FLOW CELLS AND METHODS
20250207123 ยท 2025-06-26
Inventors
- Gianluca Andrea Artioli (Cambridge, GB)
- Johan Sebastian BASUKI (Singapore, SG)
- Craig Ciesla (Mountain View, CA, US)
- Tyler J. Dill (San Diego, CA, US)
- Louise Jane Fraser (Great Cambourne, GB)
- Niall Anthony Gormley (Cambridge, GB)
- Yuan Heng Trevor Ho (Cambridge, GB)
- Aathavan Karunakaran (Berkeley, CA, US)
- Maria Ines Martins Vitoriano (Baldock, GB)
- Jessica Moore (Canvey Island, GB)
- Sebastien Georg Gabriel Ricoult (Cambridge, GB)
- Vicki S. Thomson (Cambridge, GB)
- Xavier von Hatten (Cambridge, GB)
- Jacqueline C. Weir (Cambridge, GB)
Cpc classification
C12N15/1065
CHEMISTRY; METALLURGY
B01L2200/0647
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/047
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0893
PERFORMING OPERATIONS; TRANSPORTING
C12N15/1093
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
B01L3/502761
PERFORMING OPERATIONS; TRANSPORTING
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
An example of a flow cell includes a substrate having depressions separated by interstitial regions: a polymeric hydrogel positioned within each of the depressions; and a plurality of transposome complexes immobilized within each of the depressions by a biotin-containing linker. In this example, each of the plurality of the transposome complexes is of a single type including a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand, wherein the transferred strand includes a first amplification domain and is free of an index sequence.
Claims
1. A flow cell, comprising: a substrate having depressions separated by interstitial regions; a polymeric hydrogel positioned within each of the depressions; and a plurality of transposome complexes immobilized within each of the depressions by a biotin-containing linker, each of the plurality of the transposome complexes being of a single type including a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand, wherein the transferred strand includes a first amplification domain and is free of an index sequence.
2. The flow cell as defined in claim 1, wherein the non-transferred strand consists of the portion hybridized to the portion of the transferred strand.
3. The flow cell as defined in claim 1 or claim 2, further comprising a first primer and a second primer immobilized within each of the depressions by respective second biotin-containing linkers, and wherein: the first primer corresponds with the first amplification domain; and the second primer has a sequence that is complementary to a second amplification domain of an adapter that is to be hybridized to a portion of the transferred strand.
4. The flow cell as defined in claim 1, wherein: the transferred strand and the non-transferred strand form a forked adapter; and the non-transferred strand further includes a sequencing primer sequence, an index sequence, and a second amplification domain that is complementary to a primer that is to be immobilized within each of the depressions of the flow cell.
5. The flow cell as defined in claim 1, further comprising a first primer and a second primer immobilized within each of the depressions by respective second biotin-containing linkers, wherein: the first primer corresponds with the first amplification domain; the transferred strand and the non-transferred strand form a forked adapter; and the non-transferred strand further includes a sequencing primer sequence, an index sequence, and a second amplification domain that is complementary to the second primer.
6. A tagmentation kit, comprising: a flow cell including: a substrate having depressions separated by interstitial regions; and a plurality of transposome complexes immobilized within each of the depressions by a biotin-containing linker, each of the plurality of the transposome complexes being of a single type including a transposon end with a portion of a transferred strand hybridized to a non-transferred strand, wherein the transferred strand includes a first amplification domain; and an adapter fluid including: a carrier fluid; and an adapter including: a sequence complementary to the portion of the transferred strand of each of the plurality of transposome complexes; a sequencing primer sequence; an index sequence; and a second amplification domain that is complementary to a primer that is to be immobilized within each of the depressions of the flow cell.
7. The tagmentation kit as defined in claim 6, further comprising a grafting fluid including: a second carrier fluid; a first primer; and a second primer that is complementary to the second amplification domain, each of the first and second primers having a second biotin-containing linker at its 5 end.
8. The tagmentation kit as defined in claim 6, wherein the flow cell further includes: a first primer; and a second primer that is complementary to the second amplification domain, each of the first and second primers immobilized within each of the depressions by a second biotin-containing linker at its 5 end.
9. A tagmentation kit, comprising: a flow cell including: a substrate having depressions separated by interstitial regions; and a plurality of transposome complexes immobilized within each of the depressions by a biotin-containing linker, each of the plurality of the transposome complexes being of a single type including a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand to form a forked adapter, wherein the transferred strand includes a first amplification domain, a sequencing primer sequence, an index sequence, and a second amplification domain that is complementary to a primer that is to be immobilized within each of the depressions of the flow cell; and a grafting fluid including: a carrier fluid; a first primer; and a second primer that is complementary to the second amplification domain, each of the first and second primers having a second biotin-containing linker at its 5 end.
10. A method, comprising: generating at least partially adapted DNA sample fragments on a flow cell using a plurality of transposome complexes attached to a surface of the flow cell within a flow channel by a biotin-containing linker; cleaving the at least partially adapted DNA sample fragments such that the biotin-containing linkers remain attached to the surface; and one of: using the flow cell for a subsequent cycle of generating at least partially adapted DNA sample fragments; or using the flow cell to amplify at least some of the previously cleaved and at least partially adapted DNA sample fragments.
11. The method as defined in claim 10, wherein: each of the plurality of the transposome complexes is of a single type including a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand to form a forked adapter, wherein the transferred strand includes a first amplification domain, and wherein the non-transferred strand further includes a sequencing primer sequence, an index sequence, and a second amplification domain that is complementary to a primer that is or is to be immobilized within each of the depressions of the flow cell; each of the at least partially adapted DNA sample fragments is a fully adapted DNA sample fragment; and generating the fully adapted DNA sample fragments includes: introducing a DNA sample and a tagmentation buffer to the flow cell; performing tagmentation of the DNA sample using the plurality of transposome complexes; removing a transposase enzyme of each of the plurality of transposome complexes; and performing gap fill ligation to attach the DNA sample fragments to respective adapters.
12. The method as defined in claim 11, wherein after cleaving the fully adapted DNA sample fragments such that the biotin-containing linker remains attached to the surface and prior to using the flow cell, the method further comprises removing streptavidin from the biotin-containing linker.
13. The method as defined in any one of claim 10 through claim 12, wherein the flow cell is used for the subsequent cycle of generating at least partially adapted DNA sample fragments, and wherein the subsequent cycle of generating at least partially adapted DNA sample fragments involves: introducing a new plurality of the transposome complexes into the flow channel, whereby at least some of the new plurality of the transposome complexes attach to at least some of the biotin-containing linkers within the flow channel; introducing a new DNA sample and a new tagmentation buffer to the flow channel; and repeating the tagmentation, transposase enzyme removal, and gap fill ligation with the new DNA sample.
14. The method as defined in claim 11 or claim 12, wherein the flow cell is used for the amplification of the previously cleaved and fully adapted DNA sample fragments, and wherein the amplification of the previously cleaved and fully adapted DNA sample fragments involves: attaching first and second primers to at least some of the biotin-containing linkers within the flow channel; and introducing single stranded forms of the previously cleaved and fully adapted DNA sample fragments into the flow cell.
15. The method as defined in claim 10, wherein: each of the plurality of the transposome complexes is of a single type including a transposon end with a portion of a transferred strand hybridized to a non-transferred strand; the transferred strand includes a first amplification domain; each of the at least partially adapted DNA sample fragments is a fully adapted DNA sample fragment; and generating the fully adapted DNA sample fragments includes: introducing a DNA sample and a tagmentation buffer to the flow channel; performing tagmentation of the DNA sample using the plurality of transposome complexes; removing a transposase enzyme of each of the plurality of transposome complexes; and replacing the non-transferred strand of each of the plurality of transposome complexes with an adapter including: a sequence complementary to the portion of the transferred strand; a sequencing primer sequence; an index sequence; and a second amplification domain that is complementary to a primer that is or is to be immobilized within each of the depressions of the flow cell, thereby dehybridizing the non-transferred strand and hybridizing the adapter to the portion of the transferred strand of each of the plurality of transposome complexes; and performing gap fill ligation to attach the DNA sample fragments to respective adapters.
16. The method as defined in claim 15, wherein after cleaving the fully adapted DNA sample fragments such that the biotin-containing linker remains attached to the surface and prior to using the flow cell, the method further comprises removing streptavidin from the biotin-containing linker.
17. The method as defined in claim 15 or claim 16, wherein the flow cell is used for the subsequent cycle of generating at least partially adapted DNA sample fragments, and wherein the subsequent cycle of generating fully adapted DNA sample fragments includes: introducing a new plurality of the transposome complexes into the flow channel, whereby at least some of the new plurality of the transposome complexes attach to at least some of the biotin-containing linkers within the flow channel; introducing a new DNA sample and a new tagmentation buffer to the flow channel; and repeating the tagmentation, transposase enzyme removal, replacement of the non-transferred strand with the adapter, and gap fill ligation with the new DNA sample.
18. The method as defined in claim 15 or claim 16, wherein the flow cell is used for the amplification of the previously cleaved and fully adapted DNA sample fragments, and wherein the amplification of the previously cleaved and fully adapted DNA sample fragments involves: attaching first and second primers to at least some of the biotin-containing linkers within the flow channel; and introducing single stranded forms of the previously cleaved and fully adapted DNA sample fragments into the flow cell.
19. The method as defined in claim 10, wherein: the plurality of the transposome complexes includes first transposome complexes including a first amplification domain and second transposome complexes including a second amplification domain; each of the at least partially adapted DNA sample fragments is a fully adapted DNA sample fragment; and generating the fully adapted DNA sample fragments includes: introducing a DNA sample and a tagmentation buffer to the flow cell; performing tagmentation of the DNA sample using the plurality of transposome complexes; removing a transposase enzyme of each of the plurality of transposome complexes; and performing an extension reaction.
20. The method as defined in claim 19, wherein some of the fully adapted DNA sample fragments include a targeted region, and wherein after cleaving the fully adapted DNA sample fragments, the method further comprises generating an enriched sample by: denaturing the fully adapted DNA sample fragments to generate single stranded fully adapted DNA sample fragments, wherein some of the single stranded fully adapted DNA sample fragments include the targeted region; transporting the single stranded fully adapted DNA sample fragments to an enrichment receptacle on the flow cell; and introducing biotinylated capture probes to the enrichment receptacle, whereby the some of the single stranded fully adapted DNA sample fragments with the targeted region respectively hybridize to the biotinylated capture probes to form enriched complexes, and some other of the single stranded fully adapted DNA sample fragments without the targeted regions remain unattached.
21. The method as defined in claim 20, further comprising: replenishing streptavidin in the flow channel; transporting the enriched sample to the flow channel including the replenished streptavidin, whereby the enriched complexes attach to the biotin-containing linkers and the single stranded fully adapted DNA sample fragments without the targeted regions remain unattached; introducing a wash solution to the flow channel to remove the single stranded fully adapted DNA sample fragments without the targeted regions; releasing the some of the single stranded fully adapted DNA sample fragments with the targeted region from the biotinylated capture probes; and transporting the some of the single stranded fully adapted DNA sample fragments with the targeted region to a holding receptacle.
22. The method defined in claim 21, wherein while the some of the single stranded fully adapted DNA sample fragments with the targeted region are in the holding receptacle, the method further comprises removing streptavidin from the biotin-containing linker in the flow channel; and attaching first and second primers to at least some of the biotin-containing linkers within the flow channel.
23. The method defined in claim 21 or claim 22, wherein the flow cell is used for the amplification of the previously cleaved and fully adapted DNA sample fragments, and wherein the amplification of the previously cleaved and fully adapted DNA sample fragments is initiated by transporting the some of the single stranded fully adapted DNA sample fragments with the targeted region from the holding receptacle to the flow channel after the first and second primers have been attached.
24. The method as defined in claim 10, wherein: each of the plurality of the transposome complexes is of a single type including a transposon end with a portion of a transferred strand hybridized to a non-transferred strand; the transferred strand includes a first amplification domain; each of the at least partially adapted DNA sample fragments is a partially adapted DNA sample fragment; generating the partially adapted DNA sample fragments includes: introducing a DNA sample and a tagmentation buffer to the flow channel; performing tagmentation of the DNA sample using the plurality of transposome complexes; and removing a transposase enzyme of each of the plurality of transposome complexes.
25. The method as defined in claim 24, wherein after the partially adapted DNA sample fragments are cleaved, the method further comprises: denaturing the partially adapted DNA sample fragments to generate single stranded partially adapted DNA sample fragments, wherein some of the single stranded partially adapted DNA sample fragments include a targeted region; transporting the single stranded partially adapted DNA sample fragments to an enrichment receptacle on the flow cell, the enrichment receptacle including surface bound adapters having a second amplification domain and a region complementary to the targeted region, whereby the some of the single stranded partially adapted DNA sample fragments with the targeted region respectively hybridize to the surface bound adapters, and some other of the single stranded partially adapted DNA sample fragments without the targeted regions remain unattached; introducing a wash solution to the enrichment receptacle to remove the single stranded partially adapted DNA sample fragments without the targeted regions; and performing an extension reaction along the surface bound adapters, thereby generating fully adapted DNA sample fragments.
26. A method, comprising: capturing a plurality of biotinylated dDpn1 at a plurality of biotin-containing linkers attached to a surface within a flow channel of a flow cell; introducing a DNA sample to the flow cell, whereby methylated bacterial DNA within the DNA sample is captured by the biotinylated dDpn1; introducing a wash solution to the flow channel to remove uncaptured DNA sample therefrom; releasing the methylated bacterial DNA from the biotinylated dDpn1 such that the biotin-containing linker remains attached to the surface; transporting the cleaved methylated bacterial DNA to a holding receptacle; while the cleaved methylated bacterial DNA is in the holding receptacle: replenishing streptavidin from the biotin-containing linker; introducing a plurality of biotinylated transposome complexes to the flow channel, whereby the plurality of biotinylated transposome complexes attach to some of the biotin-containing linkers; and introducing a plurality of biotinylated primers to the flow channel, whereby the plurality of biotinylated primers attach to some other of the biotin-containing linkers; and transporting the cleaved methylated bacterial DNA back to the flow channel containing the biotinylated transposome complexes and the biotinylated primers.
27. A method, comprising: introducing a tagmentation entity having a first visible light responsive member attached thereto to a flow cell having a second visible light responsive member attached thereto; and exposing a predetermined area of the flow cell to visible light while the tagmentation entity is present in the flow cell, thereby coupling the first and second visible light responsive members and attaching the tagmentation entity to the flow cell at the predetermined area.
28. The method as defined in claim 27, further comprising: introducing primers having the first visible light responsive member attached thereto to the flow cell; and exposing a second predetermined area of the flow cell to visible light while the primers are present in the flow cell, thereby coupling the first and second visible light responsive members and attaching the primers to the flow cell at the second predetermined area.
