METHOD FOR THE DETECTION OF A SEXUALLY TRANSMITTED INFECTIOUS PATHOGEN
20230160021 · 2023-05-25
Inventors
Cpc classification
C12Q2527/125
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to methods for the detection of a sexually transmitted infectious pathogens in human subjects. The detection can be done without sample purification and on several types of pathogens. The methods are ideal for urine samples. One pathogen is Chlamydia trachomatis.
Claims
1. A method for the detection of a sexually transmitted infectious pathogen in a human subject without sample purification, the method comprising the steps; a) providing a urine sample from the human subject, b) adding an antimicrobial peptide to the urine sample, c) amplifying the released nucleic acids by loop-mediated isothermal amplification (LAMP) using primers targeting the sexually transmitted infection pathogen nucleic acids, d) detecting a signal from the nucleic acid originating from the sexually transmitted infection pathogen organism, and e) indicating the human subject being infected with a sexually transmitted infectious pathogen, if the signal is above a predetermined value.
2. The method of claim 1, wherein the urine sample is diluted more than 50% with a buffer.
3. The method of claim 1, wherein the total assay time is less than 60 minutes.
4. The method of claim 1, wherein the antimicrobial peptide based release of nucleic acids is combined with a heat treatment.
5. The method of claim 1, wherein the antimicrobial peptide based release of nucleic acids is combined with surfactant(s).
6. The method of claim 1, wherein LAMP reactions are analysed in a lateral flow strip.
7. The method of claim 1, wherein the sexually transmitted infection pathogen primers are designed to detect Chlamydia trachomatis specific nucleic acids.
8. The method of claim 1, wherein the antimicrobial peptide is a cecropins.
9. The method of claim 1, wherein the sensitivity is higher than 60%.
10. The method of claim 1, wherein the loop-mediated isothermal amplification (LAMP) comprise a Bsm polymerase.
11. A point-of-care method for the detection of Chlamydia trachomatis and/or Neisseria gonorrhoeae in a human subject without sample purification, the method comprising the steps; a) providing a urine sample diluted more than 50% from the human subject, b) adding a Cecropin peptide to the urine sample, c) amplifying the released nucleic acids by loop-mediated isothermal amplification (LAMP) using primers targeting Chlamydia trachomatis and/or Neisseria gonorrhoeae nucleic acids using a Bsm polymerase, d) detecting a signal from the nucleic acid originating from Chlamydia trachomatis and/or Neisseria gonorrhoeae by a lateral flow strip, and e) indicating the human subject being infected with Chlamydia trachomatis and/or Neisseria gonorrhoeae, if the signal is above a predetermined value, wherein said point-of-care method have a detection sensitivity of more than 60% compared to the Cobas®4800 CT/NG Test (Roche) in standard settings.
12. A point-of-care method for the detection of Chlamydia trachomatis and/or Neisseria gonorrhoeae in a human subject without sample purification, the method comprising the steps; a) providing a urine sample, b) adding a Cecropin peptide to the urine sample, and allowing the peptide to lysis the cells for less than 15 minutes, c) diluting the urine sample obtained in step b) more than 50% c) amplifying the released nucleic acids by loop-mediated isothermal amplification (LAMP) using primers targeting Chlamydia trachomatis and/or Neisseria gonorrhoeae nucleic acids using a Bsm polymerase, d) detecting a signal from the nucleic acid originating from Chlamydia trachomatis and/or Neisseria gonorrhoeae by a lateral flow strip, and e) indicating the human subject being infected with Chlamydia trachomatis and/or Neisseria gonorrhoeae, if the signal is above a predetermined value, wherein said point-of-care method has a detection sensitivity of more than 60% compared to the Cobas®4800 CT/NG Test (Roche) in standard settings.
13. The method of claim 1, wherein the antimicrobial peptide based release of nucleic acids is combined with surfactants.
14. The method of claim 1, wherein the primers are selected from the group consisting of SEQ ID NO 5-28.
15. A kit of part for simultaneous detection and quantitation of sexual transmitted diseases such as but not limited to Chlamydia trachomatis and/or Neisseria gonorrhoeae, said kit comprises a) a lysis mixture in the following ranges: 0.5-5 μM AMP (Cecropin P1) 5-50 mM EDTA 0.1-10% non-ionic surfactant b) a mixture comprising nucleotide sequences that encodes a nucleotide sequence selected from the group comprising or any combinations of SEQ ID NO 5-28, or a part of it or a nucleotide having 90% sequence identity with any of SEQ ID NO: 5-28, and/or a polymerase capable of mediating a Loop-mediated isothermal amplification (LAMP), and c) a device comprising a lateral flow strip
Description
BRIEF DESCRIPTION OF THE FIGURES
[0317]
[0318]
[0319] Probit curve for C. trachomatis-LAMP assay LOD in water and pooled urine.
