RNAi Agents for Inhibiting Expression of Activin Receptor-Like Kinase 7 (ALK7), Compositions Thereof, and Methods of Use
20250207139 ยท 2025-06-26
Inventors
- Michelle Ngai (Fitchburg, WI, US)
- Mark Majewski (Rockton, IL, US)
- Zhi-Ming DING (Waunakee, WI, US)
- Agnieszka Glebocka (Madison, WI, US)
- Tao Pei (Middleton, WI, US)
- James C. HAMILTON (Sierra Madre, CA, US)
- Grigoriy Shekhtman (Los Angeles, CA, US)
Cpc classification
C12N2320/35
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an Activin Receptor-Like Kinase 7 (ALK7) gene. The ALK7 RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an ALK7 gene. Pharmaceutical compositions that include one or more ALK7 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described ALK7 RNAi agents to adipose tissue, in vivo, provides for inhibition of ALK7 gene expression and a reduction in ALK7 activity, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including obesity, diabetes, or insulin resistance.
Claims
1. An RNAi agent for inhibiting expression of a Activin Receptor-Like Kinase 7 (ALK7) gene, comprising: an antisense strand wherein nucleotides 1-21 of the antisense strand (5.fwdarw.3) comprise the nucleotide sequence (5.fwdarw.3): AUUGUUGGAACUAUGACAGAC (SEQ ID NO: 558); and a sense strand that comprises a nucleotide sequence that differs by 0 or 1 nucleotides from the nucleotide sequence (5.fwdarw.3): GUCUGUCAUAGUUCCAACAAU (SEQ ID NO: 599); wherein all or substantially all of the nucleotides of the antisense strand and all or substantially all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2-fluoro modified nucleotides, 2-O-methyl modified nucleotides, and cyclopropyl phosphonate-containing nucleotides, wherein the sense strand is linked to one or more lipid moieties.
2. The RNAi agent of claim 1, wherein the one or more lipid moieties are conjugated to the sense strand on the 5 terminus of the sense strand, the 3 terminus of the sense strand, or both the 5 and 3 terminus of the sense strand.
3. The RNAi agent of claim 1, wherein each of the one or more lipid moieties is independently selected from the group consisting of ##STR00017## wherein indicates the point of connection to the RNAi agent.
4. The RNAi agent of claim 1, wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
5. The RNAi agent of claim 1, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
6. The RNAi agent of claim 1, wherein the sense strand comprises one or two inverted abasic residues.
7. The RNAi agent of claim 1, wherein the antisense strand comprises the modified nucleotide sequence (5.fwdarw.3): cPrpasUfsuguuGfgaacUfaUfgAfcagasc (SEQ ID NO: 269); wherein a represents 2-O-methyl adenosine, c represents 2-O-methyl cytidine, g represents 2-O-methyl guanosine, and u represent 2-O-methyl uridine; Af represents 2-fluoro adenosine, Cf represents 2-fluoro cytidine, Gf represents 2-fluoro guanosine, and Uf represents 2-fluoro uridine; cPrpa represents a 5-cyclopropyl phosphonate-2-O-methyl adenosine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
8. The RNAi agent of claim 7, wherein the sense strand comprises the modified nucleotide sequence (5.fwdarw.3): gucugucaUfAfGfuuccaacaau (SEQ ID NO: 364) wherein a represents 2-O-methyl adenosine, c represents 2-O-methyl cytidine, g represents 2-O-methyl guanosine, and u represent 2-O-methyl uridine; Af represents 2-fluoro adenosine, Cf represents 2-fluoro cytidine, Gf represents 2-fluoro guanosine, and Uf represents 2-fluoro uridine.
9. The RNAi agent of claim 8, wherein the sense strand further comprises one or more inverted abasic residues.
10. The RNAi agent of claim 9, wherein the RNAi agent is linked to LP-379-a on the 5 terminus of the sense strand, and linked to LP-371-a on the 3 terminus of the sense strand.
11. The RNAi agent of claim 9, wherein the sense strand has the structure: LP-379-a-L6-(NH-C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-S)-LP-371-a (SEQ ID NO: 535), and the antisense strand has the structure: cPrpasUfsuguuGfgaacUfaUfgAfcagasc (SEQ ID NO: 269), wherein a represents 2-O-methyl adenosine, c represents 2-O-methyl cytidine, g represents 2-O-methyl guanosine, and u represent 2-O-methyl uridine; Af represents 2-fluoro adenosine, Cf represents 2-fluoro cytidine, Gf represents 2-fluoro guanosine, and Uf represents 2-fluoro uridine, cPrpa represents a 5-cyclopropyl phosphonate-2-O-methyl adenosine, (invAb) represents an inverted abasic residue, (C6-S) has the structure: ##STR00018## L6 has the structure: ##STR00019## (NH-C6)s has the structure: ##STR00020## LP-379-a has the structure: ##STR00021## and LP-371-a has the structure: ##STR00022##
12. The RNAi agent of claim 1, wherein the RNAi agent is a pharmaceutically acceptable salt.
13. The RNAi agent of claim 12, wherein the pharmaceutically acceptable salt is a sodium salt.
14. The RNAi agent of claim 11, wherein the RNAi agent is a sodium salt.
15. A pharmaceutical composition comprising the RNAi agent of claim 1, wherein the composition comprises a pharmaceutically acceptable excipient.
16. A pharmaceutical composition comprising the RNAi agent of claim 11, wherein the composition comprises a pharmaceutically acceptable excipient.
17. The pharmaceutical composition of claim 16, wherein the pharmaceutically acceptable excipient is sodium chloride.
18. A method of treating an ALK7-related disease, disorder, or symptom, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 17.
19. The method of claim 18, wherein the ALK7-related disease is obesity, diabetes, or insulin resistance.
20. The method of claim 19, wherein the RNAi agent is administered to a human subject at a dose of about 0.01 mg/kg to about 5.0 mg/kg of body weight of the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
DETAILED DESCRIPTION
RNAi Agents
[0057] Described herein are RNAi agents for inhibiting expression of the ALK7 (or Acvr1c) gene (referred to herein as ALK7 RNAi agents or ALK7 RNAi triggers). Each ALK7 RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 18 to 30 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 18 to 27 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense strands are each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the RNAi agent antisense strands are each independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.
[0058] Examples of nucleotide sequences used in forming ALK7 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3, 4, 5, 6, are shown in Tables 7A, 7B, 8, 9A, and 10.
[0059] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5 end of the antisense strand (e.g., this region may be separated from the 5 end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).
[0060] A sense strand of the ALK7 RNAi agents described herein includes at least 15 consecutive nucleotides that have at least 85% identity to a core stretch sequence (also referred to herein as a core stretch or core sequence) of the same number of nucleotides in an ALK7 mRNA. In some embodiments, a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length (sometimes referred to, e.g., as a target sequence) present in the ALK7 mRNA target. In some embodiments, this sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length.
[0061] An antisense strand of an ALK7 RNAi agent described herein includes at least 16 consecutive nucleotides that have at least 85% complementarity to a core stretch of the same number of nucleotides in an ALK7 mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, an antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., target sequence) of the same length present in the ALK7 mRNA target. In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this antisense strand core stretch is 19 nucleotides in length. In some embodiments, this antisense strand core stretch is 17 nucleotides in length. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.
[0062] The ALK7 RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an ALK7 RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22., or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an ALK7 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)
[0063] In some embodiments, the antisense strand of an ALK7 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ALK7 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.
[0064] In some embodiments, the sense strand and/or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3 end, the 5 end, or both the 3 and 5 ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the ALK7 mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the ALK7 mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.
[0065] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5 and/or 3 end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3 and 5 extensions. In some embodiments, one or more of the 3 extension nucleotides of one strand base pairs with one or more 5 extension nucleotides of the other strand. In other embodiments, one or more of 3 extension nucleotides of one strand do not base pair with one or more 5 extension nucleotides of the other strand. In some embodiments, an ALK7 RNAi agent has an antisense strand having a 3 extension and a sense strand having a 5 extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an overhang refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.
[0066] In some embodiments, an ALK7 RNAi agent comprises an antisense strand having a 3 extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an ALK7 RNAi agent comprises an antisense strand having a 3 extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding ALK7 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding ALK7 mRNA sequence.
[0067] In some embodiments, an ALK7 RNAi agent comprises a sense strand having a 3 extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to or are the identical to nucleotides in the ALK7 mRNA sequence. In some embodiments, the 3 sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5 to 3).
[0068] A sense strand can have a 3 extension and/or a 5 extension. In some embodiments, an ALK7 RNAi agent comprises a sense strand having a 5 extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the ALK7 mRNA sequence.
[0069] Examples of sequences used in forming ALK7 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, an ALK7 RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 10. In certain embodiments, an ALK7 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, an ALK7 RNAi agent antisense strand includes the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21, of any of the sequences in Tables 2 or 3. In some embodiments, an ALK7 RNAi agent sense strand includes the sequence of any of the sequences in Tables 2, 4, 5, or 6. In some embodiments, an ALK7 RNAi agent sense strand includes the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Tables 2, 4, 5, or 6. In certain embodiments, an ALK7 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4, 5, 6, or 10.
[0070] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5 end and the antisense strand 3 end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3 end and the antisense strand 5 end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).
[0071] In some embodiments, the sense strand 5 end and the antisense strand 3 end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3 end and the antisense strand 5 end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3 or 5 overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5 overhang end, a blunt end and a 3 overhang end, a frayed end and a 5 overhang end, a frayed end and a 3 overhang end, two 5 overhang ends, two 3 overhang ends, a 5 overhang end and a 3 overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3 terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.
[0072] The ALK7 RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the ALK7 RNAi agent are modified nucleotides. The ALK7 RNAi agents disclosed herein may further be comprised of one or more modified internucleoside linkages, e.g., one or more phosphorothioate or phosphorodithioate linkages. In some embodiments, an ALK7 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2-modified nucleotide is combined with modified internucleoside linkage.
[0073] In some embodiments, an ALK7 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an ALK7 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, an ALK7 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein.
Modified Nucleotides
[0074] Modified nucleotides, when used in various oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administration of the oligonucleotide construct.
[0075] In some embodiments, an ALK7 RNAi agent contains one or more modified nucleotides. As used herein, a modified nucleotide is a nucleotide other than a ribonucleotide (2-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2-modified nucleotides, inverted nucleotides, modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2,3-seco nucleotide mimics (unlocked nucleobase analogues), locked nucleotides, 3-O-methoxy (2 internucleoside linked) nucleotides, 2-F-Arabino nucleotides, 5-Me, 2-fluoro nucleotide, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides. 2-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2 position of the five-membered sugar ring) include, but are not limited to, 2-O-methyl nucleotides (also referred to herein or in the art as 2-methoxy nucleotides), 2-fluoro nucleotides (also referred to herein or in the art as 2-deoxy-2-fluoro nucleotides), 2-deoxy nucleotides, 2-methoxyethyl (2-O-2-methoxylethyl) nucleotides (also referred herein or in the art as 2-MOE nucleotides), 2-amino nucleotides, and 2-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single ALK7 RNAi agent or even in a single nucleotide thereof. The ALK7 RNAi agent sense strands and antisense strands can be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
[0076] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulflydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.
[0077] In some embodiments, the 5 and/or 3 end of the antisense strand can include abasic residues (Ab), which can also be referred to as an abasic site or abasic nucleotide. An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1 position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203). In some embodiments, an abasic residue can be placed internally in a nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3 end of the antisense strand. In some embodiments, the 5 end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab are added to the 3 end of the sense strand. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
[0078] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide. Chemical structures for certain modified nucleotides are set forth in Table 11 herein.
Modified Internucleoside Linkages
[0079] In some embodiments, one or more nucleotides of an ALK7 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case s), chiral phosphorothioates, thiophosphates, phosphorodithioates (represented herein as lower case ss), phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3-5 linkages, 2-5 linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH.sub.2 components.
[0080] In some embodiments, a sense strand of an ALK7 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages, an antisense strand of an ALK7 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages. In some embodiments, a sense strand of an ALK7 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages, an antisense strand of an ALK7 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages.
[0081] In some embodiments, an ALK7 RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3 end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5 end of the sense strand nucleotide sequence, and another phosphorothioate or phosphorodithioate linkage is at the 3 end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkage are located at the 5 end of the sense strand, and another phosphorothioate or phosphorodithioate linkage is at the 3 end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate or phosphorodithioate linkages between the terminal nucleotides on both the 5 and 3 ends and the optionally present inverted abasic residue terminal caps. In some embodiments, a targeting ligand is linked to the sense strand via a phosphorothioate or phosphorodithioate linkage.
[0082] In some embodiments, an ALK7 RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5 end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5 end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5 end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5 end of the antisense strand. In some embodiments, an ALK7 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.
Capping Residues or Moieties
[0083] In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as a cap, a terminal cap, or a capping residue. As used herein, a capping residue is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a nucleotide sequence of an RNAi agent disclosed herein. A capping residue can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, inverted abasic residues (invAb) (also referred to in the art as inverted abasic sites) are added as capping residues (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art, and include, for example, inverted abasic residues as well as carbon chains such as a terminal C.sub.3H.sub.7 (propyl), C.sub.6H.sub.13 (hexyl), or C.sub.12H.sub.25 (dodecyl) groups. In some embodiments, a capping residue is present at either the 5 terminal end, the 3 terminal end, or both the 5 and 3 terminal ends of the sense strand. In some embodiments, the 5 end and/or the 3 end of the sense strand may include more than one inverted abasic deoxyribose moiety as a capping residue.
[0084] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3 end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5 end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between a targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.
[0085] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5 end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between a targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked via phosphate, phosphorothioate (e.g., shown herein as (invAb)s)), or other internucleoside linkages. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3 end of the antisense strand core stretch sequence, or the 3 end of the antisense strand sequence, may include an inverted abasic residue. The chemical structures for inverted abasic deoxyribose residues are shown in Table 11 below.
ALK7 RNAi Agents
[0086] The ALK7 RNAi agents disclosed herein are designed to target specific positions on an ALK7 gene (e.g., SEQ ID NO:1 (NM_145259.3)). As defined herein, an antisense strand sequence is designed to target an ALK7 gene at a given position on the gene when the 5 terminal nucleobase of the antisense strand is aligned with a position that is 21 nucleotides downstream (towards the 3 end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target an ALK7 gene at position 304 requires that when base pairing to the gene, the 5 terminal nucleobase of the antisense strand is aligned with position 324 of an ALK7 gene.
[0087] As provided herein, an ALK7 RNAi agent does not require that the nucleobase at position 1 (5.fwdarw.3) of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. For example, for an ALK7 RNAi agent disclosed herein that is designed to target position 304 of an ALK7 gene, the 5 terminal nucleobase of the antisense strand of the ALK7 RNAi agent must be aligned with position 324 of the gene; however, the 5 terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 324 of an ALK7 gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene transcript across a core stretch sequence of at least 16 consecutive nucleotides. As shown by, among other things, the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the ALK7 RNAi agent (e.g., whether the ALK7 RNAi agent is designed to target an ALK7 gene at position 304, at position 264, at position 785, or at some other position) is an important factor to the level of inhibition achieved by the ALK7 RNAi agent. (See, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of OffTarget Effects, PLOS Computational Biology, 11(12),
[0088] In some embodiments, the ALK7 RNAi agents disclosed herein target an ALK7 gene at or near the positions of the ALK7 sequence shown in Table 1. In some embodiments, the antisense strand of an ALK7 RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target ALK7 19-mer sequence disclosed in Table 1.
TABLE-US-00001 TABLE1 ALK719-mermRNATargetSequences(takenfromhomosapiensActivinReceptor- LikeKinase7(ALK7)transcript,GenBankNM_145259.3(SEQIDNO:1)) ALK719-mer Corresponding TargetedGene SEQID TargetSequences PositionsofSequence Position(as No. (5.fwdarw.3) onSEQIDNO:1 referredtoherein) 2 ACUGAAGUGUGUAUGUCUU 295-313 293 3 AACAGAAGGAGCAUGUUGG 343-361 341 4 GUCAUGCUAACCAAUGGAA 368-386 366 5 CUUCUGUCAUAGUUCCAAC 439-457 437 6 CUGUCAUAGUUCCAACAAU 442-460 440 7 UGGUAUCUGAAUAUCAUGA 1023-1041 1021 8 AACAGGGCUCCUUAUAUGA 1041-1059 1039 9 GUCUGGCACACCUUCAUAU 1125-1143 1123 10 CUGGCACACCUUCAUAUGG 1127-1145 1125 11 GGCACACCUUCAUAUGGAG 1129-1147 1127 12 ACAAGGUAAACCUGCUAUU 1159-1177 1157 13 AGGUAAACCUGCUAUUGCU 1162-1180 1160 14 GUGCCAUAGCGGACUUAGG 1230-1248 1228 15 CUGUGAAGCAUGAUUCAAU 1254-1272 1252 16 UGUGAAGCAUGAUUCAAUA 1255-1273 1253 17 AAUACUGAACACUAUCGAC 1270-1288 1268 18 UCGACAUACCUCAGAAUCC 1284-1302 1282 19 UGAAAUGCUUGAUGAUACA 1333-1351 1331 20 AAUGCUUGAUGAUACAAUG 1336-1354 1334 21 CGAGCUGACAUCUAUUCUG 1382-1400 1380 22 CUGUUGGUCUGGUUUACUG 1398-1416 1396 23 GUUGAGGAGUACCAAUUGC 1451-1469 1449 24 UCAGAUCCCUCGAUAGAGG 1490-1508 1488 25 AUCCCUCGAUAGAGGAAAU 1494-1512 1492 26 AAGUUUCGACCAAGUAUCC 1535-1553 1533 27 ACUGCUCUUCGUAUUAAGA 1640-1658 1638
[0089] Homo sapiens activin A receptor type 1C, ACVR1C, also known as ALK7, GenBank NM_145259.3 (SEQ ID NO:1), gene transcript (8853 bases):
TABLE-US-00002 1 agtggcaggagcgccgcgcaccgccagccgcagggggcgtgggatgggggcggccgggga 61 ggggggcgcccacactgactagagccaaccgcgcacttcaaaagggtgtcggtgccgcgc 121 tcccctcccgcggcccgggaacttcaaagcgggccgtgctgccccggctgcctcgctctg 181 ctctggggcctcgcagccccggcgcggccgcctggtggcgatgacccgggcgctctgctc 241 agcgctccgccaggctctcctgctgctcgcagcggccgccgagctctcgccaggactgaa 301 gtgtgtatgtcttttgtgtgattcttcaaacttcacctgccaaacagaaggagcatgttg 361 ggcatcagtcatgctaaccaatggaaaagagcaggtgatcaaatcctgtgtctcccttcc 421 agaactgaatgctcaagtcttctgtcatagttccaacaatgttaccaaaaccgaatgctg 481 cttcacagatttttgcaacaacataacactgcaccttccaacagcatcaccaaatgcccc 541 aaaacttggacccatggagctggccatcattattactgtgcctgtttgcctcctgtccat 601 agctgcgatgctgacagtatgggcatgccagggtcgacagtgctcctacaggaagaaaaa 661 gagaccaaatgtggaggaaccactctctgagtgcaatctggtaaatgctggaaaaactct 721 gaaagatctgatttatgatgtgaccgcctctggatctggctctggtctacctctgttggt 781 tcaaaggacaattgcaaggacgattgtgcttcaggaaatagtaggaaaaggtagatttgg 841 tgaggtgtggcatggaagatggtgtggggaagatgtggctgtgaaaatattctcctccag 901 agatgaaagatcttggtttcgtgaggcagaaatttaccagacggtcatgctgcgacatga 961 aaacatccttggtttcattgctgctgacaacaaagataatggaacttggactcaactttg 1021 gctggtatctgaatatcatgaacagggctccttatatgactatttgaatagaaatatagt 1081 gaccgtggctggaatgatcaagctggcgctctcaattgctagtggtctggcacaccttca 1141 tatggagattgttggtacacaaggtaaacctgctattgctcatcgagacataaaatcaaa 1201 gaatatcttagtgaaaaagtgtgaaacttgtgccatagcggacttagggttggctgtgaa 1261 gcatgattcaatactgaacactatcgacatacctcagaatcctaaagtgggaaccaagag 1321 gtatatggctcctgaaatgcttgatgatacaatgaatgtgaatatctttgagtccttcaa 1381 acgagctgacatctattctgttggtctggtttactgggaaatagcccggaggtgttcagt 1441 cggaggaattgttgaggagtaccaattgccttattatgacatggtgccttcagatccctc 1501 gatagaggaaatgagaaaggttgtttgtgaccagaagtttcgaccaagtatcccaaacca 1561 gtggcaaagttgtgaagcactccgagtcatggggagaataatgcgtgagtgttggtatgc 1621 caacggagcggcccgcctaactgctcttcgtattaagaagactatatctcaactttgtgt 1681 caaagaagactgcaaagcctaatgatgataattatgttaaaaagaaatctctcatagctt 1741 tcttttccattttcccctttatgtgaatgtttttgccattttttttttgttctacctcaa 1801 agataagacagtacagtatttaagtgcccataaggcagcatgaaaagataactctaaagt 1861 taagcatgggcaggagttgacttcatccaatctctatgttatgtttaattttattttgaa 1921 agcaacacctcaactcatctttttatttaataaggaagaaatatattacaaaagtataaa 1981 ataagctctataaaaatgttatagtcattaagtttttattttacttgaaccaagagcaca 2041 tgaatgaacaggaaaagatgtaaaaacatttttttctgagatgaaaacatattaattaaa 2101 catgcaaattagagcatgctatctttaggtgatgcaatctatgtttccccctttttaagt 2161 tagcaggactttttaaaaataaatattgctctaaactttaatatatcgaacgtgagagtg 2221 gagctgcttagtggaagatgtaagtgaggtgggtgtcccatgtgcttggtctccccttct 2281 gctgttctcctgttcttcataatccactactgcagcagtccctgaaccactaaacttgtt 2341 cctttcatttacaaaagagatacctgacatcctgagacactgagaaatgtcctgaagtca 2401 cacagctaatggcagaactggcactaggtccaaatcttgtgataatgaacaccgtaaggt 2461 tagctagcttcctactttcccttgaatagtgcttttctccctatgtaatatcttttatta 2521 tgatatttgtggtttagaaggcatattgagttattttgcagaatcataatggacccgcac 2581 aaaatctcagaaccatatctgttgacattttttctcatagaaatatcatggttaccccat 2641 ttgttaatgagcattaatgttttctgaacacttccaaagattaatcaaacataaatattc 2701 attgtctgaaaatgtctttaagatacaattcagaggtccctatttcctttgtacatacac 2761 acttagaaagaaaagacagaaaaggaagaggaaggaaggaaatattttgagaatatattg 2821 agaagaattaagaaaactcttcaatgaagtgttaacaaccaaaccctacagacggtatca 2881 gaaacagcaaatagatattcctctaccctttcacagtgagtgagtgagtacagaagaatg 2941 ctcatgatagttttgccttcattctactttctgtggacacagagtaatgaatatttaatg 3001 ggacattaaatatgcccttcaaatctataattttactttggtaaacgagatttaacatga 3061 tgtcttttatgctcctaaaacatcttttttcaaactccattccttagaacattcttctac 3121 tgagatgatccaagaccaaaagtgttctttggtacttgcttataaagtgatagtacatgt 3181 tagcatataatgtattttgaagagtgaagtaaatgctattgataacagtaaaaaaaaaaa 3241 aaaaaactaataacagtaaagaaatgctacttgatttttttttaaactggattgctcaga 3301 ttacctgatcgtggtggaacccttttattaagaggaggggaaactttttactatcccata 3361 tttaactgttctataaagcaaagcacagcttgggtaatagcgttctgaaggatatacttc 3421 tgtattttctcatagagtacaatttagtgattatgcttcatttcactatggaaatatgtt 3481 actgaatctatcttcattttactgagttgaaataaggaaggcaaaaaactgacagctatg 3541 gagtttgcgtgtacttccatactcgttaatgctctcatccacttattaaataatcataga 3601 gcacccatatcttgcttgccacaatatcgggtacaagagggaatacaaagatagataggt 3661 cctgccctcagggattttaaagtctaatttgggaatgggaatagggatgtgagtgtgtgg 3721 gggaagagattaaattgacagataaaatacgaagtgggatgtcttgagttctgcatgaca 3781 gtgggtttctaggataggtctgaaaattgctttcatttgcaacacatttagaaagtagct 3841 ttatttggatattacagacaatctaaatatatcatcagtttttaaaagtgcctatgtgaa 3901 gtgatttttaaaaagagcctatgtgaaggggtaatcttgcttgttcttgttactaatttc 3961 tcatagattgtttttctgcatatataagaacgaaattatttatttactatggttgtacgt 4021 gcctcaaataaacaagaatgatatttcctgttttatttacttatgttgggtaaatatgct 4081 tattgaatttttaagagaggattttttaccatctccatttttcttgtcattatgttttgt 4141 agcttatttgagggtgtctaaatataatttcatattttattggttcaactttcactctga 4201 agaaatccgtatgttagtacattttgaggtatttttcttgttcttgtgttgtttaactat 4261 gactcctaactgagtagtcttatatttcaattacaaaatacattttttaagaaagggaat 4321 agagcagcaaaaatgataaggaaaatgttaaaagttgtaatatttcctttactcttaaca 4381 ggattatatatagaacatgctcacttacaaaaataggatgatgaagtttagagcataagg 4441 caggcttcttgtatatacttatgctgtcaaatgttatattgtttttaatggagtcccatt 4501 gtgtaatatttatttcttttacattttgttataagcaaaaaaaaaaaaaattctccttag 4561 gttatgttcagagtatcagtgttctttactccttacagatattttggctttggggtataa 4621 tacaagacttgggaaaacactattatgaattttcagtactgtataaagtggtgatgggat 4681 ttaaatgcagcatcactttctgaaaataagagaaacattatttgttgtcagtatttcagc 4741 atgaacttgttgccttgtaaattttgcctttaagtttgtaattggtacagattctgttgt 4801 atgctttcttctatgtctaaaatatttggcatgtcacatctagaattcttaatttatgtt 4861 ctgacttgagagttaagtgaaacatgactgtcgtgcactattttaggcatagcacttgct 4921 tttcatctttatactttcaattaactttgcattttaaatttccatgattgtatgaaaata 4981 gtaacctggttgcagtatctgaaaaaattaaaattagcttttatttaaaaatgaaaatct 5041 acaatagattcattaggttagaagttccagaataatttattattttattacacctactat 5101 tgtagaattactaataaaacaaaacaaaactactcctattttcctggaattttgccacca 5161 tgtgacttattggggcagagaaaactcagggttgtctttgagtctgcacaaaagcaccag 5221 ggaacctgcttagcaaatcgtctgaaaacagggagctgatgtttgccattatacaaagtt 5281 tgagtaaacaacttaaaattgcttgttagggcatagtctttgattgaaataagtatgaga 5341 atgtatttggctaaataaatgtatttaaaatatacaaattttatttcccactggaaaatt 5401 aagaaagtagcagtaccaaatgaataaaagctggcagttgatgtcttcaataatcattcc 5461 tttaaaataaattcacaaacacatcattacaagctacttagaaatgtttagtattcgtat 5521 cttaaaatggcaccattgtggttttcaaagatattttaaacatcttttgtgaaacatact 5581 atttctgtttgacaatgctttgttctagctctgtgtgctgatacctacatggagtttttc 5641 tgctattttagtgaaaacagtaattcttttatcttgagagctgcttctaaataacaaaaa 5701 agttaattggaatgtaagtttttaaaaaatgttaatattaaatagaatttttataatatg 5761 ggcatttttcaaaacattttaatgaaaatatatagatatttgactttctttttttcatct 5821 agccttgctttatatttcattatttttctcactttttttcttaatattccctcactatct 5881 ttcaacattatcattagttcctaattttaaaaataactcttatttaacttaaccgtctgg 5941 aatttagccttctaatgaaagagaatcccttagtactctcagagattatataaagttatt 6001 ccaattttgtgtagatgacgaaaccaaggatcagagattaaatgactactagttactagc 6061 agaactcttatgaaagcctggtggtgacacccagcactgttccctgccatatccccaact 6121 tttactgattaaaaattaattcgcatgcatctaaacctaccttgaatgcacactaacgta 6181 atgtgccattcaatgatgatgataaaatcccacttttctttgggtttctactaaaataat 6241 ttactcactcagagtgaggtcaatgagaaaaactaaactaggctaagaaagagttgtaga 6301 atggttgttgagctaagtaggcaaccactggggtgctgataaaattaatggataaaattt 6361 aggaactgtgagagtatagaatttcttagtgcaagtaatgattagagaagcttcctgaca 6421 tcccccaccctttctgtaaggactgttctttctctttgtaccttggaatgggggtgaaag 6481 gtgatttgatagctgaatttgggactatgtccagtgggatattatctaacttttctctct 6541 ttctcttttttttcccctcagtttctcattagtttgtctttggcattcatcttcttttag 6601 tgcattaaaaaatgtttggcagatctcatcaatcccaagtcactctataattcctgtatt 6661 tctttagttgtcgtttaacctgtccaaacttctacacaatgaacttcttaacaagatttt 6721 aagttctctgtataagaggtttcacctcataacttctccagtaatccttcatttggcact 6781 atagagtatttgttaatggcagagatgatttttcttttaaaacctaaaaagactagctgt 6841 tatttgtattctagcttttagctaacatataaagaatgtctacttttgctttaatgctaa 6901 attccgcttgagaaatagtaactgggaaagacaatttgaaatatatgccccataatgtga 6961 ttgttaaatttatttctgctgttccataccattgctttgttttgcttttgacaaactaag 7021 ccattatgctattagtttggaatataatactacagcaaaattaggtaacaatccctattt 7081 taaaattcccctaacaataatagaactgccagcatacttttctctttcagttgtagatga 7141 atacattcgagagaatatgagctgtatttcatcctagattttaatattttcagatgtgac 7201 tgtatttcctgatcattggtccaagttgtcctaaaagaaatttttctctccagacctaac 7261 agttttaactgcaagagtttactgtgggttatgttaatctgaattttaatagggccacta 7321 agaatctgagtgccttaggagattacccttatacccactgccatcacatccagtcaggcc 7381 tgttgtgctctatataaatcttcccagctgaggggcaggtgcgggctaaaatccaactgc 7441 aattggctcccagacataattttatattttacagagaagcatcttattggcttatatgtg 7501 tttaaagaatggtctggcttatacatcttcagaaaatgagaattaaaaagtcaaaataat 7561 tcttgacatctacagattgaacaaagaacttagaagaaataatactttatcttttcatcc 7621 tggcattcctgagagaagagaaattgattgtttatcatgttggtttaatttttcaaccca 7681 gacaatctgcagcaaggcacatggaccccaattttgatatcgtccatacagttttcattc 7741 tatgcatggagctaattactgactttgcctgtaaagagaggattgtgtgcctaaattttg 7801 tctaacaaatgcaagcgtagaatgacatttactaatatttctatttcttccataggctaa 7861 ataatagtaactaagtatttttaaggacacagccctttttttctctttatacaaaatgag 7921 agtatctgagccaaaatattaaattctagttcttttccgcaatgactagtgtcaagctca 7981 tgtactcttctgattctagactggagaagattattcaaacttgatctgtgtttcaggttt 8041 ttaaatgtcctaaaaacagaaaattagattcagatctcaaaaaaggaattttggattgac 8101 tttcaaagtactaatactaattatacttttcttttggtagcgtgactcttcttataccta 8161 agaacatattacaaatgtcaaaaccattgcattttgacattgcaaaacatgccttgaact 8221 cttgaactactgtgaaaagaatcaccgttgtaaagactttttgtaagctagctgatactc 8281 ttaagtatgtaaaaagattgtctttcagccgacaggcccaaaggaatgtatataaggaag 8341 gaatatgaaaaaataaattaggttttaaaataggaattgggcaataaactgtatcaaaaa 8401 tatgtagatggattttagtagttgtaatttaaatgtggaaggtgaagagaatttcaaact 8461 ccaaagagaaatgaatgatattcagatgtttcattaatttctagtctgtgaaaatatgca 8521 ttttatagtaatatgtatagacttattttatttagaaataatagtgttttagaatttatt 8581 aaaaactcagtgatagcctttataccaaaatgtttaactttaccaacagcaagtcataaa 8641 agtatttattttaaagctttttaatattatcgtgtaactttcatctgtcttcagatgtaa 8701 ataattatctgcctaaatgttatatttttatgtatgcattttctgaaaatgtattgtttt 8761 gtaaagtgggaaagataataaatcaagcacttcttgcacttgtttctgtgaagcatatag 8821 aactctattttaaataaaggaagatgtgtcgta
[0090] In some embodiments, an ALK7 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (543) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ALK7 agent includes an antisense strand wherein position 1 of the antisense strand (543) is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.