29. The method as defined in claim 27 or claim 28, wherein after the tagmentation entity is coupled, the method further comprises: introducing a DNA sample to the flow cell; initiating tagmentation of the DNA sample using the coupled tagmentation entity; removing a transposase enzyme of the tagmentation entity; and coupling a second tagmentation entity, having the first visible light responsive member attached thereto, at a second predetermined area of the flow cell by: introducing the second tagmentation entity into the flow cell; and exposing the second predetermined area of the flow cell to visible light while the second tagmentation entity is present in the flow cell, thereby coupling the first and second visible light responsive members and attaching the second tagmentation entity to the flow cell at the second predetermined area.
30. The method as defined in claim 29, wherein the first and second tagmentation entities have different index sequences.
31. A kit, comprising: a flow cell including: a substrate having depressions separated by interstitial regions; and a biotinylated polymeric hydrogel positioned within each of the depressions; a transposome fluid including: a first carrier fluid; and a plurality of biotinylated transposome complexes; a grafting fluid including: a second carrier fluid; and a plurality of biotinylated amplification primers; and streptavidin.
32. The kit as defined in claim 31, further comprising biotinylated enrichment probes.
33. The kit as defined in claim 31 or claim 32, further comprising a biotin streptavidin cleavage composition.
34. The kit as defined in any one of claim 31 through claim 33, further comprising a cleaving agent that is to cleave a cleavage site of each biotinylated transposome complex.
35. The kit as defined in any one of claim 31 through claim 34, wherein: each biotinylated transposome complex is of a single type including a transposon end with a portion of a transferred strand hybridized to a non-transferred strand, wherein the transferred strand includes a first amplification domain; and the kit further comprises an adapter fluid including: a third carrier fluid; and an adapter including: a sequence complementary to the portion of the transferred strand of each of the plurality of transposome complexes; a sequencing primer sequence; an index sequence; and a second amplification domain that is complementary to one type of the plurality of biotinylated amplification primers.
36. The kit as defined in any one of claim 31 through claim 34, wherein the plurality of biotinylated transposome complexes includes: first transposome complexes including a first amplification domain that has a same sequence as one type of the plurality of biotinylated amplification primers; and second transposome complexes including a second amplification domain that has a same sequence as a second type of the plurality of biotinylated amplification primers.
37. The kit as defined in any one of claim 31 through claim 34, wherein: the plurality of biotinylated transposome complexes includes first transposome complexes including a first amplification domain that has a same sequence as one type of the plurality of biotinylated amplification primers; and the flow cell further comprises an enrichment chamber including surface bound adapters having a second amplification domain that has a same sequence as a second type of the plurality of biotinylated amplification primers and a region complementary to a target sample region.
38. A method, comprising: selectively activating a sub-set of transposome complexes in a predetermined area of a flow cell by heating the predetermined area to an activation temperature and cooling an other area of the flow cell below the activation temperature, wherein the flow cell includes: a substrate having depressions separated by interstitial regions; a polymeric hydrogel positioned within each of the depressions; and the transposome complexes respectively immobilized within each of the depressions; and introducing a DNA sample to the flow cell, whereby a portion of the DNA sample binds to and is tagmented by the sub-set of transposome complexes in the predetermined area and an other portion of the DNA sample binds to, but remains untagmented by, the transposome complexes in the other area.
39. The method as defined in claim 38, wherein the activation temperature ranges from about 20 C. to about 55 C.
40. The method as defined in claim 38 or claim 39, further comprising: removing a transposase enzyme of each of the transposome complexes, thereby releasing the other portion of the DNA sample and whereby the portion of the DNA sample remains attached in the predetermined area; washing the removed transposase enzymes and the released DNA sample from the flow cell; and introducing fresh transposase enzymes to the flow cell, thereby reforming transposome complexes in the other area.
41. The method as defined in any one of claim 38 through claim 40, wherein: a second predetermined area of the flow cell corresponds with at least a portion of the other area; and the method further comprises: selectively activating a second sub-set of transposome complexes in the second predetermined area by heating the second predetermined area to the activation temperature and cooling at least the predetermined area of the flow cell below the activation temperature; and introducing a second DNA sample to the flow cell, whereby a portion of the second DNA sample binds to and is tagmented by the second sub-set of transposome complexes in the second predetermined area.
42. A method, comprising: introducing a DNA sample to a flow cell including: a substrate having depressions separated by interstitial regions; a polymeric hydrogel positioned within each of the depressions; and transposome complexes immobilized within each of the depressions; whereby the DNA sample binds to the transposome complexes across the flow cell; introducing an encapsulated complex into the flow cell, the encapsulated complex including a catalytic metal surrounded by a coating material; and selectively releasing the catalytic metal from the encapsulated complex at a predetermined area of the flow cell by exposing the encapsulated complex to a mechanism that initiates removal of the coating material, thereby initiating tagmentation of a portion of the DNA sample in the predetermined area while leaving an other portion of the DNA sample untagmented in an other area.
43. The method as defined in claim 42, wherein the mechanism is heat and the method further comprises cooling the other area of the flow cell to prevent catalytic metal release in the other area.
44. The method as defined in claim 42, wherein the mechanism is light.
45. The method as defined in claim 42, wherein the mechanism is a change in pH.
46. The method as defined in any of claim 42 through claim 45, further comprising: removing a transposase enzyme of each of the transposome complexes, thereby releasing the other portion of the DNA sample from the other area and whereby the portion of the DNA sample remains attached in the predetermined area; washing the removed transposase enzymes and the released other portion of the DNA sample from the flow cell; and introducing fresh transposase enzymes to the flow cell, thereby reforming transposome complexes in the other area.
47. The method as defined in claim 46, wherein: a second predetermined area of the flow cell corresponds with at least a portion of the other area; and the method further comprises: introducing a second DNA sample to the flow cell, whereby the second DNA sample binds to the transposome complexes across the flow cell; introducing a second encapsulated complex into the flow cell, the second encapsulated complex including a second catalytic metal surrounded by a second coating material; and selectively releasing the second catalytic metal from the second encapsulated complex at the second predetermined area by exposing the second encapsulated complex to a second mechanism that initiates removal of the second coating material, thereby initiating tagmentation of a portion of the second DNA sample in the second predetermined area.
48. A method, comprising: introducing a DNA sample to a flow cell including: a substrate having depressions separated by interstitial regions; a polymeric hydrogel positioned within each of the depressions; transposome complexes immobilized within each of the depressions; and a removable coating overlying the transposome complexes; exposing a sub-set of the transposome complexes at a predetermined area of the flow cell by removing a portion of the removable coating from the predetermined area; and initiating tagmentation of at least a portion of the DNA sample at the predetermined area.
49. The method as defined in claim 48, wherein exposing the sub-set of the transposome complexes involves heating the predetermined area, and the method further comprises cooling an other area of the flow cell to prevent removal of an other portion of the removable coating from the other area.
50. The method as defined in claim 48, wherein exposing the sub-set of the transposome complexes involves exposing the predetermined area to visible light.
51. The method as defined in claim 48, wherein exposing the sub-set of the transposome complexes involves changing a pH at the predetermined area.
52. The method as defined in any one of claim 48 through claim 51, further comprising: removing a transposase enzyme from the transposome complexes in the sub-set; and washing the removed transposase enzymes from the flow cell.
53. The method as defined in claim 52, wherein: a second predetermined area of the flow cell corresponds with at least a portion of the other area; and the method further comprises: introducing a second DNA sample to the flow cell; exposing a second sub-set of the transposome complexes at the second predetermined area of the flow cell by removing a second portion of the removable coating from the second predetermined area; and initiating tagmentation of at least a portion of the second DNA sample at the second predetermined area.
54. A kit, comprising: a flow cell including: a substrate having depressions separated by interstitial regions; a polymeric hydrogel positioned within each of the depressions; an amplification primer set attached to the polymeric hydrogel within each of the depressions; and a target primer attached to the polymeric hydrogel within each of the depressions, wherein the target primer attached within the depressions located at a first region of the flow cell is orthogonal to the target primer attached within the depressions located at a second region of the flow cell; a first fluid including: a liquid carrier; and a first plurality of transposome complexes dispersed in the liquid carrier, each of the first plurality of transposome complexes including a first spatial tag that is complementary to the target primer attached within the depressions located at the first region of the flow cell; and a second fluid including: a liquid carrier; and a second plurality of transposome complexes dispersed in the liquid carrier, each of the second plurality of transposome complexes including a second spatial tag that is complementary to the target primer attached within the depressions located at the second region of the flow cell.
55. The kit as defined in claim 54, wherein: each first spatial tag is attached at a 5 end of a transferred strand of each of the first plurality of transposome complexes; and each second spatial tag is attached at a 5 end of a transferred strand of each of the second plurality of transposome complexes.
56. The kit as defined in claim 54, wherein: some of the first spatial tags are respectively attached at a 5 end of a transferred strand of some of the first plurality of transposome complexes; some other of the first spatial tags are respectively attached at a 3 end of a non-transferred strand of some other of the first plurality of transposome complexes; some of the second spatial tags are respectively attached at a 5 end of a transferred strand of some of the second plurality of transposome complexes; and some other of the second spatial tags are respectively attached at a 3 end of a non-transferred strand of some other of the second plurality of transposome complexes.
57. A method for using the kit of claim 54, the method comprising: operatively positioning the flow cell in a sequencing instrument; generating fully adapted first DNA sample fragments in the first region of the flow cell by: introducing the first fluid into the flow cell at a hybridization temperature, whereby the first spatial tags respectively hybridize to the target primers attached within the depressions located at the first region of the flow cell; introducing a first DNA sample into the flow cell, whereby the first DNA sample is tagmented by the first plurality of transposome complexes; removing a transposase enzyme of each of the first plurality of transposome complexes; and performing gap fill ligation or an extension reaction; and generating fully adapted second DNA sample fragments in the second region of the flow cell by: introducing the second fluid into the flow cell at a hybridization temperature, whereby the second spatial tags respectively hybridize to the target primers attached within the depressions located at the second region of the flow cell; introducing a second DNA sample into the flow cell, whereby the second DNA sample is tagmented by the second plurality of transposome complexes; removing a transposase enzyme of each of the second plurality of transposome complexes; and performing gap fill ligation or an extension reaction.
58. A method for using the kit of claim 54, the method comprising: operatively positioning the flow cell in a sequencing instrument; exposing the first plurality of transposome complexes to a first DNA sample, whereby the first DNA sample binds to at least some of the first plurality of transposome complexes to form a first bound complex; introducing the first bound complex to the flow cell, whereby the first spatial tags respectively hybridize to the target primers attached within the depressions located at the first region of the flow cell; passivating the first bound complex at the first region of the flow cell; exposing the second plurality of transposome complexes to a second DNA sample, whereby the second DNA sample binds to at least some of the second plurality of transposome complexes to form a second bound complex; and introducing the second bound complex to the flow cell, whereby the second spatial tags respectively hybridize to the target primers attached within the depressions located at the second region of the flow cell.
59. The method as defined in claim 58, further comprising passivating the second bound complex at the second region of the flow cell.
60. The method as defined in claim 58 or claim 59, wherein passivating the first bound complex involves attaching an anti-fouling agent to the first bound complex.
61. The method as defined in claim 58 or claim 59, wherein passivating the first bound complex involves forming a hydrophobic polymer shell over the first bound complex.
62. The method as defined in any one of claim 58 through claim 61, further comprising: de-passivating the first bound complex at the first region of the flow cell; and simultaneously initiating the formation of respective sets of fully adapted DNA fragments at each of the first and second regions of the flow cell.
63. A method for using the kit of claim 54, the method comprising: operatively positioning the flow cell in a sequencing instrument; generating partially adapted first DNA sample fragments in the first region of the flow cell by: introducing the first fluid into the flow cell at a hybridization temperature, whereby the first spatial tags respectively hybridize to the target primers attached within the depressions located at the first region of the flow cell; introducing a first DNA sample into the flow cell, whereby the first DNA sample is tagmented by the first plurality of transposome complexes; and removing a transposase enzyme of each of the first plurality of transposome complexes; generating partially adapted second DNA sample fragments in the second region of the flow cell by: introducing the second fluid into the flow cell at a hybridization temperature, whereby the second spatial tags respectively hybridize to the target primers attached within the depressions located at the second region of the flow cell; introducing a second DNA sample into the flow cell, whereby the second DNA sample is tagmented by the second plurality of transposome complexes; and removing a transposase enzyme of each of the second plurality of transposome complexes; and performing gap fill ligation or an extension reaction, thereby generating fully adapted first and second DNA sample fragments.
64. A method, comprising: attaching an amplification primer set along a flow cell lane; and sequentially attaching orthogonal target primers in at least two different regions of the flow cell lane.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] Some examples of the flow cells disclosed herein include surface chemistry for immobilizing transposome complexes and primers to the surface of the flow cell. By incorporating this surface chemistry, the flow cell can be repurposed for a particular application. On flow cell tagmentation generates DNA sample fragments (i.e., library fragments of the larger DNA sample) on the same surface where amplification and sequencing of the fragments takes place. This eliminates the need for off flow cell DNA sample preparation to generate the library fragments, and thus provides a more stream-lined and efficient process. Some of the methods using these example flow cells also enable library fragment indexing and/or enrichment.
[0030] Other examples of the flow cells disclosed herein include light activated surface chemistry. This enables spatial location/position control over surface chemistry activation, which in turn enables selective surface preparation and/or reaction initiation.
[0031] Still other examples of the flow cells disclosed herein include utilize heat, light, or a pH change to activate transposome complexes in a predetermined area of the flow cell. This enables control over where a sample is seeded and amplified, and thus enables multiple samples to be used and identified by spatial indexing.
Definitions
[0032] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0033] As used herein, the singular forms a, an, and the refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term comprising as used herein is synonymous with including, containing, or characterized by, and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
[0034] Reference throughout the specification to one example, another example, an example, and so forth, means that a particular element (e.g., feature, structure, composition, configuration, and/or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0035] The terms substantially and about used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms can refer to less than or equal to 5% from a stated value, such as less than or equal to 2% from a stated value, such as less than or equal to 1% from a stated value, such as less than or equal to 0.5% from a stated value, such as less than or equal to 0.2% from a stated value, such as less than or equal to 0.1% from a stated value, such as less than or equal to 0.05% from a stated value.