[0320]
[0321] Lytic effect of heat (90° C. 5 min) and antimicrobial peptides (50 μM) on E. coli cell integrity. Flow cytometry analysis was conducted with double-staining lysed cells with SYTO9/PI combination. Lysis reaction was carried out in 10% artificial urine conditions. AMP 6 was used as a negative control (no growth inhibition effect in experiments above).
[0322]
[0323] Lytic effect of AMPs in combination with detergent Triton-X-100. E. coli lysis was analysed with flow cytometry. AMP and Triton-X-100 concentrations in lysis mixture were 50 μM and 2%, respectively. Note: AMP 5 was acquired from PepScan instead of using our self-purified batch. Thus, there is a difference in lysis efficiency of AMP 5 if compared to results shown before.
[0324]
[0325] Urine tolerance was analyzed for Bst (A) and Bsm (B) DNA polymerases with qLAMP (at 63° C.) in the presence of 0%, 5%, 10%, 15% or 20% of pooled patient urine (from 5 CT negative mails and 5 females) at 107-104 template DNA concentration. Urine tolerance results were expressed as a relative time to results.
[0326]
[0327] Loop-mediated isothermal amplification directly from E. coli cell lysates. Isothermal amplification after pretreatment of urine spiked E. coli with different lysate preparation techniques. Lysozyme was used at 1 mg/ml concentration, polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether at 1% and peptides at 50 μM concentration for the biological sample treatment. All sample pretreatments were performed for 5 min at RT° C. (except for heat treatment that was incubated at 95° C.).
[0328]
[0329] Loop-mediated isothermal amplification activity in the presence of different lytic agents. Percentage of amplification activity in the presence of 0.1% polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether, 0.1 mg/ml lysozyme (with or without 0.1% polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether or 1 mM EDTA) or alkaline lysis components.
[0330]
[0331] Loop-mediated isothermal amplification activity in the presence of different lytic peptides. Percentage of amplification activity in the presence of 5 μM antimicrobial peptides.
[0332]
[0333] Urine tolerance comparison of different polymerases (Bsm, GspM2.0, GspM, Bst, Bst2.0, GspSSD, GspSSD2.0, OmniAmp, Tin, SD) measured with estimated amplification time to results in minutes.
EXAMPLES
Example 1—Efficient and Rapid Loop-Mediated Isothermal Amplification Based Method for Chlamydia trachomatis Detection Directly from Urine
[0334] Introduction and Overview
[0335] The lack of sensitive tests for C. trachomatis detection makes it difficult to diagnose Chlamydia infection efficiently directly from unprocessed patient's samples.
[0336] Here the inventors present a rapid and sensitive assay based on loop-mediated isothermal amplification method (LAMP), which can detect at least 5 C. trachomatis pathogens per reaction (25 cryptic plasmid copies) directly from urine samples within 21 min. Our clinical data showed that specificity of the assay is 100% and sensitivity 73%. Additionally, we demonstrate that our assay does not give any cross-reactivity with at least 30 pathogen's DNA potentially present in the urine samples. Furthermore, assay's novel approach does not require purification or extraction of DNA from clinical sample prior to amplification, so the need for specialized equipment is eliminated. This makes the whole procedure significantly less laborious, less time-consuming and consequently less expensive for early detection and identification of infectious disease. C. trachomatis specific LAMP assay is relatively simple to perform and could therefore be applied in numerous point-of-care settings.
[0337] Chlamydia trachomatis is a widespread sexually transmitted obligatory intracellular human pathogen. Most often, C. trachomatis is prevalent in adolescents and young adults of age 15-25 who have new or multiple sexual partners. The pathogen can also be passed from an infected mother to her baby during vaginal childbirth. In men Chlamydia trachomatis usually cause prostatitis and epididymitis and is mostly symptomatic causing a mild to moderate, clear to white urethral discharge, burning sensation during urination or dysuria. However, women with this infection often have minimal or no symptoms which leads to late diagnosis of the Chlamydia infection. Long-term effect of the C. trachomatis infection has been in turns associated with cervicitis, pelvic inflammatory disease, ectopic pregnancy, and acute or chronic pelvic pain.
[0338] Chlamydia has two life cycle stages: elementary body (EB) and reticulate body (RB), that are distinguishable by morphological and biological properties. The extracellular EBs are highly infectious, dispersal and analogue to spore. Once EB enters the epithelial cells it transforms into the metabolically active RBs that are able to replicate and accumulate within cytoplasmic inclusions of the cell. RBs are then converted into the more resistant EBs and are released from the cell.