[0091] In some embodiments, an ALK7 agent includes an antisense strand wherein position 2 of the antisense strand (5.fwdarw.3) is capable of forming a base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ALK7 agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5 4 3) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
[0092] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5 end.fwdarw.3 end) can be perfectly complementary to an ALK7 gene, or can be non-complementary to an ALK7 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5 end.fwdarw.3 end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5 end.fwdarw.3 end) forms an A:U or U:A base pair with the sense strand.
[0093] In some embodiments, an ALK7 RNAi agent antisense strand comprises the sequence of nucleotides (from 5 end.fwdarw.3 end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an ALK7 RNAi sense strand comprises the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 6a.
[0094] In some embodiments, an ALK7 RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5 end.fwdarw.3 end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 6a.
[0095] In some embodiments, the ALK7 RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.
TABLE-US-00003 TABLE2 ALK7RNAiAgentAntisenseStrandandSenseStrandCoreStretchBaseSequences(N=any nucleobase;I=inosine(hypoxanthinenucleobase) Corresponding AntisenseStrandBase SenseStrandBase Positions SEQ Sequence(5.fwdarw.3) SEQ Sequence(5.fwdarw.3) ofIdentified Targeted ID (ShownasanUnmodified ID (ShownasanUnmodified Sequenceon Gene NO:. NucleotideSequence) NO:. NucleotideSequence) SEQIDNO:1 Position 28 AAGACAUACACACUUCAGU 145 ACUGAAGUGUGUAUGUCUU 295-313 293 29 UAGACAUACACACUUCAGU 146 ACUGAAGUGUGUAUGUCUA 295-313 293 30 NAGACAUACACACUUCAGU 147 ACUGAAGUGUGUAUGUCUN 295-313 293 31 NAGACAUACACACUUCAGN 148 NCUGAAGUGUGUAUGUCUN 295-313 293 32 CCAACAUGCUCCUUCUGUU 149 AACAGAAGGAGCAUGUUGG 343-361 341 33 UCAACAUGCUCCUUCUGUU 150 AACAGAAGGAGCAUGUUGA 343-361 341 34 ACAACAUGCUCCUUCUGUU 151 AACAGAAGGAGCAUGUUGU 343-361 341 35 NCAACAUGCUCCUUCUGUU 152 AACAGAAGGAGCAUGUUGN 343-361 341 36 NCAACAUGCUCCUUCUGUN 153 NACAGAAGGAGCAUGUUGN 343-361 341 37 UUCCAUUGGUUAGCAUGAC 154 GUCAUGCUAACCAAUGGAA 368-386 366 38 AUCCAUUGGUUAGCAUGAC 155 GUCAUGCUAACCAAUGGAU 368-386 366 39 NUCCAUUGGUUAGCAUGAC 156 GUCAUGCUAACCAAUGGAN 368-386 366 40 NUCCAUUGGUUAGCAUGAN 157 NUCAUGCUAACCAAUGGAN 368-386 366 41 GUUGGAACUAUGACAGAAG 158 CUUCUGUCAUAGUUCCAAC 439-457 437 42 UUUGGAACUAUGACAGAAG 159 CUUCUGUCAUAGUUCCAAA 439-457 437 43 AUUGGAACUAUGACAGAAG 160 CUUCUGUCAUAGUUCCAAU 439-457 437 44 NUUGGAACUAUGACAGAAG 161 CUUCUGUCAUAGUUCCAAN 439-457 437 45 NUUGGAACUAUGACAGAAN 162 NUUCUGUCAUAGUUCCAAN 439-457 437 46 AUUGUUGGAACUAUGACAG 163 CUGUCAUAGUUCCAACAAU 442-460 440 47 UUUGUUGGAACUAUGACAG 164 CUGUCAUAGUUCCAACAAA 442-460 440 48 NUUGUUGGAACUAUGACAG 165 CUGUCAUAGUUCCAACAAN 442-460 440 49 NUUGUUGGAACUAUGACAN 166 NUGUCAUAGUUCCAACAAN 442-460 440 50 UCAUGAUAUUCAGAUACCA 167 UGGUAUCUGAAUAUCAUGA 1023-1041 1021 51 ACAUGAUAUUCAGAUACCA 168 UGGUAUCUGAAUAUCAUGU 1023-1041 1021 52 NCAUGAUAUUCAGAUACCA 169 UGGUAUCUGAAUAUCAUGN 1023-1041 1021 53 NCAUGAUAUUCAGAUACCN 170 NGGUAUCUGAAUAUCAUGN 1023-1041 1021 54 UCAUAUAAGGAGCCCUGUU 171 AACAGGGCUCCUUAUAUGA 1041-1059 1039 55 ACAUAUAAGGAGCCCUGUU 172 AACAGGGCUCCUUAUAUGU 1041-1059 1039 56 NCAUAUAAGGAGCCCUGUU 173 AACAGGGCUCCUUAUAUGN 1041-1059 1039 57 NCAUAUAAGGAGCCCUGUN 174 NACAGGGCUCCUUAUAUGN 1041-1059 1039 58 AUAUGAAGGUGUGCCAGAC 175 GUCUGGCACACCUUCAUAU 1125-1143 1123 59 UUAUGAAGGUGUGCCAGAC 176 GUCUGGCACACCUUCAUAA 1125-1143 1123 60 NUAUGAAGGUGUGCCAGAC 177 GUCUGGCACACCUUCAUAN 1125-1143 1123 61 NUAUGAAGGUGUGCCAGAN 178 NUCUGGCACACCUUCAUAN 1125-1143 1123 62 CCAUAUGAAGGUGUGCCAG 179 CUGGCACACCUUCAUAUGG 1127-1145 1125 63 UCAUAUGAAGGUGUGCCAG 180 CUGGCACACCUUCAUAUGA 1127-1145 1125 64 ACAUAUGAAGGUGUGCCAG 181 CUGGCACACCUUCAUAUGU 1127-1145 1125 65 NCAUAUGAAGGUGUGCCAG 182 CUGGCACACCUUCAUAUGN 1127-1145 1125 66 NCAUAUGAAGGUGUGCCAN 183 NUGGCACACCUUCAUAUGN 1127-1145 1125 67 CUCCAUAUGAAGGUGUGCC 184 GGCACACCUUCAUAUGGAG 1129-1147 1127 68 UUCCAUAUGAAGGUGUGCC 185 GGCACACCUUCAUAUGGAA 1129-1147 1127 69 AUCCAUAUGAAGGUGUGCC 186 GGCACACCUUCAUAUGGAU 1129-1147 1127 70 NUCCAUAUGAAGGUGUGCC 187 GGCACACCUUCAUAUGGAN 1129-1147 1127 71 NUCCAUAUGAAGGUGUGCN 188 NGCACACCUUCAUAUGGAN 1129-1147 1127 72 AAUAGCAGGUUUACCUUGU 189 ACAAGGUAAACCUGCUAUU 1159-1177 1157 73 UAUAGCAGGUUUACCUUGU 190 ACAAGGUAAACCUGCUAUA 1159-1177 1157 74 NAUAGCAGGUUUACCUUGU 191 ACAAGGUAAACCUGCUAUN 1159-1177 1157 75 NAUAGCAGGUUUACCUUGN 192 NCAAGGUAAACCUGCUAUN 1159-1177 1157 76 AGCAAUAGCAGGUUUACCU 193 AGGUAAACCUGCUAUUGCU 1162-1180 1160 77 UGCAAUAGCAGGUUUACCU 194 AGGUAAACCUGCUAUUGCA 1162-1180 1160 78 NGCAAUAGCAGGUUUACCU 195 AGGUAAACCUGCUAUUGEN 1162-1180 1160 79 NGCAAUAGCAGGUUUACCN 196 NGGUAAACCUGCUAUUGCN 1162-1180 1160 80 CCUAAGUCCGCUAUGGCAC 197 GUGCCAUAGCGGACUUAGG 1230-1248 1228 81 UCUAAGUCCGCUAUGGCAC 198 GUGCCAUAGCGGACUUAGA 1230-1248 1228 82 ACUAAGUCCGCUAUGGCAC 199 GUGCCAUAGCGGACUUAGU 1230-1248 1228 83 NCUAAGUCCGCUAUGGCAC 200 GUGCCAUAGCGGACUUAGN 1230-1248 1228 84 NCUAAGUCCGCUAUGGCAN 201 NUGCCAUAGCGGACUUAGN 1230-1248 1228 85 AUUGAAUCAUGCUUCACAG 202 CUGUGAAGCAUGAUUCAAU 1254-1272 1252 86 UUUGAAUCAUGCUUCACAG 203 CUGUGAAGCAUGAUUCAAA 1254-1272 1252 87 NUUGAAUCAUGCUUCACAG 204 CUGUGAAGCAUGAUUCAAN 1254-1272 1252 88 NUUGAAUCAUGCUUCACAN 205 NUGUGAAGCAUGAUUCAAN 1254-1272 1252 89 UAUUGAAUCAUGCUUCACA 206 UGUGAAGCAUGAUUCAAUA 1255-1273 1253 90 AAUUGAAUCAUGCUUCACA 207 UGUGAAGCAUGAUUCAAUU 1255-1273 1253 91 NAUUGAAUCAUGCUUCACA 208 UGUGAAGCAUGAUUCAAUN 1255-1273 1253 92 NAUUGAAUCAUGCUUCACN 209 NGUGAAGCAUGAUUCAAUN 1255-1273 1253 93 GUCGAUAGUGUUCAGUAUU 210 AAUACUGAACACUAUCGAC 1270-1288 1268 94 UUCGAUAGUGUUCAGUAUU 211 AAUACUGAACACUAUCGAA 1270-1288 1268 95 AUCGAUAGUGUUCAGUAUU 212 AAUACUGAACACUAUCGAU 1270-1288 1268 96 NUCGAUAGUGUUCAGUAUU 213 AAUACUGAACACUAUCGAN 1270-1288 1268 97 NUCGAUAGUGUUCAGUAUN 214 NAUACUGAACACUAUCGAN 1270-1288 1268 98 GGAUUCUGAGGUAUGUCGA 215 UCGACAUACCUCAGAAUCC 1284-1302 1282 99 UGAUUCUGAGGUAUGUCGA 216 UCGACAUACCUCAGAAUCA 1284-1302 1282 100 AGAUUCUGAGGUAUGUCGA 217 UCGACAUACCUCAGAAUCU 1284-1302 1282 101 NGAUUCUGAGGUAUGUCGA 218 UCGACAUACCUCAGAAUCN 1284-1302 1282 102 NGAUUCUGAGGUAUGUCGN 219 NCGACAUACCUCAGAAUCN 1284-1302 1282 103 UGUAUCAUCAAGCAUUUCA 220 UGAAAUGCUUGAUGAUACA 1333-1351 1331 104 AGUAUCAUCAAGCAUUUCA 221 UGAAAUGCUUGAUGAUACU 1333-1351 1331 105 NGUAUCAUCAAGCAUUUCA 222 UGAAAUGCUUGAUGAUACN 1333-1351 1331 106 NGUAUCAUCAAGCAUUUCN 223 NGAAAUGCUUGAUGAUACN 1333-1351 1331 107 CAUUGUAUCAUCAAGCAUU 224 AAUGCUUGAUGAUACAAUG 1336-1354 1334 108 UAUUGUAUCAUCAAGCAUU 225 AAUGCUUGAUGAUACAAUA 1336-1354 1334 109 AAUUGUAUCAUCAAGCAUU 226 AAUGCUUGAUGAUACAAUU 1336-1354 1334 110 NAUUGUAUCAUCAAGCAUU 227 AAUGCUUGAUGAUACAAUN 1336-1354 1334 111 NAUUGUAUCAUCAAGCAUN 228 NAUGCUUGAUGAUACAAUN 1336-1354 1334 112 CAGAAUAGAUGUCAGCUCG 229 CGAGCUGACAUCUAUUCUG 1382-1400 1380 113 UAGAAUAGAUGUCAGCUCG 230 CGAGCUGACAUCUAUUCUA 1382-1400 1380 114 AAGAAUAGAUGUCAGCUCG 231 CGAGCUGACAUCUAUUCUU 1382-1400 1380 115 NAGAAUAGAUGUCAGCUCG 232 CGAGCUGACAUCUAUUCUN 1382-1400 1380 116 NAGAAUAGAUGUCAGCUCN 233 NGAGCUGACAUCUAUUCUN 1382-1400 1380 117 CAGUAAACCAGACCAACAG 234 CUGUUGGUCUGGUUUACUG 1398-1416 1396 118 UAGUAAACCAGACCAACAG 235 CUGUUGGUCUGGUUUACUA 1398-1416 1396 119 AAGUAAACCAGACCAACAG 236 CUGUUGGUCUGGUUUACUU 1398-1416 1396 120 NAGUAAACCAGACCAACAG 237 CUGUUGGUCUGGUUUACUN 1398-1416 1396 121 NAGUAAACCAGACCAACAN 238 NUGUUGGUCUGGUUUACUN 1398-1416 1396 122 GCAAUUGGUACUCCUCAAC 239 GUUGAGGAGUACCAAUUGC 1451-1469 1449 123 UCAAUUGGUACUCCUCAAC 240 GUUGAGGAGUACCAAUUGA 1451-1469 1449 124 ACAAUUGGUACUCCUCAAC 241 GUUGAGGAGUACCAAUUGU 1451-1469 1449 125 NCAAUUGGUACUCCUCAAC 242 GUUGAGGAGUACCAAUUGN 1451-1469 1449 126 NCAAUUGGUACUCCUCAAN 243 NUUGAGGAGUACCAAUUGN 1451-1469 1449 127 CCUCUAUCGAGGGAUCUGA 244 UCAGAUCCCUCGAUAGAGG 1490-1508 1488 128 UCUCUAUCGAGGGAUCUGA 245 UCAGAUCCCUCGAUAGAGA 1490-1508 1488 129 ACUCUAUCGAGGGAUCUGA 246 UCAGAUCCCUCGAUAGAGU 1490-1508 1488 130 NCUCUAUCGAGGGAUCUGA 247 UCAGAUCCCUCGAUAGAGN 1490-1508 1488 131 NCUCUAUCGAGGGAUCUGN 248 NCAGAUCCCUCGAUAGAGN 1490-1508 1488 132 AUUUCCUCUAUCGAGGGAU 249 AUCCCUCGAUAGAGGAAAU 1494-1512 1492 133 UUUUCCUCUAUCGAGGGAU 250 AUCCCUCGAUAGAGGAAAA 1494-1512 1492 134 NUUUCCUCUAUCGAGGGAU 251 AUCCCUCGAUAGAGGAAAN 1494-1512 1492 135 NUUUCCUCUAUCGAGGGAN 252 NUCCCUCGAUAGAGGAAAN 1494-1512 1492 136 GGAUACUUGGUCGAAACUU 253 AAGUUUCGACCAAGUAUCC 1535-1553 1533 137 UGAUACUUGGUCGAAACUU 254 AAGUUUCGACCAAGUAUCA 1535-1553 1533 138 AGAUACUUGGUCGAAACUU 255 AAGUUUCGACCAAGUAUCU 1535-1553 1533 139 NGAUACUUGGUCGAAACUU 256 AAGUUUCGACCAAGUAUCN 1535-1553 1533 140 NGAUACUUGGUCGAAACUN 257 NAGUUUCGACCAAGUAUCN 1535-1553 1533 141 UCUUAAUACGAAGAGCAGU 258 ACUGCUCUUCGUAUUAAGA 1640-1658 1638 142 ACUUAAUACGAAGAGCAGU 259 ACUGCUCUUCGUAUUAAGU 1640-1658 1638 143 NCUUAAUACGAAGAGCAGU 260 ACUGCUCUUCGUAUUAAGN 1640-1658 1638 144 NCUUAAUACGAAGAGCAGN 261 NCUGCUCUUCGUAUUAAGN 1640-1658 1638 N =any nucleobase
[0096] The ALK7 RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the ALK7 RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.
[0097] In some embodiments, the antisense strand of an ALK7 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an ALK7 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
[0098] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.
[0099] Certain modified ALK7 RNAi agent sense and antisense strands are provided in Table 3, Table 4, Table 5, Table 6, Table 6a, and Table 10. Certain modified ALK7 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified ALK7 RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Tables 4, 5, and 6. In forming ALK7 RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3, 4, 5, and 6, as well as in Table 2, above, can be a modified nucleotide.
[0100] The ALK7 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, Table 6, Table 6a can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0101] In some embodiments, an ALK7 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.
[0102] In some embodiments, an ALK7 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, Table 6a, or Table 10.
[0103] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5 and 6.
[0104] As used in Tables 3, 4, 5, 6, 6a, and 10, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: [0105] A=adenosine-3-phosphate [0106] C=cytidine-3-phosphate [0107] G=guanosine-3-phosphate [0108] U=uridine-3-phosphate [0109] I=inosine-3-phosphate [0110] a=2-O-methyladenosine-3-phosphate [0111] as =2-O-methyladenosine-3-phosphorothioate [0112] c=2-O-methylcytidine-3-phosphate [0113] cs=2-O-methylcytidine-3-phosphorothioate [0114] g=2-O-methylguanosine-3-phosphate [0115] gs=2-O-methylguanosine-3-phosphorothioate [0116] i=2-O-methylinosine-3-phosphate [0117] is =2-O-methylinosine-3-phosphorothioate [0118] t=2-O-methyl-5-methyluridine-3-phosphate [0119] ts=2-O-methyl-5-methyluridine-3-phosphorothioate [0120] u=2-O-methyluridine-3-phosphate [0121] us=2-O-methyluridine-3-phosphorothioate [0122] Af=2-fluoroadenosine-3-phosphate [0123] Afs=2-fluoroadenosine-3-phosporothioate [0124] Cf=2-fluorocytidine-3-phosphate [0125] Cfs=2-fluorocytidine-3-phosphorothioate [0126] Gf=2-fluoroguanosine-3-phosphate [0127] Gfs=2-fluoroguanosine-3-phosphorothioate [0128] Tf=2-fluoro-5-methyluridine-3-phosphate [0129] Tfs=2-fluoro-5-methyluridine-3-phosphorothioate [0130] Uf=2-fluorouridine-3-phosphate [0131] Ufs=2-fluorouridine-3-phosphorothioate [0132] dT=2-deoxythymidine-3-phosphate [0133] A.sub.UNA=2,3-seco-adenosine-3-phosphate [0134] A.sub.UNAs=2,3-seco-adenosine-3-phosphorothioate [0135] C.sub.UNA=2,3-seco-cytidine-3-phosphate [0136] C.sub.UNAS=2,3-seco-cytidine-3-phosphorothioate [0137] G.sub.UNA=2,3-seco-guanosine-3-phosphate [0138] G.sub.UNAS=2,3-seco-guanosine-3-phosphorothioate [0139] U.sub.UNA=2,3-seco-uridine-3-phosphate [0140] U.sub.UNAS=2,3-seco-uridine-3-phosphorothioate [0141] a_2N=see Table 11 [0142] a_2Ns=see Table 11 [0143] (invAb)=inverted abasic deoxyribonucleotide-5-phosphate, see Table 11 [0144] (invAb)s=inverted abasic deoxyribonucleotide-5-phosphorothioate, see Table 11 [0145] s=phosphorothioate linkage [0146] ss=phosphorodithioate linkage [0147] p=terminal phosphate (as synthesized) [0148] vpdN=vinyl phosphonate deoxyribonucleotide [0149] cPrpa=5-cyclopropyl phosphonate-2-O-methyladenosine-3-phosphate (see Table 11) [0150] cPrpas=5-cyclopropyl phosphonate-2-O-methyladenosine-3-phosphorothioate (see Table 11) [0151] cPrpi=5-cyclopropyl phosphonate-2-O-methylinosine-3-phosphate (see Table 11) [0152] cPrpis=5-cyclopropyl phosphonate-2-O-methylinosine-3-phosphorothioate (see Table 11) [0153] cPrpu=5-cyclopropyl phosphonate-2-O-methyluridine-3-phosphate (see Table 11) [0154] cPrpus=5-cyclopropyl phosphonate-2-O-methyluridine-3-phosphorothioate (see Table 11) [0155] (C6-SS-C6)=see Table 11 [0156] (C6-S)=see Table 11 [0157] (6-SS-6)=see Table 11 [0158] (NH2-C6)=see Table 11 [0159] (NH2-C6)s=see Table 11 [0160] (NH-C6)=see Table 11 [0161] (NH-C6)s=see Table 11 [0162] L6=see Table 11 [0163] LP-371-a=see Table 11 [0164] LP-379-a=see Table 11 [0165] LP-371-p=see Table 11 [0166] LP-379-p=see Table 11 [0167] (NAG37)=see Table 11 [0168] (NAG37)s=see Table 11
[0169] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage s or phosphorodithioate linkage ss), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5-3-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate or phosphorodithioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides. Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3 end of a given oligonucleotide sequence would typically have a hydroxyl (OH) group at the respective 3 position of the given monomer instead of a phosphate moiety ex vivo. Additionally, for the embodiments disclosed herein, when viewing the respective strand 5.fwdarw.3, the inverted abasic residues are inserted such that the 3 position of the deoxyribose is linked at the 3 end of the preceding monomer on the respective strand (see, e.g., Table 11). Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate tautomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the ALK7 RNAi agents and compositions of ALK7 RNAi agents disclosed herein.
[0170] Certain examples of PK/PD modulators and linking groups used with the ALK7 RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense strand and/or antisense strand can have any PK/PD modulators or linking groups listed herein, as well as other targeting groups, PK/PD modulators, linking groups, conjugated to the 5 and/or 3 end of the sequence.