[0036] Adapter. An oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. Suitable adapter lengths may range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. The adapter may include any combination of nucleotides and/or nucleic acids. In some examples, the adapter can include an amplification domain, e.g., having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, the adapter can include a sequence that is complementary to at least a portion of a flow cell surface bound primer (which includes the universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to the complementary flow cell surface bound primer during amplification and cluster generation. In some examples, the adapter can also include a sequencing primer sequence (i.e., sequencing binding site) or a sequencing sample index (i.e., a barcode sequence). Combinations of different adapters may be incorporated into the nucleic acid molecule, such as the DNA fragments generated via tagmentation.
[0037] Amplification Domain: A portion of an adapter having a universal nucleotide sequence, such as a P5 or P7 sequence or a complement thereof, that can serve as a starting point for template amplification and cluster generation.
[0038] Corresponds with: When one primer corresponds with an amplification domain, the primer and amplification domain may have the same sequence, so that a copy of the amplification domain generates a sequence complementary to the primer; or they may have complementary sequences when the amplification domain is introduced as part of an adapter.
[0039] Depositing: Any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0040] Depression: A discrete concave feature in a substrate or a layer of a substrate (e.g., a patterned resin) having a surface opening that is at least partially surrounded by interstitial region(s) of the substrate or the layer. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The depression may also have more complex architectures, such as ridges, step features, etc.
[0041] DNA Sample: A polymeric form of nucleotides of any length that includes deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides derived from an RNA (ribonucleic acid) sample. The DNA sample is double stranded. The DNA sample may include naturally occurring DNA, which includes a nitrogen containing heterocyclic base (a nucleobase such as adenine, thymine, cytosine and/or guanine), a sugar (specifically deoxyribose, i.e., a sugar lacking a hydroxyl group that is present at the 2 position in ribose), and a backbone containing phosphodiester bonds. An analog structure can have an alternate backbone linkage including any of a variety known in the art.
[0042] The DNA sample may be genomic DNA (gDNA) that can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva) or tissues. gDNA can be prepared by lysing a cell that contains the DNA. The cell may be lysed under conditions that substantially preserve the integrity of the cell's gDNA. In one particular example, thermal lysis may be used to lyse a cell. In another particular example, exposure of a cell to alkaline pH can be used to lyse a cell while causing relatively little damage to gDNA. Any of a variety of basic compounds can be used for lysis including, for example, potassium hydroxide, sodium hydroxide, and the like. Additionally, relatively undamaged gDNA can be obtained from a cell lysed by an enzyme that degrades the cell wall. Cells lacking a cell wall either naturally or due to enzymatic removal can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse a cell include exposure to detergents, mechanical disruption, sonication heat, pressure differential such as in a French press device, or Dounce homogenization. Agents that stabilize gDNA can be included in a cell lysate or isolated gDNA sample including, for example, nuclease inhibitors, chelating agents, salts, buffers and the like. A crude cell lysate containing gDNA may be used without further isolation of the gDNA. In one example, a whole blood sample may be lysed using an inorganic salt free lysis buffer, and the crude lysate may be exposed to specific processing steps to generate a complexed crude lysate. This complexed crude lysate can also be used as the DNA sample without further isolation or purification.
[0043] Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0044] Flow Cell: A vessel having an enclosed flow channel where a reaction can be carried out, or a vessel having a channel that is open to a surrounding environment and in which a reaction can be carried out. The vessel with an open flow channel may be referred to herein as an open wafer flow cell. Any example of the flow cell may include an inlet for delivering reagent(s) to the channel, and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.
[0045] Flow channel: An area that is defined between two bonded or otherwise attached components or that is defined within a lane so that it is open to the surrounding environment. The flow channel can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned sequencing surfaces or a patterned sequencing surface and a lid, and thus may be in fluid communication with one or more components of the sequencing surface(s).
[0046] Fragment: A portion or piece of the DNA sample. A partially adapted fragment is a portion or piece of the DNA sample that has been tagmented, and thus includes an adapter ligated to the 5 end of the DNA fragment. A fully adapted fragment is a portion or piece of the DNA sample that has adapters incorporated at both 3 and 5 ends of the DNA fragment.
[0047] Primer. A single stranded nucleic acid molecule that can hybridize to a target sequence, such as an adapter attached to a fragment. As one example, a flow cell surface bound primer can serve as a starting point for fragment amplification and cluster generation. As another example, a flow cell surface bound primer can serve as a hybridization point for a spatial tag, and thus for targeting attachment of particular transposome complexes and DNA samples. As still another example, a primer (e.g., a sequencing primer) may be introduced that can hybridize to fragments or fragment amplicons in order to prime synthesis of a new strand that is complementary to the fragments or fragment amplicons. Any primer can include any combination of nucleotides or analogs thereof. In some examples, the primer is a single-stranded oligonucleotide or polynucleotide. The primer length can be any number of bases long. In an example, each of the flow cell surface bound primer and the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.
[0048] Tagmentation Entity: Any component involved in the process of tagmentation. The term may refer to a transposome complex, a transposase enzyme, a reagent, or the like.
[0049] Tagmentation: A process in which the DNA sample is cleaved/fragmented and tagged (e.g., with the adapters) for analysis. Tagmentation is an in vitro transposition reaction.
[0050] Transferred and Non-Transferred Strands: The term transferred strand refers to a sequence that includes a transferred portion of a transposon end. Similarly, the term non-transferred strand refers to a sequence that includes the non-transferred portion of a transposon end. The 3-end of a transferred strand is joined or transferred to a double stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to the double stranded fragment during tagmentation. In an example, the transferred and non-transferred strands include at least partially complementary portions that are covalently bound together.
[0051] Transposase or Transposase Enzyme: An enzyme that is capable of forming a functional complex with a transposon end-containing composition (e.g., transposons, transposon ends, transposon end compositions) and catalyzing insertion or transposition of the transposon end-containing composition into the double-stranded DNA sample with which it is incubated, for example, in the in vitro transposition reaction (i.e., tagmentation). A transposase as presented herein can also include integrases from retrotransposons and retroviruses. Although many examples described herein refer to Tn5 transposase and/or hyperactive Tn5 transposase, it will be appreciated that any transposase that is capable of inserting a transposon end with sufficient efficiency to 5-tag and fragment the DNA sample for its intended purpose can be used.
[0052] Transposome Complex: An entity formed between a transposase and a double stranded nucleic acid including a transposase integration recognition site. For example, the transposome complex can be a transposase enzyme pre-incubated with double-stranded transposon DNA under conditions that support non-covalent complex formation. Double-stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions or other double-stranded DNAs capable of interacting with a transposase, such as the hyperactive Tn5 transposase.
[0053] Transposon End: A double-stranded nucleic acid strand that exhibits only the nucleotide sequences (the transposon end sequences) that are necessary to form the complex with the transposase that is functional in tagmentation. The double-stranded nucleic acid strand of the transposon end can include any nucleic acid or nucleic acid analogue suitable for forming the functional complex with the transposase. For example, the transposon end can include natural DNA or DNA analogs (with modified bases and/or backbones), and can include nicks in one or both strands.
Flow Cells
[0054] Some examples of the flow cells disclosed herein include a biotin-containing linker that enables the flow cell to be repurposed for different applications. Other examples of the flow cells disclosed herein include a visible light responsive member that enables the flow cell to be selectively activated.
[0055] An example of the flow cell 10 is depicted from the top view in
[0056] A top view of an example of the flow cell 10 is shown in
[0057] In the examples shown in
[0058] Different substrates 12 or 12 or 14 or 14 are shown in
[0059] In the example shown in
[0060] In the examples shown in
[0061] The base support 22, 22 may be any of the examples set forth herein for the single layered structure of the substrate 14, 14. The patterned material 24, 24 may be any material that is capable of being patterned with depressions 26, 26.
[0062] In an example, the patterned material 24, 24 may be an inorganic oxide that is selectively applied to the base support 22, 22, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta.sub.2O.sub.5), aluminum oxide (e.g., Al.sub.2O.sub.3), silicon oxide (e.g., SiO.sub.2), hafnium oxide (e.g., HfO.sub.2), etc. In another example, the patterned material 24, 24 may be a resin matrix material that is applied to the base support 22, 22 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP from Bellex), and combinations thereof.
[0063] In an example, the substrates 12, 12 or 14, 14 may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular sheet or panel having its largest dimension up to about 10 feet ( 3 meters). In an example, the substrate 12, 12 or 14, 14 is a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form an individual flow cell substrate. In another example, the substrate 12, 12 or 14, 14 is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 12, 12 or 14, 14 with any suitable dimensions may be used. For another example, a panel may be used that is a rectangular support, which has a greater surface area than a 300 mm round wafer. Panels may subsequently be diced to form individual flow cells.
[0064] The flow cell 10 also includes the flow channel 20. While several flow channels 20 are shown in
[0065] At least a portion of the flow channel 20 may be defined in the substrate 12, 12 or 14, 14 using any suitable technique that depends, in part, upon the material(s) of the substrate 12, 12 or 14, 14. With the open wafer flow cell, the entire flow channel 20 may be defined by the lane 36 that is defined in the substrate 12 or 14. In one example, at least a portion of the flow channel 20 is etched into a glass substrate, such as substrate 14, 14. In another example, at least a portion of the flow channel 20 may be patterned into a resin matrix material of a multi-layered structure using photolithography, nanoimprint lithography, etc. In enclosed versions of the flow cell 10, a separate material (e.g., material 28) may be applied to the substrate 12, 12 or 14, 14 so that the separate material 28 defines at least a portion of the walls of the flow channel 20.
[0066] In an example, the flow channel 20 has a substantially rectangular configuration with rounded ends. The length and width of the flow channel 20 may be smaller, respectively, than the length and width of the substrate 12, 12 or 14, 14 so that a portion of the substrate surface surrounding the flow channel 20 is available for attachment to another substrate 12, 12 or 14, 14 or to a lid or to define the perimeter of the open flow channel 20. In some instances, the width of each flow channel 20 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, the length of each flow channel 54 can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and/or length of each flow channel 20 can be greater than, less than or between the values specified above. In another example, the flow channel 20 is square (e.g., 10 mm10 mm).
[0067] The depth/height of each flow channel 20 can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the separate material 28 that partially defines the flow channel walls. In other examples, the depth/height of each flow channel 20 can be about 1 m, about 10 m, about 50 m, about 100 m, or more. In an example, the depth/height may range from about 10 m to about 100 m. In another example, the depth/height is about 5 m or less. It is to be understood that the depth/height of each flow channel 20 can also be greater than, less than or between the values specified above. The depth/height of the flow channel 20 may also vary along the length and width of the flow cell 10, e.g., when depressions 26, 26 are used.
[0068] The example flow cell architecture of
[0069] The layout or pattern may be characterized with respect to the density (number) of the depressions 26, 26 in a defined area. For example, the depressions 26, 26 may be present at a density of approximately 2 million per mm.sup.2. The density may be tuned to different densities including, for example, a density of about 100 per mm.sup.2, about 1,000 per mm.sup.2, about 0.1 million per mm.sup.2, about 1 million per mm.sup.2, about 2 million per mm.sup.2, about 5 million per mm.sup.2, about 10 million per mm.sup.2, about 50 million per mm.sup.2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high density array may be characterized as having depressions 26, 26 separated by less than about 100 nm, a medium density array may be characterized as having the depressions 26, 26 separated by about 400 nm to about 1 m, and a low density array may be characterized as having the depressions 26, 26 separated by greater than about 1 m.
[0070] The layout or pattern of the depressions 26, 26 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 26, 26 to the center of an adjacent depression 26, 26 (center-to-center spacing) or from the right edge of one depression 26, 26 to the left edge of an adjacent depression 26, 26 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 m, about 0.5 m, about 1 m, about 5 m, about 10 m, about 100 m, or more or less. The average pitch for a particular pattern can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 26, 26 have a pitch (center-to-center spacing) of about 1.5 m. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.
[0071] The size of each depression 26, 26 may be characterized by its volume, opening area, depth, and/or diameter. For example, the volume can range from about 110.sup.3 m.sup.3 to about 100 m.sup.3, e.g., about 110.sup.2 m.sup.3, about 0.1 m.sup.3, about 1 m.sup.3, about 10 m.sup.3, or more, or less. For another example, the opening area can range from about 110.sup.3 m.sup.2 to about 100 m.sup.2, e.g., about 110.sup.2 m.sup.2, about 0.1 m.sup.2, about 1 m.sup.2, at least about 10 m.sup.2, or more, or less. For still another example, the depth can range from about 0.1 m to about 100 m, e.g., about 0.5 m, about 1 m, about 10 m, or more, or less. For yet another example, the diameter or length and width can range from about 0.1 m to about 100 m, e.g., about 0.5 m, about 1 m, about 10 m, or more, or less.
[0072] The example flow cell architecture of
[0073] The example flow cell architecture of
[0074] In one example, the flow cell architecture shown in
[0075] The polymeric hydrogel 32, 32 may be poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM) or another of the acrylamide copolymers disclosed herein (e.g., poly(NN-dimethylacrylamide), polyethylene glycol (PEG)-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, crosslinked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymers (PEO-PPO), poly(hydroxyethyl methacrylate) (PHEMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymers, poly(ethylene glycol)-poly(lactic-co-glycolic acid) block copolymers, poly(acrylic-co-vinylsulfonic acid), poly(acrylamide-co-vinylsulfonic acid), poly(L-aspartic acid), poly(aspartamide), adipic dihydrazide modified or aldehyde modified poly(L-glutamic acid), bisacrylamide, or hydrogels based on one or more of polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, and collagen, or combinations or mixtures thereof.
[0076] In one example, the polymeric hydrogel 32, 32 includes an acrylamide copolymer. In this example, the acrylamide copolymer has a structure (I):
##STR00001##
[0077] wherein: [0078] R.sup.A is an azide or a tetrazine or any other functional group that can attach to an alkyne, an amino, an alkenyl, an alkyne, a halogen, a hydraarea, a hydrazine, a carboxyl, a hydroxy, a tetrazole, nitrone, sulfate, or thiol; [0079] R.sup.B is H or optionally substituted alkyl; [0080] R.sup.C, R.sup.D, and R.sup.E are each independently selected from the group consisting of H and optionally substituted alkyl; [0081] each of the (CH.sub.2).sub.p can be optionally substituted; [0082] p is an integer in the range of 1 to 50; [0083] n is an integer in the range of 1 to 50,000; and [0084] m is an integer in the range of 1 to 100,000.
[0085] One specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl) acrylamide-co-acrylamide, PAZAM.
[0086] One of ordinary skill in the art will recognize that the arrangement of the recurring n and m features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0087] The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 10 MDa, or may be, in a specific example, about 312 kDa.
[0088] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a lightly cross-linked polymer.