[0339] Being an obligate intracellular pathogen makes it difficult to culture C. trachomatis in laboratory. Treatment of C. trachomatis infection depends not only on the site of the infection but also on the patient's age and on the case of complexity. So it is very important to identify C. trachomatis in the early stage of infection and start immediate treatment as soon as possible to prevent the development of further long-term complications and decrease the chance of getting other infections such as N. gonorrhoeae or Human immunodeficiency virus.
[0340] The diagnosis of sexually transmitted Chlamydia infection involves collection of the samples: regularly urethral swab or urine specimen from males and endocervical or vaginal swab from females. Successful screening and preventing further spread and complications of Chlamydia depends on the ability to diagnose infections accurately, rapidly and inexpensively. Modern laboratories still use traditional testing methods such as cell culture and antigen based detection. The cell culture method is highly specific but has very low sensitivity, is expensive, slow (the result could be obtained only after 3 days) and requires special sample collection, storage and transport. Immunological assays like the enzyme immunoassay and direct fluorescent antibody (DFA) assay have low sensitivity and specificity as a cell culture method which limits the use of these tests in diagnostic field. As an alternative to the traditional laboratory methods, nucleic acid amplification tests (NAATs) were developed allowing detection of pathogen-specific DNA or RNA sequences. These tests are significantly more sensitive for the screening and diagnosis of genital Chlamydia infection because they can detect as little as single nucleic acid copy of the target. There are several different nucleic-acid amplification based tests for C. trachomatis detection: Abbott RealTime CT/NG uses ligase chain reaction (LCR); Aptima COMBO uses transcription-mediated amplification (TMA); BD ProbeTec ET use strand displacement amplification (SDA); Xpert CT/NG and Cobas CT/NG tests use real-time polymerase chain reaction (PCR). Loop-mediated isothermal amplification (LAMP) stands out to be a novel, highly sensitive and specific diagnostic tool because of the ease of performing and capability to diagnose a negligible amount of pathogen genetic material within an hour. LAMP method has several advantages over widely used PCR. LAMP is carried out at a constant temperature (60-65° C.) and does not require a thermal cycler. LAMP uses 4-6 different primers (2 inner, 2 outer and/or 2 additional loop primers) and a polymerase with a strand displacement activity to identify 6 distinct regions on the target gene sequence. This allows to generate an amplification product containing of single-stranded loop regions where primers can bind without template denaturation. The additions of loop primers significantly accelerate amplification, increasing sensitivity and reducing reaction time. The amount of DNA product at the end of the LAMP reaction is considerably higher that than in PCR and can be simply visualized using metal ion indicators like calcein or such DNA biding dyes as SYBR green, ethidium bromide, picogreen, propidium iodide, hydroxy naphthol blue.
[0341] Here the present inventors have developed C. trachomatis specific LAMP assay for the rapid and sensitive pathogen detection from human urine with minimal processing steps. Developed assay allows detection of C. trachomatis directly from urine sample, providing rapid, sensitive, diagnosis with minimal need for training. Clinical analysis showed up to 73% sensitivity and 100% specificity of the developed C. trachomatis specific LAMP assay. The assay requires 21 min and the product can be detected using lateral-flow (LF) strips which is very beneficial for application in the point-of-care (POC) settings.
[0342] Materials and Methods
[0343] Design and Selection of the Primers
[0344] All C. trachomatis specific LAMP assay primer sets were designed to target highly conserved region of the C. trachomatis cryptic plasmid within coding sequence 2-CDS2. LAMP primers were designed using LAMP Designer 1.10 software (PREMIER Biosoft USA) and screened for their high sensitivity towards DNA target and for the absence of the non-specific background on lateral flow strips. The sequence of the best performing primer set is shown in Supplementary Table 1. Primers FIP and LF were 5′labeled with biotin and BIP and LB primers with FAM to allow product detection on the lateral flow strips. Primers were obtained from Microsynth AG (Balgach, Switzerland).
[0345] C. trachomatis ATCC DNA Sample
[0346] Commercially available C. trachomatis strain UW-36/Cx genomic DNA (ATCC®VR-886D™) was obtained from ATCC (American Culture Collection) and CDS2 target copy number was determined by qPCR (Applied Biosystems) using pGL3-CDS2 plasmid and following primers: Fw 5′-CTCCTTGGAGCATTGTCTGG-3′and Rw 5′-CGGATGCGATGAACAGTTTG-3′
[0347] LAMP Reaction
[0348] C. trachomatis specific LAMP reaction was carried out according to the protocol supplied by Eiken Chemical Co. Ltd with LAMP reaction total volume 50 μl. Bst polymerase was replaced with Bsm polymerase and 1.2 μl gDNA (ATCC)/ or 5 μl of pre-treated urine sample. All LAMP reactions were performed at 63° C. for indicated time period and analysed on the lateral flow strips (AMODIA Bioservice GmbH) according to manufacturer's protocol. Reaction product was cut with PmlI restrictase (Thermo Fisher Scientific Inc. USA) to confirm product specificity.