TABLE-US-00004 TABLE3 ALK7RNAiAgentAntisenseStrandSequences SEQ UnderlyingBaseSequence SEQ AS ModifiedAntisenseStrand ID (5.fwdarw.3)(Shownasan ID StrandID (5.fwdarw.3) NO. UnmodifiedNucleotideSequence) NO. CA005127 cPrpusAfsugauAfgaauCfgUfgCfuucasc 262 UAUGAUAGAAUCGUGCUUCAC 551 CA005129 cPrpusAfsggauUfcuggGfgUfaUfgucusc 263 UAGGAUUCUGGGGUAUGUCUC 552 CA005131 cPrpusCfsgaauAfgaugUfcAfgCfucgcsu 264 UCGAAUAGAUGUCAGCUCGCU 553 CA005139 cPrpasAfsgacaUfacacAfcUfuCfagucsc 265 AAGACAUACACACUUCAGUCC 554 CA005141 cPrpusCfsaacaUfgcucCfuUfcUfguuusg 266 UCAACAUGCUCCUUCUGUUUG 555 CA005143 cPrpusUfsccauUfgguuAfgCfaUfgacusg 267 UUCCAUUGGUUAGCAUGACUG 556 CA005145 cPrpusUfsuggaAfcuauGfaCfaGfaagasc 268 UUUGGAACUAUGACAGAAGAC 557 CA005147 cPrpasUfsuguuGfgaacUfaUfgAfcagasc 269 AUUGUUGGAACUAUGACAGAC 558 CA005149 cPrpusCfsaugaUfauucAfgAfuAfccagsc 270 UCAUGAUAUUCAGAUACCAGC 559 CA005151 cPrpusCfsauauAfaggaGfcCfcUfguucsa 271 UCAUAUAAGGAGCCCUGUUCA 560 CA005153 cPrpasUfsaugaAfggugUfgCfcAfgaccsa 272 AUAUGAAGGUGUGCCAGACCA 561 CA005155 cPrpusCfsauauGfaaggUfgUfgCfcagasc 273 UCAUAUGAAGGUGUGCCAGAC 562 CA005157 cPrpusUfsccauAfugaaGfgUfgUfgccasg 274 UUCCAUAUGAAGGUGUGCCAG 563 CA005159 cPrpasAfsuagcAfgguuUfaCfcUfugugsu 275 AAUAGCAGGUUUACCUUGUGU 564 CA005161 cPrpasGfscaauAfgcagGfuUfuAfccuusg 276 AGCAAUAGCAGGUUUACCUUG 565 CA005163 cPrpusCfsuaagUfccgcUfaUfgGfcacasa 277 UCUAAGUCCGCUAUGGCACAA 566 CA005165 cPrpasUfsugaaUfcaugCfuUfcAfcagcsc 278 AUUGAAUCAUGCUUCACAGCC 567 CA005167 cPrpusAfsuugaAfucauGfcUfuCfacagsc 279 UAUUGAAUCAUGCUUCACAGC 568 CA005169 cPrpusUfscgauAfguguUfcAfgUfauugsc 280 UUCGAUAGUGUUCAGUAUUGC 569 CA005171 cPrpusGfsauucUfgaggUfaUfgUfcgausc 281 UGAUUCUGAGGUAUGUCGAUC 570 CA005173 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 UGUAUCAUCAAGCAUUUCAGG 571 CA005175 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 UAUUGUAUCAUCAAGCAUUUC 572 CA005177 cPrpusAfsgaauAfgaugUfcAfgCfucgusu 284 UAGAAUAGAUGUCAGCUCGUU 573 CA005179 cPrpusAfsguaaAfccagAfcCfaAfcagasc 285 UAGUAAACCAGACCAACAGAC 574 CA005181 cPrpusCfsaauuGfguacUfcCfuCfaacasc 286 UCAAUUGGUACUCCUCAACAC 575 CA005183 cPrpusCfsucuaUfcgagGfgAfuCfugaasg 287 UCUCUAUCGAGGGAUCUGAAG 576 CA005185 cPrpasUfsuuccUfcuauCfgAfgGfgaucsu 288 AUUUCCUCUAUCGAGGGAUCU 577 CA005187 cPrpusGfsauacUfugguCfgAfaAfcuucsu 289 UGAUACUUGGUCGAAACUUCU 578 CA005189 cPrpusCfsuuaaUfacgaAfgAfgCfaguusc 290 UCUUAAUACGAAGAGCAGUUC 579 CA006102 cPrpusAfsugauagaauCfgUfgCfuucasc 291 UAUGAUAGAAUCGUGCUUCAC 551 CA007125 cPrpusUfsuggaAfcuauGfaCfaGfaagsasc 292 UUUGGAACUAUGACAGAAGAC 557 CA007130 cPrpusUfsuggaacuauGfaCfagaagasc 293 UUUGGAACUAUGACAGAAGAC 557 CA007131 cPrpusUfsUfggaacuauGfaCfaGfaagasc 294 UUUGGAACUAUGACAGAAGAC 557 CA007132 cPrpusUfsuGfgaacuauGfaCfaGfaagasc 295 UUUGGAACUAUGACAGAAGAC 557 CA007133 cPrpusUfsuggAfacuauGfaCfaGfaagasc 296 UUUGGAACUAUGACAGAAGAC 557 CA007134 cPrpusUfsuggAfaCfuAfuGfaCfaGfaagasc 297 UUUGGAACUAUGACAGAAGAC 557 CA007135 cPrpasUfsuguuGfgaacUfaUfgAfcagsasc 298 AUUGUUGGAACUAUGACAGAC 558 CA007137 cPrpusUfsuguuGfgaacUfaUfgAfcagasc 299 UUUGUUGGAACUAUGACAGAC 580 CA007142 cPrpasUfsuguuggaacUfaUfgacagasc 300 AUUGUUGGAACUAUGACAGAC 558 CA007143 cPrpasUfsUfguuggaacUfaUfgAfcagasc 301 AUUGUUGGAACUAUGACAGAC 558 CA007144 cPrpasUfsuGfuuggaacUfaUfgAfcagasc 302 AUUGUUGGAACUAUGACAGAC 558 CA007145 cPrpasUfsuguUfggaacUfaUfgAfcagasc 303 AUUGUUGGAACUAUGACAGAC 558 CA007147 cPrpusCfsaugaUfauucAfgAfuAfccasgsc 304 UCAUGAUAUUCAGAUACCAGC 559 CA007152 cPrpusCfsaugauauucAfgAfuaccagsc 305 UCAUGAUAUUCAGAUACCAGC 559 CA007153 cPrpusCfsAfugauauucAfgAfuAfccagsc 306 UCAUGAUAUUCAGAUACCAGC 559 CA007154 cPrpusCfsaUfgauauucAfgAfuAfccagsc 307 UCAUGAUAUUCAGAUACCAGC 559 CA007155 cPrpusCfsaugAfuauucAfgAfuAfccagsc 308 UCAUGAUAUUCAGAUACCAGC 559 CA007156 cPrpusCfsaugAfuAfuUfcAfgAfuAfccagsc 309 UCAUGAUAUUCAGAUACCAGC 559 CA007379 cPrpisUfsuguuGfgaacUfaUfgAfcagasc 310 IUUGUUGGAACUAUGACAGAC 581 CA007380 cPrpisUfsuguuGfgaacUfaUfgAfcagasc 311 IUUGUUGGAACUAUGACAGAC 581 CA007563 cPrpusUfscgauAfguguUfcAfgUfauusgsc 312 UUCGAUAGUGUUCAGUAUUGC 569 CA007568 cPrpusUfscgauaguguUfcAfguauugsc 313 UUCGAUAGUGUUCAGUAUUGC 569 CA007569 cPrpusUfsCfgauaguguUfcAfgUfauugsc 314 UUCGAUAGUGUUCAGUAUUGC 569 CA007570 cPrpusUfscGfauaguguUfcAfgUfauugsc 315 UUCGAUAGUGUUCAGUAUUGC 569 CA007571 cPrpusUfscgaUfaguguUfcAfgUfauugsc 316 UUCGAUAGUGUUCAGUAUUGC 569 CA007572 cPrpusUfscgaUfaGfuGfuUfcAfgUfauugsc 317 UUCGAUAGUGUUCAGUAUUGC 569 CA007573 cPrpusUfscGfaUfaGfuGfuUfcAfgUfauugsc 318 UUCGAUAGUGUUCAGUAUUGC 569 CA007574 cPrpusGfsuaucAfucaaGfcAfuUfucasgsg 319 UGUAUCAUCAAGCAUUUCAGG 571 CA007579 cPrpusGfsuaucaucaaGfcAfuuucagsg 320 UGUAUCAUCAAGCAUUUCAGG 571 CA007580 cPrpusGfsUfaucaucaaGfcAfuUfucagsg 321 UGUAUCAUCAAGCAUUUCAGG 571 CA007581 cPrpusGfsuAfucaucaaGfcAfuUfucagsg 322 UGUAUCAUCAAGCAUUUCAGG 571 CA007582 cPrpusGfsuauCfaucaaGfcAfuUfucagsg 323 UGUAUCAUCAAGCAUUUCAGG 571 CA007583 cPrpusGfsuauCfaUfcAfaGfcAfuUfucagsg 324 UGUAUCAUCAAGCAUUUCAGG 571 CA007584 cPrpusGfsuAfuCfaUfcAfaGfcAfuUfucagsg 325 UGUAUCAUCAAGCAUUUCAGG 571 CA007586 cPrpusAfsuuguAfucauCfaAfgCfauususc 326 UAUUGUAUCAUCAAGCAUUUC 572 CA007591 cPrpusAfsuuguaucauCfaAfgcauuusc 327 UAUUGUAUCAUCAAGCAUUUC 572 CA007592 cPrpusAfsUfuguaucauCfaAfgCfauuusc 328 UAUUGUAUCAUCAAGCAUUUC 572 CA007593 cPrpusAfsuUfguaucauCfaAfgCfauuusc 329 UAUUGUAUCAUCAAGCAUUUC 572 CA007594 cPrpusAfsuugUfaucauCfaAfgCfauuusc 330 UAUUGUAUCAUCAAGCAUUUC 572 CA007595 cPrpusAfsuugUfaUfcAfuCfaAfgCfauuusc 331 UAUUGUAUCAUCAAGCAUUUC 572 CA007596 cPrpusAfsuUfgUfaUfcAfuCfaAfgCfauuusc 332 UAUUGUAUCAUCAAGCAUUUC 572 CA008042 cPrpusGfsuaUfcaucaaGfcAfuUfucagsg 333 UGUAUCAUCAAGCAUUUCAGG 571 CA008047 cPrpusGfsuaUfcaucaaGfcAfuUfucagssg 334 UGUAUCAUCAAGCAUUUCAGG 571 CA008050 cPrpisUfsugUfuggaacUfaUfgAfcagasc 335 IUUGUUGGAACUAUGACAGAC 581 CA008052 cPrpusCfsauGfauauucAfgAfuAfccagsc 336 UCAUGAUAUUCAGAUACCAGC 559 CA008053 cPrpusCfsauGfauauucAfgAfuAfccagssc 337 UCAUGAUAUUCAGAUACCAGC 559 CA008054 cPrpusUfscgAfuaguguUfcAfgUfauugsc 338 UUCGAUAGUGUUCAGUAUUGC 569 CA008055 cPrpusUfscgAfuaguguUfcAfgUfauugssc 339 UUCGAUAGUGUUCAGUAUUGC 569 CA008087 cPrpisUfsugUfuggaacUfaUfgAfcagassc 340 IUUGUUGGAACUAUGACAGAC 581 CA008542 cPrpusUfsuggaAfcuauGfaUfaGfaagasc 341 UUUGGAACUAUGAUAGAAGAC 582 CA008544 cPrpusUfsuggaAfcuauGfaCfaGfaggasc 342 UUUGGAACUAUGACAGAGGAC 583 CA008546 cPrpusUfsuggaAfcuauGfaCfaGfaaggsc 343 UUUGGAACUAUGACAGAAGGC 584 CA008547 cPrpusUfsuggaAfcuauGfaUfaGfaggasc 344 UUUGGAACUAUGAUAGAGGAC 585 CA008548 cPrpusUfsuggaAfcuauGfaUfaGfaaggsc 345 UUUGGAACUAUGAUAGAAGGC 586 CA008550 cPrpusUfsuggaAfcuauGfaCfaGfggg 346 UUUGGAACUAUGACAGGGG 587 CA008551 cPrpusUfsuggaAfcuauGfaUfaGfggg 347 UUUGGAACUAUGAUAGGGG 588 CA008553 cPrpusUfsuGfuuggaacUfaUfgAfcagasc 348 UUUGUUGGAACUAUGACAGAC 580 CA008554 cPrpisUfsuGfuuggaacUfaUfgAfcagasc 349 IUUGUUGGAACUAUGACAGAC 581 CA008555 cPrpisUfsuGfuuggaacUfaUfgAfcagassc 350 IUUGUUGGAACUAUGACAGAC 581 CA008556 cPrpisUfsuguuGfgaacUfaUfgAfcagassc 351 IUUGUUGGAACUAUGACAGAC 581 CA009908 cPrpusUfsuggaAfcuauGfaCfaGfaagassc 352 UUUGGAACUAUGACAGAAGAC 557 CA009909 cPrpusUfsugggAfcuauGfaCfaGfaagasc 353 UUUGGGACUAUGACAGAAGAC 589 CA009910 cPrpusUfsuggG.sub.UNAAfcuauGfaCfaGfaagasc 354 UUUGGGACUAUGACAGAAGAC 589 CA009911 cPrpusUfsuggG.sub.UNAAfcuauGfaCfaGfaggasc 355 UUUGGGACUAUGACAGAGGAC 590 CA009912 cPrpusUfsuggaGfcuauGfaCfaGfaagasc 356 UUUGGAGCUAUGACAGAAGAC 591 CA009913 cPrpusUfsuggaG.sub.UNAcuauGfaCfaGfaggasc 357 UUUGGAGCUAUGACAGAGGAC 592 CA009914 cPrpusUfsuigaAfcuauGfaCfaGfaagasc 358 UUUIGAACUAUGACAGAAGAC 593 CA009915 cPrpusUfsugiaAfcuauGfaCfaGfaagasc 359 UUUGIAACUAUGACAGAAGAC 594 I =inosine (hypoxanthine nucleobase) nucleotide
TABLE-US-00005 TABLE4 ALK7AgentSenseStrandSequences(ShownWithoutLinkers,Conjugates,CappingMoieties, orTerminaldT) SEQ UnderlyingBaseSequence SEQ ModifiedSenseStrand ID (5.fwdarw.3)(ShownasanUnmodified ID StrandID (5.fwdarw.3) NO. NucleotideSequence) NO. CS005138-NL ggacugaaGfUfGfuguaugucuu 360 GGACUGAAGUGUGUAUGUCUU 595 CS005140-NL caaacagaAfGfGfagcauguuga 361 CAAACAGAAGGAGCAUGUUGA 596 CS005142-NL cagucaugCfUfAfaccaauggaa 362 CAGUCAUGCUAACCAAUGGAA 597 CS005144-NL gucuucugUfCfAfuaguuccaaa 363 GUCUUCUGUCAUAGUUCCAAA 598 CS005146-NL gucugucaUfAfGfuuccaacaau 364 GUCUGUCAUAGUUCCAACAAU 599 CS005148-NL gcugguauCfUfGfaauaucauga 365 GCUGGUAUCUGAAUAUCAUGA 600 CS005150-NL ugaacaggGfCfUfccuuauauga 366 UGAACAGGGCUCCUUAUAUGA 601 CS005152-NL uggucuggCfAfCfaccuucauau 367 UGGUCUGGCACACCUUCAUAU 602 CS005154-NL gucuggcaCfAfCfcuucauauga 368 GUCUGGCACACCUUCAUAUGA 603 CS005156-NL cuggcacaCfCfUfucauauggaa 369 CUGGCACACCUUCAUAUGGAA 604 CS005158-NL acacaaggUfAfAfaccugcuauu 370 ACACAAGGUAAACCUGCUAUU 605 CS005160-NL caagguaaAfCfCfugcuauugcu 371 CAAGGUAAACCUGCUAUUGCU 606 CS005162-NL uugugccaUfAfGfcggacuuaga 372 UUGUGCCAUAGCGGACUUAGA 607 CS005164-NL ggcugugaAfGfCfaugauucaau 373 GGCUGUGAAGCAUGAUUCAAU 608 CS005166-NL gcugugaaGfCfAfugauucaaua 374 GCUGUGAAGCAUGAUUCAAUA 609 CS005168-NL gcaauacuGfAfAfcacuaucgaa 375 GCAAUACUGAACACUAUCGAA 610 CS005170-NL gaucgacaUfAfCfcucagaauca 376 GAUCGACAUACCUCAGAAUCA 611 CS005172-NL ccugaaauGfCfUfugaugauaca 377 CCUGAAAUGCUUGAUGAUACA 612 CS005174-NL ga_2NaaugcuUfGfAfugauacaa_2Nua 378 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS005176-NL aacgagcuGfAfCfaucuauucua 379 AACGAGCUGACAUCUAUUCUA 614 CS005178-NL gucuguugGfUfCfugguuuacua 380 GUCUGUUGGUCUGGUUUACUA 615 CS005180-NL guguugagGfAfGfuaccaauuga 381 GUGUUGAGGAGUACCAAUUGA 616 CS005182-NL cuucagauCfCfCfucgauagaga 382 CUUCAGAUCCCUCGAUAGAGA 617 CS005184-NL agaucccuCfGfAfuagaggaaau 383 AGAUCCCUCGAUAGAGGAAAU 618 CS005186-NL a_2NgaaguuuCfGfAfccaaguauca 384 (A.sup.2N)GAAGUUUCGACCAAGUAUCA 619 CS005188-NL gaacugcuCfUfUfcguauuaaga 385 GAACUGCUCUUCGUAUUAAGA 620 CS005209-NL ggacugaaGfUfGfuguaugucuu 386 GGACUGAAGUGUGUAUGUCUU 595 CS005210-NL caaacagaAfGfGfagcauguuga 387 CAAACAGAAGGAGCAUGUUGA 596 CS005211-NL cagucaugCfUfAfaccaauggaa 388 CAGUCAUGCUAACCAAUGGAA 597 CS005212-NL gucuucugUfCfAfuaguuccaaa 389 GUCUUCUGUCAUAGUUCCAAA 598 CS005213-NL gucugucaUfAfGfuuccaacaau 390 GUCUGUCAUAGUUCCAACAAU 599 CS005214-NL gcugguauCfUfGfaauaucauga 391 GCUGGUAUCUGAAUAUCAUGA 600 CS005215-NL ugaacaggGfCfUfccuuauauga 392 UGAACAGGGCUCCUUAUAUGA 601 CS005216-NL uggucuggCfAfCfaccuucauau 393 UGGUCUGGCACACCUUCAUAU 602 CS005217-NL gucuggcaCfAfCfcuucauauga 394 GUCUGGCACACCUUCAUAUGA 603 CS005218-NL cuggcacaCfCfUfucauauggaa 395 CUGGCACACCUUCAUAUGGAA 604 CS005219-NL acacaaggUfAfAfaccugcuauu 396 ACACAAGGUAAACCUGCUAUU 605 CS005220-NL caagguaaAfCfCfugcuauugcu 397 CAAGGUAAACCUGCUAUUGCU 606 CS005221-NL uugugccaUfAfGfcggacuuaga 398 UUGUGCCAUAGCGGACUUAGA 607 CS005222-NL ggcugugaAfGfCfaugauucaau 399 GGCUGUGAAGCAUGAUUCAAU 608 CS005223-NL gcugugaaGfCfAfugauucaaua 400 GCUGUGAAGCAUGAUUCAAUA 609 CS005224-NL gcaauacuGfAfAfcacuaucgaa 401 GCAAUACUGAACACUAUCGAA 610 CS005225-NL gaucgacaUfAfCfcucagaauca 402 GAUCGACAUACCUCAGAAUCA 611 CS005226-NL ccugaaauGfCfUfugaugauaca 403 CCUGAAAUGCUUGAUGAUACA 612 CS005227-NL ga_2NaaugcuUfGfAfugauacaa_2Nua 404 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS005228-NL aacgagcuGfAfCfaucuauucua 405 AACGAGCUGACAUCUAUUCUA 614 CS005229-NL gucuguugGfUfCfugguuuacua 406 GUCUGUUGGUCUGGUUUACUA 615 CS005230-NL guguugagGfAfGfuaccaauuga 407 GUGUUGAGGAGUACCAAUUGA 616 CS005231-NL cuucagauCfCfCfucgauagaga 408 CUUCAGAUCCCUCGAUAGAGA 617 CS005232-NL agaucccuCfGfAfuagaggaaau 409 AGAUCCCUCGAUAGAGGAAAU 618 CS005233-NL a_2NgaaguuuCfGfAfccaaguauca 410 (A.sup.2N)GAAGUUUCGACCAAGUAUCA 619 CS005234-NL gaacugcuCfUfUfcguauuaaga 411 GAACUGCUCUUCGUAUUAAGA 620 CS007126-NL gucuucugUfcAfuAfguuccaaa 412 GUCUUCUGUCAUAGUUCCAAA 598 CS007127-NL gucuucugUfCfaUfaguuccaaa 413 GUCUUCUGUCAUAGUUCCAAA 598 CS007128-NL gucuucUfguCfAfuaguuccaaa 414 GUCUUCUGUCAUAGUUCCAAA 598 CS007129-NL gucuucUfgUfcAfuaguuccaaa 415 GUCUUCUGUCAUAGUUCCAAA 598 CS007136-NL gucugucaUfAfGfuuccaacaaa 416 GUCUGUCAUAGUUCCAACAAA 621 CS007138-NL gucugucaUfaGfuUfccaacaau 417 GUCUGUCAUAGUUCCAACAAU 599 CS007139-NL gucugucaUfAfgUfuccaacaau 418 GUCUGUCAUAGUUCCAACAAU 599 CS007140-NL gucuguCfauAfGfuuccaacaau 419 GUCUGUCAUAGUUCCAACAAU 599 CS007141-NL gucuguCfaUfaGfuuccaacaau 420 GUCUGUCAUAGUUCCAACAAU 599 CS007148-NL gcugguauCfuGfaAfuaucauga 421 GCUGGUAUCUGAAUAUCAUGA 600 CS007149-NL gcugguauCfUfgAfauaucauga 422 GCUGGUAUCUGAAUAUCAUGA 600 CS007150-NL gcugguAfucUfGfaauaucauga 423 GCUGGUAUCUGAAUAUCAUGA 600 CS007151-NL gcugguAfuCfuGfaauaucauga 424 GCUGGUAUCUGAAUAUCAUGA 600 CS007564-NL gcaauacuGfaAfcAfcuaucgaa 425 GCAAUACUGAACACUAUCGAA 610 CS007565-NL gcaauacuGfAfaCfacuaucgaa 426 GCAAUACUGAACACUAUCGAA 610 CS007566-NL gcaauaCfugAfAfcacuaucgaa 427 GCAAUACUGAACACUAUCGAA 610 CS007567-NL gcaauaCfuGfaAfcacuaucgaa 428 GCAAUACUGAACACUAUCGAA 610 CS007578-NL ccugaaAfuGfcUfugaugauaca 429 CCUGAAAUGCUUGAUGAUACA 612 CS007711-NL gaaaugcuUfGfAfugauacaaua 430 GAAAUGCUUGAUGAUACAAUA 622 CS007712-NL ga_2NaaugcuUfgAfuGfauacaa_2Nua 431 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS007713-NL ga_2NaaugcuUfGfaUfgauacaa_2Nua 432 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS007714-NL ga_2NaaugCfuuGfAfugauacaa_2Nua 433 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS007715-NL ga_2NaaugCfuUfgAfugauacaa_2Nua 434 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS007716-NL ccugaaauGfcUfuGfaugauaca 435 CCUGAAAUGCUUGAUGAUACA 612 CS007717-NL ccugaaauGfCfuUfgaugauaca 436 CCUGAAAUGCUUGAUGAUACA 612 CS007718-NL ccugaaAfugCfUfugaugauaca 437 CCUGAAAUGCUUGAUGAUACA 612 CS007719-NL ccugaaAfuGfcUfugaugauaca 438 CCUGAAAUGCUUGAUGAUACA 612 CS008543-NL guccucugUfcAfuAfguuccaaa 439 GUCCUCUGUCAUAGUUCCAAA 623 CS008545-NL gccuucugUfcAfuAfguuccaaa 440 GCCUUCUGUCAUAGUUCCAAA 624 CS008549-NL ccccugUfcAfuAfguuccaaa 441 CCCCUGUCAUAGUUCCAAA 625 CS008552-NL gucugucaUfaGfuUfccaacaaa 442 GUCUGUCAUAGUUCCAACAAA 621 CS011689-NL ccugaaAfuGfcUfugaugauaca 443 CCUGAAAUGCUUGAUGAUACA 612 CS011691-NL ccugaaAfuGfcUfugaugauaca 444 CCUGAAAUGCUUGAUGAUACA 612 I =inosine (hypoxanthine nucleobase) nucleotide (A2N) =2-aminoadenosine nucleotide
TABLE-US-00006 TABLE5 ALK7AgentSenseStrandSequences(ShownWith(NH2-C6)Linker,(NAG37)sligand,(invAb)endcap,orterminaldT(seeTable11 forstructureinformation.)) SEQID UnderlyingBaseSequence(5.fwdarw.3) NO. (ShownasanUnmodifiedNucleotide SEQID StrandID ModifiedSenseStrand(5.fwdarw.3) Sequence) NO. CS005138 (NH2-C6)s(invAb)sggacugaaGfUfGfuguaugucuus(invAb)-(C6- 445 GGACUGAAGUGUGUAUGUCUUT 626 SS)-MeC5-dT CS005140 (NH2-C6)s(invAb)scaaacagaAfGfGfagcauguugas(invAb)-(C6- 446 CAAACAGAAGGAGCAUGUUGAT 627 SS)-MeC5-dT CS005142 (NH2-C6)s(invAb)scagucaugCfUfAfaccaauggaas(invAb)-(C6- 447 CAGUCAUGCUAACCAAUGGAAT 628 SS)-MeC5-dT CS005144 (NH2-C6)s(invAb)sgucuucugUfCfAfuaguuccaaas(invAb)-(C6- 448 GUCUUCUGUCAUAGUUCCAAAT 629 SS)-MeC5-dT CS005146 (NH2-C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6- 449 GUCUGUCAUAGUUCCAACAAUT 630 SS)-MeC5-dT CS005148 (NH2-C6)s(invAb)sgcugguauCfUfGfaauaucaugas(invAb)-(C6- 450 GCUGGUAUCUGAAUAUCAUGAT 631 SS)-MeC5-dT CS005150 (NH2-C6)s(invAb)sugaacaggGfCfUfccuuauaugas(invAb)-(C6- 451 UGAACAGGGCUCCUUAUAUGAT 632 SS)-MeC5-dT CS005152 (NH2-C6)s(invAb)suggucuggCfAfCfaccuucauaus(invAb)-(C6- 452 UGGUCUGGCACACCUUCAUAUT 633 SS)-MeC5-dT CS005154 (NH2-C6)s(invAb)sgucuggcaCfAfCfcuucauaugas(invAb)-(C6- 453 GUCUGGCACACCUUCAUAUGAT 634 SS)-MeC5-dT CS005156 (NH2-C6)s(invAb)scuggcacaCfCfUfucauauggaas(invAb)-(C6- 454 CUGGCACACCUUCAUAUGGAAT 635 SS)-MeC5-dT CS005158 (NH2-C6)s(invAb)sacacaaggUfAfAfaccugcuauus(invAb)-(C6- 455 ACACAAGGUAAACCUGCUAUUT 636 SS)-MeC5-dT CS005160 (NH2-C6)s(invAb)scaagguaaAfCfCfugcuauugcus(invAb)-(C6- 456 CAAGGUAAACCUGCUAUUGCUT 637 SS)-MeC5-dT CS005162 (NH2-C6)s(invAb)suugugccaUfAfGfcggacuuagas(invAb)-(C6- 457 UUGUGCCAUAGCGGACUUAGAT 638 SS)-MeC5-dT CS005164 (NH2-C6)s(invAb)sggcugugaAfGfCfaugauucaaus(invAb)-(C6- 458 GGCUGUGAAGCAUGAUUCAAUT 639 SS)-MeC5-dT CS005166 (NH2-C6)s(invAb)sgcugugaaGfCfAfugauucaauas(invAb)-(C6- 459 GCUGUGAAGCAUGAUUCAAUAT 640 SS)-MeC5-dT CS005168 (NH2-C6)s(invAb)sgcaauacuGfAfAfcacuaucgaas(invAb)-(C6- 460 GCAAUACUGAACACUAUCGAAT 641 SS)-MeC5-dT CS005170 (NH2-C6)s(invAb)sgaucgacaUfAfCfcucagaaucas(invAb)-(C6- 461 GAUCGACAUACCUCAGAAUCAT 642 SS)-MeC5-dT CS005172 (NH2-C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6- 462 CCUGAAAUGCUUGAUGAUACAT 643 SS)-MeC5-dT CS005174 (NH2- 463 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 644 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)-(C6- T SS)-MeC5-dT CS005176 (NH2-C6)s(invAb)saacgagcuGfAfCfaucuauucuas(invAb)-(C6- 464 AACGAGCUGACAUCUAUUCUAT 645 SS)-MeC5-dT CS005178 (NH2-C6)s(invAb)sgucuguugGfUfCfugguuuacuas(invAb)-(C6- 465 GUCUGUUGGUCUGGUUUACUAT 646 SS)-MeC5-dT CS005180 (NH2-C6)s(invAb)sguguugagGfAfGfuaccaauugas(invAb)-(C6- 466 GUGUUGAGGAGUACCAAUUGAT 647 SS)-MeC5-dT CS005182 (NH2-C6)s(invAb)scuucagauCfCfCfucgauagagas(invAb)-(C6- 467 CUUCAGAUCCCUCGAUAGAGAT 648 SS)-MeC5-dT CS005184 (NH2-C6)s(invAb)sagaucccuCfGfAfuagaggaaaus(invAb)-(C6- 468 AGAUCCCUCGAUAGAGGAAAUT 649 SS)-MeC5-dT CS005186 (NH2-C6)s(invAb)sa_2NgaaguuuCfGfAfccaaguaucas(invAb)- 469 (A2N)GAAGUUUCGACCAAGUAUCAT 650 (C6-SS)-MeC5-dT CS005188 (NH2-C6)s(invAb)sgaacugcuCfUfUfcguauuaagas(invAb)-(C6- 470 GAACUGCUCUUCGUAUUAAGAT 651 SS)-MeC5-dT CS005209 (NAG37)s(invAb)sggacugaaGfUfGfuguaugucuus(invAb) 471 GGACUGAAGUGUGUAUGUCUU 595 CS005210 (NAG37)s(invAb)scaaacagaAfGfGfagcauguugas(invAb) 472 CAAACAGAAGGAGCAUGUUGA 596 CS005211 (NAG37)s(invAb)scagucaugCfUfAfaccaauggaas(invAb) 473 CAGUCAUGCUAACCAAUGGAA 597 CS005212 (NAG37)s(invAb)sgucuucugUfCfAfuaguuccaaas(invAb) 474 GUCUUCUGUCAUAGUUCCAAA 598 CS005213 (NAG37)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb) 475 GUCUGUCAUAGUUCCAACAAU 599 CS005214 (NAG37)s(invAb)sgcugguauCfUfGfaauaucaugas(invAb) 476 GCUGGUAUCUGAAUAUCAUGA 600 CS005215 (NAG37)s(invAb)sugaacaggGfCfUfccuuauaugas(invAb) 477 UGAACAGGGCUCCUUAUAUGA 601 CS005216 (NAG37)s(invAb)suggucuggCfAfCfaccuucauaus(invAb) 478 UGGUCUGGCACACCUUCAUAU 602 CS005217 (NAG37)s(invAb)sgucuggcaCfAfCfcuucauaugas(invAb) 479 GUCUGGCACACCUUCAUAUGA 603 CS005218 (NAG37)s(invAb)scuggcacaCfCfUfucauauggaas(invAb) 480 CUGGCACACCUUCAUAUGGAA 604 CS005219 (NAG37)s(invAb)sacacaaggUfAfAfaccugcuauus(invAb) 481 ACACAAGGUAAACCUGCUAUU 605 CS005220 (NAG37)s(invAb)scaagguaaAfCfCfugcuauugcus(invAb) 482 CAAGGUAAACCUGCUAUUGCU 606 CS005221 (NAG37)s(invAb)suugugccaUfAfGfcggacuuagas(invAb) 483 UUGUGCCAUAGCGGACUUAGA 607 CS005222 (NAG37)s(invAb)sggcugugaAfGfCfaugauucaaus(invAb) 484 GGCUGUGAAGCAUGAUUCAAU 608 CS005223 (NAG37)s(invAb)sgcugugaaGfCfAfugauucaauas(invAb) 485 GCUGUGAAGCAUGAUUCAAUA 609 CS005224 (NAG37)s(invAb)sgcaauacuGfAfAfcacuaucgaas(invAb) 486 GCAAUACUGAACACUAUCGAA 610 CS005225 (NAG37)s(invAb)sgaucgacaUfAfCfcucagaaucas(invAb) 487 GAUCGACAUACCUCAGAAUCA 611 CS005226 (NAG37)s(invAb)sccugaaauGfCfUfugaugauacas(invAb) 488 CCUGAAAUGCUUGAUGAUACA 612 CS005227 (NAG37)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb 489 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 613 CS005228 (NAG37)s(invAb)saacgagcuGfAfCfaucuauucuas(invAb) 490 AACGAGCUGACAUCUAUUCUA 614 CS005229 (NAG37)s(invAb)sgucuguugGfUfCfugguuuacuas(invAb) 491 GUCUGUUGGUCUGGUUUACUA 615 CS005230 (NAG37)s(invAb)sguguugagGfAfGfuaccaauugas(invAb) 492 GUGUUGAGGAGUACCAAUUGA 616 CS005231 (NAG37)s(invAb)scuucagauCfCfCfucgauagagas(invAb) 493 CUUCAGAUCCCUCGAUAGAGA 617 CS005232 (NAG37)s(invAb)sagaucccuCfGfAfuagaggaaaus(invAb) 494 AGAUCCCUCGAUAGAGGAAAU 618 CS005233 (NAG37)s(invAb)sa_2NgaaguuuCfGfAfccaaguaucas(invAb) 495 (A.sup.2N)GAAGUUUCGACCAAGUAUCA 619 CS005234 (NAG37)s(invAb)sgaacugcuCfUfUfcguauuaagas(invAb) 496 GAACUGCUCUUCGUAUUAAGA 620 CS007126 (NAG37)s(invAb)sgucuucugUfcAfuAfguuccaaas(invAb) 497 GUCUUCUGUCAUAGUUCCAAA 598 CS007127 (NAG37)s(invAb)sgucuucugUfCfaUfaguuccaaas(invAb) 498 GUCUUCUGUCAUAGUUCCAAA 598 CS007128 (NAG37)s(invAb)sgucuucUfguCfAfuaguuccaaas(invAb) 499 GUCUUCUGUCAUAGUUCCAAA 598 CS007129 (NAG37)s(invAb)sgucuucUfgUfcAfuaguuccaaas(invAb) 500 GUCUUCUGUCAUAGUUCCAAA 598 CS007136 (NAG37)s(invAb)sgucugucaUfAfGfuuccaacaaas(invAb) 501 GUCUGUCAUAGUUCCAACAAA 621 CS007138 (NAG37)s(invAb)sgucugucaUfaGfuUfccaacaaus(invAb) 502 GUCUGUCAUAGUUCCAACAAU 599 CS007139 (NAG37)s(invAb)sgucugucaUfAfgUfuccaacaaus(invAb) 503 GUCUGUCAUAGUUCCAACAAU 599 CS007140 (NAG37)s(invAb)sgucuguCfauAfGfuuccaacaaus(invAb) 504 GUCUGUCAUAGUUCCAACAAU 599 CS007141 (NAG37)s(invAb)sgucuguCfaUfaGfuuccaacaaus(invAb) 505 GUCUGUCAUAGUUCCAACAAU 599 CS007148 (NAG37)s(invAb)sgcugguauCfuGfaAfuaucaugas(invAb) 506 GCUGGUAUCUGAAUAUCAUGA 600 CS007149 (NAG37)s(invAb)sgcugguauCfUfgAfauaucaugas(invAb) 507 GCUGGUAUCUGAAUAUCAUGA 600 CS007150 (NAG37)s(invAb)sgcugguAfucUfGfaauaucaugas(invAb) 508 GCUGGUAUCUGAAUAUCAUGA 600 CS007151 (NAG37)s(invAb)sgcugguAfuCfuGfaauaucaugas(invAb) 509 GCUGGUAUCUGAAUAUCAUGA 600 CS007564 (NAG37)s(invAb)sgcaauacuGfaAfcAfcuaucgaas(invAb) 510 GCAAUACUGAACACUAUCGAA 610 CS007565 (NAG37)s(invAb)sgcaauacuGfAfaCfacuaucgaas(invAb) 511 GCAAUACUGAACACUAUCGAA 610 CS007566 (NAG37)s(invAb)sgcaauaCfugAfAfcacuaucgaas(invAb) 512 GCAAUACUGAACACUAUCGAA 610 CS007567 (NAG37)s(invAb)sgcaauaCfuGfaAfcacuaucgaas(invAb) 513 GCAAUACUGAACACUAUCGAA 610 CS007578 (NAG37)s(invAb)sccugaaAfuGfcUfugaugauacas(invAb) 514 CCUGAAAUGCUUGAUGAUACA 612 CS007711 (NH2-C6)s(invAb)sgaaaugcuUfGfAfugauacaauas(invAb)-(C6- 515 GAAAUGCUUGAUGAUACAAUAT 652 SS)-MeC5-dT CS007712 (NH2- 516 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 644 C6)s(invAb)sga_2NaaugcuUfgAfuGfauacaa_2Nuas(invAb)-(C6- T SS)-MeC5-dT CS007713 (NH2- 517 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 644 C6)s(invAb)sga_2NaaugcuUfGfaUfgauacaa_2Nuas(invAb)-(C6- T SS)-MeC5-dT CS007714 (NH2- 518 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 644 C6)s(invAb)sga_2NaaugCfuuGfAfugauacaa_2Nuas(invAb)-(C6- T SS)-MeC5-dT CS007715 (NH2- 519 G(A.sup.2N)AAUGCUUGAUGAUACA(A.sup.2N)UA 644 C6)s(invAb)sga_2NaaugCfuUfgAfugauacaa_2Nuas(invAb)-(C6- T SS)-MeC5-dT CS007716 (NH2-C6)s(invAb)sccugaaauGfcUfuGfaugauacas(invAb)-(C6- 520 CCUGAAAUGCUUGAUGAUACAT 643 SS)-MeC5-dT CS007717 (NH2-C6)s(invAb)sccugaaauGfCfuUfgaugauacas(invAb)-(C6- 521 CCUGAAAUGCUUGAUGAUACAT 643 SS)-MeC5-dT CS007718 (NH2-C6)s(invAb)sccugaaAfugCfUfugaugauacas(invAb)-(C6- 522 CCUGAAAUGCUUGAUGAUACAT 643 SS)-MeC5-dT CS007719 (NH2-C6)s(invAb)sccugaaAfuGfcUfugaugauacas(invAb)-(C6- 523 CCUGAAAUGCUUGAUGAUACAT 643 SS)-MeC5-dT CS008543 (NAG37)s(invAb)sguccucugUfcAfuAfguuccaaas(invAb) 524 GUCCUCUGUCAUAGUUCCAAA 623 CS008545 (NAG37)s(invAb)sgccuucugUfcAfuAfguuccaaas(invAb) 525 GCCUUCUGUCAUAGUUCCAAA 624 CS008549 (NAG37)s(invAb)sccccugUfcAfuAfguuccaaas(invAb) 526 CCCCUGUCAUAGUUCCAAA 625 CS008552 (NAG37)s(invAb)sgucugucaUfaGfuUfccaacaaas(invAb) 527 GUCUGUCAUAGUUCCAACAAA 621 CS011689 (NH2-C6)-L6-C6-sccugaaAfuGfcUfugaugauacas-(C6-SS)- 528 CCUGAAAUGCUUGAUGAUACAT 643 MeC5-dT CS011691 (NH2-C6)sccugaaAfuGfcUfugaugauacas-(C6-SS)-MeC5-dT 529 CCUGAAAUGCUUGAUGAUACAT 643 I =inosine (hypoxanthine nucleobase) nucleotide (A.sup.2N) =2-aminoadenosine nucleotide
TABLE-US-00007 TABLE6 ALK7AgentSenseStrandSequences(Shownwithlipidmoiety.)Thestructuresofthelipidmoietiesare showninTable11. Corresponding SenseStrand IDNumber WithoutLinker Strand orConjugate ID ModifiedSenseStrand(5.fwdarw.3) SEQIDNO. (SeeTable4) CS005429 LP-379-a-L6-(NH-C6)s(invAb)sgugaagcaCfGfAfuucuaucauas(invAb)-(C6-S)-LP-371-a 530 CS005430 LP-379-a-L6-(NH-C6)s(invAb)sgagacauaCfCfCfcagaauccuas(invAb)-(C6-S)-LP-371-a 531 CS005431 LP-379-a-L6-(NH-C6)s(invAb)sagcgagcuGfAfCfaucuauucgas(invAb)-(C6-S)-LP-371-a 532 CS007081 LP-379-a-L6-(NH-C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)-(C6-S)- 533 CS005174-NL LP-371-a CS007082 LP-379-a-L6-(NH-C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)-LP-371-a 534 CS005172-NL CS007437 LP-379-a-L6-(NH-C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-S)-LP-371-a 535 CS005146-NL CS007438 LP-379-a-L6-(NH-C6)s(invAb)sgcugguauCfUfGfaauaucaugas(invAb)-(C6-S)-LP-371-a 536 CS005148-NL CS007966 LP-379-a-L6-(NH-C6)s(invAb)sccugaaauGfcUfuGfaugauacas(invAb)-(C6-S)-LP-371-a 537 CS007716-NL CS007967 LP-379-a-L6-(NH-C6)s(invAb)sccugaaauGfCfuUfgaugauacas(invAb)-(C6-S)-LP-371-a 538 CS007717-NL CS007968 LP-379-a-L6-(NH-C6)s(invAb)sccugaaAfugCfUfugaugauacas(invAb)-(C6-S)-LP-371-a 539 CS007718-NL CS007969 LP-379-a-L6-(NH-C6)s(invAb)sccugaaAfuGfcUfugaugauacas(invAb)-(C6-S)-LP-371-a 540 CS007719-NL CS007970 LP-379-a-L6-(NH-C6)s(invAb)sgaaaugcuUfGfAfugauacaauas(invAb)-(C6-S)-LP-371-a 541 CS007711-NL CS007971 LP-379-a-L6-(NH-C6)s(invAb)sga_2NaaugcuUfgAfuGfauacaa_2Nuas(invAb)-(C6-S)- 542 CS007712-NL LP-371-a CS007972 LP-379-a-L6-(NH-C6)s(invAb)sga_2NaaugcuUfGfaUfgauacaa_2Nuas(invAb)-(C6-S)- 543 CS007713-NL LP-371-a CS007973 LP-379-a-L6-(NH-C6)s(invAb)sga_2NaaugCfuuGfAfugauacaa_2Nuas(invAb)-(C6-S)- 544 CS007714-NL LP-371-a CS007974 LP-379-a-L6-(NH-C6)s(invAb)sga_2NaaugCfuUfgAfugauacaa_2Nuas(invAb)-(C6-S)- 545 CS007715-NL LP-371-a CS009133 LP-379-a-L6-(NH-C6)s(invAb)sgucuucugUfCfAfuaguuccaaas(invAb)-(C6-S)-LP-371-a 546 CS005144-NL CS010070 LP-379-a-L6-(NH-C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-SS)-MeC5- 547 CS005146-NL dT CS011693 LP-379-a-L6-(NH-C6)sccugaaAfuGfcUfugaugauacas-(C6-SS)-MeC5-dT 548 CS007578-NL CS012040 LP-379-a-L6-(NH-C6)sccugaaAfuGfcUfugaugauacas-(C6-S)-LP-371-a 549 CS007578-NL CS015443 LP-379-a-L6-(NH-C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)-(C6-SS)- 550 CS005174-NL MeC5-dT I =inosine (hypoxanthine nucleobase) nucleotide (A.sup.2N) =2-aminoadenosine nucleotide