[0089] In some examples, the gel material may be a variation of structure (I). In one example, the acrylamide unit may be replaced with N, N-dimethylacrylamide
##STR00002##
[0090] In another example, the acrylamide unit in structure (I) may be replaced with,
##STR00003##
where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N, N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, structure (I) may include
##STR00004##
in addition to the recurring n and m features, where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0091] As another example of the polymeric hydrogel 32, 32, the recurring n feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):
##STR00005##
wherein R.sup.1 is H or a C1-C6 alkyl; R.sup.2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0092] As still another example, the gel material may include a recurring unit of each of structure (III) and (IV):
##STR00006##
wherein each of R.sup.1a, R.sup.2a, R.sup.1b and R.sup.2b is independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R.sup.3a and R.sup.3b is independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each L.sup.1 and L.sup.2 is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0093] As mentioned, in some examples, the polymeric hydrogel 32, 32 has one member 18, 18 of a visible light responsive pair attached thereto. A visible light responsive pair refers to two or three reagents that undergo a coupling reaction when exposed to visible light. When the pair includes two reagents, one is attached to the polymeric hydrogel 32, 32 and the other is attached to a tagmentation entity (e.g., transposome complexes), a primer, or another entity that is to be introduced to the flow cell surface. When the pair includes three reagents, one is attached to the polymeric hydrogel 32, 32, another is attached to the entity that is to be introduced to the flow cell surface, and third is present in the formulation that is introduced when the coupling reagent is to be performed.
[0094] Examples of visible light responsive pairs are shown in
[0095] The first visible light responsive member 18, 18 may be attached to the polymeric hydrogel 32, 32 via covalent bonding or non-covalent bonding. As one example, first visible light responsive member 18, 18 may be attached to some of the R.sup.A groups. Non-covalent bonding (e.g., biotin-streptavidin) may be used as long as neither member of the non-covalent binding pair can bind to the other member of the visible light responsive pair.
[0096] In another example, the flow cell architecture shown in
[0097] In still other examples, the flow cell 10 does not include either the visible light responsive member 18, 18 or the biotin-containing linker 16, 16.
[0098] In some of these examples, the transposome complexes, such as those shown in
[0099] In other of these examples, the flow cell 10 includes target primers that are capable of hybridizing to a portion of the transposome complex. The target primers are further described in reference to
Repurposing Flow Cell Surfaces
[0100] Some of the flow cells 10 may be repurposed for various applications. Example methods (shown and described in reference to
[0101] These example methods are performed with the flow cells 10 that include the architecture shown in
[0102] In the examples shown in
[0103] In each of
[0104] In the example of
[0105] The transferred strand 42 includes a 5 end functional group 48. In this example, 5 end functional group 48 is biotin. The transferred strand 42 also includes a first amplification domain 45, and a sequencing primer sequence 47 that is attached to one strand ME of the transposon end 40. The strand ME of the transposon end 40 is positioned at the 3 end of the transferred strand 42.
[0106] In this example, the first amplification domain 45 has a different sequence than a second amplification domain 49 (e.g., P5) of a subsequently introduced adapter 50 (which forms a forked adapter 50 when hybridized to the transferred strand 42 as shown at D in
[0107] The P5 primer sequence is one of:
TABLE-US-00001 P5#1:5.fwdarw.3 (SEQ.ID.NO.1) AATGATACGGCGACCACCGAGAUCTACAC; P5#2:5.fwdarw.3 (SEQ.ID.NO.2) AATGATACGGCGACCACCGAGAnCTACAC
where n is inosine in SEQ. ID. NO. 2; or
TABLE-US-00002 P5#3:5.fwdarw.3 (SEQ.ID.NO.3) AATGATACGGCGACCACCGAGAnCTACAC
where n is alkene-thymidine (i.e., alkene-dT) in SEQ. ID. NO. 3.
The P5 sequence is the complement of any of the P5 examples.
The P7 primer sequence may be any of the following:
TABLE-US-00003 P7#1:5.fwdarw.3 (SEQ.ID.NO.4) CAAGCAGAAGACGGCATACGAnAT P7#2:5.fwdarw.3 (SEQ.ID.NO.5) CAAGCAGAAGACGGCATACnAGAT P7#3:5.fwdarw.3 (SEQ.ID.NO.6) CAAGCAGAAGACGGCATACnAnAT
where n is 8-oxoguanine in each of SEQ. ID. NOS. 4-6.
[0108] It is to be understood that other sequences may be used for the amplification domains 45, 49 (e.g., P7, P5) and for the primers 55, 57 (e.g., P7, P5), as long as the combination enables the desired amplification. As such, the designations P5, P5, and P7 are provided as examples, and the corresponding domains 45, 49 and/or primers 55, 57 are not limited to the specific sequences set forth herein. As examples, a P15, PA, PB, PC, or PD primer may be used.
[0109] The P15 primer sequence is:
TABLE-US-00004 P15:5.fwdarw.3 (SEQ.ID.NO.7) AATGATACGGCGACCACCGAGAnCTACAC
where n is allyl-T (i.e., a thymine nucleotide analog having an allyl functionality).
The other primer sequences (PA-PD) mentioned above include:
TABLE-US-00005 PA5.fwdarw.3 (SEQ.ID.NO.8) GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG PB5.fwdarw.3 (SEQ.ID.NO.9) CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT PC5.fwdarw.3 (SEQ.ID.NO.10) ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT PD5.fwdarw.3 (SEQ.ID.NO.11) GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC
[0110] While not shown in the example sequences for PA-PD, it is to be understood that any of these sequences may include a cleavage site 52, such as uracil, 8-oxoguanine, allyl-T, diols, etc. at any point in the strand. The sequences for the first amplification domain 45/primer 55 and for the second amplification domain 49/primer 57 may be selected to have orthogonal cleavage sites (i.e., one cleavage site is not susceptible to the cleaving agent used for the other cleavage site), so that after amplification, forward or reverse strands can be cleaved, leaving the other of the reverse or forward strands for sequencing.
[0111] The primers 55, 57 may also include a polyT sequence at the 5 end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.
[0112] The sequencing primer sequences 47, 53 (the latter of which is part of the adapter 50) have different sequences from each other that respectively bind to sequencing primers introduced into the flow cell 10 after tagmentation and amplification. As examples, the sequencing primer sequence 47 may bind a sequencing primer that primes synthesis of a new strand that is complementary to forward strand fragments/fragment amplicons and the sequencing primer sequence 53 may bind a sequencing primer that primes synthesis of a new strand that is complementary to reverse strand fragments/fragment amplicons.
[0113] The transposon end 40 of each transposome complex 38A includes the strands ME respectively hybridized to the strands ME. As such, the strands ME, ME are complementary. The double stranded transposon end 40 is capable of complexing with the transposase 46. As examples, the strands ME, ME of the transposon end 40 may be the related but non-identical 19-base pair (bp) outer end (e.g., strand ME) and inner end (e.g., strand ME) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strand ME) and the R2 end (strand ME) recognized by the MuA transposase.
[0114] At the outset of the method shown in
[0115] In this example method, fully adapted DNA fragments are generated by introducing a DNA sample 54 and a tagmentation buffer to the flow cell 10 (see B); performing tagmentation of the DNA sample 54 using the plurality of transposome complexes 38A (see B); removing the transposase enzyme 46 of each of the plurality of transposome complexes 38A (see C); replacing the non-transferred strand 44 of each of the plurality of transposome complexes 38A with an adapter 50 including a sequence, e.g., ME, complementary to the ME portion of the transferred strand 42; a sequencing primer sequence 53; an index sequence 51; and a second amplification domain 49 that is complementary to the primer 47 that is or is to be immobilized within each of the depressions 26 of the flow cell 10, thereby dehybridizing the non-transferred strand 44 and hybridizing the adapter 50 to the portion ME of the transferred strand 42 of each of the plurality of transposome complexes 38A (thus forming the forked adapter 50, see D); and performing gap fill ligation to attach the DNA sample fragments to respective forked adapters 50 (see D).
[0116] As shown at B in
[0117] When the DNA sample 54 is introduced into the flow cell 10 including the transposome complexes 38A, the DNA sample 54 is fragmented and 5 ends of both strands of the duplex fragments 58, 58 are ligated to respective 3 ends of the transferred strands 42 of the transposome complexes 38A. Fragmentation and ligation may take place at a temperature at or above 30 C. In one example, the temperature may range from 30 C. to about 55 C. In another example, the temperature may range from 35 C. to about 45 C. The 3 ends of the duplex fragments 58, 58 are not ligated to the 5 ends of the non-transferred strands 44. As such, a gap G (shown in
[0118] As shown in
[0119] The non-transferred strand 44 of each of the plurality of transposome complexes 38A is replaced with the adapter 50, which creates the forked adapter 50 shown in
[0120] Gap fill ligation is then performed to attach the DNA sample fragments 58, 58 to the sequence ME of respective forked adapters 50 (see
[0121] As a result of gap fill ligation, fully adapted DNA fragments are attached to the flow cell 10. The fully adapted fragments are shown at D and include the first amplification domain 45 (e.g., P7) at one end and the second amplification domain 49 (e.g., P5) at the other end, with the respective DNA fragments 58, 58 therebetween.
[0122] The fully adapted DNA fragments are then cleaved by introducing a suitable cleaving agent for the cleavage site 52. As examples, uracil can be cleaved by Uracil-DNA glycosylase (UDG), inosine can be cleaved by Endo IV, 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol linkages can be cleaved by oxidation, such as treatment with a periodate reagent.
[0123] By cleaving the fully adapted DNA sample fragments at the cleavage site 52, the biotin-containing linker 16 remains attached to the surface, as shown at F in
[0124] The cleaved fully adapted DNA fragments are transported into a holding receptacle 26. This is shown at E in
[0125] After cleaving the fully adapted DNA sample fragments such that the biotin-containing linker 16 remains attached to the flow cell surface, and prior to using the flow cell 10, the method further comprises removing streptavidin 60 from the biotin-containing linker 16. Streptavidin (or avidin) 60 removal is depicted at F in
[0126] To remove streptavidin 60, a biotin streptavidin cleavage composition may be introduced into the flow cell 10. Examples of the biotin streptavidin cleavage composition include about 95% formamide and about 10 mM ethylenediaminetetraacetic acid (EDTA), or from about 10% by volume to about 50% by volume of a formamide reagent and a balance of a salt buffer. At suitable reaction temperatures, these cleavage compositions disrupt the biotin-streptavidin interactions, thus releasing whatever is attached (e.g., streptavidin, 5 end functional group 48 (biotin)) to the biotin of the biotin-containing linker 16. Alternatively, a hot wash with biotin and/or desthiobiotin causes the newly added biotin and/or desthiobiotin to compete with the already bound biotin. By disrupting the biotin-streptavidin interactions, the streptavidin 60 and 5 end functional group 48 (biotin) are removed, leaving the biotinBCN (i.e., one example of the biotin-containing linker 16) attached to the polymeric hydrogel 30.
[0127] The flow cell 10 may then be used for a subsequent cycle of generating new fully adapted DNA sample fragments (e.g., going from F back to A in
[0128] When the flow cell 10 is used for the subsequent cycle of generating new fully adapted DNA sample fragments, the subsequent cycle of generating fully adapted DNA sample fragments includes: introducing a new plurality of the transposome complexes 38A into the flow channel 20, whereby at least some of the new plurality of the transposome complexes 38A attach to at least some of the biotin-containing linkers 16 within the flow channel 20; introducing a new DNA sample 54 and a new tagmentation buffer to the flow channel 20; and repeating the tagmentation, transposase enzyme 46 removal, replacement of the non-transferred strand 44 with the adapter 50, and gap fill ligation with the new DNA sample. The repeated steps may be performed in the same manner as described herein. For example, streptavidin 60 may be added with the transposome complexes 38A (which include biotin as 5 end group 48) to attach them to the biotin-containing linkers 16. The flow cell 10 may be used again and again to prepare single stranded fully adapted fragments 56A, 56B from several different DNA samples.
[0129] When the flow cell 10 is used for amplification of at least some of the previously cleaved and fully adapted DNA sample fragments, the method involves attaching first and second primers 55, 57 (e.g., P7, P5) to at least some of the biotin-containing linkers 16 within the flow channel 20 (see G in
[0130] While P5 and P7 primers are referenced, it is to be understood that other sequences may be used for the primers 55, 57, as long as the combination enables the desired amplification of the single stranded fully adapted DNA sample fragments 56A, 56B. The primers 55, 57 include a 5 end group 48 (in this example biotin) so that they can attach to the biotin-containing linkers 16 through streptavidin 60. Any of the avidin/streptavidin techniques described herein for attaching the transposome complexes 38A to the biotinylated polymeric hydrogel 30 may be used to attach the primers 55, 57.
[0131] Once the primers 55, 57 are attached, the single stranded fully adapted sample fragments 56A, 56B may be transported back to the flow channel 20, where each will seed in a depression 26 and undergo amplification. The second amplification domain 49 (e.g., P5) of the single stranded fully adapted sample fragments 56A, 56B hybridizes to the primer 57 in a depression 26. The sample fragments 56A, 56B are copied from the hybridized primers 57 (e.g., P5) by 3 extension using a high-fidelity DNA polymerase. The original sample fragments 56A, 56B are denatured, leaving the copies immobilized all around the depression 26. Isothermal bridge amplification or some other form of amplification may be used to amplify the immobilized copies. For example, the copied templates loop over to hybridize to an adjacent, complementary primer 55 (e.g., P7), and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary primers and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters of amplicons within the depressions 26. Each cluster of double stranded bridges is denatured. In an example, the reverse strands are removed by specific base cleavage, leaving forward template strands. This example of clustering is referred to as bridge amplification, and is one example of the amplification that may be performed. It is to be understood that other amplification techniques may be used.
[0132] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
[0133] After sequencing, the biotin streptavidin cleavage composition may again be introduced to remove the primers 55, 57, and amplicons and nascent strands attached thereto. This leaves the biotin-containing linker 16 within the depressions 26 ready for another cycle (similar to
[0134] In the example of
[0135] The transferred strand 42 includes a 5 end functional group 48. In this example, 5 end functional group 48 is biotin. The transferred strand 42 also includes the sequencing primer sequence 47 that is attached to one strand ME of the transposon end 40, and the first amplification domain 45. While not shown, the transferred stand 42 may also include the index sequence between the sequencing primer sequence 47 and the first amplification domain 45. The strand ME of the transposon end 40 is positioned at the 3 end of the transferred strand 42.
[0136] In this example, the non-transferred strand 44 is an adapter that further includes a sequencing primer sequence 53 (attached to the strand ME), an index sequence 51, and a second amplification domain 49 (e.g., P5) that is complementary to a primer 57 (e.g., P5) that is to be immobilized within each of the depressions 26 of the flow cell 10 (see G in
[0137] The first amplification domain 45 has a different sequence than the second amplification domain 49, but has the same sequence as one primer 55 that is to be introduced to the flow cell 10 (e.g., at G in
[0138] The sequencing primer sequences 47, 53 have different sequences from each other that respectively bind to sequencing primers introduced into the flow cell 10 after tagmentation and amplification.