[0349] For quantitative LAMP (qLAMP) EvaGreen (Biotium) fluorescent and ROX (Thermo Fisher Scientific Inc. USA) reference dyes were added to the reaction. Primers without Biotin/FAM labelling were used and product was detected using Applied Biosystems 7900HT Real-Time PCR System. A standard curve was constructed using serial dilutions of BglII linearized pGL3-CDS2 plasmid. qLAMP was performed at 63° C. with 40 cycles, each 1 min long, and data reading after 30 sec.
[0350] Pooled Urine
[0351] Urine samples from 5 men and 5 women, all C. trachomatis negative were mixed together in equal volumes. The samples further denoted as pooled urine was used in C. trachomatis specific LAMP assay for inhibition and assay sensitivity analyses.
[0352] Sample Pre-Treatment
[0353] Clinical patients'urine samples (30 μl) were incubated for 5 min together with 1× lysis mix (SelfD Technologie GmbH, Leipzig, Germany), containing lytic peptide (12% from final volume) or pre-heated at 90° C. for 5 min and then cooled down on ice. 5 μl of each pre-treated urine sample were then applied for C. trachomatis specific LAMP amplification.
[0354] Statistical Analysis
[0355] Statistical analyses of C. trachomatis specific LAMP assay's limit of detection were performed with XLSTAT, 95% confidence interval (CI) was calculated using logistic regression model. Assay sensitivity and specificity was calculated using online tool from MedCalc confidence interval for 95%.
[0356] Clinical Specimen Collection and Storage
[0357] First-void morning urine samples were collected from 650 patients from 18 to 25 year old (316 females and 334 males) attending Sexual Health Clinique (Tartu, Estonia) from October 2013 to December 2014. Urine samples were self-collected into a clean polypropylene container (with average sample volume of 25-35 ml) without preservative and led by patients to the Sexual Health Clinique on the same day. Criteria for patient enrolment in the study were recent change of the sexual partner, multiple sexual partners, unprotected sexual intercourse, sexually transmitted infection of the partner or symptoms of the sexually transmitted disease (like increased/abnormal vaginal discharge, urethral discharge, abdominal pain, painful urination, dysuria, itching and redness in the genital area), pregnancy or prophylactics.
[0358] Urine samples were tested by Cobas®4800 CT/NG Test (Roche) for the presence of C. trachomatis and N. gonorrhoeae according to manufacturer's instruction by the United Laboratories of the Tartu University Hospital regularly on the second day of the sample collection but no longer than 72 h after collection.
[0359] The 91 urine samples were tested by C. trachomatis specific LAMP assay within 6 h after collection (not more than 24 h from collection). 71 C. trachomatis positive samples were frozen at −20° C. and tested separately. Approval for the study was obtained from the Research Ethics Committee of the University of Tartu. Confidentiality was addressed in the patient information sheet.
[0360] Results
[0361] Development of C. trachomatis Specific LAMP Assay
[0362] As the DNA purification step is not included in the LAMP assay, developed amplification method has to tolerate higher volumes of urine in the reaction mixture which theoretically can increase the whole assay sensitivity as more targets are added to the reaction. Therefore, urine tolerance of LAMP method was tested with pooled urine samples. In our experimental set-up LAMP reaction mixture contained up to 20% of urine and 100 copies of template DNA. The result demonstrated that reactions containing 15% of urine did not give any signal when analysed on lateral flow (LF) strips, indicating that 21 min of amplification time was insufficient for target amplification. 5-10% of urine in reaction mixture gave positive signal in all replicates (n=5) (
[0363] Assessment of Limit of Detection (LOD) for C. trachomatis Specific LAMP Assay
[0364] Next the lowest C. trachomatis plasmid copy number was determined by developed C. trachomatis specific LAMP assay. For this LAMP amplification efficiency was tested at different C. trachomatis genomic DNA concentrations in water or in 10% pooled urine. Probit analysis showed that assay was sensitive enough to detect 25 plasmid copies per reaction in water (0.95 value) (
TABLE-US-00003 TABLE 1 LOD determination for C. trachomatis specific LAMP assay Copies per Lower bound Upper bound reaction 95% 95% Limit of detection in water 25 21 33 (0.95 value) Limit of detection in pooled 70 61 96 urine (0.95 value)
[0365] Determination of C. trachomatis Specific LAMP Assay Specificity
[0366] Although C. trachomatis primers were designed targeting pathogen specific region, their specificity had to be experimentally verified. C. trachomatis LAMP assay was further analysed for possible non-specific reactivity using excess amount of genomic DNA from human and 30 microorganisms potentially present in human urine (listed in Supplementary Table S3). As a result C. trachomatis specific LAMP assay did not give cross-reactivity with any examined pathogens'DNA. Consequently, newly developed LAMP assay is highly specific in detection of Chlamydia trachomatis from human urine, fitting well for molecular diagnostic system.