TABLE-US-00008 TABLE6a ALK7AgentSenseStrandSequences(Shownwithlipidmoiety.)ThestructuresofthelipidmoietiesareshowninTable11. UnderlyingBaseSequence(5.fwdarw.3) Strand SEQID (ShownasanUnmodifiedNucleotide SEQID ID ModifiedSenseStrand(5.fwdarw.3) NO. Sequence) NO. CS005429 LP-379-a-L6-(NH- 530 GUGAAGCACGAUUCUAUCAUA 653 C6)s(invAb)sgugaagcaCfGfAfuucuaucauas(invAb)-(C6-S)-LP- 371-a CS005430 LP-379-a-L6-(NH- 531 GAGACAUACCCCAGAAUCCUA 654 C6)s(invAb)sgagacauaCfCfCfcagaauccuas(invAb)-(C6-S)-LP- 371-a CS005431 LP-379-a-L6-(NH- 532 AGCGAGCUGACAUCUAUUCGA 655 C6)s(invAb)sagcgagcuGfAfCfaucuauucgas(invAb)-(C6-S)-LP- 371-a CS007081 LP-379-a-L6-(NH- 533 G(A2N)AAUGCUUGAUGAUACA(A2N)UA 613 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)-(C6- S)-LP-371-a CS007082 LP-379-a-L6-(NH- 534 CCUGAAAUGCUUGAUGAUACA 612 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)-LP- 371-a CS007437 LP-379-a-L6-(NH- 535 GUCUGUCAUAGUUCCAACAAU 599 C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-S)-LP- 371-a CS007438 LP-379-a-L6-(NH- 536 GCUGGUAUCUGAAUAUCAUGA 600 C6)s(invAb)sgcugguauCfUfGfaauaucaugas(invAb)-(C6-S)-LP- 371-a CS007966 LP-379-a-L6-(NH- 537 CCUGAAAUGCUUGAUGAUACA 612 C6)s(invAb)sccugaaauGfcUfuGfaugauacas(invAb)-(C6-S)-LP- 371-a CS007967 LP-379-a-L6-(NH- 538 CCUGAAAUGCUUGAUGAUACA 612 C6)s(invAb)sccugaaauGfCfuUfgaugauacas(invAb)-(C6-S)-LP- 371-a CS007968 LP-379-a-L6-(NH- 539 CCUGAAAUGCUUGAUGAUACA 612 C6)s(invAb)sccugaaAfugCfUfugaugauacas(invAb)-(C6-S)-LP- 371-a CS007969 LP-379-a-L6-(NH- 540 CCUGAAAUGCUUGAUGAUACA 612 C6)s(invAb)sccugaaAfuGfcUfugaugauacas(invAb)-(C6-S)-LP- 371-a CS007970 LP-379-a-L6-(NH- 541 GAAAUGCUUGAUGAUACAAUA 622 C6)s(invAb)sgaaaugcuUfGfAfugauacaauas(invAb)-(C6-S)-LP- 371-a CS007971 LP-379-a-L6-(NH- 542 G(A2N)AAUGCUUGAUGAUACA(A2N)UA 613 C6)s(invAb)sga_2NaaugcuUfgAfuGfauacaa_2Nuas(invAb)-(C6- S)-LP-371-a CS007972 LP-379-a-L6-(NH- 543 G(A2N)AAUGCUUGAUGAUACA(A2N)UA 613 C6)s(invAb)sga_2NaaugcuUfGfaUfgauacaa_2Nuas(invAb)-(C6- S)-LP-371-a CS007973 LP-379-a-L6-(NH- 544 G(A2N)AAUGCUUGAUGAUACA(A2N)UA 613 C6)s(invAb)sga_2NaaugCfuuGfAfugauacaa_2Nuas(invAb)-(C6- S)-LP-371-a CS007974 LP-379-a-L6-(NH- 545 G(A2N)AAUGCUUGAUGAUACA(A2N)UA 613 C6)s(invAb)sga_2NaaugCfuUfgAfugauacaa_2Nuas(invAb)-(C6- S)-LP-371-a CS009133 LP-379-a-L6-(NH- 546 GUCUUCUGUCAUAGUUCCAAA 598 C6)s(invAb)sgucuucugUfCfAfuaguuccaaas(invAb)-(C6-S)-LP- 371-a CS010070 LP-379-a-L6-(NH- 547 GUCUGUCAUAGUUCCAACAAUT 630 C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-SS)- MeC5-dT CS011693 LP-379-a-L6-(NH-C6)sccugaaAfuGfcUfugaugauacas-(C6-SS)- 548 CCUGAAAUGCUUGAUGAUACAT 643 MeC5-dT CS012040 LP-379-a-L6-(NH-C6)sccugaaAfuGfcUfugaugauacas-(C6-S)-LP- 549 CCUGAAAUGCUUGAUGAUACA 612 371-a CS015443 LP-379-a-L6-(NH- 550 G(A.sup.2N)AAUGCUUGAUGAUACA(A2N)UA 644 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)-(C6- T SS)-MeC5-dT I =inosine (hypoxanthine nucleobase) nucleotide (A.sup.2N) =2-aminoadenosine nucleotide
[0171] The ALK7 RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, Table 6, or Table 6a can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0172] As shown in Table 5 above, certain of the example ALK7 RNAi agent nucleotide sequences are shown to further include reactive linking groups at one or both of the 5 terminal end and the 3 terminal end of the sense strand. For example, many of the ALK7 RNAi agent sense strand sequences shown in Table 5 above have a (NH2-C6) linking group at the 5 end of the nucleotide sequence. Other linking groups, such as a (6-SS-6) linking group or a (C6-SS-C6) linking group, may be present as well or alternatively in certain embodiments. Such reactive linking groups are positioned to facilitate the linking of targeting ligands, targeting groups, and/or PK/PD modulators to the ALK7 RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and provide for formation of covalent linkages between two molecules or reactants. Suitable conjugation reactions for use in the scope of the inventions herein include, but are not limited to, amide coupling reaction, Michael addition reaction, hydrazone formation reaction, inverse-demand Diels-Alder cycloaddition reaction, oxime ligation, and Copper (I) catalyzed or strain-promoted azide-alkyne cycloaddition reaction cycloaddition reaction.
[0173] In some embodiments, targeting ligands, can be synthesized as activated esters, such as tetrafluorophenyl (TFP) esters, which can be displaced by a reactive amino group (e.g., NH.sub.2-C.sub.6) to attach the targeting ligand to the ALK7 RNAi agents disclosed herein. In some embodiments, targeting ligands are synthesized as azides, which can be conjugated to a propargyl or DBCO group, for example, via Copper (I) catalyzed or strain-promoted azide-alkyne cycloaddition reaction.
[0174] Additionally, certain of the nucleotide sequences can be synthesized with a dT nucleotide at the 3 terminal end of the sense strand, followed by (3.fwdarw.5) a linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate the linkage to additional components, such as, for example, a lipid or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced, removing the dT from the molecule, which can then facilitate the conjugation of the desired component. The terminal dT nucleotide therefore is not a part of the fully conjugated construct.
[0175] In some embodiments, the antisense strand of an ALK7 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 10. In some embodiments, the sense strand of an ALK7 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10.
[0176] In some embodiments, an ALK7 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an ALK7 RNAi agent antisense strand comprises the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In certain embodiments, an ALK7 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0177] In some embodiments, an ALK7 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an ALK7 RNAi agent sense strand comprises the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24, of any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 6a or Table 10. In certain embodiments, an ALK7 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0178] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5 end.fwdarw.3 end) can be perfectly complementary to an ALK7 gene, or can be non-complementary to an ALK7 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5 end.fwdarw.3 end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5 end.fwdarw.3 end) forms an A:U or U:A base pair with the sense strand.
[0179] In some embodiments, an ALK7 RNAi agent antisense strand comprises the sequence of nucleotides (from 5 end.fwdarw.3 end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10. In some embodiments, an ALK7 RNAi sense strand comprises the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 6a or Table 10.
[0180] In some embodiments, an ALK7 RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5 end.fwdarw.3 end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising the sequence of nucleotides (from 5 end.fwdarw.3 end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 6a or Table 10.
[0181] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the ALK7 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Tables 7A, 7B, 8, and 9A.
[0182] In some embodiments, an ALK7 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, an ALK7 RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an ALK7 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an ALK7 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, PK/PD modulator and/or other non-nucleotide group wherein the targeting group, linking group, PK/PD modulator and/or other non-nucleotide group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an ALK7 RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an ALK7 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and/or other non-nucleotide group, wherein the targeting group, linking group, PK/PD modulator and/or other non-nucleotide group is covalently linked to the sense strand or the antisense strand.
[0183] In some embodiments, an ALK7 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises a PK/PD modulator. In some embodiments, an ALK7 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises one or more lipid moieties.
[0184] In some embodiments, an ALK7 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises a lipid moiety. In some embodiments, an ALK7 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Tables 2, 7A, 7B, 8, 9A, or 10, and comprises one or more lipid moieties.
[0185] In some embodiments, an ALK7 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Tables 7A, 7B, 8, 9A, and 10.
[0186] In some embodiments, an ALK7 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Tables 7A, 7B, 8, 9A, and 10, and comprises a lipid moiety.
[0187] In some embodiments, an ALK7 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 7A, 7B, 8, 9A, and 10.
TABLE-US-00009 TABLE 7A ALK7 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. (Shown without Linking Agents or Conjugates) AS AS SS SS modified unmodified modified unmodified Duplex AS ID SEQ ID NO: SEQ ID NO: SS ID SEQ ID NO: SEQ ID NO: AC004151 CA005139 265 554 CS005138-NL 360 595 AC004152 CA005141 266 555 CS005140-NL 361 596 AC004153 CA005143 267 556 CS005142-NL 362 597 AC004154 CA005145 268 557 CS005144-NL 363 598 AC004155 CA005147 269 558 CS005146-NL 364 599 AC004156 CA005149 270 559 CS005148-NL 365 600 AC004157 CA005151 271 560 CS005150-NL 366 601 AC004158 CA005153 272 561 CS005152-NL 367 602 AC004159 CA005155 273 562 CS005154-NL 368 603 AC004160 CA005157 274 563 CS005156-NL 369 604 AC004161 CA005159 275 564 CS005158-NL 370 605 AC004162 CA005161 276 565 CS005160-NL 371 606 AC004163 CA005163 277 566 CS005162-NL 372 607 AC004164 CA005165 278 567 CS005164-NL 373 608 AC004165 CA005167 279 568 CS005166-NL 374 609 AC004166 CA005169 280 569 CS005168-NL 375 610 AC004167 CA005171 28 570 CS005170-NL 376 611 AC004168 CA005173 282 571 CS005172-NL 377 612 AC004169 CA005175 283 572 CS005174-NL 378 613 AC004170 CA005177 284 573 CS005176-NL 379 614 AC004171 CA005179 285 574 CS005178-NL 380 615 AC004172 CA005181 286 575 CS005180-NL 381 616 AC004173 CA005183 287 576 CS005182-NL 382 617 AC004174 CA005185 288 577 CS005184-NL 383 618 AC004175 CA005187 289 578 CS005186-NL 384 619 AC004176 CA005189 290 579 CS005188-NL 385 620 AC004197 CA005139 265 554 CS005209-NL 386 595 AC004198 CA005141 266 555 CS005210-NL 387 596 AC004199 CA005143 267 556 CS005211-NL 388 597 AC004200 CA005145 268 557 CS005212-NL 389 598 AC004201 CA005147 269 558 CS005213-NL 390 599 AC004202 CA005149 270 559 CS005214-NL 391 600 AC004203 CA005151 271 560 CS005215-NL 392 601 AC004204 CA005153 272 561 CS005216-NL 393 602 AC004205 CA005155 273 562 CS005217-NL 394 603 AC004206 CA005157 274 563 CS005218-NL 395 604 AC004207 CA005159 275 564 CS005219-NL 396 605 AC004208 CA005161 276 565 CS005220-NL 397 606 AC004209 CA005163 277 566 CS005221-NL 398 607 AC004210 CA005165 278 567 CS005222-NL 399 608 AC004211 CA005167 279 568 CS005223-NL 400 609 AC004212 CA005169 280 569 CS005224-NL 401 610 AC004213 CA005171 281 570 CS005225-NL 402 611 AC004214 CA005173 282 571 CS005226-NL 403 612 AC004215 CA005175 283 572 CS005227-NL 404 613 AC004216 CA005177 284 573 CS005228-NL 405 614 AC004217 CA005179 285 574 CS005229-NL 406 615 AC004218 CA005181 286 575 CS005230-NL 407 616 AC004219 CA005183 287 576 CS005231-NL 408 617 AC004220 CA005185 288 577 CS005232-NL 409 618 AC004221 CA005187 289 578 CS005233-NL 410 619 AC004222 CA005189 290 579 CS005234-NL 411 620 AC005846 CA007125 292 557 CS005212-NL 389 598 AC005847 CA005145 268 557 CS007126-NL 412 598 AC005848 CA005145 268 557 CS007127-NL 413 598 AC005849 CA005145 268 557 CS007128-NL 414 598 AC005850 CA005145 268 557 CS007129-NL 415 598 AC005851 CA007130 293 557 CS005212-NL 389 598 AC005852 CA007131 294 557 CS005212-NL 389 598 AC005853 CA007132 295 557 CS005212-NL 389 598 AC005854 CA007134 297 557 CS005212-NL 389 598 AC005855 CA007133 296 557 CS005212-NL 389 598 AC005856 CA007135 298 558 CS005213-NL 390 599 AC005857 CA007137 299 580 CS007136-NL 416 621 AC005858 CA005147 269 558 CS007138-NL 417 599 AC005859 CA005147 269 558 CS007139-NL 418 599 AC005860 CA005147 269 558 CS007140-NL 419 599 AC005861 CA005147 269 558 CS007141-NL 420 599 AC005862 CA007142 300 558 CS005213-NL 390 599 AC005863 CA007143 301 558 CS005213-NL 390 599 AC005864 CA007144 302 558 CS005213-NL 390 599 AC005865 CA007145 303 558 CS005213-NL 390 599 AC005867 CA007147 304 559 CS005214-NL 391 600 AC005868 CA005149 270 559 CS007148-NL 421 600 AC005869 CA005149 270 559 CS007149-NL 422 600 AC005870 CA005149 270 559 CS007150-NL 423 600 AC005871 CA005149 270 559 CS007151-NL 424 600 AC005872 CA007152 305 559 CS005214-NL 391 600 AC005873 CA007153 306 559 CS005214-NL 391 600 AC005874 CA007154 307 559 CS005214-NL 391 600 AC005875 CA007155 308 559 CS005214-NL 391 600 AC005876 CA007156 309 559 CS005214-NL 391 600 AC006111 CA007379 310 581 CS005213-NL 390 599 AC006290 CA007563 312 569 CS005224-NL 401 610 AC006291 CA005169 280 569 CS007564-NL 425 610 AC006292 CA005169 280 569 CS007565-NL 426 610 AC006293 CA005169 280 569 CS007566-NL 427 610 AC006294 CA005169 280 569 CS007567-NL 428 610 AC006295 CA007568 313 569 CS005224-NL 401 610 AC006296 CA007569 314 569 CS005224-NL 401 610 AC006297 CA007570 315 569 CS005224-NL 401 610 AC006298 CA007571 316 569 CS005224-NL 401 610 AC006299 CA007572 317 569 CS005224-NL 401 610 AC006300 CA007573 318 569 CS005224-NL 401 610 AC006305 CA005173 282 571 CS007578-NL 429 612 AC006425 CA005175 283 572 CS007711-NL 430 622 AC006427 CA005175 283 572 CS007712-NL 431 613 AC006428 CA005175 283 572 CS007713-NL 432 613 AC006429 CA005175 283 572 CS007714-NL 433 613 AC006430 CA005175 283 572 CS007715-NL 434 613 AC006431 CA007591 327 572 CS005174-NL 378 613 AC006432 CA007592 328 572 CS005174-NL 378 613 AC006433 CA007593 329 572 CS005174-NL 378 613 AC006434 CA007594 330 572 CS005174-NL 378 613 AC006435 CA007595 331 572 CS005174-NL 378 613 AC006436 CA007596 332 572 CS005174-NL 378 613 AC006437 CA007574 319 571 CS005172-NL 377 612 AC006438 CA005173 282 571 CS007716-NL 435 612 AC006439 CA005173 282 571 CS007717-NL 436 612 AC006440 CA005173 282 571 CS007718-NL 437 612 AC006441 CA005173 282 571 CS007719-NL 438 612 AC006442 CA007579 320 571 CS005172-NL 377 612 AC006443 CA007580 321 571 CS005172-NL 377 612 AC006444 CA007581 322 571 CS005172-NL 377 612 AC006445 CA007582 323 571 CS005172-NL 377 612 AC006446 CA007583 324 571 CS005172-NL 377 612 AC006447 CA007584 325 571 CS005172-NL 377 612 AC006734 CA008042 333 571 CS007716-NL 435 612 AC006735 CA008047 334 571 CS007716-NL 435 612 AC006738 CA008050 335 581 CS005213-NL 390 599 AC006741 CA008052 336 559 CS005214-NL 391 600 AC006742 CA008052 336 559 CS007148-NL 421 600 AC006743 CA008053 337 559 CS007148-NL 421 600 AC006744 CA008054 338 569 CS005224-NL 401 610 AC006745 CA008054 338 569 CS007564-NL 425 610 AC006746 CA008055 339 569 CS007564-NL 425 610 AC006747 CA008050 335 581 CS007138-NL 417 599 AC006773 CA008087 340 581 CS007138-NL 417 599 AC007192 CA008542 341 582 CS007126-NL 412 598 AC007193 CA008544 342 583 CS008543-NL 439 623 AC007194 CA008546 343 584 CS008545-NL 440 624 AC007195 CA008547 344 585 CS008543-NL 439 623 AC007196 CA008548 345 586 CS008545-NL 440 624 AC007197 CA008550 346 587 CS008549-NL 441 625 AC007198 CA008551 347 588 CS008549-NL 441 625 AC007199 CA008553 348 580 CS008552-NL 442 621 AC007200 CA008554 349 581 CS007138-NL 417 599 AC007201 CA008555 350 581 CS007138-NL 417 599 AC007202 CA007137 299 580 CS008552-NL 442 621 AC007203 CA007380 311 581 CS007138-NL 417 599 AC007204 CA008556 351 581 CS007138-NL 417 599 AC008318 CA009908 352 557 CS007126-NL 412 598 AC008319 CA009909 353 589 CS007126-NL 412 598 AC008320 CA009910 354 589 CS007126-NL 412 598 AC008321 CA009911 355 590 CS008543-NL 439 623 AC008322 CA009912 356 591 CS007126-NL 412 598 AC008323 CA009913 357 592 CS008543-NL 439 623 AC008324 CA009914 358 593 CS007126-NL 412 598 AC008325 CA009915 359 594 CS007126-NL 412 598 AC008484 CA007380 311 581 CS005146-NL 364 599 AC009978 CA005173 282 571 CS011689-NL 443 612 AC009980 CA005173 282 571 CS011691-NL 444 612
TABLE-US-00010 TABLE 7B ALK7 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. AS AS SS SS modified unmodified modified unmodified Duplex AS ID SEQ ID NO: SEQ ID NO: SS ID SEQ ID NO: SEQ ID NO: AC004151 CA005139 265 554 CS005138 445 626 AC004152 CA005141 266 555 CS005140 446 627 AC004153 CA005143 267 556 CS005142 447 628 AC004154 CA005145 268 557 CS005144 448 629 AC004155 CA005147 269 558 CS005146 449 630 AC004156 CA005149 270 559 CS005148 450 631 AC004157 CA005151 271 560 CS005150 451 632 AC004158 CA005153 272 561 CS005152 452 633 AC004159 CA005155 273 562 CS005154 453 634 AC004160 CA005157 274 563 CS005156 454 635 AC004161 CA005159 275 564 CS005158 455 636 AC004162 CA005161 276 565 CS005160 456 637 AC004163 CA005163 277 566 CS005162 457 638 AC004164 CA005165 278 567 CS005164 458 639 AC004165 CA005167 279 568 CS005166 459 640 AC004166 CA005169 280 569 CS005168 460 641 AC004167 CA005171 281 570 CS005170 461 642 AC004168 CA005173 282 571 CS005172 462 643 AC004169 CA005175 283 572 CS005174 463 644 AC004170 CA005177 284 573 CS005176 464 645 AC004171 CA005179 285 574 CS005178 465 646 AC004172 CA005181 286 575 CS005180 466 647 AC004173 CA005183 287 576 CS005182 467 648 AC004174 CA005185 288 577 CS005184 468 649 AC004175 CA005187 289 578 CS005186 469 650 AC004176 CA005189 290 579 CS005188 470 651 AC004197 CA005139 265 554 CS005209 471 595 AC004198 CA005141 266 555 CS005210 472 596 AC004199 CA005143 267 556 CS005211 473 597 AC004200 CA005145 268 557 CS005212 474 598 AC004201 CA005147 269 558 CS005213 475 599 AC004202 CA005149 270 559 CS005214 476 600 AC004203 CA005151 271 560 CS005215 477 601 AC004204 CA005153 272 561 CS005216 478 602 AC004205 CA005155 273 562 CS005217 479 603 AC004206 CA005157 274 563 CS005218 480 604 AC004207 CA005159 275 564 CS005219 481 605 AC004208 CA005161 276 565 CS005220 482 606 AC004209 CA005163 277 566 CS005221 483 607 AC004210 CA005165 278 567 CS005222 484 608 AC004211 CA005167 279 568 CS005223 485 609 AC004212 CA005169 280 569 CS005224 486 610 AC004213 CA005171 281 570 CS005225 487 611 AC004214 CA005173 282 571 CS005226 488 612 AC004215 CA005175 283 572 CS005227 489 613 AC004216 CA005177 284 573 CS005228 490 614 AC004217 CA005179 285 574 CS005229 491 615 AC004218 CA005181 286 575 CS005230 492 616 AC004219 CA005183 287 576 CS005231 493 617 AC004220 CA005185 288 577 CS005232 494 618 AC004221 CA005187 289 578 CS005233 495 619 AC004222 CA005189 290 579 CS005234 496 620 AC005846 CA007125 292 557 CS005212 474 598 AC005847 CA005145 268 557 CS007126 497 598 AC005848 CA005145 268 557 CS007127 498 598 AC005849 CA005145 268 557 CS007128 499 598 AC005850 CA005145 268 557 CS007129 500 598 AC005851 CA007130 293 557 CS005212 474 598 AC005852 CA007131 294 557 CS005212 474 598 AC005853 CA007132 295 557 CS005212 474 598 AC005854 CA007134 297 557 CS005212 474 598 AC005855 CA007133 296 557 CS005212 474 598 AC005856 CA007135 298 558 CS005213 475 599 AC005857 CA007137 299 580 CS007136 501 621 AC005858 CA005147 269 558 CS007138 502 599 AC005859 CA005147 269 558 CS007139 503 599 AC005860 CA005147 269 558 CS007140 504 599 AC005861 CA005147 269 558 CS007141 505 599 AC005862 CA007142 300 558 CS005213 475 599 AC005863 CA007143 301 558 CS005213 475 599 AC005864 CA007144 302 558 CS005213 475 599 AC005865 CA007145 303 558 CS005213 475 599 AC005867 CA007147 304 559 CS005214 476 600 AC005868 CA005149 270 559 CS007148 506 600 AC005869 CA005149 270 559 CS007149 507 600 AC005870 CA005149 270 559 CS007150 508 600 AC005871 CA005149 270 559 CS007151 509 600 AC005872 CA007152 305 559 CS005214 476 600 AC005873 CA007153 306 559 CS005214 476 600 AC005874 CA007154 307 559 CS005214 476 600 AC005875 CA007155 308 559 CS005214 476 600 AC005876 CA007156 309 559 CS005214 476 600 AC006111 CA007379 310 581 CS005213 475 599 AC006290 CA007563 312 569 CS005224 486 610 AC006291 CA005169 280 569 CS007564 510 610 AC006292 CA005169 280 569 CS007565 511 610 AC006293 CA005169 280 569 CS007566 512 610 AC006294 CA005169 280 569 CS007567 513 610 AC006295 CA007568 313 569 CS005224 486 610 AC006296 CA007569 314 569 CS005224 486 610 AC006297 CA007570 315 569 CS005224 486 610 AC006298 CA007571 316 569 CS005224 486 610 AC006299 CA007572 317 569 CS005224 486 610 AC006300 CA007573 318 569 CS005224 486 610 AC006305 CA005173 282 571 CS007578 514 612 AC006425 CA005175 283 572 CS007711 515 652 AC006427 CA005175 283 572 CS007712 516 644 AC006428 CA005175 283 572 CS007713 517 644 AC006429 CA005175 283 572 CS007714 518 644 AC006430 CA005175 283 572 CS007715 519 644 AC006431 CA007591 327 572 CS005174 463 644 AC006432 CA007592 328 572 CS005174 463 644 AC006433 CA007593 329 572 CS005174 463 644 AC006434 CA007594 330 572 CS005174 463 644 AC006435 CA007595 331 572 CS005174 463 644 AC006436 CA007596 332 572 CS005174 463 644 AC006437 CA007574 319 571 CS005172 462 643 AC006438 CA005173 282 571 CS007716 520 643 AC006439 CA005173 282 571 CS007717 521 643 AC006440 CA005173 282 571 CS007718 522 643 AC006441 CA005173 282 571 CS007719 523 643 AC006442 CA007579 320 571 CS005172 462 643 AC006443 CA007580 321 571 CS005172 462 643 AC006444 CA007581 322 571 CS005172 462 643 AC006445 CA007582 323 571 CS005172 462 643 AC006446 CA007583 324 571 CS005172 462 643 AC006447 CA007584 325 571 CS005172 462 643 AC006734 CA008042 333 571 CS007716 520 643 AC006735 CA008047 334 571 CS007716 520 643 AC006738 CA008050 335 581 CS005213 475 599 AC006741 CA008052 336 559 CS005214 476 600 AC006742 CA008052 336 559 CS007148 506 600 AC006743 CA008053 337 559 CS007148 506 600 AC006744 CA008054 338 569 CS005224 486 610 AC006745 CA008054 338 569 CS007564 510 610 AC006746 CA008055 339 569 CS007564 510 610 AC006747 CA008050 335 58 CS007138 502 599 AC006773 CA008087 340 581 CS007138 502 599 AC007192 CA008542 341 582 CS007126 497 598 AC007193 CA008544 342 583 CS008543 524 623 AC007194 CA008546 343 584 CS008545 525 624 AC007195 CA008547 344 585 CS008543 524 623 AC007196 CA008548 345 586 CS008545 525 624 AC007197 CA008550 346 587 CS008549 526 625 AC007198 CA008551 347 588 CS008549 526 625 AC007199 CA008553 348 580 CS008552 527 621 AC007200 CA008554 349 581 CS007138 502 599 AC007201 CA008555 350 581 CS007138 502 599 AC007202 CA007137 299 580 CS008552 527 621 AC007203 CA007380 311 581 CS007138 502 599 AC007204 CA008556 351 581 CS007138 502 599 AC008318 CA009908 352 557 CS007126 497 598 AC008319 CA009909 353 589 CS007126 497 598 AC008320 CA009910 354 589 CS007126 497 598 AC008321 CA009911 355 590 CS008543 524 623 AC008322 CA009912 356 591 CS007126 497 598 AC008323 CA009913 357 592 CS008543 524 623 AC008324 CA009914 358 593 CS007126 497 598 AC008325 CA009915 359 594 CS007126 497 598 AC008484 CA007380 311 581 CS005146 449 630 AC009978 CA005173 282 571 CS011689 528 643 AC009980 CA005173 282 571 CS011691 529 643
TABLE-US-00011 TABLE 8 ALK7 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. (Shown with PK/PD modulators) AS AS SS SS modified unmodified modified unmodified Duplex AS ID SEQ ID NO: SEQ ID NO: SS ID SEQ ID NO: SEQ ID NO: AC004390 CA005127 262 551 CS005429 530 653 AC004391 CA005129 263 552 CS005430 531 654 AC004392 CA005131 264 553 CS005431 532 655 AC005181 CA006102 291 551 CS005429 530 653 AC005823 CA005175 283 572 CS007081 533 613 AC005824 CA005173 282 571 CS007082 534 612 AC006188 CA005147 269 558 CS007437 535 599 AC006189 CA005149 270 559 CS007438 536 600 AC006643 CA007574 319 571 CS007082 534 612 AC006644 CA005173 282 571 CS007966 537 612 AC006645 CA005173 282 571 CS007967 538 612 AC006646 CA005173 282 571 CS007968 539 612 AC006647 CA005173 282 571 CS007969 540 612 AC006648 CA007579 320 571 CS007082 534 612 AC006649 CA007580 321 571 CS007082 534 612 AC006650 CA007581 322 571 CS007082 534 612 AC006651 CA007582 323 571 CS007082 534 612 AC006652 CA007583 324 571 CS007082 534 612 AC006653 CA007584 325 571 CS007082 534 612 AC006654 CA005175 283 572 CS007970 541 622 AC006655 CA007586 326 572 CS007081 533 613 AC006656 CA005175 283 572 CS007971 542 613 AC006657 CA005175 283 572 CS007972 543 613 AC006658 CA005175 283 572 CS007973 544 613 AC006659 CA005175 283 572 CS007974 545 613 AC006660 CA007591 327 572 CS007081 533 613 AC006661 CA007592 328 572 CS007081 533 613 AC006662 CA007593 329 572 CS007081 533 613 AC006663 CA007594 330 572 CS007081 533 613 AC006664 CA007595 331 572 CS007081 533 613 AC006665 CA007596 332 572 CS007081 533 613 AC007027 CA008042 333 571 CS007082 534 612 AC007028 CA008047 334 571 CS007082 534 612 AC007029 CA008042 333 571 CS007966 537 612 AC007030 CA008047 334 571 CS007966 537 612 AC007694 CA007125 292 557 CS009133 546 598 AC008492 CA007380 311 581 CS010070 547 630 AC008546 CA005147 269 558 CS010070 547 630 AC009982 CA005173 282 571 CS011693 548 643 AC010357 CA005173 282 571 CS012040 549 612 AC013158 CA007586 326 572 CS015443 550 644
TABLE-US-00012 TABLE 9A Conjugate Duplex ID Numbers Referencing Position Targeted On ALK7 Gene Targeted ALK7 Gene Position Duplex AS ID SS ID (Of SEQ ID NO:1) AC004390 CA005127 CS005429 N/A AC004391 CA005129 CS005430 N/A AC004392 CA005131 CS005431 N/A AC005181 CA006102 CS005429 N/A AC005823 CA005175 CS007081 1334 AC005824 CA005173 CS007082 1331 AC006188 CA005147 CS007437 440 AC006189 CA005149 CS007438 1021 AC006643 CA007574 CS007082 1331 AC006644 CA005173 CS007966 1331 AC006645 CA005173 CS007967 1331 AC006646 CA005173 CS007968 1331 AC006647 CA005173 CS007969 1331 AC006648 CA007579 CS007082 1331 AC006649 CA007580 CS007082 1331 AC006650 CA007581 CS007082 1331 AC006651 CA007582 CS007082 1331 AC006652 CA007583 CS007082 1331 AC006653 CA007584 CS007082 1331 AC006654 CA005175 CS007970 1334 AC006655 CA007586 CS007081 1334 AC006656 CA005175 CS007971 1334 AC006657 CA005175 CS007972 1334 AC006658 CA005175 CS007973 1334 AC006659 CA005175 CS007974 1334 AC006660 CA007591 CS007081 1334 AC006661 CA007592 CS007081 1334 AC006662 CA007593 CS007081 1334 AC006663 CA007594 CS007081 1334 AC006664 CA007595 CS007081 1334 AC006665 CA007596 CS007081 1334 AC007027 CA008042 CS007082 1331 AC007028 CA008047 CS007082 1331 AC007029 CA008042 CS007966 1331 AC007030 CA008047 CS007966 1331 AC007694 CA007125 CS009133 437 AC008492 CA007380 CS010070 440 AC008546 CA005147 CS010070 440 AC009982 CA005173 CS011693 1331 AC010357 CA005173 CS012040 1331 AC013158 CA007586 CS015443 1334
[0188] ALK7 RNAi agent conjugate duplex IDs targeted to mouse ALK7 are denoted with N/A for their respective targeted ALK7 gene positions.
