0.13 0.14 CC GG DD 7 0.27 0.14 0.13 CC GG DD 7 0.27 0.16 0.11 CC GG II 8 0.41 0.16 0.25 CC GG DD 7 0.27 0.17 0.11 CC GG DD 7 0.27 0.17 0.10 CC GG DD 7 0.27 0.18 0.10 CC GG DD 7 0.27 0.18 0.09 CC GG DD 7 0.27 0.19 0.09 CC GG DD 7 0.27 0.19 0.08 CC GG DD 7 0.27 0.19 0.08 CC GG DD 7 0.27 0.19 0.08 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.2 0.07 CC GG DD 7 0.27 0.24 0.03 CC GG DD 7 0.27 0.25 0.02 CC GG DD 7 0.27 0.25 0.02 CC GG DD 7 0.27 0.25 0.02 CC GG DD 7 0.27 0.25 0.02 CC GG II 8 0.41 0.25 0.16 CC GG DD 7 0.27 0.26 0.01 CC GG II 8 0.41 0.26 0.15 CC GG II 8 0.41 0.26 0.15 CC GG DD 7 0.27 0.27 0.01 CC GG DD 7 0.27 0.27 0.00 CC GG II 8 0.41 0.27 0.14 CC GG DD 7 0.27 0.28 0.01 CC GG DD 7 0.27 0.3 0.03 CC GG DD 7 0.27 0.3 0.03 CC GG II 8 0.41 0.31 0.10 CC GG II 8 0.41 0.32 0.09 CC GG DD 7 0.27 0.33 0.06 CC GG II 8 0.41 0.34 0.07 CC GG II 8 0.41 0.34 0.07 CC GG II 8 0.41 0.34 0.07 CC GG II 8 0.41 0.34 0.07 CC GG II 8 0.41 0.34 0.07 CC GG II 8 0.41 0.35 0.06 CC GG II 8 0.41 0.35 0.06 CC GG II 8 0.41 0.38 0.03 CC GG II 8 0.41 0.39 0.02 CC GG II 8 0.41 0.39 0.02 CC GG II 8 0.41 0.41 0.00 CC GG II 8 0.41 0.41 0.00 CC GG II 8 0.41 0.42 0.01 CC GG II 8 0.41 0.42 0.01 CC GG II 8 0.41 0.42 0.01 CC GG II 8 0.41 0.43 0.02 CC GG II 8 0.41 0.44 0.04 CC GG II 8 0.41 0.45 0.04 CC GG II 8 0.41 0.45 0.04 CC GG II 8 0.41 0.45 0.04 CC GG II 8 0.41 0.45 0.04 CC GG II 8 0.41 0.46 0.05 CC GG II 8 0.41 0.46 0.05 CC GG II 8 0.41 0.47 0.06 CC GG II 8 0.41 0.47 0.06 CC GG II 8 0.41 0.47 0.06 CC GG II 8 0.41 0.47 0.06 CC GG II 8 0.41 0.47 0.06 CC GG II 8 0.41 0.48 0.07 CC GG II 8 0.41 0.48 0.07 CC GG II 8 0.41 0.5 0.09 CC GG II 8 0.41 0.5 0.09 CC GG II 8 0.41 0.5 0.09 CC GG II 8 0.41 0.53 0.12 CC GG II 8 0.41 0.53 0.12 CC GG II 8 0.41 0.54 0.13 CC GG II 8 0.41 0.57 0.16 CC TT II 9 0.97 0.58 0.39 CC TT II 9 0.97 0.76 0.21 CC TT II 9 0.97 0.76 0.21 CC TT II 9 0.97 0.78 0.19 CC TT II 9 0.97 0.79 0.18 CC TT II 9 0.97 0.82 0.15 CC TT II 9 0.97 0.83 0.14 CC TT II 9 0.97 0.83 0.14 CC TT II 9 0.97 0.86 0.11 CC TT II 9 0.97 0.92 0.05 CC TT II 9 0.97 0.96 0.01 CC TT II 9 0.97 0.98 0.01 CC TT II 9 0.97 1 0.03 CC TT II 9 0.97 1.06 0.09 CC TT II 9 0.97 1.07 0.10 CC TT II 9 0.97 1.13 0.16 DD GG DD 1 0.07 0.04 0.03
(179) The same genotyping and phenotyping as for the inbred parent lines was done for more than 200 F1 hybrids made from various combinations of inbred parent lines (data not shown).
(180) Here a model was also developed (shown in
(181) Regression analysis was done for determining whether actual seed sizes measured in fruits of the F1 hybrid plants and the predicted seed sizes of the model correlate. A regression line was determined by the method of ordinary least squares to define a line that most closely fit the data. An R squared value (R.sup.2) was calculated to show the variance explained by the predictions. The result is shown in