[0367] Clinical Validation of the Developed C. trachomatis Specific LAMP Assay
[0368] To determine the prevalence of Chlamydia trachomatis in symptomatic and asymptomatic patients the urine samples subjected to clinical study (N=650) were additionally evaluated. In order to analyze the collected data the descriptive statistics was used to provide important information received from patients and doctors. Patients included in the symptomatic group turned to the doctor for medical advice/control and had following symptoms: abnormal genital discharge, dysuria, abdominal pain, spotting between periods, itching or redness of the genital area. Patients, who had no symptoms, were included in the asymptomatic group. 157 out of 650 patients (24%), had symptoms of sexually transmitted infection (STI) and 493 patients (76%) were asymptomatic. 51% of the patients were males and 49% females, with an average age of 22 years old (18-25 years old). C. trachomatis was diagnosed in 39 male patients and 47 female patients out of which only 12 (31%) and 13 (28%) had symptoms, respectively. In all collected and analysed urine samples the prevalence of Neisseria gonorrhoeae was 3%. Co-infection with N. gonorrhoeae/C. trachomatis seems to be quite frequent, 6-8% from all C. trachomatis positive samples.
[0369] Clinical data confirmed that C. trachomatis infection is mainly asymptomatic, which makes it difficult to diagnose and estimate the real prevalence in human population (Table 2 and Supplementary Table 4).
TABLE-US-00004 TABLE 2 Clinical characteristics of the studied group (N = 650) CT prevalence in the Mean clinical CT Gender N (%) Age SYM* ASYM* study SYM ASYM negative SYM ASYM Male 334 22 70 264 39 12 27 295 57 238 (51%) (21%) (79%) (31%) (69%) (19%) (81%) Female 316 22 87 229 47 13 34 269 74 195 (49%) (27.5%) (72.5%) (28%) (72%) (27.5%) (72.5%) *Patient info analysis presents gender distribution, number and percentage of the C. trachomatis (CT) positive patients with symptoms (SYM) and without symptoms (ASYM).
[0370] C. trachomatis specific LAMP assay clinical sensitivity and specificity was validated in a study, comprising 91 freshly collected patient urine samples. First-void morning urine samples were self-collected by 56 male and 34 female patients. 11 out of 91 had C. trachomatis infection (determined by Roche Cobas 4800 CT/NG test). One C. trachomatis positive patient was also positive for N. gonorrhoeae. Collected urine samples were subjected in parallel for C. trachomatis specific LAMP assay. Two different sample pre-treatment strategies were tested and compared to untreated samples: heating at 90° C. for 5 min and incubation with peptide lysis mix. Results showed that highest assay sensitivity (73%) was obtained when using peptide/detergent lysis mix whereas pre-treatment with heat showed 64% of assay sensitivity, and sensitivity dropped to 55% when urine samples were left untreated (Table 3). These data clearly shows that pre-treatment of urine samples prior to amplification provide a better access of pathogen DNA material.
TABLE-US-00005 TABLE 3 C. trachomatis detection in 91 first-void urine samples with the Roche Cobas Amplicor CT assay and C. trachomatis specific LAMP assay C. trachomatis LAMP assay Peptide lysis mix Untreated urine* Heat treated urine** pretreated urine*** Fresh urine samples Positive Negative Positive Negative Positive Negative Roche Cobas Positive 6 5 7 4 8 3 Amplicor CT assay Negative 0 80 0 80 0 80 Sensitivity % [95% CI] 55% [23.38-83.25%] 64% [30.79-89.07%] 73% [39.03-93.98%] Specificity % [95% CI] 100% [95.5-100%] 100% [95.5-100%] 100% [95.5-100%] *5 μl of fresh urine was added to LAMP reaction. **5 μl of urine was incubated at 90° C. for 5 min and after that added to LAMP reaction. ***30 μl of urine was incubated with 4 μl (peptide lysis mix) for 5 min and after that 5 μl was taken out and added to LAMP reaction.
[0371] All 80 C. trachomatis negative samples were detected as negative by developed LAMP assay, thus clinical specificity was estimated to 100%.