TABLE-US-00013 TABLE10 ConjugateIDNumbersWithChemicallyModifiedAntisenseandSenseStrands(includingLinkersandConjugates) ACID SenseStrand(FullyModifiedwithConjugatedPK/PD SEQID SEQID Number modulator)(5.fwdarw.3) NO: AntisenseStrand(5.fwdarw.3) NO: AC004390 LP-379-a-L6-(NH- 530 cPrpusAfsugauAfgaauCfgUfgCfuucasc 262 C6)s(invAb)sgugaagcaCfGfAfuucuaucauas(invAb)-(C6-S)- LP-371-a AC004391 LP-379-a-L6-(NH- 531 cPrpusAfsggauUfcuggGfgUfaUfgucusc 263 C6)s(invAb)sgagacauaCfCfCfcagaauccuas(invAb)-(C6-S)- LP-371-a AC004392 LP-379-a-L6-(NH- 532 cPrpusCfsgaauAfgaugUfcAfgCfucgcsu 264 C6)s(invAb)sagcgagcuGfAfCfaucuauucgas(invAb)-(C6-S)- LP-371-a AC005181 LP-379-a-L6-(NH- 530 cPrpusAfsugauagaauCfgUfgCfuucasc 291 C6)s(invAb)sgugaagcaCfGfAfuucuaucauas(invAb)-(C6-S)- LP-371-a AC005823 LP-379-a-L6-(NH- 533 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC005824 LP-379-a-L6-(NH- 534 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006188 LP-379-a-L6-(NH- 535 cPrpasUfsuguuGfgaacUfaUfgAfcagasc 269 C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-S)- LP-371-a AC006189 LP-379-a-L6-(NH- 536 cPrpusCfsaugaUfauucAfgAfuAfccagsc 270 C6)s(invAb)sgcugguauCfUfGfaauaucaugas(invAb)-(C6-S)- LP-371-a AC006643 LP-379-a-L6-(NH- 534 cPrpusGfsuaucAfucaaGfcAfuUfucasgsg 319 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006644 LP-379-a-L6-(NH- 537 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 C6)s(invAb)sccugaaauGfcUfuGfaugauacas(invAb)-(C6-S)- LP-371-a AC006645 LP-379-a-L6-(NH- 538 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 C6)s(invAb)sccugaaauGfCfuUfgaugauacas(invAb)-(C6-S)- LP-371-a AC006646 LP-379-a-L6-(NH- 539 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 C6)s(invAb)sccugaaAfugCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006647 LP-379-a-L6-(NH- 540 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 C6)s(invAb)sccugaaAfuGfcUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006648 LP-379-a-L6-(NH- 534 cPrpusGfsuaucaucaaGfcAfuuucagsg 320 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006649 LP-379-a-L6-(NH- 534 cPrpusGfsUfaucaucaaGfcAfuUfucagsg 321 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006650 LP-379-a-L6-(NH- 534 cPrpusGfsuAfucaucaaGfcAfuUfucagsg 322 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006651 LP-379-a-L6-(NH- 534 cPrpusGfsuauCfaucaaGfcAfuUfucagsg 323 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006652 LP-379-a-L6-(NH- 534 cPrpusGfsuauCfaUfcAfaGfcAfuUfucagsg 324 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006653 LP-379-a-L6-(NH- 534 cPrpusGfsuAfuCfaUfcAfaGfcAfuUfucagsg 325 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC006654 LP-379-a-L6-(NH- 541 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 C6)s(invAb)sgaaaugcuUfGfAfugauacaauas(invAb)-(C6-S)- LP-371-a AC006655 LP-379-a-L6-(NH- 533 cPrpusAfsuuguAfucauCfaAfgCfauususc 326 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006656 LP-379-a-L6-(NH- 542 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 C6)s(invAb)sga_2NaaugcuUfgAfuGfauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006657 LP-379-a-L6-(NH- 543 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 C6)s(invAb)sga_2NaaugcuUfGfaUfgauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006658 LP-379-a-L6-(NH- 544 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 C6)s(invAb)sga_2NaaugCfuuGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006659 LP-379-a-L6-(NH- 545 cPrpusAfsuuguAfucauCfaAfgCfauuusc 283 C6)s(invAb)sga_2NaaugCfuUfgAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006660 LP-379-a-L6-(NH- 533 cPrpusAfsuuguaucauCfaAfgcauuusc 327 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006661 LP-379-a-L6-(NH- 533 cPrpusAfsUfuguaucauCfaAfgCfauuusc 328 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006662 LP-379-a-L6-(NH- 533 cPrpusAfsuUfguaucauCfaAfgCfauuusc 329 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006663 LP-379-a-L6-(NH- 533 cPrpusAfsuugUfaucauCfaAfgCfauuusc 330 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006664 LP-379-a-L6-(NH- 533 cPrpusAfsuugUfaUfcAfuCfaAfgCfauuusc 331 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC006665 LP-379-a-L6-(NH- 533 cPrpusAfsuUfgUfaUfcAfuCfaAfgCfauuusc 332 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-S)-LP-371-a AC007027 LP-379-a-L6-(NH- 534 cPrpusGfsuaUfcaucaaGfcAfuUfucagsg 333 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC007028 LP-379-a-L6-(NH- 534 cPrpusGfsuaUfcaucaaGfcAfuUfucagssg 334 C6)s(invAb)sccugaaauGfCfUfugaugauacas(invAb)-(C6-S)- LP-371-a AC007029 LP-379-a-L6-(NH- 537 cPrpusGfsuaUfcaucaaGfcAfuUfucagsg 333 C6)s(invAb)sccugaaauGfcUfuGfaugauacas(invAb)-(C6-S)- LP-371-a AC007030 LP-379-a-L6-(NH- 537 cPrpusGfsuaUfcaucaaGfcAfuUfucagssg 334 C6)s(invAb)sccugaaauGfcUfuGfaugauacas(invAb)-(C6-S)- LP-371-a AC007694 LP-379-a-L6-(NH- 546 cPrpusUfsuggaAfcuauGfaCfaGfaagsasc 292 C6)s(invAb)sgucuucugUfCfAfuaguuccaaas(invAb)-(C6-S)- LP-371-a AC008492 LP-379-a-L6-(NH- 547 cPrpisUfsuguuGfgaacUfaUfgAfcagasc 311 C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6- SS)-MeC5-dT AC008546 LP-379-a-L6-(NH- 547 cPrpasUfsuguuGfgaacUfaUfgAfcagasc 269 C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6- SS)-MeC5-dT AC009982 LP-379-a-L6-(NH-C6)sccugaaAfuGfcUfugaugauacas-(C6- 548 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 SS)-MeC5-dT AC010357 LP-379-a-L6-(NH-C6)sccugaaAfuGfcUfugaugauacas-(C6- 549 cPrpusGfsuaucAfucaaGfcAfuUfucagsg 282 S)-LP-371-a AC013158 LP-379-a-L6-(NH- 550 cPrpusAfsuuguAfucauCfaAfgCfauususc 326 C6)s(invAb)sga_2NaaugcuUfGfAfugauacaa_2Nuas(invAb)- (C6-SS)-MeC5-dT
[0189] In some embodiments, an ALK7 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an ALK7 RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, an ALK7 RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt The RNAi agents described herein, upon delivery to a cell expressing an ALK7 gene, inhibit or knockdown expression of one or more ALK7 genes in vivo and/or in vitro.
Targeting Groups, Linking Groups, Lipid PK/PD Moieties, and Delivery Vehicles
[0190] In some embodiments, an ALK7 RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetic/pharmacodynamic (PK/PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. The non-nucleotide group can be covalently linked to the 3 and/or 5 end of either the sense strand and/or the antisense strand. In some embodiments, an ALK7 RNAi agent contains a non-nucleotide group linked to the 3 and/or 5 end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5 end of an ALK7 RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
[0191] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.
[0192] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which in some instances can serve as linkers.
[0193] A targeting group, with or without a linker, can be attached to the 5 or 3 end of any of the sense and/or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10. A linker, with or without a targeting group, can be attached to the 5 or 3 end of any of the sense and/or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10.
[0194] The ALK7 RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5-terminus and/or the 3-terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.
[0195] For example, in some embodiments, the ALK7 RNAi agents disclosed herein are synthesized having an NH.sub.2-C.sub.6 group at the 5-terminus of the sense strand of the RNAi agent. The terminal amino group subsequently can be reacted to form a conjugate with, for example, a group that includes a lipid moiety. In some embodiments, the ALK7 RNAi agents disclosed herein are synthesized having one or more alkyne groups at the 5-terminus of the sense strand of the RNAi agent.
[0196] In some embodiments, targeting groups are linked to the ALK7 RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an ALK7 RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.
[0197] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be linked to the 3 and/or the 5 end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5 or 3 end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5 end of an RNAi agent sense strand. Examples of linking groups, include but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues/nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and/or PEG groups. Examples of certain linking groups are provided in Table 11.
[0198] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, pharmacokinetic modulator, or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and/or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description. In some embodiments, an ALK7 RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.
[0199] In some embodiments, an ALK7 RNAi agent is linked to one or more lipid PK/PD moieties (referred to herein as lipid moieties or PK/PD modulators.) Lipid PK/PD moieties may enhance the pharmacodynamic or pharmacokinetic properties of the RNAi agent. In some embodiments, the lipid moiety may be conjugated to a linker at the 3 or 5 end of a sense strand or an antisense strand of an RNAi agent described herein. In some embodiments, a lipid moiety may be linked at both the 3 or 5 end of either the sense strand or the antisense strand of an RNAi agent described herein.
[0200] In some embodiments, a lipid moiety may be conjugated to an ALK7 RNAi agent by reacting an ALK7 RNAi agent comprising an amine-comprising linker, for example, (NH2-C6) (see table 11). In some embodiments, the amine-comprising linker may be located on the 5 end of the sense strand or the antisense strand of an ALK7 RNAi agent. In some embodiments, the amine-comprising linker may be located on the 3 end of the sense strand or the antisense strand of an RNAi agent.
[0201] In some embodiments, an RNAi agent comprising an amine-comprising linker, such as (NH2-C6) or (NH2-C6)s, may be reacted with a lipid comprising an activated ester moiety.
[0202] In some embodiments, an RNAi agent comprising a disulfide linker, such as C6-SS-C6, may be reacted with a lipid comprising an aromatic sulfone, such as LP-371-p.
[0203] In some embodiments, an RNAi agent comprising an alkyne linker, such as L6-p, may be reacted with a lipid comprising an azide, such as LP-379-p. The lipid may be reacted with L6 to form a triazole before or after an amidation reaction with an amine such as NH2-C6.
[0204] In some embodiments, an ALK7 RNAi agent may be conjugated to a lipid moiety using phosphoramidite synthesis. Synthesizing oligonucleotides using phosphoramidites is well-known in the art. In some embodiments, a lipid moiety may be conjugated to the 5 end of the sense strand or the antisense strand of an ALK7 RNAi agent using a phosphoramidite. In some embodiments, a lipid moiety may be conjugated to the 3 end of the sense strand or the antisense strand of an ALK7 RNAi agent using a phosphoramidite.
[0205] In some embodiments, ALK7 RNAi agents may comprise a lipid moiety on an internal nucleotide (i.e., not on the 3 or 5 terminal nucleotides.) In some embodiments, a lipid moiety on an internal nucleotide may be linked to the 2 position of ribose.
[0206] Any of the ALK7 RNAi agent nucleotide sequences listed in Tables 2, 3, 4, 5, 6, and 10, whether modified or unmodified, can contain 3 and/or 5 targeting group(s), linking group(s), and/or lipid PK/PD moieties. Any of the ALK7 RNAi agent sequences listed in Tables 3, 4, 5, 6, and 10, or are otherwise described herein, which contain a 3 or 5 targeting group, linking group, and/or lipid PK/PD moiety can alternatively contain no 3 or 5 targeting group, linking group, or lipid PK/PD moiety, or can contain a different 3 or 5 targeting group, linking group, or lipid PK/PD moiety including, but not limited to, those depicted in Table 11. Any of the ALK7 RNAi agent duplexes listed in Tables 7A, 7B, 8, 9A and 10, whether modified or unmodified, can further comprise a targeting group, linking group, or PK/PD moiety including, but not limited to, those depicted in Table 11, and the targeting group, linking group or PK/PD moiety can be attached to the 3 or 5 terminus of either the sense strand or the antisense strand of the ALK7 RNAi agent duplex.
[0207] Examples of certain modified nucleotides, capping moieties, lipid moieties, and linking groups are provided in Table 11.
TABLE-US-00014 TABLE 11 Structures Representing Various Modified Nucleotides, Capping Moieties, lipid PK/PD moieties and Linking Groups (wherein indicates the point of connection)
[0208] Alternatively, other linking groups known in the art may be used. In many instances, linking groups can be commercially acquired or alternatively, are incorporated into commercially available nucleotide phosphoramidites. (See, e.g., International Patent Application Publication No. WO 2019/161213, which is incorporated herein by reference in its entirety).
[0209] To evaluate the activity of ALK7 RNAi agents in a ALK7-AAV model as described in the Examples below, certain ALK7 RNAi agents were conjugated to an N-acetyl-galactosamine (NAG) containing targeting ligand having the chemical structure referred to as NAG37 (see Table 11). NAG37 is known to have high affinity to bind to asialoglycoprotein receptors that are abundantly expressed on liver cells, including hepatocytes (see, e.g., International Patent Application Publication No. WO2018044350A1). The use of NAG37-conjugated ALK7 RNAi agents was to evaluate the expression of AAV-ALK7 in the liver.
[0210] In some embodiments, an ALK7 RNAi agent is delivered without being conjugated to a targeting ligand or pharmacokinetic/pharmacodynamic (PK/PD) modulator (referred to as being naked or a naked RNAi agent).
[0211] In some embodiments, an ALK7 RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and/or another non-nucleotide group to facilitate delivery of the ALK7 RNAi agent to the cell or tissue of choice, for example, to adipose tissue in vivo. In some embodiments, an ALK7 RNAi agent is conjugated to a lipid moiety.
[0212] In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.
[0213] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art for nucleic acid delivery. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesteryl and cholesteryl derivatives), encapsulating in nanoparticles, liposomes, micelles, conjugating to polymers or DPCs (see, for example WO 2000/053722, WO 2008/022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors. In some embodiments the RNAi agents can be conjugated to antibodies having affinity for adipocyte cells. In some embodiments, the RNAi agents can be linked to targeting ligands that have affinity for cells in adipose tissue, for example adipocyte cells or receptors present on adipocyte cells.
Pharmaceutical Compositions and Formulations
[0214] The ALK7 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as medicaments). In some embodiments, pharmaceutical compositions include at least one ALK7 RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of ALK7 mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an ALK7 RNAi agent linked to a PK/PD modulator as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions that include an ALK7 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
[0215] The pharmaceutical compositions that include an ALK7 RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described ALK7 RNAi agent, thereby inhibiting the expression of ALK7 mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that can be mediated at least in part by a reduction in ALK7 gene expression. In some embodiments, the subject has been previously diagnosed with having one or more metabolic diseases such as obesity, diabetes, or insulin resistance.
[0216] In some embodiments the subject has been previously diagnosed with having obesity, diabetes, or insulin resistance.
[0217] Embodiments of the present disclosure include pharmaceutical compositions for delivering an ALK7 RNAi agent to adipose tissue in vivo. Such pharmaceutical compositions can include, for example, an ALK7 RNAi agent conjugated to a lipid moiety.
[0218] In some embodiments, the described pharmaceutical compositions including an ALK7 RNAi agent are used for treating or managing clinical presentations in a subject that would benefit from the inhibition of expression of ALK7. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed ALK7 RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.
[0219] In some embodiments, the described ALK7 RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. A second therapeutic can be another ALK7 RNAi agent (e.g., an ALK7 RNAi agent that targets a different sequence within an ALK7 gene). In some embodiments, a second therapeutic can be an RNAi agent that targets the ALK7 gene. An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, and/or aptamer. The ALK7 RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.
[0220] The described pharmaceutical compositions that include an ALK7 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of ALK7 mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an ALK7 RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more ALK7 RNAi agents, thereby preventing or inhibiting the at least one symptom.
[0221] In some embodiments, one or more of the described ALK7 RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.
[0222] The route of administration is the path by which an ALK7 RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids including the ALK7 RNAi agents described herein, for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The ALK7 RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, in some embodiments, the herein described pharmaceutical compositions are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intracerebroventricularly, intraarticularly, intraocularly, or intraperitoneally, or topically.
[0223] The pharmaceutical compositions including an ALK7 RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intracerebroventricular, intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or intratracheal administration. For example, in some embodiments, it is desired that the ALK7 RNAi agents described herein inhibit the expression of an ALK7 gene in adipose tissue.
[0224] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0225] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., ALK7 RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
[0226] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.
[0227] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0228] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0229] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.
[0230] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0231] The ALK7 RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
[0232] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as pharmaceutical compositions. As used herein, pharmacologically effective amount, therapeutically effective amount, or simply effective amount refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.
[0233] In some embodiments, ALK7 RNAi agent pharmaceutical compositions may contain salts such as sodium chloride, calcium chloride, magnesium chloride, potassium chloride, sodium phosphate dibasic, sodium phosphate monobasic, or combinations thereof.
[0234] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another ALK7 RNAi agent (e.g., an ALK7 RNAi agent that targets a different sequence within the ALK7 target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, and/or an aptamer.
[0235] In some embodiments, described herein are compositions that include a combination or cocktail of at least two ALK7 RNAi agents having different sequences. In some embodiments, the two or more ALK7 RNAi agents are each separately and independently linked to lipids.
[0236] Described herein are compositions for delivery of ALK7 RNAi agents to adipose tissue. Furthermore, compositions for delivery of ALK7 RNAi agents to adipose tissue, in vivo, are generally described herein.
[0237] Generally, an effective amount of an ALK7 RNAi agent disclosed herein will be in the range of from about 0.0001 to about 20 mg/kg of body weight dose, e.g., from about 0.001 to about 5 mg/kg of body weight dose. In some embodiments, an effective amount of an ALK7 RNAi agent will be in the range of from about 0.01 mg/kg to about 3.0 mg/kg of body weight per dose. In some embodiments, an effective amount of an ALK7 RNAi agent will be in the range of from about 0.03 mg/kg to about 2.0 mg/kg of body weight per dose. In some embodiments, an effective amount of an ALK7 RNAi agent will be in the range of from about 0.01 to about 1.0 mg/kg. In some embodiments, an effective amount of an ALK7 RNAi agent will be in the range of from about 0.50 to about 1.0 mg/kg. In some embodiments, a fixed dose of ALK7 RNAi agent is administered to the subject. In some embodiments the dose administered to the human subject is between about 1.0 mg and about 750 mg. In some embodiments, the dose of ALK7 RNAi agent administered to the human subject is between about 10 mg and about 450 mg. In some embodiments, the dose of ALK7 RNAi agent administered to the human subject is between about 25 mg and about 450 mg. In some embodiments, the dose of ALK7 RNAi agent administered to the human subject is about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, or about 450 mg. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum. In some embodiments, a dose is administered daily. In some embodiments, a dose is administered weekly. In further embodiments, a dose is administered bi-weekly, tri-weekly, once monthly, or once quarterly (i.e., once every three months).
[0238] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an ALK7 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide, and/or an aptamer.
[0239] The described ALK7 RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers.
Methods of Treatment and Inhibition of ALK7 Gene Expression
[0240] The ALK7 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and/or inhibition in expression of ALK7 mRNA and/or a reduction in ALK7 protein levels.
[0241] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder for which the subject would benefit from reduction in ALK7 protein, including but not limited to, obesity, diabetes, or insulin resistance. Treatment of a subject can include therapeutic and/or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more ALK7 RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.
[0242] ALK7 activity is known to play a role in metabolic disorders. In some embodiments, the described ALK7 RNAi agents are used to treat at least one symptom mediated at least in part by a reduction in ALK7 protein levels, in a subject. The subject is administered a therapeutically effective amount of any one or more of the described ALK7 RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.
[0243] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by ALK7 gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the ALK7 RNAi agents described herein.
[0244] In some embodiments, the ALK7 RNAi agents are used to treat or manage a clinical presentation or pathological state in a subject, wherein the clinical presentation or pathological state is mediated at least in part by a reduction in ALK7 gene expression. The subject is administered a therapeutically effective amount of one or more of the ALK7 RNAi agents or ALK7 RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an ALK7 RNAi agent described herein to a subject to be treated.
[0245] In a further aspect, the disclosure features methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms that may be addressed by a reduction in ALK7 protein levels, the methods comprising administering to a subject in need thereof an ALK7 RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10. Also described herein are compositions for use in such methods.
[0246] The described ALK7 RNAi agents and/or compositions that include ALK7 RNAi agents can be used in methods for therapeutic treatment of disease or conditions caused by enhanced or elevated ALK7 protein levels. Such methods include administration of an ALK7 RNAi agent as described herein to a subject, e.g., a human or animal subject.
[0247] In another aspect, the disclosure provides methods for the treatment (including prophylactic treatment) of a pathological state (such as a condition or disease) mediated at least in part by ALK7 gene expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.
[0248] In some embodiments, methods for inhibiting expression of an ALK7 gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.
[0249] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by ALK7 gene expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.
[0250] In some embodiments, methods for inhibiting expression of an ALK7 gene are disclosed herein, wherein the methods comprise administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.
[0251] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by ALK7 gene expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.
[0252] In some embodiments, methods for inhibiting expression of an ALK7 gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4. Table 5, Table 6, Table 6a, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.
[0253] In some embodiments, methods of inhibiting expression of an ALK7 gene are disclosed herein, wherein the methods include administering to a subject an ALK7 RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3 or Table 10. In other embodiments, disclosed herein are methods of inhibiting expression of an ALK7 gene, wherein the methods include administering to a subject an ALK7 RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, Table 6a, or Table 10, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10.
[0254] In some embodiments, methods for inhibiting expression of an ALK7 gene in a cell are disclosed herein, wherein the methods include administering one or more ALK7 RNAi agents comprising a duplex structure of one of the duplexes set forth in Tables 7A, 7B, 8, 9A, and 10.
[0255] In some embodiments, the gene expression level and/or mRNA level of an ALK7 gene in certain adipose tissues of subject to whom a described ALK7 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the ALK7 RNAi agent or to a subject not receiving the ALK7 RNAi agent. In some embodiments, the ALK7 protein levels in certain adipose tissues of a subject to whom a described ALK7 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the ALK7 RNAi agent or to a subject not receiving the ALK7 RNAi agent. The gene expression level, protein level, and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject. In some embodiments, the ALK7 mRNA levels in certain adipose tissues subject to whom a described ALK7 RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the ALK7 RNAi agent or to a subject not receiving the ALK7 RNAi agent.
[0256] A reduction in gene expression, mRNA, and protein levels can be assessed by any methods known in the art. Reduction or decrease in ALK7 protein levels are collectively referred to herein as a decrease in, reduction of, or inhibition of ALK7 expression. The Examples set forth herein illustrate known methods for assessing inhibition of ALK7 gene expression, including but not limited to determining ALK7 protein levels.
Cells, Tissues, Organs, and Non-Human Organisms
[0257] Cells, tissues, organs, and non-human organisms that include at least one of the ALK7 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.
Additional Illustrative Embodiments
[0258] Provided here are certain additional illustrative embodiments of the disclosed technology. These embodiments are illustrative only and do not limit the scope of the present disclosure or of the claims attached hereto.