[0139] The index sequence 51 is a unique barcode sequence that can be used for DNA sample fragment identification and indexing. In another example, the index sequence is a unique molecular index (UMI).
[0140] At the outset of the method shown in
[0141] In this example method, fully adapted DNA fragments are generated by introducing a DNA sample 54 and a tagmentation buffer to the flow channel 10 (see B); performing tagmentation of the DNA sample 54 using the plurality of transposome complexes 38B (see B); removing the transposase enzyme 46 of each of the plurality of transposome complexes 38B (see C); and performing gap fill ligation to attach the DNA sample fragments to respective non-transferred strands 44 (e.g., the forked adapters 50, see D).
[0142] As shown at B in
[0143] When the DNA sample 54 is introduced into the flow cell 10 including the transposome complexes 38B, the DNA sample 54 is fragmented and 5 ends of both strands of the duplex fragments 58, 58 are ligated to respective 3 ends of the transferred strands 42 of the transposome complexes 38B. Fragmentation and ligation may take place as described in reference to
[0144] As shown in
[0145] Gap fill ligation is then performed to attach the DNA sample fragments 58, 58 to the non-transferred strands 44 (see
[0146] The fully adapted DNA fragments are then cleaved by introducing a suitable cleaving agent for the cleavage site 52. Any of the example cleaving agents disclosed herein may be used. By cleaving the fully adapted DNA sample fragments at the cleavage site 52, the biotin-containing linker 16 remains attached to the surface, as shown at F in
[0147] The cleaved fully adapted DNA fragments are transported into a holding receptacle 26. This is shown at E in
[0148] After cleaving the fully adapted DNA sample fragments such that the biotin-containing linker 16 remains attached to the flow cell surface, and prior to using the flow cell 10, the method further comprises removing streptavidin 60 from the biotin-containing linker 16. Streptavidin 60 removal is depicted at F in
[0149] The flow cell 10 may then be used for a subsequent cycle of generating new fully adapted DNA sample fragments (e.g., going from F back to A in
[0150] When the flow cell 10 is used for the subsequent cycle of generating new fully adapted DNA sample fragments, the subsequent cycle of generating fully adapted DNA sample fragments includes: introducing a new plurality of the transposome complexes 38B into the flow channel 20, whereby at least some of the new plurality of the transposome complexes 38B attach to at least some of the biotin-containing linkers 16 within the flow channel 20; introducing a new DNA sample 54 and a new tagmentation buffer to the flow channel 20; and repeating the tagmentation, transposase enzyme 46 removal, and gap fill ligation with the new DNA sample 54. The repeated steps may be performed in the same manner as described herein. For example, streptavidin 60 may be added with the transposome complexes 38B to attach them to the biotin-containing linkers 16. The flow cell 10 may be used again and again to prepare fully adapted fragments 56A, 56B from several different DNA samples. In these examples, the fully adapted fragments 56A, 56B from several different DNA samples may be stored in the holding receptacle 26 and then introduced when it is desirable to perform amplification of all of the fragments.
[0151] When the flow cell 10 is used for amplification of at least some of the previously cleaved and fully adapted DNA sample fragments, the method involves attaching first and second primers 55, 57 to at least some of the biotin-containing linkers 16 within the flow channel 20 (see G); and introducing single stranded forms of the previously cleaved and fully adapted DNA sample fragments 56A, 56B into the flow cell 10.
[0152] While P5 and P7 primers are referenced, it is to be understood that other sequences may be used for the primers 55, 57, as long as the combination enables the desired amplification of the single stranded fully adapted DNA sample fragments 56A, 56B. The primers 55, 57 include biotin at the 5 end so that they can attach to the biotin-containing linkers 16 through streptavidin 60. Any of the avidin/streptavidin techniques described herein for attaching the transposome complexes 38B to the biotinylated polymeric hydrogel 30 may be used to attach the primers 55, 57.
[0153] Once the primers 55, 57 are attached, the single stranded fully adapted sample fragments 56A, 56B may be transported back to the flow channel 20, where each will seed in a depression 26 and undergo amplification as described in reference to
[0154] In the examples shown in
[0155] The flow cell 10 including the biotinylated polymeric hydrogel 30 may also be used for enrichment. Enrichment enables a target portion of the DNA sample 54, e.g., specific genetic variants in a given sample, to be isolated and analyzed. For this type of analysis, the target portion or region of interest may be enriched, e.g., which helps to separate the target portion from the remainder of the DNA sample 54. This enables the sequencing reads to be dedicated to the target portion. The enrichment techniques disclosed herein utilize on-flow cell hybridization and capture of the tagmented DNA fragments 58, 58 that correspond to the target portion. Examples are shown in
[0156] In each of the examples shown in
[0157] As shown in
[0158] In the example shown in
[0159] The first and second amplification domains 45C, 49D of the transposome complexes 38C, 38D have different sequences from each other (e.g., P7 and P5), but have the same sequence, respectively, as first and second primers (shown as 55 and 57 in I of
[0160] While not shown, it is to be understood that in each of the examples shown in
[0161] As shown in
[0162] In the transposome complex 38E, the transferred strand 42E includes a first amplification domain 45E and a sequencing primer sequence 47E that is attached to one strand ME of the transposon end 40E. In some examples, the transferred strand 42F includes an index sequence between the first amplification domain 45E and the sequencing primer sequence 47E. The strand ME of the transposon end 40E is positioned at the 3 end of the transferred strand 42E. Similar to the transferred strand 42E, the transferred strand 42F of the transposome complex 38F includes a second amplification domain 49F and a sequencing primer sequence 47F that is attached to one strand ME of the transposon end 40F. The strand ME of the transposon end 40F is positioned at the 3 end of the transferred strand 42F.
[0163] The first and second amplification domains 45E, 49F of the transposome complexes 38E, 38F have different sequences from each other (e.g., P7 and P5), but have the same sequence, respectively, as first and second primers (shown as 55 and 57 in I of
[0164] Similar to the sequencing primer sequences 47C, 47D, the sequencing primer sequences 47E, 47F have different sequences from each other that respectively bind to sequencing primers introduced into the flow cell after tagmentation and amplification.
[0165] The transposome complexes 38E, 38F are configured for asymmetric attachment to the flow cell surface (as shown in
[0166] Referring back to
[0167] When SDS or another chaotropic detergent has been used for transposase removal, the washing solution may be flushed through the flow channel prior to initiating the extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.
[0168] To initiate the extension reaction, an extension amplification mix is introduced into the flow cell 10. An example of the extension amplification mix includes nucleotides, a recombinase, a polymerase, and accessory proteins. The extension amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor, a surfactant (e.g., TWEEN polysorbates), and/or a co-solvent (e.g., glycerol, dimethylformamide, etc.). The ExAMP reagents available from Illumina Inc. are examples of suitable extension amplification mixes.
[0169] The flow cell 10 may be up to 60 C. (e.g., at about 38 C.) when the extension amplification mix is introduced.
[0170] At the outset of the extension reaction, the non-transferred strands 44C, 44D are dehybridized. Additional sequences (adapters) are added to the 3 ends of the partially adapted fragments (fragments 58, 58) by an extension reaction using the extension amplification mix. The extension reaction involves the addition of nucleotides in a template dependent fashion from 3 ends of the DNA fragments 58, 58 using the respective transferred strands 42C, 42D as the template. This extension is represented by the arrows in C of
[0171] The fully adapted DNA fragments are then cleaved by introducing a suitable cleaving agent for the cleavage site 52. Cleavage may be performed as described in reference to
[0172] The method shown in
[0173] The biotinylated capture probe 62 includes i) one or more single stranded deoxyribonucleic acid sequences that is/are complementary to the targeted region(s), and ii) biotin at an end for subsequent attachment with the avidin/streptavidin 60 on the flow cell surface. In its simplest form, the biotinylated capture probe 62 includes a single stranded sequence that is complementary to a target region of the DNA sample, with biotin at the end.
[0174] As shown in
[0175] The enrichment receptacle 26 is heated, and the biotinylated capture probe 62 (e.g., one or more side chains thereof) will hybridize to the target region of some of the single stranded, fully adapted DNA sample fragments 56C, 56D. This forms the enriched complexes 64.
[0176] While not shown in
[0177] The method shown in
[0178] In
[0179] The bound single stranded, fully adapted DNA sample fragments 56C, 56D (with the targeted region) can then be released from the biotinylated capture probes 62; and transported to the holding receptacle 26 (see G in
[0180] While the fragments 56C, 56D are in the holding receptacle 26, the method further comprises removing streptavidin 60 from the biotin-containing linker 16 in the flow channel 20 (see H in
[0181] The fragments 56C, 56D are then transported from the holding receptacle 26 back to the flow channel 20, where they will hybridize to one of the primers 55, 57 and undergo amplification as described herein. Two amplicons of one of the single stranded, fully adapted DNA sample fragments 56C, 56D are shown at J in
[0182] Referring now to
[0183] In this example, the biotinylated polymeric hydrogel 30 (within biotin-containing linkers 16) are present in the depressions 16 of the flow cell 10 (see A of
[0184] In this example, tagmentation forms partially adapted DNA sample fragments 58, 58, and thus the gap G (shown in
[0185] Without performing gap fill ligation, the partially adapted fragments (with the non-transferred strands 42 still attached) may be cleaved at cleavage site 52 using a cleaving agent as disclosed herein. The method then further includes denaturing the partially adapted DNA sample fragments from each other and to remove the non-transferred strands 44 to generate single stranded partially adapted DNA sample fragments 68A, 68B (shown at D in
[0186] In this example, the second amplification domain 49 has the same sequence as the primer 57 (e.g., P5) that is to be introduced into the flow cell 10, and the resulting fully adapted fragments 56E, 56F will include a complement 45 of the first amplification domain 45 (e.g., P7) of the transposome complex 38A. Thus, the fully adapted fragments 56E, 56F shown in the bottom part of D include 45 (e.g., P7), which can hybridize to the flow cell primer 55 (e.g., P7) to initiate amplification. In the enrichment receptacle 26, the extension reaction may be performed as described herein. The resulting fully adapted fragments 56E, 56F can then be cleaved from the receptacle 26.
[0187] While the fragments 56E, 56F are in the enrichment receptacle 26, the method further comprises removing streptavidin 60 from the biotin-containing linker 16 in the flow channel 20; and attaching first and second primers 55, 57 (e.g., P7, P5) to at least some of the biotin-containing linkers 16 within the flow channel 20 (see F in
[0188] After enrichment (D in
[0189] The example methods shown in
[0190] The biotinylated dDpn1 70 is attached to the flow cell surface via streptavidin 60 and the biotin-containing linkers 16. When DNA sample is introduced into the flow cell 10, methylated bacterial DNA 72 within the DNA sample is captured by the biotinylated dDpn1 70.
[0191] After methylated bacterial DNA 72 capture, any of the wash solutions disclosed herein may be used to remove uncaptured DNA sample from the flow cell 10.
[0192] Once the uncaptured DNA sample and wash solution are removed, the methylated bacterial DNA 72 may then be released from the biotinylated dDpn1 70 using a solution containing Mg.sup.2+, proteinase K, or SDS. Proteinase K or SDS is likely to release the biotinylated dDpn1 70 and the methylated bacterial DNA 72. In the latter instances, the biotinylated dDpn1 70 would be separated from the methylated bacterial DNA 72.
[0193] In one specific example, Mg.sup.2+ is used to release the captured methylated bacterial DNA 72. In this example, after the methylated bacterial DNA 72 is released, it is transported to the holding receptacle 26 while the biotinylated dDpn1 70 is removed. In one example, the biotinylated dDpn1 70 is removed with the streptavidin 60. In this example, the biotin streptavidin cleavage composition may be introduced into the flow cell 10, which will break the biotin-streptavidin interactions, thus releasing the biotinylated dDpn1 70 from the streptavidin 60 and releasing the streptavidin from the biotin-containing linker 16. In another example, the biotinylated dDpn1 70 may include another cleavable group, and a cleaving agent for that group may be used to remove the biotinylated dDpn1 70. As examples, the cleaving agent may be an enzymatic cleaving agent or an acid. Proteinase K or SDS may be used to remove the biotinylated dDpn1 70.
[0194] The replenishment of the streptavidin 60, introduction of the transposome complexes 38C, 38D and the biotinylated primers 55, 57, tagmentation, and amplification may be performed as described herein.
Light Activating Flow Cell Surface
[0195] Other examples of the flow cell 10 include the visible light responsive member 18, which enables at least a portion of the flow cell surface to be selectively activated at a desirable time for a desirable reaction. These flow cells 10 may be used in a method that includes introducing a tagmentation entity (e.g., transposome complexes 38), having a first visible light responsive member 18A attached thereto, to a flow cell 10 having a second visible light responsive member 18B attached thereto; and exposing a predetermined area of the flow cell 10 to visible light while the tagmentation entity is present in the flow cell 10, thereby coupling the first and second visible light responsive members 18A, 18B and attaching the tagmentation entity to the flow cell 10 at the predetermined area. Several example methods are shown in
[0196] In these examples, the tagmentation entity 74 may be any of the transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F described herein. The process that is performed to generate the fully adapted DNA fragments 56 (e.g., gap fill ligation, extension reaction, etc.) will depend upon the type of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F that is used.
[0197] Also in these examples, the visible light responsive members 18A, 18B may be any examples of the visible light responsive members 18 described herein in reference to
[0198] In the examples shown in
[0199] When the tagmentation entity 74 is introduced into the flow channel 20, a specific region (e.g., region 76A in
[0200] In the example shown in
[0201] In
[0202] As shown in
[0203] In the example shown in
[0204] The light responsive members 18A, 18B are not active unless they are exposed to visible light, and thus the light responsive members 18A, 18B present in any regions 76B, 76C of the flow cell 10 that are not exposed to visible light will not attach the tagmentation entity 74. In
[0205] After coupling of the tagmentation entity 74 in the desired region 76A, the remaining unbound tagmentation entities 74 are removed from the flow channel 20 using an example of the washing solution set forth herein.
[0206] In the example shown in
[0207] In
[0208] In
[0209] At each area/region 76A, 76B, 76C, tagmentation and transposase 46 inactivation may be performed before performing a suitable reaction for generating fully adapted DNA sample fragments and ultimately single stranded, fully adapted DNA sample fragments 56 (not shown in
[0210] Once all of the desired regions 76A, 76B, 76C have the desired tagmentation entity 74 attached, the desired DNA sample 54 tagmented, and the transposase enzymes 46 removed, the fully adapted DNA sample fragments may be generated using gap fill ligation or an extension reaction depending upon the transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F. These processes may be respectively performed as described herein.