[0372] In order to confirm the results from the clinical study we analysed additional 71 C. trachomatis positive urine samples that were frozen at −20° C. after collection. C. trachomatis specific LAMP assay was performed using the same pre-treated methods as described above. The sample set contained frozen C. trachomatis positive urines from 31 males and 40 females. Six C. trachomatis positive patients were also positive for N. gonorrhoeae and 9 patients had only N. gonorrhoeae infection. 48 out of 71 C. trachomatis positive urine samples tested positive with C. trachomatis specific LAMP assay using heat or peptide lysis mix. Analysis showed that both heating and lyses mix provided the sensitivity up to 68% in frozen samples (Table 4). Storage of the urine sample in the freezer might be the reason why sensitivity was decreased from 73% in “fresh”, never frozen urine samples (urine lyses with peptide/detergent lysis mix) to 68% (urine lyses with peptide/detergent lysis mix or heat) in frozen urine samples, because frozen urine yielded a big amount of urinary “microscopic sediments”compared to that found in “fresh”urine causing difficulties for sample pre-treatment. At the same time it can also be assumed that reaction temperature and freezing-thawing procedure itself can disrupt pathogen membrane, thereby releasing genomic material. That is why our assay showed 55% (“fresh”urine) and 63% (frozen urine) of sensitivity with untreated urine.
TABLE-US-00006 TABLE 4 Analysis of 71 frozen C. trachomatis positive urine samples with C. trachomatis specific LAMP assay C. trachomatis LAMP assay Untreated urine* Heated urine** Urine antimicrobial lyses*** Frozen urine samples Positive Negative Positive Negative Positive Negative Roche Cobas 4800 Positive 45 26 48 23 48 23 CT/NG assay Sensitivity % [95% CI) 63% [51.1-74.5%] 68% [55.5-78.24%] 68% [55.5-78.24%] *5 μl of frozen urine was added to the reaction mix. **5 μl of frozen urine was incubated at 90° C. for 5 min and then added to the reaction. ***30 μl of frozen urine were incubated with 4 μl of 1 × lyses mix for 5 min out of which 5 μl was then added to reaction mix.
[0373] Discussion
[0374] Sexually transmitted infections (STIs), including Chlamydia trachomatis, remain an important focus area of the global public health. High number of cases within asymptomatic C. trachomatis infection (76% in our clinical study) leads to delayed diagnosis and further serious complications. Although Chlamydia infection is highly prevalent, the knowledge regarding this STI was highly restricted in public health settings due to various limitations of diagnostic methods such as low pathogen detection sensitivity, low speed, time-consuming, expensiveness and need for specialist training. Consequently, successful detection and fast identification of this pathogen is necessary for early diagnosis and treatment of the disease.
[0375] This paper demonstrates for the first time, the development of simple, rapid, cost-effective, sensitive and specific LAMP assay for detection of C. trachomatis from urine samples. For that C. trachomatis cryptic plasmid has been chosen as a target for diagnostic testing because it is present at up to 10 copies per genome. Cryptic plasmid is relatively stable nucleic acid target being more resistant to nuclease damage than the genomic DNA. Chosen CDS2 region shares high homology between different C. trachomatis serovars and is present in the Swedish mutant strains. The use of six primers in LAMP reaction (F3, B3/FIP, BIP/LF, LB) provides not only a greater specificity than other amplification method but also accelerate the amplification time. Our data showed that novel C. trachomatis specific LAMP assay can detect at least 25 copies of the cryptic plasmid target which corresponds to 2.5-6 pathogens per reaction (depending on the particular strain). Consequently, the newly developed LAMP assay is 100% specific in detection of Chlamydia trachomatis and can be easily applied in the point-of-care settings (POC). The whole assay takes less than 30 min, does not require additional equipment or trained personnel and the amplification product can be easily visualized by lateral flow dipsticks.
[0376] In focus of current research was also the detection of the pathogen with minimal processing steps directly from urine sample enabling simple and convenient application which is very advantageous for POC testing. As urine itself can contain various inhibitory substances it is quite challenging to use urine samples without prior DNA purification step before amplification. As it was already mentioned above our novel approach is based on loop-mediated amplification method (LAMP) and can detect pathogen directly from crude urine sample. To our knowledge only few reports related to detection of bacteria using LAMP method directly from biological sample are available so here we presented for the first time developed LAMP assay which enables detection of C. trachomatis directly in crude urine which thereby can replace current POC tests with pretty poor pathogen detection sensitivities (10-40%).