[0259] Embodiment 1. An RNAi agent for inhibiting expression of a Activin Receptor-Like Kinase 7 (ALK7) gene, comprising: [0260] an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and [0261] a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
[0262] Embodiment 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.
[0263] Embodiment 3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
[0264] Embodiment 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the ALK7 RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
[0265] Embodiment 5. The RNAi agent of any one of embodiments 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.
[0266] Embodiment 6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from the group consisting of: 2-O-methyl nucleotide, 2-fluoro nucleotide, 2-deoxy nucleotide, 2,3-seco nucleotide mimic, locked nucleotide, 2-F-arabino nucleotide, 2-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2-O-methyl nucleotide, inverted 2-deoxy nucleotide, 2-amino-modified nucleotide, 2-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3-O-methyl nucleotide.
[0267] Embodiment 7. The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2-O-methyl nucleotides, 2-fluoro nucleotides, or combinations thereof.
[0268] Embodiment 8. The RNAi agent of any one of embodiments 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.
[0269] Embodiment 9. The RNAi agent of any one of embodiments 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
[0270] Embodiment 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
[0271] Embodiment 11. The RNAi agent of any one of embodiments 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.
[0272] Embodiment 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
[0273] Embodiment 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
[0274] Embodiment 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
[0275] Embodiment 15. The RNAi agent of embodiment 14, wherein the RNAi agent has two blunt ends.
[0276] Embodiment 16. The RNAi agent of any one of embodiments 1-15, wherein the sense strand comprises one or two terminal caps.
[0277] Embodiment 17. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues.
[0278] Embodiment 18. The RNAi agent of embodiment 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, or Table 10.
[0279] Embodiment 19. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides.
[0280] Embodiment 20. The RNAi agent of embodiment 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5.fwdarw.3):
TABLE-US-00015 (SEQIDNO:558) AUUGUUGGAACUAUGACAGAC; or (SEQIDNO:569) UUCGAUAGUGUUCAGUAUUGC; or (SEQIDNO:571) UGUAUCAUCAAGCAUUUCAGG.
[0281] Embodiment 21. The RNAi agent of embodiment 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5.fwdarw.3):
TABLE-US-00016 (SEQIDNO:599) GUCUGUCAUAGUUCCAACAAU; or (SEQIDNO:610) GCAAUACUGAACACUAUCGAA; or (SEQIDNO:612) CCUGAAAUGCUUGAUGAUACA.
[0282] Embodiment 22. The RNAi agent of embodiment 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.
[0283] Embodiment 23. The RNAi agent of embodiment 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5 .fwdarw.3):
TABLE-US-00017 (SEQIDNO:269) cPrpasUfsuguuGfgaacUfaUfgAfcagasc; (SEQIDNO:339) cPrpusUfscgAfuaguguUfcAfgUfauugssc; or (SEQIDNO:282) cPrpusGfsuaucAfucaaGfcAfuUfucagsg.
wherein a represents 2-O-methyl adenosine, c represents 2-O-methyl cytidine, g represents 2-O-methyl guanosine, and u represent 2-O-methyl uridine; Af represents 2-fluoro adenosine, Cf represents 2-fluoro cytidine, Gf represents 2-fluoro guanosine, and Uf represents 2-fluoro uridine; cPrpu represents a 5-cyclopropyl phosphonate-2-O-methyl uridine, cPrpa represents a 5-cyclopropyl phosphonate-2-O-methyl adenosine; s represents a phosphorothioate linkage, ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
[0284] Embodiment 24. The RNAi agent of embodiment 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5.fwdarw.3):
TABLE-US-00018 (SEQIDNO:364) gucugucaUfAfGfuuccaacaau; (SEQIDNO:425) gcaauacuGfaAfcAfcuaucgaa; or (SEQIDNO:429) ccugaaAfuGfcUfugaugauaca.
wherein a represents 2-O-methyl adenosine, c represents 2-O-methyl cytidine, g represents 2-O-methyl guanosine, and u represent 2-O-methyl uridine; Af represents 2-fluoro adenosine, Cf represents 2-fluoro cytidine, Gf represents 2-fluoro guanosine, and Uf represents 2-fluoro uridine; and s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.
[0285] Embodiment 25. The RNAi agent of any one of embodiments 20-24, wherein the sense strand further includes inverted abasic residues at the 3 terminal end of the nucleotide sequence, at the 5 end of the nucleotide sequence, or at both.
[0286] Embodiment 26. The RNAi agent of any one of embodiments 1-25, wherein the RNAi agent is linked to a lipid moiety.
[0287] Embodiment 27. The RNAi agent of embodiment 26, wherein the RNAi agent is linked to two or more lipid moieties.
[0288] Embodiment 28. The RNAi agent of embodiment 27, wherein each of the lipid moieties is independently selected from the group consisting of:
##STR00010##
wherein indicates the point of connection to the RNAi agent.
[0289] Embodiment 29. The RNAi agent of any one of embodiments 26-28, wherein each of the lipid moieties is independently selected from the group consisting of:
##STR00011##
wherein indicates the point of connection to the RNAi agent.
[0290] Embodiment 30. The RNAi agent of embodiment 26 or embodiment 27, wherein the lipid moiety is conjugated to the sense strand.
[0291] Embodiment 31. The RNAi agent of embodiment 26, wherein the RNAi agent is linked to LP-379-a on the 5 terminus of the sense strand, and linked to LP-371-a on the 3 terminus of the sense strand.
[0292] Embodiment 32. A composition comprising the RNAi agent of any one of embodiments 1-31, wherein the composition further comprises a pharmaceutically acceptable excipient.
[0293] Embodiment 33. The RNAi agent of embodiment 1, wherein the RNAi agent has a duplex structure of any one of the duplexes of Table 10.
[0294] Embodiment 34. The RNAi agent of embodiment 32, wherein the duplex structure is selected from the group consisting of: AC006188, AC006189, AC006648, AC006661, or AC006663.
[0295] Embodiment 35. The RNAi agent of embodiment 1, wherein the RNAi agent has the structure of any one of
[0296] Embodiment 36. The composition of embodiment 35, further comprising a second RNAi agent capable of inhibiting the expression of Activin Receptor-Like Kinase 7 gene expression.
[0297] Embodiment 37. The composition of any one of embodiments 35-36, further comprising one or more additional therapeutics.
[0298] Embodiment 38. The composition of any of embodiments 35-37, wherein the RNAi agent is a sodium salt.
[0299] Embodiment 39. The composition of any of embodiments 35-37, wherein the pharmaceutically acceptable excipient is water for injection.
[0300] Embodiment 40. The composition of any of embodiments 35-38, wherein the pharmaceutically acceptable excipient is a buffered saline solution.
[0301] Embodiment 41. The composition of any of embodiments 35-38, wherein the pharmaceutically acceptable excipient is sodium chloride.
[0302] Embodiment 42. A method for inhibiting expression of an ALK7 gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of embodiments 1-34 or the composition of any one of embodiments 35-41.
[0303] Embodiment 43. The method of embodiment 42, wherein the cell is within a subject.
[0304] Embodiment 44. The method of embodiment 43, wherein the subject is a human subject.
[0305] Embodiment 45. The method of any one of embodiments 42-44, wherein following the administration of the RNAi agent the Activin Receptor-Like Kinase 7 (ALK7) gene expression is inhibited by at least about 30%.
[0306] Embodiment 46. A method of treating one or more symptoms or diseases associated with enhanced or elevated ALK7 activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of embodiments 35-41.
[0307] Embodiment 47. The method of embodiment 46, wherein the disease is a metabolic disease.
[0308] Embodiment 48. The method of embodiment 47, wherein the metabolic disease is obesity, diabetes, or insulin resistance.
[0309] Embodiment 49. The method of embodiment 46, wherein the disease is obesity, diabetes, or insulin resistance.
[0310] Embodiment 50. The method of embodiment 49, wherein the disease is obesity.
[0311] Embodiment 51. The method of any one of embodiments 42-50, wherein the RNAi agent is administered at a dose of about 0.01 mg/kg to about 5.0 mg/kg of body weight of the subject.
[0312] Embodiment 52. The method of any one of embodiments 42-51, wherein the RNAi agent is administered at a dose of about 0.03 mg/kg to about 2.0 mg/kg of body weight of the subject.
[0313] Embodiment 53. The method of any one of embodiments 42-50, wherein the RNAi agent is administered at a fixed dose of about 25 mg to about 450 mg.
[0314] Embodiment 54. The method of embodiment 53, wherein the RNAi agent is administered at a dose of about 25 mg, about 50 mg, about 150 mg, or about 450 mg.
[0315] Embodiment 55. The method of any of embodiments 42-54, wherein the RNAi agent is administered in two or more doses.
[0316] Embodiment 56. The method of any one of embodiments 43-55, wherein the subject is administered a second therapeutic.
[0317] Embodiment 57. The method of embodiment 56, wherein the second therapeutic is a glucagon-like peptide 1 (GLP1) agonist.
[0318] Embodiment 58. The method of embodiment 57, wherein the GLP1 agonist is tirzepatide.
[0319] Embodiment 59. Use of the RNAi agent of any one of embodiments 1-34, for the treatment of a disease, disorder, or symptom that is mediated at least in part by ALK7 activity and/or ALK7 gene expression.
[0320] Embodiment 60. Use of the composition according to any one of embodiments 35-41, for the treatment of a disease, disorder, or symptom that is mediated at least in part by Activin Receptor-Like Kinase 7 (ALK7) activity and/or Activin Receptor-Like Kinase 7 (ALK7) gene expression.
[0321] Embodiment 61. Use of the composition according to any one of embodiments 35-41, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by Activin Receptor-Like Kinase 7 (ALK7) and/or Activin Receptor-Like Kinase 7 (ALK7) gene expression.
[0322] Embodiment 62. The use of any one of embodiments 59-61, wherein the disease is a metabolic disease.
[0323] Embodiment 63. A method of making an RNAi agent of any one of embodiments 1-34, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.
[0324] Embodiment 64. The method of embodiment 63, wherein the sense strand comprises a lipid moiety.
[0325] Embodiment 65. The method of embodiment 64, comprising conjugating a lipid moiety to the sense strand.
EXAMPLES
Example 1. Synthesis of ALK7RNAi Agents
[0326] ALK7 RNAi agent duplexes disclosed herein were synthesized in accordance with the following:
[0327] A. Synthesis. The sense and antisense strands of the ALK7 RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E (Bioautomation), a MerMadel2 (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 or 600 , obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2-O-methyl phosphoramidites that were used included the following: (5-O-dimethoxytrityl-N.sup.6-(benzoyl)-2-O-methyl-adenosine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5-O-dimethoxy-trityl-N.sup.4-(acetyl)-2-O-methyl-cytidine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2-O-methyl-guanosine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5-O-dimethoxytrityl-2-O-methyl-uridine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2-deoxy-2-fluoro-phosphoramidites carried the same protecting groups as the 2-O-methyl RNA amidites. 5-dimethoxytrityl-2-O-methyl-inosine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3-O-dimethoxytrityl-2-deoxyribose-5-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5-(4,4-Dimethoxytrityl)-N6-(benzoyl)-2,3-seco-adenosine, 2-benzoyl-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5-(4,4-Dimethoxytrityl)-N-acetyl-2,3-seco-cytosine, 2-benzoyl-3-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite, 5-(4,4-Dimethoxytrityl)-N-isobutyryl-2,3-seco-guanosine, 2-benzoyl-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5-(4,4-Dimethoxy-trityl)-2,3-seco-uridine, 2-benzoyl-3-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite. TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher). Linker L6 was purchased as propargyl-PEG5-NHS from BroadPharm (catalog #BP-20907) and coupled to the NH.sub.2-C.sub.6 group from an aminolink phosphoramidite to form -L6-(NHC6)-, using standard coupling conditions. The linker Alk-cyHex was similarly commercially purchased from Lumiprobe (alkyne phosphoramidite, 5-terminal) as a propargyl-containing compound phosphoramidite compound to form the linker -Alk-cyHex-. In each case, phosphorothioate or phosphorodithioate linkages were introduced as specified using the conditions set forth herein. The cyclopropyl phosphonate phosphoramidites were synthesized in accordance with International Patent Application Publication No. WO 2017/214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).
[0328] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 ) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2 O-Me), and 60 seconds (2 F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.
[0329] Alternatively, tri-alkyne moieties were introduced post-synthetically (see section E, below). For this route, the sense strand was functionalized with a 5 and/or 3 terminal nucleotide containing a primary amine. TFA aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 ) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2 O-Me), and 60 seconds (2 F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.
[0330] B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% to 31% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30 C. The solution was evaporated and the solid residue was reconstituted in water (see below).
[0331] C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13 m column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16/40 column packed with Sephadex G-25 fine with a running buffer of 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.
[0332] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1PBS (Phosphate-Buffered Saline, 1, Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at 15 to 25 C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg/(mL.Math.cm)) and the dilution factor to determine the duplex concentration.
E. Synthesis of Lipids
Synthesis of LP-379-p
##STR00012##
[0333] Compound 1 (Asta Tech #89929, 3.00 g) was dissolved in 50 mL DMF. Then TBTU (3.09 g) and DIPEA (6.2 mL) were added and the mixture was stirred for 10 minutes. Compound 2 (1.68 g in DMF) was then added. The mixture was allowed to stir for 1 hour. Then the mixture was diluted with 300 mL EtOAc and washed with 3% citric acid (360 mL), H.sub.2O (260 mL), and NaCl (160 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated on rotary evaporator and placed under high vacuum. The crude product was loaded onto 80 g column in 14 mL DCM with 2 drops MeOH and purified with flash chromatography (MeOH/DCM, 0-4% over 40 min.) Yield 4.033 g. LC-MS: calculated [M+H]498.71, found 499.85.
##STR00013##
[0334] Compound 1 (4.033 g) was dissolved in 50 mL 1:1 DCM:TFA. The mixture was stirred for 1 hour. The product was concentrated on rotary evaporator and placed under high vacuum. The product was then dissolved in ACN, concentrated, then dissolved in DCM and concentrated again. Yield 3.839 g. LC-MS: calculated [M+H]442.60, found 443.81.
Synthesis of LP-371-p
##STR00014##
[0335] Compound 1 (palmitic acid, 2.50 g) was dissolved in 60 mL DMF. Then TBTU (3.44 g) and DIPEA (6.9 mL) were added. The reaction was stirred for 10 minutes then compound 2 (2.66 g in DMF) was added. The reaction was complete after 1 hour. The mixture was diluted with 300 mL EtOAc and washed with 3% citric acid (360 mL), H.sub.2O (260 mL), and NaCl (160 mL), then dried over Na.sub.2SO.sub.4. The product was filtered and concentrated on rotary evaporator and high vacuum. The product was purified using column chromatography (loaded in DCM (15 mL) with a drop of MeOH onto a 80G RediSep Gold Rf column, mobile phase MeOH/DCM, 0-5% over 30 minutes. Yield 4.094 g. LC-MS: calculated [M+H]486.74, found 488.11.
##STR00015##
[0336] Compound 1 (4.094 g) was dissolved in 4M HCl in dioxane (28 mL) at 0 C. for 10 minutes. The reaction was allowed to warm to room temperature then stirred for 2 hours. The product was concentrated on rotary evaporator and high vacuum. Yield 3.485 g. LC-MS: calculated [M+H]386.57, found 388.02.
##STR00016##
[0337] Compound 1 (2.3 g) was dissolved in 80 mL THF. Then TEA (4.975 mL) and compound 2 (3.10 g) were added. The reaction was stirred for 1 hour. The reaction was dry loaded with Celite 545, the mixture was concentrated in a 28 C. water bath and placed on high vacuum to fully dry. The product was purified with flash chromatography (MeOH/DCM, 0-6% over 40 min.) Yield 2.905 g. LC-MS: calculated [M+H]636.85, found 637.95.
Linkers
[0338] Linker L6 was purchased as propargyl-PEG5-NHS from BroadPharm (catalog #BP-20907) and coupled to the NH.sub.2-C.sub.6 group from an aminolink phosphoramidite to form -L6-C6-, using standard coupling conditions.
Conjugation of Lipid PK/PD Modulator Precursors
[0339] Either prior to or after annealing, one or more lipid PK/PD modulator precursors can be linked to the RNAi agents disclosed herein. The following describes the general conjugation process used to link lipid PK/PD modulator precursors to the constructs set forth in the Examples depicted herein.
A. Conjugation of a Sulfone-Containing Lipid PK/PD Modulator Precursor
[0340] In a vial, functionalized sense strand was dissolved at 50 mg/mL in sterilized water. Then 20 equivalents of each of 0.1 M Hepes pH 8.5 buffer and dithiothreitol are added. The mixture was allowed to react for one hour, then the conjugate was precipitated in acetonitrile and PBS, and the solids were centrifuged into a pellet.
[0341] The pellet was brought up in a 70/30 mixture of DMSO/water at a solids concentration of 30 mg/mL. Then, the sulfone-containing lipid PK/PD modulator precursor was added at 1.5 equivalents. The vial was purged with N.sub.2, and heated to 40 C. while stirring. The mixture was allowed to react for one hour. The product was purified on an AEX-HPLC (mobile phase A: 25 mM TRIS pH=7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH=7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; solid phase TSKgel-30; 1.5 cm10 cm.) The solvent was removed by rotary evaporator, and desalted with a 3K spin column using 210 mL exchanges with sterilized water. The solid product was dried using lyophilization and stored for later use.
B. Conjugation of an Azide-Containing Lipid PK/PD Modulator Precursor
[0342] One molar equivalent of TG-TBTA resin loaded with Cu(I) was weighed into a glass vial. The vial was purged with N.sub.2 for 15 minutes. Then, functionalized sense strand was dissolved in a separate vial in sterilized water at a concentration of 100 mg/mL. Then two equivalents of the azide-containing lipid PK/PD modulator precursor (50 mg/mL in DMF) is added to the vial. Then TEA, DMF and water are added until the final reaction conditions are 33 mM TEA, 60% DMF, and 20 mg/mL of the conjugated product. The solution was then transferred to the vial with resin via a syringe. The N.sub.2 purge was removed and the vial was sealed and moved to a stir plate at 40 C. The mixture was allowed to react for 16 hours. The resin was filtered off using a 0.45 m filter.
[0343] The product was purified using AEX purification (mobile phase A: 25 mM TRIS pH=7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH=7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile solid phase TSKgel-30; 1.5 cm10 cm.) The acetonitrile was removed using a rotary evaporator, and desalted with a 3K spin column using 210 mL exchanges with sterilized water. The solid product was dried using lyophilization and stored for later use.
Example 2. In Vivo Administration of ALK7 RNAi Agents in Mice
[0344] ALK7 RNAi agents were evaluated in vivo in mice. On Day 1, five (n=5) female C57bl/6 mice in each group were given a single subcutaneous (SQ) injection of 250 l per 25 g body weight containing either 1.0 mg/kg (mpk), 3.0 mg/kg (mpk) of an ALK7 RNAi agent, or saline. Dosing was in accordance with Table 12 below.
TABLE-US-00019 TABLE 12 Dosing groups for the mice of Example 2. Group ID Dose (RNAi Agent) # of Animals 1. Saline Day 1: Single SQ Injection n = 5 2. 1.0 mg/kg AC004391 Day 1: Single SQ Injection n = 5 3. 3.0 mg/kg AC004391 Day 1: Single SQ Injection n = 5 4. 1.0 mg/kg AC004390 Day 1: Single SQ Injection n = 5 5. 3.0 mg/kg AC004390 Day 1: Single SQ Injection n = 5 6. 1.0 mg/kg AC004392 Day 1: Single SQ Injection n = 5 7. 3.0 mg/kg AC004392 Day 1: Single SQ Injection n = 5 8. 1.0 mg/kg AC005181 Day 1: Single SQ Injection n = 5 9. 3.0 mg/kg AC005181 Day 1: Single SQ Injection n = 5 10. 1.0 mg/kg AC005824 Day 1: Single SQ Injection n = 5 11. 3.0 mg/kg AC005824 Day 1: Single SQ Injection n = 5 12. 1.0 mg/kg AC005823 Day 1: Single SQ Injection n = 5 13. 3.0 mg/kg AC005823 Day 1: Single SQ Injection n = 5
[0345] ALK7 RNAi agents AC004391, AC004390, AC004392, and AC005181 target and initiate RNAi and RNA-induced silencing complex (RISC) of mouse ALK7. ALK7 RNAi agents AC005824 and AC005823 target and initiate RNAi and RNA-induced silencing complex (RISC) of human ALK7.
[0346] Five (n=5) mice were dosed in each group. Mice were injected subcutaneously (SQ) on day 1. On day 15, mice were euthanized, and 50 mg adipose tissues (inguinal white adipose tissue iWAT, perigonadal white adipose tissue pgWAT) were collected for analysis. Samples were analyzed by qPCR for mALK7 mRNA knockdown, using mARL1 as the endogenous control gene. Each group was normalized to group 1 (saline). Average results for each group are shown in Table 13 below.
TABLE-US-00020 TABLE 13 Relative expression of ALK7 mRNA in various tissues analyzed by qPCR for each of the dosing groups of Example 2. iWAT pgWAT Group Average (n = 5) Group Average (n = 5) Rel. Error Error Rel. Error Error Group ID Exp. (Low) (High) Exp. (Low) (High) 1. Saline 1.000 0.111 0.124 1.000 0.144 0.168 2. 1.0 mg/kg AC004391 0.501 0.101 0.127 0.566 0.135 0.178 3. 3.0 mg/kg AC004391 0.504 0.085 0.103 0.503 0.097 0.121 4. 1.0 mg/kg AC004390 0.454 0.066 0.078 0.496 0.062 0.071 5. 3.0 mg/kg AC004390 0.339 0.097 0.137 0.394 0.142 0.223 6. 1.0 mg/kg AC004392 0.542 0.109 0.137 0.520 0.124 0.163 7. 3.0 mg/kg AC004392 0.376 0.095 0.127 0.542 0.125 0.163 8. 1.0 mg/kg AC005181 0.399 0.057 0.067 0.349 0.091 0.124 9. 3.0 mg/kg AC005181 0.337 0.069 0.087 0.187 0.063 0.096 10. 1.0 mg/kg AC005824 0.505 0.130 0.175 0.461 0.103 0.133 11. 3.0 mg/kg AC005824 0.294 0.039 0.044 0.347 0.062 0.075 12. 1.0 mg/kg AC005823 0.422 0.122 0.171 0.407 0.114 0.158 13. 3.0 mg/kg AC005823 0.345 0.100 0.141 0.322 0.104 0.154
[0347] As shown in Table 13, Groups 2-13 showed reductions in ALK7 in comparison to Group 1 dosed with no ALK7 RNAi agent, in both iWAT and pgWAT. Particularly, ALK7 RNAi agent AC005824 at 3.0 mg/kg dose achieved 70% ALK7 inhibition (0.294) in iWAT on Day 15. Dose response was observed in Groups 4&5, 6&7, 8&9, 10&11, and 12&13 in iWAT, and also observed in Groups 2&3, 4&5, 8&9, 10&11, and 12&13 in pgWAT.
Example 3. ALK7-SEAP Mouse Model
[0348] To evaluate ALK7 RNAi agents in vivo, an ALK7-SEAP mouse model was used. C57bl6/Albino female mice were transiently transfected in vivo with plasmid by hydrodynamic tail vein (HTV) injection. Mice were injected, via hydrodynamic tail vein (HTV) injection, with plasmid pMIR1066 containing the nucleobases 220-3200 of the ALK7 cDNA sequence (NCBI Reference Sequence: NM_145259.3 (Seq ID No. 1)) inserted into the 3 UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 20 g of the plasmid containing the ALK7 genome in Ringer's solution in a total volume of 10% of the animal's body weight was injected, via HTV, to create ALK7-SEAP model mice. Following transfection with ALK7-SEAP, the mice were subsequently administered ALK7 RNAi agents. Inhibition of ALK7 gene expression by ALK7 RNAi agent results in concomitant inhibition of SEAP expression. SEAP expression levels were measured by Phospha-Light SEAP Reporter Gene Assay System (ThermoFisher Cat #T1016). Prior to treatment, SEAP expression levels in serum were measured and the mice were grouped according to average SEAP levels.
[0349] Analyses: SEAP levels may be measured at various times, both before and after administration of ALK7 RNAi agents.
[0350] i) Serum collection: Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000g for 3 min to separate the serum and stored at 4 C.
[0351] ii) Serum SEAP levels: Serum was collected and measured by the Phospha-Light SEAP Reporter Gene Assay System (ThermoFisher) according to the manufacturer's instructions. Serum SEAP levels for each animal was normalized to the control group of mice injected with saline in order to account for the non-treatment related decline in ALK7 sequence expression with this model. First, the SEAP level for each animal at a time point was divided by the pre-treatment level of expression in that animal (pre-treatment) in order to determine the ratio of expression normalized to pre-treatment. Expression at a specific time point was then normalized to the control group by dividing the normalized to pre-treatment ratio for an individual animal by the average normalized to pre-treatment ratio of all mice in the normal saline control group. Alternatively, in some Examples set forth herein, the serum SEAP levels for each animal were assessed by normalizing to pre-treatment levels only.
Example 4. In Vivo Administration of ALK7 RNAi Agents in ALK7-SEAP Mice
[0352] The ALK7-SEAP model described in Example 3, above, was used. On Day 21, four (n=4) female C57bl/6 albino mice in each group were dosed with plasmid containing the nucleobases 220-3200 of the ALK7 cDNA sequence, via HTV injection. On Day 1, the mice were dosed with either isotonic saline or ALK7 RNAi agents formulated in saline (at 3 mg/kg), via subcutaneous (S Q) injection, at 250 L per 25 g (10 mL/kg) body weight injection volume. The dosing regimen is in accordance with Table 14 below.
TABLE-US-00021 TABLE 14 Dosing for mice of Example 4. Group Dose (RNAi Agent) Dosing Route # of Animals (n=) 1 Saline Day 1 SQ Injection n = 4 2 3 mg/kg AC004197 Day 1 SQ Injection n = 4 3 3 mg/kg AC004198 Day 1 SQ Injection n = 4 4 3 mg/kg AC004199 Day 1 SQ Injection n = 4 5 3 mg/kg AC004200 Day 1 SQ Injection n = 4 6 3 mg/kg AC004201 Day 1 SQ Injection n = 4 7 3 mg/kg AC004202 Day 1 SQ Injection n = 4 8 3 mg/kg AC004204 Day 1 SQ Injection n = 4 9 3 mg/kg AC004205 Day 1 SQ Injection n = 4 10 3 mg/kg AC004206 Day 1 SQ Injection n = 4 11 3 mg/kg AC004207 Day 1 SQ Injection n = 4 12 3 mg/kg AC004208 Day 1 SQ Injection n = 4
[0353] Serum was collected on Day 7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 15, with average SEAP reflecting the normalized average value of SEAP.
TABLE-US-00022 TABLE 15 Average SEAP normalized to pre-treatment and saline control in ALK7-SEAP mice of Example 4. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID SEAP Dev SEAP Dev SEAP Dev 1. Saline 1.000 0.091 1.000 0.299 1.000 0.231 2. 3 mg/kg AC004197 0.334 0.151 0.219 0.122 0.249 0.176 3. 3 mg/kg AC004198 0.701 0.165 0.740 0.244 0.544 0.328 4. 3 mg/kg AC004199 0.452 0.105 0.473 0.213 0.457 0.143 5. 3 mg/kg AC004200 0.086 0.063 0.039 0.025 0.023 0.027 6. 3 mg/kg AC004201 0.141 0.083 0.097 0.063 0.081 0.063 7. 3 mg/kg AC004202 0.164 0.018 0.076 0.053 0.053 0.042 8. 3 mg/kg AC004204 0.466 0.120 0.484 0.112 0.539 0.087 9. 3 mg/kg AC004205 0.428 0.127 0.525 0.186 0.561 0.239 10. 3 mg/kg AC004206 0.267 0.126 0.170 0.073 0.208 0.067 11. 3 mg/kg AC004207 0.212 0.102 0.180 0.071 0.173 0.053 12. 3 mg/kg AC004208 0.344 0.078 0.316 0.062 0.343 0.174
[0354] Groups 2-12 showed reduction in SEAP-ALK7 at all time points compared to the saline control Group 1. In particular, A D004200 achieved substantial inhibition (0.023, 98 knockdown) after a single subcutaneous administration of 3 mg/kg at Day 22.
Example 5. In Vivo Administration of ALK7RNAi Agents in ALK7 SEAPmic
[0355] The ALK7-SEAP model described in Example 3, above, was used. On Day 21, four (n=4) female C57bl/6 albino mice in each group were dosed with plasmid containing the nucleobases 220-3200 of the ALK7 cDNA sequence, via HTV injection. On Day 1, the mice were dosed with either isotonic saline or ALK7 RNAi agents formulated in saline (at 3 mg/kg), via subcutaneous (S Q) injection, at 250 L per 25 g (10 mL/kg) body weight injection volume. The dosing regimen is in accordance with Table 16 below.
TABLE-US-00023 TABLE 16 Dosing for mice of Example 5. Group Dose (RNAi Agent) Dosing Route # of Animals (n=) 1 Saline Day 1 SQ Injection n = 4 2 3 mg/kg AC004210 Day 1 SQ Injection n = 4 3 3 mg/kg AC004211 Day 1 SQ Injection n = 4 4 3 mg/kg AC004212 Day 1 SQ Injection n = 4 5 3 mg/kg AC004213 Day 1 SQ Injection n = 4 6 3 mg/kg AC004214 Day 1 SQ Injection n = 4 7 3 mg/kg AC004215 Day 1 SQ Injection n = 4 8 3 mg/kg AC004216 Day 1 SQ Injection n = 4 9 3 mg/kg AC004217 Day 1 SQ Injection n = 4 10 3 mg/kg AC004218 Day 1 SQ Injection n = 4 11 3 mg/kg AC004219 Day 1 SQ Injection n = 4 12 3 mg/kg AC004220 Day 1 SQ Injection n = 4 13 3 mg/kg AC004221 Day 1 SQ Injection n = 4 14 3 mg/kg AC004222 Day 1 SQ Injection n = 4
[0356] Serum was collected on Day 6, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 17, with average SEAP reflecting the normalized average value of SEAP.