[0211] As noted above, each depression 26 may be configured with primers 55, 57 for amplification and cluster generation of the fully adapted DNA sample fragments 56. These processes may be performed as described herein.
[0212] If it is desirable, cleavage of the forward and/or reverse fully adapted DNA sample fragments may take place, followed by denaturation. If desirable for a particular workflow, the cleaved and single stranded fully adapted DNA sample fragments 56 may be transported to another area, e.g., on the flow cell 10 off of the flow cell 10, for enrichment as described herein.
[0213] After amplification and cluster generation, sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
[0214] The examples shown in
[0215] In
[0216] When transposome complexes 38A or 38B or 38C and 38D, or 38E and 38F (which include the visible light responsive member 18A) are to be attached in the area 80, a fluid containing the desired transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F may be introduced into the flow cell 10 and the tagmentation area 80 may be exposed to visible light using any of the light sources 78 described herein (not shown in
[0217] When primers 55, 57 are to be attached in the area 84, a fluid containing the primers 55, 57 (having the visible light responsive member 18B at the 5 end) may be introduced into the flow cell 10 and the clustering area 84 may be exposed to visible light. The visible light responsive members 18A, 18B that are exposed to the visible light will undergo a coupling reaction to attach the primers 55, 57 within the depressions 26 or the portion of the lane 36 in the clustering area 84.
[0218] It is to be understood that transposome complex 38 attachment and primer 55, 57 attachment may take place in any order, as long as transposome complex 38 attachment takes place before DNA sample 54 introduction.
[0219] Once fully adapted fragments are generated in the tagmentation area 80 and once the primers 55, 57 are attached in the clustering area 84, a cleaving agent may be introduced into the flow channel 20 to cleave the fully adapted fragments. Flow may be directed toward the denaturation area 82, where the fully adapted fragments are denatured to form single stranded fully adapted fragments (e.g., 56) which then move to the clustering area 84 where they are seeded and amplified.
[0220] In
[0221] When transposome complexes 38A or 38B or 38C and 38D, or 38E and 38F (which include the visible light responsive member 18A) are to be attached, a fluid containing the transposome complexes 38A or 38B or 38C and 38D, or 38E and 38F (which include the visible light responsive member 18A) may be introduced into the flow cell 10 and the tagmentation area 80 may be exposed to visible light using any of the light sources 78 described herein (not shown in
[0222] When probes 62 (which are similar to probes 62, except that the visible light responsive member 18B is positioned at the end instead of biotin) are to be attached, a fluid containing the probes 62 may be introduced into the flow cell 10 and the enrichment area 86 may be exposed to visible light. The visible light responsive members 18A, 18B that are exposed to the visible light will undergo a coupling reaction to attach the probes 62 within the depressions 26 or the portion of the lane 36 in the enrichment area 86.
[0223] Once fully adapted fragments are generated in the tagmentation area 80 and the probes 62 are attached in the enrichment area 86, but before the primers 55, 57 are attached in the clustering area 84, a cleaving agent may be introduced into the flow channel 20 to cleave the fully adapted fragments. Flow may be directed toward the denaturation area 82, where the fully adapted fragments are exposed to heat and denatured to form the single stranded fully adapted fragments (e.g., 56A, 56B, etc.) which then move to the enrichment area 86, where fragments including the target region are hybridized to the probes 62. A wash solution may be introduced to flush out any fragments that do not include the target region and thus are not attached within the enrichment area 86.
[0224] While the fragments including the target region are hybridized to the probes 62, the primers 55, 57 may be introduced into the flow cell channel 20. A fluid containing the primers 55, 57 (having the visible light responsive member 18B attached at the 5 end) may be introduced into the flow cell 10 and the clustering area 84 may be exposed to visible light. The visible light responsive members 18A, 18B exposed to visible light from the light source 78 undergo a coupling reaction to attach the primers 55, 57 within the depressions 26 or the portion of the lane 36 in the clustering area 84.
[0225] Once the primers 55, 57 are attached, the fragments including the target region may be dehybridized from the probes 62 and transported to the clustering area 84 where they are seeded and amplified.
[0226] In
[0227] When transposome complexes 38A or 38C and 38D, or 38E and 38F (which include the visible light responsive member 18A) are to be attached, a fluid containing the transposome complexes 38A or 38C and 38D, or 38E and 38F (which include the visible light responsive member 18A) may be introduced into the flow cell 10 and the tagmentation area 80 may be exposed to visible light using any of the light sources 78 described herein (not shown in
[0228] The amplicon hybridization and extension area 88 is an area where the partially adapted DNA fragments can be hybridized and extended to introduce suitable adapters for amplification. Specific sequences 90 are introduced to the surface of amplicon hybridization and extension area 88. These sequences 90 have a portion that can hybridize to the partially adapted fragment, a portion that is a complement of the adapter that is to be added, and have the light responsive member 18A at the 5 end. A fluid containing the sequences 90 may be introduced into the flow cell 10 and the amplicon hybridization and extension area 88 may be exposed to visible light. The visible light responsive members 18A, 18B undergo a coupling reaction to attach the sequences 90 within the depressions 26 or the portion of the lane 36 in the amplicon hybridization and extension area 88.
[0229] Once the partially adapted fragments are generated in the tagmentation area 80 and the sequences 90 are attached in the amplicon hybridization and extension area 88, but before the primers 55, 57 are attached in the clustering area 84, a cleaving agent may be introduced into the flow channel 20 to cleave the partially adapted fragments. Flow may be directed toward the denaturation area 82, where the partially adapted fragments are heated and denatured to form single strands, which then move to the amplicon hybridization and extension area 88, where the single stranded partially adapted fragments are hybridized to the sequences 90. An extension mix may be introduced to add the adapters and extend the partially adapted fragments into fully adapted fragments.
[0230] While the fully adapted fragments are hybridized to the sequences 90, the primers 55, 57 may be introduced into the flow cell channel 20. A fluid containing the primers 55, 57 (having the visible light responsive member 18A at the 5 end) may be introduced into the flow cell 10 and the clustering area 84 may be exposed to visible light. The exposed visible light responsive members 18A, 18B undergo a coupling reaction to attach the primers 55, 57 within the depressions 26 or the portion of the lane 36 in the clustering area 84.
[0231] Once the primers 55, 57 are attached, the fully adapted fragments may be dehybridized from the sequences 90 and transported to the clustering region 84 where they are seeded and amplified.
[0232] The examples shown in
Activating Flow Cell Surfaces with a Protective Coating
[0233]
[0234] The flow cell 10 is similar to that shown in
[0235] The removable coating 92 overlies the depressions 26 (and any surface chemistry therein) and the interstitial regions 34. The removable coating 92 may be any material that melts, collapses, softens, solubilizes, or permeabilizes upon exposure to a predetermined stimulus, such as light, heat, or a pH change.
[0236] Removable coatings 92 that are responsive to light are made of photocleavable materials.
[0237] In some examples, the light removable coating is a hydrophilic polymer cross-linked with a photo-cleavable cross-linker, an acid-labile cross-linker, and/or a heat-labile crosslinker. In one specific example, the hydrophilic polymer is a polyvinyl alcohol/polyethylene glycol graft copolymer, and the photo-cleavable cross-linker is a coumarin or o-nitrobenzyl moiety. The coumarin or o-nitrobenzyl moieties may covalently conjugate with poly(ethylene glycol) of the polyvinyl alcohol/polyethylene glycol graft copolymer. The coumarin or o-nitrobenzyl is cleavable upon exposure to ultraviolet (UV) (100 nm to 400 nm) or blue light (450 nm to 495 nm), which leads to decreased cross-linking density of the coating. Thus, upon light exposure, the cleaved polymer coating becomes hydrophilic and washable by an aqueous solution. In another example, the hydrophilic polymer is a polyvinyl alcohol/polyethylene glycol graft copolymer, and the photo-cleavable cross-linker is an acid-labile cross-linker. In this example, the acid-labile cross-linker is an acetal moiety. With the acid-labile cross-linker, an acid species can be generated in the presence of a photoacid generator (PAG) and upon exposure to UV light, which changes the pH and cleaves the cross-linker, thus rendering the polymeric coating more soluble (and easily removable via rinsing).
[0238] In other examples, the light removable coating is a hydrophilic polymer capped with a photo-cleavable hydrophobic group or an acid-labile group. The photo-cleavable hydrophobic groups or acid-labile groups are protective groups on the polymer side chains that render the polymer more hydrophobic. These examples undergo a phase transition from hydrophobic to hydrophilic upon exposure to light. In an example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol/polyethylene glycol graft copolymer, which is functionalized with the photo-cleavable hydrophobic group, such as a coumarin or o-nitrobenzyl moiety. These photo-cleavable groups are generally hydrophobic, which prevents the coating 92 from being removed and washed away by an aqueous solution. Upon exposure to UV or visible light, these hydrophobic groups will be cleaved, returning the removable coating 92 back to its hydrophilic form. In another example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol/polyethylene glycol graft copolymer, which is functionalized with an acid-labile group. An acid species can be generated in the presence of a photoacid generator (PAG) and upon exposure to UV light, which cleaves the acid-labile group. In one example, the cleavage of tert-butyl carbonate groups leads to the hydrophilic polyphenol coating, which is washable and removable by an aqueous solution.
[0239] In still other examples, the light removable coating is a thermo-responsive polymer and a photo-thermal additive (or photo-thermal filler). The thermo-responsive polymer may be selected from the group consisting of polylactic acid, poly(lactic-co-glycolic) acid, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrins, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and a combination thereof. The photo-thermal additive or photo-thermal filler included in the composite may be nano-sized or any micro-sized structures that absorb light (e.g., photonic) energy at a certain wavelength range and convert the absorbed energy to heat. The photo-thermal filler (or photo-thermal additive) may be selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole particles, graphene sheets, carbon nanotubes, carbon nanodots, black phosphorus particles, azobenzene particles, and combinations thereof. Upon exposure to UV or visible light, energy absorbed by the photo-thermal additive(s) is converted to heat, which induces a phase transition in the polymer matrix (due to the presence of the thermo-responsive polymer). This phase transition causes this light removable coating to soften or dissolve. The softened or dissolved coating can then be removed using an aqueous solvent.
[0240] Still other light removable coatings are light and pH responsive. With these coatings, exposure to light induces proton release. Examples of these light removable coatings include 2-Naphthol-6,8-disulfonic acid or 1,2-Naphthoquinone-2-diazide-5-sulfonic acid.
[0241] Heat removable coatings are made of thermo-responsive materials. As an example, the thermo-responsive material may be a polymer, a wax, or a myristic acid that melts upon reaching a certain temperature. As another example, the thermo-responsive material may be a polymer that transitions from a hydrophobic state to a hydrophilic state upon reaching a certain temperature, e.g., UCST (upper critical solution temperature) polymers, such as poly(acrylamide-co-acrylonitrile). As yet another example, the thermo-responsive material may be a polymer that transitions form a hydrophilic state to a hydrophobic state upon reaching a certain temperature, e.g., LCST (lower critical solution temperature) polymers, such as poly(N-isopropylacrylamide) or PNIPAAm, which has a transition temperature of about 32 C.-44 C. In a specific example, the heat removable coating may include a polymer that is selected from the group consisting of polylactic acid, poly(lactic-co-glycolic) acid, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrins, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and a combination thereof. Another suitable thermo-responsive material is made up of a hydrophilic polymer cross-linked with the heat-labile cross-linker. An example of the heat-labile cross-linker is disuccinimidyl adipate (DSA). DSA is a homobifunctional cross-linker with two NHS ester groups. The NHS esters react with primary amines to form stable amide bonds. DSA reacts with primary amines, creating a covalent linkage through amide bond formation. DSA contains a linker that is susceptible to hydrolysis under elevated temperatures. As still another example, the thermo-responsive material may be a gel, such as hydroxypropyl methylcellulose, which has a viscosity linked to temperature.
[0242] pH change removable coatings are made of, or include, pH responsive materials. Alternatively, the pH responsive material may be adjacent to the removable coating. Examples of polymers that are soluble in aqueous solutions having different PH levels include chitosan, which is soluble under acidic conditions, and copolymers of non-water soluble monomers with amine functional monomers, which are tunable to dissolve at different pHs depending on the content of the amino functional monomer. One example of the copolymer is dimethylaminoethyl methacrylate, which is soluble under basic conditions. Other examples of pH responsive polymers are those that are commercially available under the tradename EUDRAGIT from Evonik. As described herein, light and/or heat may be used to generate a local pH change.
[0243] The method shown in
[0244] In
[0245] While the DNA sample 54 is present in the flow channel 20, the predetermined area 76A of the flow cell 10 is exposed to the stimulus that melts, solubilizes, or permeabilizes the removable coating 92. This is depicted in
[0246] When light is the stimulus, any suitable visible light source 78 may be used to illuminate the desired area/region 76A, 76B, 76C of the flow cell 10. While the light source 78 is shown in
[0247] When heat is the stimulus, any suitable heating mechanism may be used. The heating mechanism may be included in a complementary metal oxide semiconductor chip that coupled to the flow cell substrate 12, 14, included as part of the lid of the flow cell 10, or included/embedded in the flow cell substrate 12, 14, or deposited within the depressions 26. Examples of the heating mechanism may include one or more electrode materials that are capable of converting electricity to a suitable amount of thermal energy to heat up the desired portion of the removable coating 92. In other examples, an external heating mechanism may be used, such as a heater of a sequencing instrument in which the flow cell 10 is positioned.
[0248] In some instances when heat is the removal mechanism, the other area(s) 76B. 76C of the flow channel 20 may be actively cooled while the area 76A is heated. Localized cooling may be performed with an active cooling system of an external heater (e.g., a Peltier). It is to be understood that while localized cooling may be used, it may not be used when the heating is localized to the desired area 76A. In other words, the heating mechanism can be used to locally heat an area where the coating 92 is to be removed, and the other area(s) may remain unheated.
[0249] When a pH change is the stimulus, the pH change may be initiated by altering the temperature at the predetermined area 76A, 76B, 76C. In some examples, PH levels decrease with an increase in temperature, and thus the heating mechanism may be used to induce a localized change in pH. In an example, a buffer that decreases pH with an increase in temperature, such as an acetate buffer, a citrate buffer, or a phosphate buffer, may be added to the flow cell 10 prior to localized heating. In another example, a buffer that increases pH with an increase in temperature, such as a borate buffer, may be added to the flow cell 10 prior to localized heating. In still another example, a buffer that can increase or decrease pH with an increase in temperature, such as a glycine buffer, may be added to the flow cell 10 prior to localized heating. In other examples, an acid (or another source of pH-lowering H+ ions) may be generated in the vicinity of an electrode that is adjacent to the predetermined area 76A (e.g., in the lid, substrate 12, 14, etc.), and the acid or source of pH-lowering H+ ions lowers the pH. In still other examples, an acid (or another source of pH-lowering H+ ions) may be generated when the predetermined area 76A is exposed to light. The light exposure induces a photocatalytic reaction, and thus proton release in the desired area for coating removal. Thus, the pH change is coupled with a temperature change or light exposure, which enables the spatial control.