[0377] In spite of the fact that addition of 10% urine slightly decreased analytical sensitivity (up to 3 times) the assay was still sensitive enough to detect Chlamydia from minimally processed patient samples. As human urine can contain different number of Chlamydia cells it was very important to successfully lyse pathogen cell membrane in order to better access the DNA material from the cells. For that different methods for cellular membrane lysis were tested. Heating at 90° C. and the application of lytic peptides carry a potential to be applied for urine lysate preparation prior to nucleic acid amplification. Therefore our novel approach successfully combined LAMP amplification with fast sample preparation techniques: thermal or peptide lysis applying them directly in clinical samples. As a result the overall sensitivity of the novel C. trachomatis specific LAMP assay increased up to 73% when using antimicrobial peptide lysis mix and 68% when samples were heat pre-treated prior addition into the amplification reaction. As simple and easy to apply sample pre-treatment method is one of the major criteria for the true self-diagnostic tests it is very important to find the best strategy for lysing such challenging pathogen as Chlamydia directly in crude urine releasing its genetic material in such a way, that it would be suitable for the subsequent rapid amplification by LAMP method. Our data shows that the application of antimicrobial peptide lysis mix provides the most efficient newly developed sample pre-treatment strategy that suits all above mentioned requirements. Therefore there is no need to prior DNA purification and concentration, like in PCR-based Chlamydia detection assays, which makes the whole detection less laborious and time consuming. Such features as increased sensitivity, controllability, simplicity, rapid response time and high specificity of pathogen detection compared to other isothermal amplification methods or POC immunoassays make our novel C. trachomatis specific assay appealing for the application as the most reliable molecular diagnostic tool for POC testing. Taken together we have developed for the first time simple, rapid and sensitive LAMP assay based method for the specific detection of C. trachomatis directly from crude urine samples that have a great potential for the application in numerous POC settings.
[0378] Supplementary Material
TABLE-US-00007 TABLE SI LAMP primer set selected for C. trachomatis specific detection Name Sequence F3 5′ AAT ATC ATC TTT GCG GTT GC 3′ B3 5′ TCT ACA AGA GTA CAT CGG TCA 3′ FIP 5′ Biotin-TCG AGC AAC CGC TGT GAC GAC CTT CAT TAT GTC GGA GTC 3′ BIP 5′ FAM-GCA GCT TGT AGT CCT GCT TGA GTC TTC GTA ACT CGC TCC 3′ LF 5′ Biotin-TAC AAA CGC CTA GGG TGC 3′ LB 5′ FAM-CGG GCG ATT TGC CTT AAC 3′
TABLE-US-00008 TABLE S2 C. trachomatis specific LAMP assay amplification time Reaction time Determination of percentage of (min) positives* 15 20% 18 60% 21 100% 24 100% 27 100%
TABLE-US-00009 TABLE S3 List of organisms used to determine specificity of the C. trachomatis LAMP assay Species Amount of DNA used per reaction Mammalian Homo sapiens sapiens 1 ng Protozoa Trichomonas vaginalis 1 ng Fungi Candida albicans, 1 ng Saccaharomyces cerevisiae 1 ng Bacteria Escherichia coli 24 pg, 100 pg Neisserea gonorrhoeae 24 pg, 100 pg Mycoplasma genitalium 24 pg, 100 pg Mycoplasma pneumoniae 24 pg, 100 pg Ureaplasma urealyticum 24 pg, 100 pg Mycoplasma hominis 24 pg, 100 pg Lactobacillus iners 24 pg, 100 pg Lactobacillus crispatus 24 pg, 100 pg Corynebacterium urealyticum 24 pg, 100 pg Prevotella bivia 24 pg, 100 pg Gardnerella vaginalis 24 pg, 100 pg Veillonella parvula 24 pg, 100 pg Enterococcus faecalis 24 pg,−100 pg Proteus mirabilis 24 pg, 100 pg Klebsiella pneumoniae 24 pg, 100 pg Klebsiella oxytoca 24 pg, 100 pg Enterobacter cloacae subsp. cloacae 24 pg, 100 pg Citrobacter freundii, 24 pg, 100 pg Staphylococcus saprophyticus subsp. 24 pg, 100 pg saprophyticus Streptococcus agalactiae 24 pg, 100 pg Staphylococcus epidermidis 24 pg, 100 pg Staphylococcus aureus subsp. aureus 24 pg, 100 pg Viruses Herpes simplex 1 24 pg, 100 pg Herpes simplex 2 24 pg, 100 pg Human papilloma virus 16 24 pg, 100 pg Human papilloma virus 18 24 pg, 100 pg
TABLE-US-00010 TABLE S4 Data for the patients with co-infection with NG CT&NG CT“−”&NG Gender “+” SYM ASYM “+” SYM ASYM Male 4 3 1 3 0 3 Female 3 3 0 6 1 5 * Gender and number of C. trachomatis and N. gonorrhoeae co-infected patients (CT&NG “+”), and C. trachomatis negative and N. gonorrhoeae infected patients (CT“−”&NG “+”) with symptoms (SYM) and without (ASYM).
Example 2—Fast and Highly Efficient Detection of Escherichia coli Directly from Urine Samples Using Loop-Mediated Isothermal Amplification
[0379] A biological sample containing E. coli bacteria (urine sample in
[0380] EvaGreen and ROX dyes can be added to the LAMP reaction for quantitative product detection or FAM labeled BIP and LB primers and biotin labeled FIP and LF primers can be used for qualitative detection on lateral-flow strips.