TABLE-US-00024 TABLE 17 Average SEAP normalized to pre-treatment and saline control in ALK7-SEAP mice of Example 5. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID SEAP Dev SEAP Dev SEAP Dev 1. Saline 1.000 0.151 1.000 0.269 1.000 0.359 2. 3 mg/kg AC004210 0.388 0.154 0.225 0.203 0.221 0.197 3. 3 mg/kg AC004211 0.251 0.126 0.279 0.219 0.680 1.002 4. 3 mg/kg AC004212 0.129 0.043 0.057 0.060 0.063 0.060 5. 3 mg/kg AC004213 0.375 0.119 0.223 0.150 0.140 0.122 6. 3 mg/kg AC004214 0.156 0.108 0.036 0.033 0.140 0.193 7. 3 mg/kg AC004215 0.121 0.065 0.099 0.102 0.136 0.161 8. 3 mg/kg AC004216 0.235 0.127 0.082 0.084 0.177 0.163 9. 3 mg/kg AC004217 0.370 0.121 0.246 0.061 0.264 0.098 10. 3 mg/kg AC004218 0.344 0.106 0.357 0.064 0.537 0.314 11. 3 mg/kg AC004219 0.487 0.136 0.290 0.079 0.316 0.117 12. 3 mg/kg AC004220 0.383 0.153 0.219 0.086 0.263 0.200 13. 3 mg/kg AC004221 0.324 0.132 0.233 0.067 0.164 0.061 14. 3 mg/kg AC004222 0.139 0.062 0.091 0.032 0.044 0.016
[0357] Groups 2-14 showed reduction in SEAP-ALK7 at all time points compared to the saline control Group 1. In particular, on AC004214 achieved substantial inhibition (0.036, 96% knockdown) after a single subcutaneous administration of 3 mg/kg at Day 15.
Example 6. ALK7-GLuc AAV Mouse Model
[0358] To evaluate certain ALK7 RNAi agents, an ALK7-GLuc (Gaussia Luciferase) AAV (Adeno-associated virus) mouse model was used. Six- to eight-week-old male C57BL/6 mice were transduced with ALK7-GLuc AAV serotype 8, administered at least 14 days prior to administration of an ALK7 RNAi agent or control. The genome of the ALK7-GLuc AAV contains the 220-3200 region of the human ALK7 cDNA sequence (GenBank NM_145259.3 (Seq ID No. 1)) inserted into the 3 UTR of the GLuc reporter gene sequence. 5E12 to 1E13 GC/kg (genome copies per kg animal body weight) of the respective virus in PBS in a total volume of 10 mL/kg animal's body weight was injected into mice via the tail vein to create ALK7-GLuc AAV model mice. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured. Prior to administration of a treatment (between day 7 and day 1 pre-dose), GLuc expression levels in serum were measured by the Pierce Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific), and the mice were grouped according to average GLuc levels.
[0359] Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000g for 3 min to separate the serum and stored at 4 C. Serum was collected and measured by the Pierce Gaussia Luciferase Glow Assay Kit according to the manufacturer's instructions. Serum GLuc levels for each animal can be normalized to the control group of mice injected with vehicle control in order to account for the non-treatment related shift in ALK7 expression with this model. To do so, first, the GLuc level for each animal at a time point was divided by the pre-treatment level of expression in that animal (Day 1) in order to determine the ratio of expression normalized to pre-treatment. Expression at a specific time point was then normalized to the control group by dividing the normalized to pre-treatment ratio for an individual animal by the average normalized to pre-treatment ratio of all mice in the normal vehicle control group. Alternatively, the serum GLuc levels for each animal was assessed by normalizing to pre-treatment levels only.
Example 7. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0360] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, four (n=4) male C.sub.57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 3.0 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 18 below.
TABLE-US-00025 TABLE 18 Dosing Groups of Example 7. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n =) 1 Saline N/A Day 1 SQ Injection n = 4 2 AC004197 3.0 mg/kg Day 1 SQ Injection n = 4 3 AC004198 3.0 mg/kg Day 1 SQ Injection n = 4 4 AC004199 3.0 mg/kg Day 1 SQ Injection n = 4 5 AC004200 3.0 mg/kg Day 1 SQ Injection n = 4 6 AC004201 3.0 mg/kg Day 1 SQ Injection n = 4 7 AC004202 3.0 mg/kg Day 1 SQ Injection n = 4 8 AC004203 3.0 mg/kg Day 1 SQ Injection n = 4 9 AC004204 3.0 mg/kg Day 1 SQ Injection n = 4 10 AC004205 3.0 mg/kg Day 1 SQ Injection n = 4 11 AC004206 3.0 mg/kg Day 1 SQ Injection n = 4 12 AC004207 3.0 mg/kg Day 1 SQ Injection n = 4 13 AC004208 3.0 mg/kg Day 1 SQ Injection n = 4 14 AC004209 3.0 mg/kg Day 1 SQ Injection n = 4
[0361] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0362] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0363] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 19, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00026 TABLE 19 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 7. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.148 1.000 0.038 1.000 0.054 2. 3.0 mg/kg AC004197 0.165 0.012 0.132 0.016 0.171 0.032 3. 3.0 mg/kg AC004198 0.695 0.048 0.736 0.060 0.874 0.032 4. 3.0 mg/kg AC004199 0.172 0.026 0.173 0.013 0.234 0.023 5. 3.0 mg/kg AC004200 0.085 0.010 0.084 0.010 0.081 0.012 6. 3.0 mg/kg AC004201 0.112 0.012 0.123 0.011 0.120 0.022 7. 3.0 mg/kg AC004202 0.098 0.023 0.112 0.027 0.105 0.007 8. 3.0 mg/kg AC004203 0.254 0.050 0.305 0.053 0.268 0.068 9. 3.0 mg/kg AC004204 0.249 0.064 0.295 0.063 0.283 0.091 10. 3.0 mg/kg AC004205 0.295 0.043 0.399 0.073 0.351 0.053 11. 3.0 mg/kg AC004206 0.216 0.035 0.250 0.038 0.226 0.027 12. 3.0 mg/kg AC004207 0.164 0.009 0.173 0.029 0.148 0.014 13. 3.0 mg/kg AC004208 0.242 0.032 0.237 0.042 0.228 0.033 14. 3.0 mg/kg AC004209 0.657 0.121 0.778 0.113 0.734 0.088
[0364] Groups 2-14 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Particularly, AC004200 achieved substantial inhibition (0.081, 0.92% knockdown) at 3.0 mg/kg on Day 22.
Example 8. In Vivo Administration of ALK7 RNAi Agents in ALK7-Gluc-AAV Mice
[0365] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, four (n=4) male C57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 3.0 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 20 below.
TABLE-US-00027 TABLE 20 Dosing Groups of Example 8. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n =) 1 Saline N/A Day 1 SQ Injection n = 4 2 AC004210 3.0 mg/kg Day 1 SQ Injection n = 4 3 AC004211 3.0 mg/kg Day 1 SQ Injection n = 4 4 AC004212 3.0 mg/kg Day 1 SQ Injection n = 4 5 AC004213 3.0 mg/kg Day 1 SQ Injection n = 4 6 AC004214 3.0 mg/kg Day 1 SQ Injection n = 4 7 AC004215 3.0 mg/kg Day 1 SQ Injection n = 4 8 AC004216 3.0 mg/kg Day 1 SQ Injection n = 4 9 AC004217 3.0 mg/kg Day 1 SQ Injection n = 4 10 AC004218 3.0 mg/kg Day 1 SQ Injection n = 4 11 AC004219 3.0 mg/kg Day 1 SQ Injection n = 4 12 AC004220 3.0 mg/kg Day 1 SQ Injection n = 4 13 AC004221 3.0 mg/kg Day 1 SQ Injection n = 4 14 AC004222 3.0 mg/kg Day 1 SQ Injection n = 4
[0366] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0367] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B3, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0368] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 21, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00028 TABLE 21 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 8. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.079 1.000 0.157 1.000 0.161 2. 3.0 mg/kg AC004210 0.370 0.094 0.491 0.056 0.525 0.062 3. 3.0 mg/kg AC004211 0.181 0.017 0.294 0.035 0.287 0.045 4. 3.0 mg/kg AC004212 0.141 0.028 0.273 0.018 0.267 0.027 5. 3.0 mg/kg AC004213 0.392 0.051 0.489 0.033 0.500 0.091 6. 3.0 mg/kg AC004214 0.149 0.018 0.263 0.029 0.275 0.027 7. 3.0 mg/kg AC004215 0.125 0.020 0.245 0.033 0.264 0.022 8. 3.0 mg/kg AC004216 0.175 0.043 0.288 0.064 0.316 0.057 9. 3.0 mg/kg AC004217 0.394 0.023 0.478 0.071 0.568 0.062 10. 3.0 mg/kg AC004218 0.492 0.127 0.573 0.186 0.624 0.172 11. 3.0 mg/kg AC004219 0.397 0.066 0.485 0.058 0.566 0.087 12. 3.0 mg/kg AC004220 0.386 0.061 0.422 0.040 0.429 0.040 13. 3.0 mg/kg AC004221 0.175 0.016 0.283 0.027 0.366 0.068 14. 3.0 mg/kg AC004222 0.150 0.021 0.234 0.053 0.260 0.049
[0369] Groups 2-14 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. In particular, AC004215 achieved 87% inhibition (0.125) at 3.0 mg/kg on Day 8.
Example 9. In Vivo Administration of ALK7 RNAi Agents in ALK7-Gluc-AAV Mice
[0370] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, six (n=6) male C57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 0.75 or 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 22 below.
TABLE-US-00029 TABLE 22 Dosing Groups of Example 9. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n =) 1 Saline N/A Day 1 SQ Injection n = 6 2 AC004200 0.75 mg/kg Day 1 SQ Injection n = 6 3 AC004200 1.5 mg/kg Day 1 SQ Injection n = 6 4 AC004201 0.75 mg/kg Day 1 SQ Injection n = 6 5 AC004201 1.5 mg/kg Day 1 SQ Injection n = 6 6 AC004202 0.75 mg/kg Day 1 SQ Injection n = 6 7 AC004202 1.5 mg/kg Day 1 SQ Injection n = 6 8 AC004212 0.75 mg/kg Day 1 SQ Injection n = 6 9 AC004212 1.5 mg/kg Day 1 SQ Injection n = 6 10 AC004214 0.75 mg/kg Day 1 SQ Injection n = 6 11 AC004214 1.5 mg/kg Day 1 SQ Injection n = 6 12 AC004215 0.75 mg/kg Day 1 SQ Injection n = 6 13 AC004215 1.5 mg/kg Day 1 SQ Injection n = 6
[0371] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0372] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B3, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0373] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 23, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00030 TABLE 23 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 9. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.168 1.000 0.174 1.000 0.111 2. 0.75 mg/kg AC004200 0.198 0.054 0.187 0.034 0.194 0.047 3. 1.5 mg/kg AC004200 0.098 0.016 0.097 0.023 0.100 0.032 4. 0.75 mg/kg AC004201 0.342 0.072 0.339 0.055 0.386 0.139 5. 1.5 mg/kg AC004201 0.156 0.048 0.191 0.037 0.178 0.032 6. 0.75 mg/kg AC004202 0.218 0.048 0.242 0.046 0.285 0.051 7. 1.5 mg/kg AC004202 0.138 0.016 0.128 0.024 0.170 0.033 8. 0.75 mg/kg AC004212 0.300 0.047 0.279 0.032 0.319 0.061 9. 1.5 mg/kg AC004212 0.149 0.034 0.140 0.024 0.154 0.026 10. 0.75 mg/kg AC004214 0.253 0.032 0.220 0.013 0.208 0.021 11. 1.5 mg/kg AC004214 0.145 0.022 0.165 0.018 0.155 0.015 12. 0.75 mg/kg AC004215 0.303 0.056 0.355 0.064 0.365 0.088 13. 1.5 mg/kg AC004215 0.212 0.013 0.211 0.039 0.197 0.031
[0374] Groups 2-13 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Particularly, AC004200 achieved 90% inhibition (0.097) at 1.5 mg/kg on Day 15. Furthermore, dose response was observed for each of the ALK7 RNAi agent tested, at all time points.
Example 10. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0375] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, six (n=6) male C57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 24 below.
TABLE-US-00031 TABLE 24 Dosing Groups of Example 10. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n=) 1 Saline N/A Day 1 SQ Injection n = 6 2 AC004200 1.5 mg/kg Day 1 SQ Injection n = 6 3 AC005846 1.5 mg/kg Day 1 SQ Injection n = 6 4 AC005847 1.5 mg/kg Day 1 SQ Injection n = 6 5 AC005848 1.5 mg/kg Day 1 SQ Injection n = 6 6 AC005849 1.5 mg/kg Day 1 SQ Injection n = 6 7 AC005850 1.5 mg/kg Day 1 SQ Injection n = 6 8 AC005851 1.5 mg/kg Day 1 SQ Injection n = 6 9 AC005852 1.5 mg/kg Day 1 SQ Injection n = 6 10 AC005853 1.5 mg/kg Day 1 SQ Injection n = 6 11 AC005855 1.5 mg/kg Day 1 SQ Injection n = 6 12 AC005854 1.5 mg/kg Day 1 SQ Injection n = 6
[0376] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0377] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0378] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 25, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00032 TABLE 25 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 10. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.115 1.000 0.163 1.000 0.170 2. 1.5 mg/kg AC004200 0.192 0.046 0.132 0.034 0.131 0.017 3. 1.5 mg/kg AC005846 0.177 0.043 0.107 0.012 0.111 0.014 4. 1.5 mg/kg AC005847 0.187 0.025 0.105 0.017 0.113 0.015 5. 1.5 mg/kg AC005848 0.225 0.064 0.121 0.019 0.145 0.019 6. 1.5 mg/kg AC005849 0.286 0.071 0.140 0.038 0.204 0.047 7. 1.5 mg/kg AC005850 0.267 0.058 0.138 0.027 0.163 0.033 8. 1.5 mg/kg AC005851 0.238 0.065 0.123 0.020 0.131 0.020 9. 1.5 mg/kg AC005852 0.326 0.043 0.175 0.019 0.231 0.049 10. 1.5 mg/kg AC005853 0.251 0.091 0.150 0.051 0.179 0.049 11. 1.5 mg/kg AC005855 0.239 0.050 0.141 0.035 0.189 0.052 12. 1.5 mg/kg AC005854 0.156 0.035 0.098 0.030 0.139 0.028
[0379] Groups 2-12 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Particularly, AC005854 achieved 90% inhibition (0.098) at 1.5 mg/kg on Day 15.
Example 11. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0380] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, six (n=6) male C57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 26 below.
TABLE-US-00033 TABLE 26 Dosing Groups of Example 11. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n=) 1 Saline N/A Day 1 SQ Injection n = 6 2 AC004202 1.5 mg/kg Day 1 SQ Injection n = 6 3 AC005867 1.5 mg/kg Day 1 SQ Injection n = 6 4 AC005868 1.5 mg/kg Day 1 SQ Injection n = 6 5 AC005869 1.5 mg/kg Day 1 SQ Injection n = 6 6 AC005870 1.5 mg/kg Day 1 SQ Injection n = 6 7 AC005871 1.5 mg/kg Day 1 SQ Injection n = 6 8 AC005872 1.5 mg/kg Day 1 SQ Injection n = 6 9 AC005873 1.5 mg/kg Day 1 SQ Injection n = 6 10 AC005874 1.5 mg/kg Day 1 SQ Injection n = 6 11 AC005875 1.5 mg/kg Day 1 SQ Injection n = 6 12 AC005876 1.5 mg/kg Day 1 SQ Injection n = 6
[0381] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0382] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0383] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 27, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00034 TABLE 27 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 11. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.074 1.000 0.186 1.000 0.189 2. 1.5 mg/kg AC004202 0.154 0.020 0.187 0.026 0.230 0.038 3. 1.5 mg/kg AC005867 0.253 0.068 0.304 0.057 0.335 0.078 4. 1.5 mg/kg AC005868 0.170 0.030 0.228 0.032 0.271 0.054 5. 1.5 mg/kg AC005869 0.214 0.046 0.276 0.082 0.305 0.076 6. 1.5 mg/kg AC005870 0.307 0.064 0.353 0.080 0.385 0.067 7. 1.5 mg/kg AC005871 0.368 0.352 0.466 0.509 0.458 0.400 8. 1.5 mg/kg AC005872 0.250 0.037 0.323 0.037 0.434 0.137 9. 1.5 mg/kg AC005873 0.217 0.020 0.268 0.058 0.310 0.037 10. 1.5 mg/kg AC005874 0.244 0.021 0.288 0.030 0.321 0.055 11. 1.5 mg/kg AC005875 0.217 0.043 0.252 0.057 0.340 0.073 12. 1.5 mg/kg AC005876 0.254 0.073 0.297 0.086 0.316 0.088
[0384] Groups 2-12 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Particularly, AC004202 achieved 85% inhibition (0.154) at 1.5 mg/kg on Day 8.
Example 12. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0385] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, five (n=5) male C57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 28 below.
TABLE-US-00035 TABLE 28 Dosing Groups of Example 12. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n=) 1 Saline N/A Day 1 SQ Injection n = 5 2 AC004201 1.5 mg/kg Day 1 SQ Injection n = 5 3 AC005856 1.5 mg/kg Day 1 SQ Injection n = 5 4 AC005857 1.5 mg/kg Day 1 SQ Injection n = 5 5 AC006111 1.5 mg/kg Day 1 SQ Injection n = 5 6 AC005858 1.5 mg/kg Day 1 SQ Injection n = 5 7 AC005859 1.5 mg/kg Day 1 SQ Injection n = 5 8 AC005860 1.5 mg/kg Day 1 SQ Injection n = 5 9 AC005861 1.5 mg/kg Day 1 SQ Injection n = 5 10 AC005862 1.5 mg/kg Day 1 SQ Injection n = 5 11 AC005863 1.5 mg/kg Day 1 SQ Injection n = 5 12 AC005864 1.5 mg/kg Day 1 SQ Injection n = 5 13 AC005865 1.5 mg/kg Day 1 SQ Injection n = 5
[0386] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0387] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0388] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 29, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00036 TABLE 29 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 12. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. 1.5 mg/kg Saline 1.000 0.324 1.000 0.181 1.000 0.322 2. 1.5 mg/kg AC004201 0.228 0.039 0.204 0.040 0.228 0.057 3. 1.5 mg/kg AC005856 0.311 0.082 0.292 0.086 0.307 0.066 4. 1.5 mg/kg AC005857 0.193 0.047 0.143 0.038 0.183 0.037 5. 1.5 mg/kg AC006111 0.172 0.036 0.172 0.026 0.206 0.051 6. 1.5 mg/kgAC005858 0.177 0.078 0.143 0.055 0.197 0.095 7. 1.5 mg/kg AC005859 0.322 0.087 0.256 0.097 0.321 0.115 8. 1.5 mg/kg AC005860 0.589 0.158 0.514 0.064 0.579 0.073 9. 1.5 mg/kg AC005861 0.275 0.087 0.217 0.048 0.257 0.078 10. 1.5 mg/kg AC005862 0.480 0.196 0.412 0.186 0.581 0.206 11. 1.5 mg/kg AC005863 0.390 0.080 0.339 0.062 0.469 0.101 12. 1.5 mg/kg AC005864 0.127 0.051 0.147 0.091 0.187 0.108 13. 1.5 mg/kg AC005865 0.541 0.063 0.437 0.114 0.598 0.120
[0389] Groups 2-13 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Particularly, AC005864 achieved 87% inhibition (0.127) at 1.5 mg/kg on Day 8.
Example 13. In Vivo Administration of ALK7RNAi Agents in Cynomolgus Monkeys
[0390] ALK7 RNAi agents were tested in Cynomolgus monkeys for inhibition of ALK7. On Day 1 and Day 29, three (n=3) male Cynomolgus monkeys for each test group were dosed with ALK7 RNAi agents formulated in saline (at 3.0 mg/kg), via subcutaneous (SQ) injection with syringe and needle in the mid-scapular region, at 0.3 mL/kg dose volume. Adipose biopsies were collected from all test animals on Day 7 (pre-dose), 15, 29, 57, and 85. The dosing regimen was in accordance with Table 30 below.
TABLE-US-00037 TABLE 30 Dosing for test animals of Example 13. # of Dose Group Dose (RNAi Agent) Animals Dosing Route Volume 1 3.0 mg/kg AC006188 n = 3 Day 1 & 29 SQ 0.3 mL/kg Injection 2 3.0 mg/kg AC006189 n = 3 Day 1 & 29 SQ 0.3 mL/kg Injection
[0391] All animals were fasted for at least 12 hours and less than 24 hours for scheduled blood collections and biopsy procedures. Blood collection site was femoral vein. A saphenous vein (not used for dose administration) may be used as an alternative collection site.
[0392] Adipose biopsies were collected as a sedated procedure. Sedation was accomplished using Ketamine HCl (10 mg/kg) or Telazol (5-8 mg/kg), administered as an intramuscular (IM) injection and supplemented with Ketamine (5 mg/kg) as needed.
[0393] An approximate 3-5 cm skin incision was made followed by collection of adipose tissue (optimally 50-150 mg). The skin will then be closed in a routine manner using suture (or alternate) materials maintaining aseptic technique.
[0394] Each biopsy site was separated by at least 1-2 cm. Biopsies were separated into 2 pieces (one piece of 25 to 75 mg and second piece of 25-75 mg) for each collection time point. Analgesics may be administered at veterinarian's discretion.
[0395] Blood was collected into tubes containing no anticoagulant (serum separator tubes). Blood was allowed to clot at ambient temperature prior to centrifugation to obtain serum.
[0396] Blood was collected on Day 7, Day 1, Day 15, Day 29, Day 57, and Day 85, prior to biopsy sample collections or dose administration (when applicable), and from any animals found in moribund condition or sacrificed at an unscheduled interval. Samples may be further collected at additional timepoints. Should there be any additional collected samples at other timepoints, their corresponding relevant data are shown below.
[0397] Individual doses of ALK7 RNAi agents were calculated based on the body weights recorded on each day of dosing.
[0398] The adipose biopsies and serum collected from the test animals were used for analysis for ALK7 expression and additional biological parameters. ALK7 mRNA expression levels were quantified via qPCR, using cARL1 as the endogenous control gene, normalized to Day 7. The data is shown in the following Table 31.
[0399] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end and the 3 terminal end of the sense strand to a lipid moiety having the modified sequences as set forth in the duplex structures herein (see Tables 3, 6, 6a, 8, 9, and 10, for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structures of LP-379-a and LP-371-a).
TABLE-US-00038 TABLE 31 ALK7 expression in adipose tissues of Cynomolgus monkeys of Example 13. Day 7 Day 15 Rel. Error Error Rel. Error Error Group ID Exp. Low High Exp. Low High 1. 3.0 mg/kg AC006188 1.000 0.212 0.269 0.171 0.073 0.128 2. 3.0 mg/kg AC006189 1.000 0.161 0.191 0.105 0.054 0.110 Day 29 Day 57 Rel. Error Error Rel. Error Error Group ID Exp. Low High Exp. Low High 1. 3.0 mg/kg AC006188 0.119 0.051 0.090 0.205 0.028 0.032 2. 3.0 mg/kg AC006189 0.139 0.032 0.041 0.212 0.044 0.056 Day 85 Day 113 Rel. Error Error Rel. Error Error Group ID Exp. Low High Exp. Low High 1. 3.0 mg/kg AC006188 0.229 0.075 0.111 0.197 0.055 0.075 2. 3.0 mg/kg AC006189 0.285 0.125 0.221 0.321 0.172 0.372
[0400] Both Groups 1 and 2, AC006188 and AC006189 showed significant inhibition of ALK7 in cynomolgus monkeys' adipose tissues. Most notably, at nadir, AC006189 achieved 89% ALK7 inhibition (0.105) at 3.0 mg/kg on Day 15. Both ACO006188 and ACO006189 showed ALK7 inhibition out to at least Day 113, with AC006188 achieving 80% ALK7 inhibition (0.197) at 3.0 mg/kg (2 dose on Day 1 and Day 29) on Day 113.
Example 14. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0401] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, five (n=5) male C57bl/6 mice in each group were dosed with 510{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 32 below.
TABLE-US-00039 TABLE 32 Dosing Groups of Example 14. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n=) 1 Saline N/A Day 1 SQ Injection n = 5 2 AC006111 1.5 mg/kg Day 1 SQ Injection n = 5 3 AC006738 1.5 mg/kg Day 1 SQ Injection n = 5 4 AC006747 1.5 mg/kg Day 1 SQ Injection n = 5 5 AC006773 1.5 mg/kg Day 1 SQ Injection n = 5 6 AC004202 1.5 mg/kg Day 1 SQ Injection n = 5 7 AC006741 1.5 mg/kg Day 1 SQ Injection n = 5 8 AC006742 1.5 mg/kg Day 1 SQ Injection n = 5 9 AC006743 1.5 mg/kg Day 1 SQ Injection n = 5 10 AC004212 1.5 mg/kg Day 1 SQ Injection n = 5 11 AC006744 1.5 mg/kg Day 1 SQ Injection n = 5 12 AC006745 1.5 mg/kg Day 1 SQ Injection n = 5 13 AC006746 1.5 mg/kg Day 1 SQ Injection n = 5
[0402] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0403] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0404] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 33, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00040 TABLE 33 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 14. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.149 1.000 0.160 1.000 0.100 2. 1.5 mg/kg AC006111 0.200 0.059 0.151 0.040 0.388 0.056 3. 1.5 mg/kg AC006738 0.582 0.168 0.401 0.066 0.692 0.146 4. 1.5 mg/kg AC006747 0.346 0.058 0.345 0.090 0.545 0.086 5. 1.5 mg/kg AC006773 0.342 0.059 0.271 0.053 0.568 0.091 6. 1.5 mg/kg AC004202 0.184 0.046 0.160 0.045 0.385 0.088 7. 1.5 mg/kg AC006741 0.300 0.056 0.172 0.017 0.415 0.078 8. 1.5 mg/kg AC006742 0.283 0.090 0.171 0.037 0.447 0.081 9. 1.5 mg/kg AC006743 0.236 0.068 0.241 0.107 0.347 0.162 10. 1.5 mg/kg AC004212 0.271 0.064 0.237 0.018 0.445 0.085 11. 1.5 mg/kg AC006744 0.239 0.049 0.182 0.020 0.343 0.032 12. 1.5 mg/kg AC006745 0.223 0.023 0.165 0.039 0.315 0.068 13. 1.5 mg/kg AC006746 0.198 0.036 0.140 0.028 0.314 0.084
[0405] Groups 2-13 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Particularly, AC006746 achieved 86% inhibition (0.140) at 1.5 mg/kg on Day 15.
Example 15. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0406] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, six (n=6) male C57bl/6 mice in each group were dosed with 410{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 34 below.
TABLE-US-00041 TABLE 34 Dosing Groups of Example 15. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n=) 1 Saline N/A Day 1 SQ Injection n = 6 2 AC005847 1.5 mg/kg Day 1 SQ Injection n = 6 3 AC007192 1.5 mg/kg Day 1 SQ Injection n = 6 4 AC007193 1.5 mg/kg Day 1 SQ Injection n = 6 5 AC007194 1.5 mg/kg Day 1 SQ Injection n = 6 6 AC007195 1.5 mg/kg Day 1 SQ Injection n = 6 7 AC007196 1.5 mg/kg Day 1 SQ Injection n = 6 8 AC007197 1.5 mg/kg Day 1 SQ Injection n = 6 9 AC007198 1.5 mg/kg Day 1 SQ Injection n = 6
[0407] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0408] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0409] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 35, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00042 TABLE 35 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 15. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.055 1.000 0.085 1.000 0.103 2. 1.5 mg/kg AC005847 0.197 0.068 0.112 0.058 0.089 0.035 3. 1.5 mg/kg AC007192 0.193 0.040 0.182 0.028 0.172 0.044 4. 1.5 mg/kg AC007193 0.183 0.033 0.156 0.030 0.124 0.022 5. 1.5 mg/kg AC007194 0.217 0.030 0.193 0.048 0.171 0.028 6. 1.5 mg/kg AC007195 0.327 0.052 0.245 0.034 0.225 0.062 7. 1.5 mg/kg AC007196 0.149 0.014 0.146 0.044 0.159 0.030 8. 1.5 mg/kg AC007197 0.799 0.273 1.104 0.239 0.840 0.246 9. 1.5 mg/kg AC007198 1.053 0.183 1.238 0.377 0.960 0.347
[0410] Groups 2-7 showed reduction in ALK7-GLuc at all time points compared to the saline control Group 1. Groups 8 and 9 showed little to negligible reduction in ALK7-Gluc at all time points compared to the saline control Group 1. Particularly, AC005847 achieved 91% inhibition (0.089) at 1.5 mg/kg on Day 22.
Example 16. In Vivo Administration of ALK7RNAi Agents in ALK7-SEAP Mice
[0411] The ALK7-SEAP model described in Example 3, above, was used. On Day 21, six (n=6) female C57bl/6 albino mice in each group were dosed with plasmid containing the nucleobases 220-3200 of the ALK7 cDNA sequence, via HTV injection. On Day 1, the mice were dosed with either isotonic saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g (10 mL/kg) body weight injection volume. The dosing regimen is in accordance with Table 36 below.
TABLE-US-00043 TABLE 36 Dosing for mice of Example 16. # of Animals Group Dose (RNAi Agent) Dosing Route (n=) 1 Saline Day 1 SQ Injection n = 6 2 1.5 mg/kg AC004212 Day 1 SQ Injection n = 6 3 1.5 mg/kg AC006290 Day 1 SQ Injection n = 6 4 1.5 mg/kg AC006291 Day 1 SQ Injection n = 6 5 1.5 mg/kg AC006292 Day 1 SQ Injection n = 6 6 1.5 mg/kg AC006293 Day 1 SQ Injection n = 6 7 1.5 mg/kg AC006294 Day 1 SQ Injection n = 6 8 1.5 mg/kg AC006295 Day 1 SQ Injection n = 6 9 1.5 mg/kg AC006296 Day 1 SQ Injection n = 6 10 1.5 mg/kg AC006297 Day 1 SQ Injection n = 6 11 1.5 mg/kg AC006298 Day 1 SQ Injection n = 6 12 1.5 mg/kg AC006299 Day 1 SQ Injection n = 6 13 1.5 mg/kg AC006300 Day 1 SQ Injection n = 6
[0412] Serum was collected on Day 6, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 37, with average SEAP reflecting the normalized average value of SEAP.
TABLE-US-00044 TABLE 37 Average SEAP normalized to pre-treatment and saline control in ALK7-SEAP mice of Example 16. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID SEAP Dev SEAP Dev SEAP Dev 1. Saline 1.000 0.120 1.000 0.149 1.000 0.226 2. 1.5 mg/kg AC004212 0.267 0.053 0.201 0.050 0.257 0.066 3. 1.5 mg/kg AC006290 0.316 0.081 0.260 0.133 0.371 0.178 4. 1.5 mg/kg AC006291 0.391 0.034 0.281 0.036 0.368 0.040 5. 1.5 mg/kg AC006292 0.425 0.060 0.347 0.072 0.378 0.083 6. 1.5 mg/kg AC006293 0.535 0.100 0.378 0.096 0.475 0.146 7. 1.5 mg/kg AC006294 0.328 0.029 0.240 0.050 0.313 0.055 8. 1.5 mg/kg AC006295 0.669 0.096 0.699 0.107 0.895 0.180 9. 1.5 mg/kg AC006296 0.545 0.074 0.615 0.111 0.787 0.211 10. 1.5 mg/kg AC006297 0.443 0.084 0.456 0.126 0.581 0.171 11. 1.5 mg/kg AC006298 0.424 0.065 0.413 0.103 0.589 0.144 12. 1.5 mg/kg AC006299 0.298 0.035 0.253 0.053 0.339 0.099 13. 1.5 mg/kg AC006300 0.268 0.051 0.188 0.057 0.251 0.068
[0413] Groups 2-13 showed reduction in SEAP-ALK7 at all time points compared to the saline control Group 1. In particular, on AC006300 achieved substantial inhibition (0.188, 81% knockdown) after a single subcutaneous administration of 1.5 mg/kg at Day 15.