[0250] Exposure of a portion of the removable coating 92 to the stimulus melts, solubilizes, or permeabilizes the portion of the removable coating 92 located at the predetermined area 76A. The removal of the portion of the removable coating 92 exposes the transposome complexes 38E, 38F at the area/region 76A. This allows the DNA sample 54 to bind at these transposome complexes 38E, 38F. Tagmentation may be then initiated in the area/region 76A. Tagmentation may be performed as described herein.
[0251] After tagmentation is performed in the desired region 76A, the flow channel 20 may be washed using an example of the washing solution set forth herein to remove the melted, solubilized, or permeabilized portion of the removable coating 92 and tagmentation reagents.
[0252] In
[0253] The processes of DNA sample 54 addition, triggering the localized removal of the removable coating 92 in another predetermined area, e.g., 76B or 76C, tagmentation, and removal of the transposase enzyme 46 can then be repeated for as many DNA samples 54 and areas as desired and/or possible within a given flow channel 20. This will allow multiple DNA samples 54, 54B to be tagmented in the respective areas 76A, 76B, etc., which will persist through clustering. The addition of the second DNA sample 54B, the removal of the second portion of the removable coating 92 in predetermined area 76B, and the tagmentation of the second DNA sample 54B is shown in
[0254] The repeated processes are performed before performing a suitable reaction for generating fully adapted DNA sample fragments (not shown in
[0255] As noted above, each depression 26 may be configured with primers 55, 57 for amplification and cluster generation. Amplification and cluster generation may be performed as described herein. Cleavage of either the forward or reverse fully adapted DNA sample fragments may then be performed. Denaturation will release the cleaved fragment, leaving the other (e.g., reverse or forward) single stranded fully adapted fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.
[0256] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
Activating Flow Cell Surfaces with Encapsulated Tagmentation Entity
[0257]
[0258] The flow cell 10 is similar to that shown in
[0259] The encapsulated complex includes an example of the tagmentation entity 74 surrounded by a coating material 98. In this example, the tagmentation entity 74 is a catalytic metal ion 96, such as Mg.sup.2+, Mn.sup.2+, etc. that catalyzes tagmentation.
[0260] The coating material 98 is removable upon exposure to a release mechanism/stimulus, such as temperature, light, or pH. Any of the temperature, light, or pH responsive materials set forth herein for the removable coating 92 may be used for the coating material 98. While the light source 78 is shown in
[0261] Another example of a temperature responsive coating material is a temperature sensitive wax or fatty acid; and triggering release of the catalytic metal ion 96 involves heating the predetermined area 76A, 76B, 76C to above a melting temperature of the temperature sensitive wax. Some examples of suitable temperature sensitive waxes include myristic acid, palmitic acid, paraffin wax, spermaceti or soy wax, each of which melts at a temperature ranging from about 40 C. to about 50 C. Other examples of suitable temperature sensitive waxes include stearic acid, beeswax, microcrystalline polyethylene wax, or carnauba wax, each of which melts at a temperature ranging from about 60 C. to about 80 C. In these examples, the predetermined area 76A, 76B, 76C is heated to the desired temperature to melt the wax and release the catalytic metal ion 96. Still another example of a temperature responsive coating material is a temperature sensitive polymer; and triggering release of the catalytic metal ion 96 involves heating the flow cell 10 above a solubilization temperature of the temperature sensitive polymer. Examples of suitable temperature sensitive polymers include UCST polymers, i.e. poly(acrylamide-co-acrylonitrile), hydroxypropyl methylcellulose, agarose, or gelatin, each of which solubilizes at a temperature greater than 30 C. Other examples of suitable temperature sensitive polymers include LCST polymers, i.e., poly(N-isopropylacrylamide), methylcellulose, or poloxamer, each of which solubilizes at a temperature less than 30 C. In these examples, the predetermined area 76A, 76B, 76C is heated to the desired temperature to solubilize the polymer and release the catalytic metal ion 96.
[0262] Some specific examples of suitable pH sensitive polymers for the coating material include EUDRAGIT L100 (methacrylic acid copolymer, type B from Evonik, Inc.) or KOLLICOAT MAE-100 (methacrylic acid copolymer, type A from BASF Corp.), each of which is soluble at pH greater than 6. Other examples of suitable pH sensitive polymers include EUDRAGIT RL/RS 100 (methacrylic acid copolymers from Evonik, Inc.) or carboxymethyl cellulose, each of which is soluble at pH greater than 8. Still other examples of suitable pH sensitive polymers include EUDRAGIT E (amino dimethyl methacryate copolymer from Evonik, Inc.) or chitosan, each of which is soluble at pH less than 3. In these examples, the pH of the predetermined region 76A, 76B, 76C is adjusted to be lower than the pH at which the polymer is sensitive (e.g., if solubility is pH X or lower) or to be higher than the pH at which the polymer is sensitive (e.g., if solubility is pH X or higher), and the polymer solubilizes. Solubilization of the polymer releases the catalytic metal ion 96.
[0263] The encapsulated complex 94 may be formed by generating a dispersion of the coating material 98, spray coating the dispersion in a fluidized bed onto the catalytic metal ion 96, and allowing the complex to dry. Alternative forms of drying could be used, such as freeze drying, vacuum drying, or microwave assisted drying. The dried product could subsequently be powderized into small matrix particles containing a mixture of the trigger material and the catalytic metal. Other suitable coating techniques, such a pan coating, spray drying, etc., may be used that effectively form a film of the coating material 98 over the catalytic metal ion 96.
[0264] The method shown in
[0265] In
[0266] While the DNA sample 54 is present in the flow channel 20, the predetermined area 76A of the flow cell 10 is exposed to the stimulus that melts, solubilizes, or permeabilizes the coating material 98. The removal of the coating material 98 from the encapsulated complex 94 releases the catalytic material 96 in the predetermined area 76A. This is depicted in
[0267] After tagmentation is performed in the desired region 76A, the flow channel 20 may be washed using an example of the washing solution set forth herein to remove the melted, solubilized, or permeabilized portion of the coating material 98 and tagmentation reagents.
[0268] In
[0269] This example method then involves reintroducing transposase enzymes 46. This is shown in
[0270] The processes of DNA sample 54 addition, triggering the localized release of the catalytic metal 96 in another predetermined area, e.g., 76B or 76C, tagmentation, removal of the transposase enzyme 46, the catalytic metal ion 96, and the bound but untagmented DNA sample 54, and reintroduction of transposase enzymes 46 can then be repeated for as many DNA samples 54 and areas as desired and/or possible within a given flow channel 20. This will allow multiple DNA samples 54, 54B to be tagmented in the respective areas 76A, 76B, etc., which will persist through clustering. The addition of the second DNA sample 54B, the localized release of the catalytic metal 96 in the predetermined area 76B, and the tagmentation of the second DNA sample 54B is shown in
[0271] The repeated processes are performed before performing a suitable reaction for generating fully adapted DNA sample fragments (not shown in
[0272] As noted above, each depression 26 may be configured with primers 55, 57 for amplification and cluster generation. Amplification and cluster generation may be performed as described herein. Cleavage of either the forward or reverse fully adapted DNA sample fragments may then be performed. Denaturation will release the cleaved fragment, leaving the other (e.g., reverse or forward) single stranded fully adapted fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.
[0273] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
Heat Activating Flow Cell Surfaces
[0274]
[0275] The flow cell 10 is similar to that shown in
[0276] The method shown in
[0277] In
[0278] While localized heating is performed, localized cooling may also be performed in the other areas 76B, 76C where tagmentation is not to be initiated. In an example, the cooling temperature is at or below 18 C. Localized cooling may be accomplished using any of the cooling mechanisms described herein. Cooling to the lower temperature helps to inhibit the transposome complex 38E, 38F activation and prevent tagmentation in the areas 76B, 76C where tagmentation is undesirable.
[0279] Once the desired area 76A is heated and the other area(s) 76B, 76C is/are cooled (if desired), the first DNA sample 54 is introduced into the flow channel 20. The first DNA sample 54 may be introduced in a suitable liquid (water, buffer etc.) through the inlet. In one example, a pump of a sequencing instrument, in which the flow cell 10 is operatively positioned, may be used to transport the first DNA sample 54 into the flow channel 20. The DNA sample 54 can bind to the transposome complexes 38E, 38F in each of the predetermined areas 76A, 76B, 76C, but tagmentation only occurs in the heated area, e.g., area 76A in
[0280] After tagmentation is performed in the desired region 76A, the flow channel 20 may be washed using an example of the washing solution set forth herein to remove tagmentation reagents.
[0281] The method shown in
[0282] In
[0283] As mentioned, this example method then involves reintroducing transposase enzymes 46. This is shown in
[0284] The processes of localized heating and cooling, DNA sample 54 addition, removal of the transposase enzyme 46 and bound but untagmented DNA sample 54, and reintroduction of transposase enzymes 46 can then be repeated for as many DNA samples 54 and areas as desired and/or possible within a given flow channel 20. This will allow multiple DNA samples 54, 54B to be tagmented in the respective areas 76A, 76B, etc., which will persist through clustering. The addition of the second DNA sample 54B and localized heating is shown in
[0285] The repeated processes are performed before performing a suitable reaction for generating fully adapted DNA sample fragments (not shown in
[0286] As noted above, each depression 26 may be configured with primers 55, 57 for amplification and cluster generation. Amplification and cluster generation may be performed as described herein. Cleavage of either the forward or reverse fully adapted DNA sample fragments may then be performed. Denaturation will release the cleaved fragment, leaving the other (e.g., reverse or forward) single stranded fully adapted fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.
[0287] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
Selective Capture of DNA Samples
[0288] The top view portion of
[0289] The flow cell lane 36 is similar to that shown in
[0290] In these examples, the flow cell lane 36 is divided into at least two regions/areas 76A, 76B. The number of regions/areas 76A, 76B depends upon the number of different samples that are to be introduced to the flow cell lane 36. The number of regions/areas 76A, 76B is also limited by the dimensions of the lane 36.
[0291] The regions/areas 76A, 76B, 76C, 76D, 76E, 76F are defined by the particular type of target primer, see reference numerals 100A, 100B, 100C, 100D, 100E, 100F in
[0292] Each target primer 100 in a given region 76A, 76B, 76C, 76D, 76E, or 76F of the flow cell 10 has the same sequence as each other target primer 100 in that region 76A, 76B, 76C, 76D, 76E, or 76F, and this sequence is complementary to the sequence of a spatial tag 102 that is to be hybridized thereto. The target primers 100D in one region 76D are orthogonal to the target primers 100A, 100B, 100C, 100E, and 100F in each other region 76A, 76B, 76C, 76E, and 76F. By orthogonal when the term is used to describe the target primers 100, it is meant that the target primers 100D in one region 76D have a different oligonucleotide sequence than the target primers 100A, 100B, 100C, 100E, and 100F in each other region 76A, 76B, 76C, 76E, and 76F, and thus the target primers 102A, 102B, 102C, 102D, 102E, 102F in the respective regions 76A, 76B, 76C, 76D, 76E, 76F are capable of hybridizing only to respective complementary spatial tags 102A, 102B, 102C, 102D, 102E, 102F.
[0293] The 5 end of the target primers 100 includes a functional group that attaches it to the polymeric hydrogel 30 or 32. In the method that utilizes the passivation component (see 104 and 106 in
[0294] The different groups of target primers 100A, 100B, etc. may be sequentially dispensed in the region/area 76A, 76B, etc. using a high precision coating method. In one example, high precision coating is achieved using a precision gantry tool. In other examples, the high precision coating method is performed using stripe coating or patch coating with a slot-die coating tool. The high precision coating method may further be used with other coating methods, such as spray coating or jetting, e.g., via inkjet. In an example, a first group of target primers 100A may be dispensed at the region 76A, and allowed to incubate so they graft to the polymeric hydrogel 30 or 32. When biotin-avidin/streptavidin-biotin linkages are used, the avidin/streptavidin 60 may be attached or introduced in accordance with any of the examples set forth herein.
[0295] The flow cell 10 including the lane 36 shown in
[0296] Each fluid in the kit includes a liquid carrier and a first plurality of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F dispersed in the liquid carrier, where each of the transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F includes a spatial tag 102 that is complementary to the target primers 100 attached in one of the regions 76A, 76B, 76C, 76D, 76E, or 76F. For example, the fluid that is to be used with the region 76D includes transposome complexes 38E and 38F which includes spatial tags 102D whose sequences are complementary to the target primers 100D. As one specific example, the spatial tags 10D may be attached to each of 3 end of the non-transferred strand (e.g., at 48E in
[0297] The liquid carrier of the respective fluids may be water. A buffer and/or salt may be added to the carrier liquid. The buffer has a pH ranging from 5 to 12. Example of neutral buffers include Tris(hydroxymethyl) aminomethane (Tris or TRIS) buffers, such as Tris-HCl or Tris-EDTA, or a carbonate buffer (e.g., 0.25 M to 1 M). Sodium sulfate (e.g., 1 M to 2 M) is a suitable salt that may be used. The transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F may be included in the carrier liquid in a concentration ranging from about 0.1 M to about 1 M.
[0298] As mentioned, any of the transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F described herein may be used. In this example, each of the transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F further includes one of the spatial tags 102A, 102B, 102C. 102D, 102E, or 102F. The spatial tag 102 is an oligonucleotide primer that is complementary to the target primer 100 contained within the region 76A, 76B, etc. of the flow cell 10 with which the fluid (containing the transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F and spatial tags 102) is to be used. Thus, the spatial tag 102A, 102B, etc. used in each fluid will depend upon the corresponding region 76A, 76B, etc. and the target primers 100A, 100B, etc. in that region 76A, 76B, etc.
[0299] When the transposome complex 38A (
[0300] An example method for making the lane 36 shown in
[0301] Two example methods for using the flow cell lane 36 of
[0302] One example method includes i) generating fully adapted first DNA sample fragments in the first region 76A of the flow cell 10 by introducing the first fluid (including the first plurality of transposome complexes 38A, or 38B, etc.) into the flow cell 10 at a hybridization temperature, whereby the first spatial tags 102A respectively hybridize to the target primers 100A attached within the depressions 26 located at the first region 76A of the flow cell 10, introducing a first DNA sample 54 into the flow cell 10, whereby the first DNA sample 54 is tagmented by the first plurality of transposome complexes 38A, or 38B, etc., removing a transposase enzyme 46 of each of the first plurality of transposome complexes 38A, or 38B, etc., and performing gap fill ligation or an extension reaction; and ii) generating fully adapted second DNA sample fragments in the second region 76B of the flow cell 10 by introducing the second fluid into the flow cell 10 at a hybridization temperature, whereby the second spatial tags 102B respectively hybridize to the target primers 100B attached within the depressions 26 located at the second region 76B of the flow cell 10, introducing a second DNA sample 54B into the flow cell 10, whereby the second DNA sample 54B is tagmented by the second plurality of transposome complexes 38A, or 38B, etc., removing a transposase enzyme 46 of each of the second plurality of transposome complexes 38A, or 38B, etc., and performing gap fill ligation or an extension reaction.
[0303] At the outset of this example method, the first fluid (including the first plurality of transposome complexes 38A, or 38B, etc. with the first spatial tag 102A) is introduced into the flow cell lane 36. The first fluid may be introduced through the inlet. In one example, a pump of the sequencing instrument may be used to transport the first fluid into the lane 36.
[0304] The temperature of the flow cell lane 36 is at or is brought to a hybridization temperature so that the first spatial tags 102A respectively hybridize to the complementary target primers 100A located at the first region 76A. Because the target primers 100B, 100C, 100D, 100E, and 100F located in other regions 76B, 76C, 76D, 76E, and 76F are not complementary to the first spatial tags 100A, the first plurality of transposome complexes 38A, or 38B, etc. will not bind in these regions 76B, 76C, 76D, 76E, and 76F.
[0305] The first DNA sample 54 is then introduced into the flow cell lane 36 as described herein (e.g., with a tagmentation buffer). Because the first plurality of transposome complexes 38A, or 38B, etc. is the only group of transposome complexes 38A, or 38B, etc. within the lane 36, the first DNA sample 54 will be tagmented by the first plurality of transposome complexes 38A, or 38B, etc. Tagmentation may be performed as described herein.
[0306] In this example method, the transposase enzyme 46 of each of the first plurality of transposome complexes 38A, or 38B, etc. is then removed. Transposase enzyme 46 removal may be performed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS) or proteinase or another chaotropic agent, or by heating the flow cell to about 60 C.). The released transposase enzymes 46 may be removed from the flow cell 10 using the wash solution.
[0307] The fully adapted DNA fragments 56 may be formed in the first region 76A using performing gap fill ligation or an extension reaction as described herein, and the process used will depend upon the transposome complex 38A, or 38B, or 38C and 38D, or 38E and 38F that used.
[0308] All of these processes can be performed with a second fluid (including the second plurality of transposome complexes 38A, or 38B, etc. with the second spatial tag 102B) and a second DNA sample 54B to generate fully adapted second DNA sample fragments in the second region 76B. The processes can then again be repeated for as many fluids, DNA samples, and areas/regions 76C, 76D, 76E, 76F as desired and/or possible within a given flow cell lane 36. This will allow multiple DNA samples 54, 54B to be tagmented in the respective areas 76A, 76B, etc., which will persist through clustering.
[0309] Because the transposome complexes 38A, or 38B, etc. are introduced sequentially and are attached only in the regions 76A, 76B, 76C, etc. at which they are capable of hybridizing, the transposome complexes 38A, or 38B, etc. in a particular fluid may include an index sequence in the transferred strand 42 and/or in an adapter 50 introduced to the flow cell 10. This enables standard indexing in addition to the spatial indexing.
[0310] Once all of the fully adapted DNA sample fragments 56 are generated, amplification and cluster generation may be performed as described herein. Cleavage of either the forward or reverse fully adapted DNA sample fragments may then be performed. Denaturation will release the cleaved fragment, leaving the other (e.g., reverse or forward) single stranded fully adapted fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.
[0311] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
[0312] Another example method includes i) generating partially adapted first DNA sample fragments in the first region 76A of the flow cell 10 by introducing the first fluid (including the first plurality of transposome complexes 38A, or 38B, etc.) into the flow cell 10 at a hybridization temperature, whereby the first spatial tags 102A respectively hybridize to the target primers 100A attached within the depressions 26 located at the first region 76A of the flow cell 10, introducing a first DNA sample 54 into the flow cell 10, whereby the first DNA sample 54 is tagmented by the first plurality of transposome complexes 38A, or 38B, etc., removing a transposase enzyme 46 of each of the first plurality of transposome complexes 38A, or 38B, etc.; and ii) generating partially adapted second DNA sample fragments in the second region 76B of the flow cell 10 by introducing the second fluid into the flow cell 10 at a hybridization temperature, whereby the second spatial tags 102B respectively hybridize to the target primers 100B attached within the depressions 26 located at the second region 76B of the flow cell 10, introducing a second DNA sample 54B into the flow cell 10, whereby the second DNA sample 54B is tagmented by the second plurality of transposome complexes 38A, or 38B, etc., and removing a transposase enzyme 46 of each of the second plurality of transposome complexes 38A, or 38B, etc.; and performing gap fill ligation or an extension reaction on each of the partially adapted first and second DNA sample fragments to form fully adapted first and second DNA sample fragments.
[0313] Another example method involves solution based binding to generate a bound complex where the DNA is bound to the transposome complexes 38A, or 38B, etc. The bound complex is shown in
[0314] Generally, this method includes exposing the first plurality of transposome complexes 38A, or 38B, etc. to a first DNA sample 54, whereby the first DNA sample 54 binds to at least some of the first plurality of transposome complexes 38A, or 38B, etc. to form a first bound complex; introducing the first bound complex to the flow cell 10, whereby the first spatial tags 102A respectively hybridize to the target primers 100A attached within the depressions 26 located at the first region 76A of the flow cell 10; passivating the first bound complex at the first region 76A of the flow cell 10; exposing the second plurality of transposome complexes 38A, or 38B, etc. to a second DNA sample 54B, whereby the second DNA sample 54B binds to at least some of the second plurality of transposome complexes 38A, or 38B, etc. to form a second bound complex; and introducing the second bound complex to the flow cell 10, whereby the second spatial tags 102B respectively hybridize to the complementary target primers 100B attached within the depressions 26 located at the second region 76B of the flow cell 10.
[0315] At the outset of this example method, the first fluid (including the first plurality of transposome complexes 38A, or 38B, etc. with the first spatial tag 102A) is mixed with the first DNA sample 54 outside of the flow cell 10. The tagmentation buffer is not included so that tagmentation does not take place prematurely. Thus, the first DNA sample 54 binds to the transposome complexes 38A, or 38B, etc., but is not tagmented. This forms a bound complex of the first DNA sample 54 bound to the first plurality of transposome complexes 38A, or 38B, etc.
[0316] The bound complex is then introduced into the flow cell lane 36 using any suitable technique.
[0317] The temperature of the flow cell lane 36 is at, or is brought to, a hybridization temperature so that the first spatial tags 102A respectively hybridize to the complementary target primers 100A located at the first region 76A. Because the target primers 100B, 100C, 100D, 100E, and 100F located in other regions 76B, 76C, 76D, 76E, and 76F are not complementary to the first spatial tags 100A, the bound complex will not bind in these regions 76B, 76C, 76D, 76E, and 76F.
[0318] The bound complex may then be passivated by introducing a passivation component (e.g., a hydrophobic polymer or an anti-fouling agent) to the flow cell lane 36. The end group(s) of the passivation component may include biotin that can attach to the avidin/streptavidin 60 of the transposome complexes 38A, or 38B, etc. containing the spatial tag 102. Alternatively, the end group(s) of the passivation component may include any functional group that is orthogonal, i.e., not responsive to, the dehybridization conditions used to detach the spatial tag 102. In still another example, the passivation component may have its own passivation tag (similar to spatial tag 102) that can attach to a passivation target primer located in a specific area of the flow cell surface. The passivation tags or target primers could have cleavage sites that allow them to be removed at a desirable time in the workflow. As an example, a hydrophobic polymer X has oligo A, while area 76A has complimentary oligo A. After the transposome complexes 38E, 38F are hybridized via the target primers in area 76A, the hydrophobic polymer X is hybridized via AA to passivate area 76A. When passivation needs to be removed, the oligo A or A can be cleaved via a chemistry, such as vinyl dT or 8 oxoG, this is orthogonal to the cleavage site of the primers and/or transposome complexes.
[0319] Passivation may involve forming a hydrophobic polymer shell 104 over the first bound complex, as depicted in
[0320] Examples of suitable hydrophobic polymers that can be used to form the shell 104 include polypropylene glycol, polycaprolactone, poly(lactic-co-glycolic acid) (PLGA), cellulose acetate, ethyl cellulose, poly alkyl (meth)acrylate, or polydimethylsiloxane (PDMS).
[0321] The anti-fouling agent 106 may be phosphate, phosphonate, a zwitterionic end group, an amphoteric polymer end group, carboxylic acid, poly(ethylene glycol), a perfluoro end group, hydroxyl, sulfonic acid, a positively chargeable end group, an alkoxy end group, or an anionic polymer end group. Examples of the zwitterionic end group are selected from the group consisting of phosphocholine, a sulfobetaine, and a carboxybetaine. One example of an amphoteric polymer end group is a polymer chain including both carboxylic acid and amine functional groups, such as a co-polymer of methacrylic acid and dimethylammonium ethylmethacrylate. Some examples of the anti-fouling agent 106 with the perfluorinated end group are selected from the group consisting of (heptadecafluoro-1,1,2,2-tetrahydrodecyl)trimethoxysilane, 3-(heptafluoroisopropoxy)propyltrimethoxysilane, nonafluorohexyltrimethoxysilane, [perfluoro(polypropyleneoxy)]methoxypropyltrimethoxysilane, 1,3-bis(trifluoropropyl)-1,1,3,3-tetramethyldisilazane, and (tridecafluoro-1,1,2,2-tetrahydrooctyl)dimethylchlorosilane. Examples of the positively chargeable end group include amine and ammonium. Examples of the anionic polymer end group include polyphosphates, polysulfonates, and polycarboxylates (e.g., poly(meth)acrylic acid).
[0322] The anti-fouling agent 106 may include a linker, such as ethylene or another short alkyl chain, poly(meth)acrylate, tetrazine, or an azide, that has the biotin or other end group for attachment to the bound complex (e.g., through the avidin/streptavidin 60).
[0323] The second bound complex may be prepared (off-board the flow cell 10) by mixing a second DNA sample 54B and the second fluid (including the second plurality of transposome complexes 38A, or 38B, etc. with the spatial tag 102B). In this example, the second fluid also does not include the tagmentation buffer. In the second fluid, the second DNA sample 54B binds to the transposome complexes 38A, or 38B, etc., but is not tagmented. This forms a bound complex of the second DNA sample 54B bound to the second plurality of transposome complexes 38A, or 38B, etc.
[0324] The second bound complex is then introduced into the flow cell lane 36 (which includes the passivated first bound complex) using any suitable technique. The temperature of the flow cell lane 36 is at, or is brought to, a hybridization temperature so that the second spatial tags 102B respectively hybridize to the complementary target primers 100B located at the second region 76B. Because the target primers 100A, 100C, 100D, 100E, and 100F located in other regions 76A, 76C, 76D, 76E, and 76F are not complementary to the second spatial tags 100B, the bound complex will not bind in these regions 76A, 76C, 76D, 76E, and 76F. Moreover, the bound complex at the region 76A is passivated, and thus any free DNA sample 54B (e.g., at the ends) will not bind to unused transposome complexes 38A, or 38B, etc. at the first region 76A. The passivation also prevents any free transposome complexes 38A, or 38B, etc. from the second solution from binding additionally to the first DNA sample 54A.
[0325] The second bound complex may then be passivated by introducing a passivation component (e.g., a hydrophobic polymer or an anti-fouling agent) to the flow cell lane 36.
[0326] The processes of bound complex formation, bound complex introduction and attachment within the desired flow cell region, and passivation of the newly introduced bound complex can then again be repeated for as many bound complexes and areas/regions 76C, 76D, 76E, 76F as desired and/or possible within a given flow cell lane 36. This will allow multiple bound complexes (each of which includes a different DNA) to be attached in the respective regions 76A, 76B, etc. Once all of the bound complexes are introduced and bound to the regions 76A, 76B, etc., the passivation component can be removed. When the biotin-avidin/streptavidin interaction is used, the passivation component can be released by introducing any example of the biotin streptavidin cleavage composition disclosed herein into the flow cell 10. Alternatively, if the passivation tags or target primers have cleavage sites, individual cleaving agents may be introduced to cleave and thus remove the passivation component from a particular area 76A, 76B, etc.
[0327] Tagmentation can be initiated either before or after the passivation component is removed. This may be accomplished by introducing any example of the tagmentation buffer into the flow cell lane 36 and ensuring that the temperature is at or above 30 C. Tagmentation may be performed as described herein.
[0328] In this example method, the transposase enzymes 46 of each of the transposome complexes 38A, or 38B, etc. is then removed. Transposase enzyme 46 removal may be performed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS) or proteinase or another chaotropic agent. Heating may not be desirable so as to avoid dehybridization of the spatial tags 102 and target primers 100. The released transposase enzymes 46 may be removed from the flow cell 10 using the wash solution.
[0329] If not removed prior to tagmentation, it is to be understood that the passivation component should be removed prior to generating the fully adapted DNA fragments 56 and prior to breaking the bond between the spatial tag 102 and the transposome complexes 38E, 38F. The removal used will depend upon how the passivation component is attached (e.g., dehybridzation, cleavage of a cleavage site, etc.)
[0330] The fully adapted DNA fragments 56 may be formed in all of the regions 76A, 76B, 76C, 76D, 76E, 76F using performing gap fill ligation or an extension reaction as described herein, and the process used will depend upon the transposome complex 38A, or 38B, or 38C and 38D, or 38E and 38F that used.
[0331] Once all of the fully adapted DNA sample fragments 56 are generated, they are exposed to amplification and cluster generation using the primers 55, 57. Cleavage of either the forward or reverse fully adapted DNA sample fragments may then be performed, followed by denaturization. These processes may occur at the same time as amplification.
[0332] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.
[0333] Any of the examples set forth herein may be adjusted for simultaneous paired end sequencing. In these instances, the amplification domains and primers may be based on the primers described in WO 2020/005503, which is incorporated by reference herein in its entirety.
Additional Notes
[0334] Each of
[0335] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0336] Reference throughout the specification to one example, another example, an example, and so forth, means that a particular element (e.g., feature, structure, and/or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0337] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.