Example 17. In Vivo Administration of ALK7 RNAi Agents in Mice
[0414] ALK7 RNAi agents were tested in vivo in mice. On Day 1, five (n=5) female C57bl/6 mice in each group were dosed with either isotonic saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen is in accordance with Table 38 below.
TABLE-US-00045 TABLE 38 Dosing for mice of Example 17. # of Animals Group Dose (RNAi Agent) Dosing Route (n=) 1 Saline Day 1 SQ Injection n = 5 2 1.5 mg/kg AC005824 Day 1 SQ Injection n = 5 3 1.5 mg/kg AC006643 Day 1 SQ Injection n = 5 4 1.5 mg/kg AC006644 Day 1 SQ Injection n = 5 5 1.5 mg/kg AC006645 Day 1 SQ Injection n = 5 6 1.5 mg/kg AC006646 Day 1 SQ Injection n = 5 7 1.5 mg/kg AC006647 Day 1 SQ Injection n = 5 8 1.5 mg/kg AC006648 Day 1 SQ Injection n = 5 9 1.5 mg/kg AC006649 Day 1 SQ Injection n = 5 10 1.5 mg/kg AC006650 Day 1 SQ Injection n = 5 11 1.5 mg/kg AC006651 Day 1 SQ Injection n = 5 12 1.5 mg/kg AC006652 Day 1 SQ Injection n = 5 13 1.5 mg/kg AC006653 Day 1 SQ Injection n = 5
[0415] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight.
[0416] On Day 15, adipose tissues were harvested from the mice test animals. Inguinal white adipose tissue (iWAT) and perigonadal white adipose tissue (pgWAT) were collected for analysis.
[0417] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end and the 3 terminal end of the sense strand to a lipid moiety having the modified sequences as set forth in the duplex structures herein (see Tables 3, 6, 6a, 8, 9, and 10, for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structures of LP-379-a and LP-371-a).
[0418] The ALK7 RNAi agents tested in this Example were fully cross-reactive across both human and mouse ALK7.
[0419] The adipose biopsies collected from the test animals were used for analysis for ALK7 expression and additional biological parameters. ALK7 mRNA expression levels were quantified via qPCR, using mARL1 as the endogenous control gene, normalized to saline control Group 1. The data are shown in the following Table 39.
TABLE-US-00046 TABLE 39 ALK7 expression in mice adipose tissues of Example 17. Day 15 iWAT pgWAT Rel Exp Error Error Rel Exp Error Error Group ID ALK7 Low High ALK7 Low High 1. Saline 1.000 0.277 0.383 1.000 0.194 0.241 2. 1.5 mg/kg AC005824 0.266 0.055 0.069 0.277 0.050 0.062 3. 1.5 mg/kg AC006643 0.348 0.034 0.037 0.296 0.063 0.081 4. 1.5 mg/kg AC006644 0.355 0.051 0.059 0.317 0.040 0.046 5. 1.5 mg/kg AC006645 0.366 0.058 0.069 0.321 0.064 0.079 6. 1.5 mg/kg AC006646 0.365 0.076 0.096 0.344 0.034 0.038 7. 1.5 mg/kg AC006647 0.222 0.057 0.076 0.175 0.059 0.088 8. 1.5 mg/kg AC006648 0.246 0.038 0.045 0.170 0.046 0.063 9. 1.5 mg/kg AC006649 0.246 0.060 0.079 0.223 0.034 0.040 10. 1.5 mg/kg AC006650 0.313 0.070 0.091 0.318 0.086 0.119 11. 1.5 mg/kg AC006651 0.317 0.048 0.057 0.343 0.075 0.096 12. 1.5 mg/kg AC006652 0.387 0.076 0.094 0.367 0.054 0.063 13. 1.5 mg/kg AC006653 0.318 0.043 0.049 0.364 0.063 0.076
[0420] Groups 2-13 showed reduction in ALK7 in mice iWAT and pgWAT at all time points compared to the saline control Group 1. In particular, AC006647 achieved substantial inhibition (0.222, 78% knockdown) on Day 15 in iWAT after a single subcutaneous administration of 1.5 mg/kg. Additionally, AC006648 achieved substantial inhibition (0.170, 83% knockdown) on Day 15 in pgWAT after a single subcutaneous administration of 1.5 mg/kg.
Example 18. In Vivo Administration of ALK7 RNAi Agents in Mice
[0421] ALK7 RNAi agents were tested in vivo in mice. On Day 1, five (n=5) female C57bl/6 mice in each group were dosed with either isotonic saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen is in accordance with Table 40 below.
TABLE-US-00047 TABLE 40 Dosing for mice of Example 18. # of Animals Group Dose (RNAi Agent) Dosing Route (n=) 1 Saline Day 1 SQ Injection n = 5 2 1.5 mg/kg AC005824 Day 1 SQ Injection n = 5 3 1.5 mg/kg AC007027 Day 1 SQ Injection n = 5 4 1.5 mg/kg AC007028 Day 1 SQ Injection n = 5 5 1.5 mg/kg AC007029 Day 1 SQ Injection n = 5 6 1.5 mg/kg AC007030 Day 1 SQ Injection n = 5
[0422] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight.
[0423] On Day 15, adipose tissues were harvested from the mice test animals. Specifically, inguinal white adipose tissue (iWAT) and perigonadal white adipose tissue (pgWAT) were collected for analysis.
[0424] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end and the 3 terminal end of the sense strand to a lipid moiety having the modified sequences as set forth in the duplex structures herein (see Tables 3, 6, 6a, 8, 9, and 10, for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structures of LP-379-a and LP-371-a).
[0425] The ALK7 RNAi agents tested in this Example were fully cross-reactive across both human and mouse ALK7.
[0426] The adipose biopsies collected from the test animals were used for analysis for ALK7 expression and additional biological parameters. ALK7 mRNA expression levels were quantified via qPCR, using mARL1 as the endogenous control gene, normalized to saline control Group 1. The data are shown in the following Table 41.
TABLE-US-00048 TABLE 41 ALK7 expression in mice adipose tissues of Example 18. Day 15 iWAT pgWAT Rel Exp Error Error Rel Exp Error Error Group ID ALK7 Low High ALK7 Low High 1. Saline 1.000 0.190 0.234 1.000 0.201 0.252 2. 1.5 mg/kg AC005824 0.395 0.094 0.124 0.250 0.062 0.083 3. 1.5 mg/kg AC007027 0.394 0.090 0.117 0.293 0.084 0.118 4. 1.5 mg/kg AC007028 0.377 0.107 0.149 0.342 0.089 0.121 5. 1.5 mg/kg AC007029 0.326 0.077 0.101 0.321 0.096 0.136 6. 1.5 mg/kg AC007030 0.262 0.043 0.051 0.299 0.102 0.154
[0427] Groups 2-6 showed reduction in ALK7 in mice iWAT and pgWAT at all time points compared to the saline control Group 1. In particular, AC007030 achieved substantial inhibition (0.262, 74% knockdown) on Day 15 in iWAT after a single subcutaneous administration of 1.5 mg/kg. Additionally, AC005824 achieved substantial inhibition (0.250, 75% knockdown) on Day 15 in pgWAT after a single subcutaneous administration of 1.5 mg/kg.
Example 19. In Vivo Administration of ALK7RNAi Agents in Mice
[0428] ALK7 RNAi agents were tested in vivo in mice. On Day 1, five (n=5) female C57bl/6 mice in each group were dosed with either isotonic saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen is in accordance with Table 42 below.
TABLE-US-00049 TABLE 42 Dosing for mice of Example 19. # of Animals Group Dose (RNAi Agent) Dosing Route (n=) 1 Saline Day 1 SQ Injection n = 5 2 1.5 mg/kg AC005823 Day 1 SQ Injection n = 5 3 1.5 mg/kg AC006654 Day 1 SQ Injection n = 5 4 1.5 mg/kg AC006655 Day 1 SQ Injection n = 5 5 1.5 mg/kg AC006656 Day 1 SQ Injection n = 5 6 1.5 mg/kg AC006657 Day 1 SQ Injection n = 5 7 1.5 mg/kg AC006658 Day 1 SQ Injection n = 5 8 1.5 mg/kg AC006659 Day 1 SQ Injection n = 5 9 1.5 mg/kg AC006660 Day 1 SQ Injection n = 5 10 1.5 mg/kg AC006661 Day 1 SQ Injection n = 5 11 1.5 mg/kg AC006662 Day 1 SQ Injection n = 5 12 1.5 mg/kg AC006663 Day 1 SQ Injection n = 5 13 1.5 mg/kg AC006664 Day 1 SQ Injection n = 5 14 1.5 mg/kg AC006665 Day 1 SQ Injection n = 5
[0429] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight.
[0430] On Day 15, adipose tissues were harvested from the mice test animals. Specifically, inguinal white adipose tissue (iWAT) and perigonadal white adipose tissue (pgWAT) were collected for analysis.
[0431] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end and the 3 terminal end of the sense strand to a lipid moiety having the modified sequences as set forth in the duplex structures herein (see Tables 3, 6, 6a, 8, 9, and 10, for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structures of LP-379-a and LP-371-a).
[0432] The ALK7 RNAi agents tested in this Example were fully cross-reactive across both human and mouse ALK7 genes.
[0433] The adipose biopsies collected from the test animals were used for analysis for ALK7 expression and additional biological parameters. ALK7 mRNA expression levels were quantified via qPCR, using mARL1 as the endogenous control gene, normalized to saline control Group 1. The data are shown in the following Table 43.
TABLE-US-00050 TABLE 43 ALK7 expression in mice adipose tissues of Example 19. Day 15 iWAT pgWAT Rel Exp Error Error Rel Exp Error Error Group ID ALK7 Low High ALK7 Low High 1. Saline 1.000 0.215 0.273 1.000 0.206 0.259 2. 1.5 mg/kg AC005823 0.379 0.053 0.061 0.235 0.036 0.043 3. 1.5 mg/kg AC006654 0.359 0.086 0.113 0.279 0.033 0.037 4. 1.5 mg/kg AC006655 0.266 0.067 0.090 0.238 0.073 0.106 5. 1.5 mg/kg AC006656 0.300 0.044 0.052 0.329 0.056 0.067 6. 1.5 mg/kg AC006657 0.297 0.048 0.057 0.282 0.028 0.031 7. 1.5 mg/kg AC006658 0.301 0.053 0.064 0.291 0.062 0.079 8. 1.5 mg/kg AC006659 0.273 0.052 0.064 0.299 0.182 0.463 9. 1.5 mg/kg AC006660 0.292 0.041 0.048 0.260 0.059 0.077 10. 1.5 mg/kg AC006661 0.272 0.073 0.100 0.223 0.057 0.077 11. 1.5 mg/kg AC006662 0.289 0.046 0.055 0.269 0.073 0.100 12. 1.5 mg/kg AC006663 0.220 0.047 0.059 0.243 0.069 0.097 13. 1.5 mg/kg AC006664 0.278 0.070 0.093 0.420 0.090 0.115 14. 1.5 mg/kg AC006665 0.344 0.056 0.068 0.405 0.041 0.045
[0434] Groups 2-14 showed reduction in ALK7 in mice iWAT and pgWAT at all time points compared to the saline control Group 1. In particular, AC006663 achieved substantial inhibition (0.220, 78% knockdown) on Day 15 in iWAT after a single subcutaneous administration of 1.5 mg/kg. Additionally, AC006661 achieved substantial inhibition (0.223, 78% knockdown) on Day 15 in pgWAT after a single subcutaneous administration of 1.5 mg/kg.
Example 20. In Vivo Administration of ALK7 RNAi Agents in DIO Mice with GLP-1 Agonist
[0435] ALK7 RNAi agents, GLP-1 agonists and combinations thereof were tested in an obese mouse DIO mouse model. Mice were dosed according to the dosing groups shown in Table 44, below.
TABLE-US-00051 TABLE 44 Dosing groups for mice of Example 20. Group Dose (RNAi Agent) Dosing Route # of Animals (n=) 1 Saline Weekly SQ n = 10 administration 2 3 mg/kg AC005181 Weekly SQ n = 10 administration 3 3 mg/kg AC005181, Weekly SQ n = 10 0.21 mpk administration of tirzepatide AC005181, daily administration of tirzepatide 4 3 mg/kg AC005181, Weekly SQ n = 10 0.14 mpk administration of tirzepatide AC005181, daily administration of tirzepatide 5 3 mg/kg AC005181, Weekly SQ n = 10 0.07 mpk administration of tirzepatide AC005181, daily administration of tirzepatide 6 0.21 mpk tirzepatide Daily administration n = 10 7 0.14 mpk tirzepatide Daily administration n = 10 8 0.07 mpk tirzepatide Daily administration n = 10
[0436] AC005181 is an RNAi agent specific to mouse ALK7. On study day 22. body weights for each animal were measured, and body weight for each animal was measured weekly thereafter. On study days 22, 29, 57, 85, 113, and 141, animals were fasted for 6 hours before being bled to collect serum. Animals were harvested on study day 152. Average body weights for groups 2, 5, 6 and 8 are shown in
[0437] These data demonstrate that co-administration of an ALK7 RNAi agent with a GLP-1 agonist such as tirzepatide may be more effective than either therapeutic alone in reducing body weight. Furthermore, a smaller dose of a GLP-1 agonist in combination with an ALK7 RNAi agent may be effective at retaining more lean mass (muscle) while reducing fat mass.
Example 21. In Vivo Administration of an ALK7RNAi Agent in Cynomolgus Monkeys
[0438] ALK7 RNAi agents were tested in Cynomolgus monkeys for inhibition of ALK7. On Day 1, four (n=4) male Cynomolgus monkeys for each test group were dosed with ALK7 RNAi agents formulated in saline (at 0.75, 1.5, or 3.0 mg/kg), via subcutaneous (SQ) injection with syringe and needle in the mid-scapular region, at 0.3 mL/kg dose volume. Adipose biopsies were collected from all test animals on Day 12 (pre-dose), 15, 29, 57, 85, 113, 141, and 169. The dosing regimen was in accordance with Table 45 below.
TABLE-US-00052 TABLE 45 Dosing for test animals of Example 21. Study # of Dose Group Material Animals Dosing Route Volume 1 Saline n = 4 Day 1 SQ Injection 0.3 mL/kg 2 0.75 mg/kg n = 4 Day 1 SQ Injection 0.3 mL/kg AC006188 3 1.5 mg/kg n = 4 Day 1 SQ Injection 0.3 mL/kg AC006188 4 3.0 mg/kg n = 4 Day 1 SQ Injection 0.3 mL/kg AC006188
[0439] All animals were fasted for at least 12 hours but less than 18 hours for scheduled blood collections and biopsy procedures. Blood collection site was femoral vein. A saphenous vein (not used for dose administration) may be used as an alternative collection site.
[0440] Adipose biopsies were collected as a sedated procedure. Sedation was accomplished using Telazol (4-8 mg/kg), administered as an intramuscular (IM) injection and supplemented with Ketamine (5 mg/kg) as needed.
[0441] An approximate 3-5 cm skin incision was made followed by collection of adipose tissue (optimally 50-150 mg). The skin will then be closed in a routine manner using suture (or alternate) materials maintaining aseptic technique.
[0442] Each biopsy site was separated by at least 1-2 cm. Biopsies were separated into 2 pieces (one piece of 25 to 75 mg and second piece of 25-75 mg) for each collection time point. Analgesics may be administered at veterinarian's discretion.
[0443] Blood was collected into tubes containing no anticoagulant (serum separator tubes). Blood was allowed to clot at ambient temperature prior to centrifugation to obtain serum.
[0444] Blood was collected on Day 12, 1, 15, 29, 57, 85, 113, 141, and 169 prior to biopsy sample collections or dose administration (when applicable), and from any animals found in moribund condition or sacrificed at an unscheduled interval. Samples may be further collected at additional timepoints. Should there be any additional collected samples at other timepoints, their corresponding relevant data are shown below.
[0445] Individual doses of ALK7 RNAi agents were calculated based on the body weights recorded on each day of dosing.
[0446] The adipose biopsies and serum collected from the test animals were used for analysis for ALK7 expression and additional biological parameters. ALK7 mRNA expression levels in WAT (from biopsy) were quantified via qPCR, using cARL1 as the endogenous control gene, normalized to Day 12 pre-dose. Results from the WAT tissue biopsy knockdown are shown in Table 46, below.
[0447] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end and the 3 terminal end of the sense strand to a lipid moiety having the modified sequences as set forth in the duplex structures herein (see Tables 3, 6, 6a, 8, 9, and 10, for specific modifications and structure information related to the ALK7 RNAi agent; see Table 11 for structures of LP-3079-a and LP-371-a).
TABLE-US-00053 TABLE 46 Average expression of ALK7 in cynomolgus monkeys in WAT relative to saline control, of Example 21. Day 15 Day 29 Rel. Exp. Error Error Rel. Exp. Error Error Group ID cALK7 Low High cALK7 Low High 1. Saline 1.423 0.606 1.057 0.981 0.726 2.795 2. 0.75 mg/kg 0.207 0.095 0.175 0.161 0.066 0.111 AC006188 3. 1.5 mg/kg 0.095 0.054 0.124 0.150 0.048 0.071 AC006188 4. 3.0 mg/kg 0.154 0.070 0.130 0.111 0.034 0.049 AC006188 Day 57 Day 85 Rel. Exp. Error Error Rel. Exp. Error Error Group ID cALK7 Low High cALK7 Low High 1. Saline 2.031 0.762 1.220 1.731 0.614 0.952 2. 0.75 mg/kg 0.224 0.061 0.083 0.205 0.048 0.063 AC006188 3. 1.5 mg/kg 0.221 0.067 0.095 0.251 0.099 0.165 AC006188 4. 3.0 mg/kg 0.189 0.026 0.030 0.214 0.067 0.097 AC006188 Day 113 Day 134 Rel. Exp. Error Error Rel. Exp. Error Error Group ID cALK7 Low High cALK7 Low High 1. Saline 2.511 0.862 1.312 1.902 0.727 1.177 2. 0.75 mg/kg 0.236 0.072 0.104 ND* ND* ND* AC006188 3. 1.5 mg/kg 0.350 0.037 0.042 ND* ND* ND* AC006188 4. 3.0 mg/kg 0.312 0.135 0.239 0.328 0.134 0.226 AC006188 Day 141 Day 169 Rel. Exp. Error Error Rel. Exp. Error Error Group ID cALK7 Low High cALK7 Low High 1. Saline ND* ND* ND* ND* ND* ND* 2. 0.75 mg/kg 0.898 0.455 0.922 0.331 0.107 0.158 AC006188 3. 1.5 mg/kg 0.552 0.224 0.378 0.397 0.082 0.104 AC006188 4. 3.0 mg/kg ND* ND* ND* ND* ND* ND* AC006188 *Groups 1 and 4 were terminated on Day 134. Groups 2 and 3 continued with the planned collection days.
[0448] ALK7 RNAi agent AC006188 achieved inhibition of ALK7 at all time points. A dose-response was observed at Day 29, 57, and 141. These data show a generally dose-dependent knockdown of ALK7 with AC006188, with expression of ALK7 being inhibited at all dose levels even as long as Day 169 from a single dose.
Example 22. Phase 1/2A Clinical Study of ALK7 RNAi Agents in Adult Volunteers with Obesity with and without Type 2 Diabetes Mellitus
[0449] ALK7 RNAi agents will be tested in human clinical trials.
[0450] Proposed Study Design: A Phase 1/2a dose-escalating study to evaluate the safety, tolerability, PK, and PD of single and multiple doses of an ALK7 RNAi agent in adult volunteers with obesity (in Part 1) and the safety, tolerability, and PD of repeat doses of an ALK7 RNAi agent in adult volunteers with obesity with and without type 2 diabetes mellitus receiving tirzepatide (in Part 2). The duration of study participation will be approximately 24-32 weeks, from the beginning of the 56-day Screening period to the end of study (Day 113 or 169 for Part 1, and Day 169 for Part 2). The Study Schema for the proposed study are set forth in
Summary of Proposed Part 1
[0451] Proposed Part 1A of the study will evaluate single ascending doses (SAD) of ALK7 RNAi agent in volunteers with obesity in Cohorts 1a, 2a, 3a, and 4a, to enroll 6 subjects in each cohort to be randomized with 4 subjects administered the ALK7 RNAi agent and 2 subjects administered placebo (PBO). Proposed Part 1B will evaluate multiple ascending doses (MAD) of ALK7 RNAi agent in volunteers with obesity in Cohorts 2b, 3b, and 4b, to also enroll 6 subjects in each cohort to be randomized with 4 subjects administered the ALK7 RNAi agent and 2 subjects administered placebo (PBO). Subcutaneous adipose tissue biopsies will be obtained at several timepoints for assessment of PD. Eligible subjects for Part 1 of the proposed study will include adult non-pregnant, non-lactating subjects, between 18-65 years old, with obesity (BMI 30-50 kg/m2), without evidence of Type 2 Diabetes at Screening (confirmed by laboratory assessment), stable weight at the time of Screening (no increase or decrease in weight >5% in the preceding 3 months), and at least one self-reported unsuccessful attempt at weight loss with lifestyle modification.
Summary of Proposed Part 2
[0452] Proposed Part 2 of the study will evaluate repeat doses of ALK7 RNAi agent in subjects with obesity with and without Type 2 Diabetes Mellitus also receiving tirzepatide. Each of Cohorts 5A and 5B of proposed Part 2 of the study will enroll and randomize 12 subjects with obesity without Type 2 Diabetes Mellitus, with 8 subjects administered the ALK7 RNAi agent and 4 subjects administered placebo (PBO). Cohort 5C will enroll and randomize 12 subjects with obesity with Type 2 Diabetes Mellitus, with 8 subjects administered the ALK7 RNAi agent and 4 subjects administered placebo (PBO). As shown in
[0453] Eligible subjects for Part 2 of the study, subject to certain additional exclusion criteria, will include adult non-pregnant, non-lactating subjects, between 18-65 years old, with obesity (BMI 30-50 kg/m2), either with [Cohort 5C] or without [Cohorts 5A, 5B] Type 2 Diabetes Miletus (T2DM), stable weight at the time of screening (no increase or decrease in weight >5% in the preceding 3 months), and at least one self-reported unsuccessful attempt at weight loss with lifestyle modification.
Example 23. In Vivo Administration of ALK7 RNAi Agents in ALK7-Gluc-AAV Mice
[0454] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, six (n=6) male C57bl/6 mice in each group were dosed with 410{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 47 below.
TABLE-US-00054 TABLE 47 Dosing Groups of Example 23. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n =) 1 Saline N/A Day 1 SQ Injection n = 6 2 AC005864 1.5 mg/kg Day 1 SQ Injection n = 6 3 AC007199 1.5 mg/kg Day 1 SQ Injection n = 6 4 AC007200 1.5 mg/kg Day 1 SQ Injection n = 6 5 AC007201 1.5 mg/kg Day 1 SQ Injection n = 6 6 AC004201 1.5 mg/kg Day 1 SQ Injection n = 6 7 AC007202 1.5 mg/kg Day 1 SQ Injection n = 6 8 AC007203 1.5 mg/kg Day 1 SQ Injection n = 6 9 AC007204 1.5 mg/kg Day 1 SQ Injection n = 6
[0455] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0456] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0457] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 48, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00055 TABLE 48 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 23. Day 1 Day 8 Day 15 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.000 1.000 0.225 1.000 0.224 2. 1.5 mg/kg AC005864 1.000 0.000 0.311 0.041 0.243 0.054 3. 1.5 mg/kg AC007199 1.000 0.000 0.285 0.077 0.336 0.068 4. 1.5 mg/kg AC007200 1.000 0.000 0.238 0.069 0.160 0.037 5. 1.5 mg/kg AC007201 1.000 0.000 0.395 0.142 0.337 0.120 6. 1.5 mg/kg AC004201 1.000 0.000 0.324 0.090 0.255 0.057 7. 1.5 mg/kg AC007202 1.000 0.000 0.286 0.109 0.236 0.092 8. 1.5 mg/kg AC007203 1.000 0.000 0.187 0.032 0.191 0.039 9. 1.5 mg/kg AC007204 1.000 0.000 0.199 0.069 0.191 0.041
[0458] Groups 2-9 showed reduction in ALK7-GLuc at all time points (Day 8 and Day 15) compared to the saline control Group 1. In particular, AC007200 achieved 84% inhibition (0.160) at 1.5 mg/kg on Day 15.
Example 24. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0459] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, six (n=6) male C57bl/6 mice in each group were dosed with 410{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 49 below.
TABLE-US-00056 TABLE 49 Dosing Groups of Example 24. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n =) 1 Saline N/A Day 1 SQ Injection n = 6 2 AC005847 1.5 mg/kg Day 1 SQ Injection n = 6 3 AC008318 1.5 mg/kg Day 1 SQ Injection n = 6 4 AC008319 1.5 mg/kg Day 1 SQ Injection n = 6 5 AC008320 1.5 mg/kg Day 1 SQ Injection n = 6 6 AC008321 1.5 mg/kg Day 1 SQ Injection n = 6 7 AC008322 1.5 mg/kg Day 1 SQ Injection n = 6 8 AC008323 1.5 mg/kg Day 1 SQ Injection n = 6 9 AC008324 1.5 mg/kg Day 1 SQ Injection n = 6 10 AC008325 1.5 mg/kg Day 1 SQ Injection n = 6
[0460] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0461] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0462] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 50, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00057 TABLE 50 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 24. Day 1 Day 8 Day 15 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.000 1.000 0.111 1.000 0.167 2. 1.5 mg/kg AC005847 1.000 0.000 0.135 0.050 0.079 0.029 3. 1.5 mg/kg AC008318 1.000 0.000 0.170 0.048 0.146 0.055 4. 1.5 mg/kg AC008319 1.000 0.000 0.235 0.046 0.146 0.037 5. 1.5 mg/kg AC008320 1.000 0.000 0.180 0.046 0.144 0.052 6. 1.5 mg/kg AC008321 1.000 0.000 0.301 0.049 0.248 0.027 7. 1.5 mg/kg AC008322 1.000 0.000 0.247 0.082 0.230 0.078 8. 1.5 mg/kg AC008323 1.000 0.000 0.476 0.097 0.524 0.080 9. 1.5 mg/kg AC008324 1.000 0.000 0.224 0.046 0.161 0.023 10. 1.5 mg/kg AC008325 1.000 0.000 0.144 0.044 0.145 0.042
[0463] Groups 2-10 showed reduction in ALK7-GLuc at all time points (Day 8 and Day 15) compared to the saline control Group 1. In particular, AC005847 achieved 92% inhibition (0.079) at 1.5 mg/kg on Day 15.
Example 25. In Vivo Administration of ALK7RNAi Agents in ALK7-Gluc-AAV Mice
[0464] The ALK7-GLuc-AAV model as described in Example 6, above, was used. On Day 21, five (n=5) male C57bl/6 mice in each group were dosed with 410{circumflex over ()}12 GC/kg ALK7-GLuc AAV8, via intravenous IV injection, at 250 L per 25 g body weight injection volume. On Day 1, the mice were dosed with either saline or ALK7 RNAi agents formulated in saline (at 0.25, 0.5, or 1.5 mg/kg), via subcutaneous (SQ) injection, at 250 L per 25 g body weight injection volume. The dosing regimen was in accordance with Table 51 below.
TABLE-US-00058 TABLE 51 Dosing Groups of Example 25. Group # of Animals ID RNAi Agent Dose Dosing Regimen (n=) 1 Saline N/A Day 1 SQ Injection n = 5 2 AC004201 0.25 mg/kg Day 1 SQ Injection n = 5 3 AC004201 0.5 mg/kg Day 1 SQ Injection n = 5 4 AC004201 1.5 mg/kg Day 1 SQ Injection n = 5 5 AC006746 0.25 mg/kg Day 1 SQ Injection n = 5 6 AC006746 0.5 mg/kg Day 1 SQ Injection n = 5 7 AC006746 1.5 mg/kg Day 1 SQ Injection n = 5 8 AC006305 0.25 mg/kg Day 1 SQ Injection n = 5 9 AC006305 0.5 mg/kg Day 1 SQ Injection n = 5 10 AC006305 1.5 mg/kg Day 1 SQ Injection n = 5
[0465] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Animals were weighed prior to dosing, and the dosing volume was individually adjusted based on the animal body weight. On Day 7, 1, 8, 15, and 22 post injection, serum was collected.
[0466] Each of the ALK7 RNAi agents included modified nucleotides that were conjugated at the 5 terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein (see Tables 3, 4, 5, 6, 7A, 7B, and 8 for specific modifications and structure information related to the ALK7 RNAi agents; see Table 11 for structure of (NAG37) and (NAG37)s ligand).
[0467] GLuc levels were determined pursuant to the procedure set forth in Example 6, above. Data from the experiment are shown in the following Table 52, with average GLuc reflecting the normalized average value of GLuc. Inhibition of ALK7 expression by an ALK7 RNAi agent results in concomitant inhibition of GLuc expression, which is measured.
TABLE-US-00059 TABLE 52 Average GLuc normalized to pre-treatment and saline control in ALK7-Gluc AAV mice of Example 25. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std Group ID GLuc Dev GLuc Dev GLuc Dev 1. Saline 1.000 0.151 1.000 0.220 1.000 0.112 2. 0.25 mg/kg AC004201 0.882 0.266 0.751 0.371 0.701 0.262 3. 0.5 mg/kg AC004201 0.502 0.190 0.433 0.146 0.405 0.195 4. 1.5 mg/kg AC004201 0.344 0.072 0.291 0.078 0.293 0.080 5. 0.25 mg/kg AC006746 0.849 0.205 0.781 0.215 0.721 0.162 6. 0.5 mg/kg AC006746 0.558 0.220 0.485 0.110 0.428 0.166 7. 1.5 mg/kg AC006746 0.326 0.063 0.307 0.072 0.319 0.047 8. 0.25 mg/kg AC006305 0.566 0.064 0.677 0.134 0.639 0.099 9. 0.5 mg/kg AC006305 0.421 0.086 0.435 0.095 0.438 0.122 10. 1.5 mg/kg AC006305 0.271 0.034 0.231 0.043 0.236 0.010
[0468] Groups 2-10 showed reduction in ALK7-GLuc at all time points (Day 8, Day 15, and Day 22) compared to the saline control Group 1. In particular, AC006305 achieved 77% inhibition (0.231) at 1.5 mg/kg on Day 15. A dose-response was observed for AC004201, AC006746, and AC006305 at all time points (Day 8, Day 15, and Day 22).
Other Embodiments
[0469] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.