[0381] In the example of E. coli detection from
Example 3—Fast and Sensitive Detection of Mycoplasma genitalium Directly from Patient Urine Samples Using Recombinase Polymerase Amplification
[0382] First-void morning urine sample is treated with 50 μM antimicrobial peptide for 5 min at RT° C. For M. genitalium sample pretreatment melittin, gramicidin peptides or other antimicrobial peptides could be used that affect intracellular Mycoplasma species.
[0383] Antibacterial peptide concentration can be varied from low μM (0.1-1 μM) to high μM (100-1000 μM) depending on the peptide and biological sample type. Pre-treatment time can be increased or lowered depending on the peptide concentration, peptide type, target organism, biological sample type.
[0384] Biological sample can be concentrated or diluted prior to peptide treatment, if required. To stimulate sample pretreatment method detergents, lytic enzymes, alkali or other additional compositions can be used, if required.
[0385] The RPA enzyme pellet is resuspended with 47.5 μl of the reaction buffer prepared by mixing the following components: 2.1 μl of 10 mM forward primer, 2.1 μl of 10 mM reverse primer (the final concentration of each primer in the reaction being 0.42 mM), 29.5 μl of rehydration buffer (TwistDX), 8.8 μl of ddH2O) and 5 μl of the biological sample lysate (prepared as described above) potentially containing M. genitalium. RPA reaction is initiated by adding 2.5 μl of 280 mM magnesium acetate.
[0386] M. genitalium specific primers targeting MGPA and 16S rRNA conserved unique regions can be used, examples of appropriate sequences are listed in patent application no PCT/EP2013/071906. Forward primers are labeled with biotin and the reverse primer with 6-carboxyfluorescein (FAM), enabling biotin-FAM double-labeled product detection on the lateral-flow strips. Different oligonucleotide labeling can be used, like DIG or other oligonucleotide linkers.
[0387] The reaction is incubated at 38° C. for 10-30 minutes. After 4 minutes of incubation, the reaction was mixed by flicking the tube. The whole procedure takes 15-35 min, to obtain qualitative lateral-flow strip result of M. genitalium infection.
Example 4—Fast and Sensitive Detection of Neisseria gonorrhoeae Directly from Patient Urine Samples Using Loop-Mediated Isothermal Amplification
[0388] A biological sample including urine sample, vaginal, rectal, cervical or urethral swab is collected. First-void morning sample is used in case of urine to ensure presence of sufficient number of pathogen nucleic acid. Biological sample can be concentrated or diluted prior to peptide pre-treatment, if required. Sample is treated with 50 μM antimicrobial peptide for 5 min at RT° C. For Neisseria species following antimicrobial peptides could be used, but not limited to demaseptins, LL-37, PG-1. Antibacterial peptide concentration can be varied and detergent (or other composition) could be added to stimulate lytic effect of the peptide. Pre-treatment time can be increased or lowered depending on the peptide concentration and type of the biological sample.
[0389] 5 μl of the biological sample lysate is added directly to the loop-mediated amplification reaction, so that final reaction volume is 50 μl and final components concentration as follows: 0.2 μM F3 primer, 0.2 μM B3 primer, 1.6 μM biotin labeled BIP primer, 1.6 μM FAM labeled FIP primer, 0.8 μM FAM labeled LF primer, 0.8 μM biotin labeled LB primer, 8 mM MgSO4, 1.4 mM dNTP, 0.8M betain, 20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% (v/v) Tween 20 and 16 units of Bsm polymerase.
[0390] Amount of biological sample per amplification reaction can be varied depending on the sample type and required sensitivity. MgSO4, dNTP and betain concentrations can be varied to obtain optimal sensitivity depending on the specific target and polymerase used in the reaction. Different oligonucleotide labeling can be used, like DIG or other oligonucleotide linkers. For N. gonorrhoeae specific and sensitive detection primer sequences listed in Table 8 can be used targeting Opa, PorA, pilin or 16S rRNA genes.
[0391] After 20-25 min incubation at 63° C., N. gonorrhoeae specific product formation is analyzed with lateral-flow strips. If patient is N. gonorrhoeae positive, two stripes appear on the lateral-flow strip, one in the “test” area and another in the “control” area. If the patient is N. gonorrhoeae negative, only one stripe appears on the lateral-flow strip in the “control” area. The completely N. gonorrhoeae testing procedure takes up to 30 min.
Example 5—Effect of Antimicrobial Peptides on the Downstream Amplification Efficiency
[0392] The described method does not require removal of the lysate preparation compositions prior to amplification, thus the effect of the selected membrane active peptides should be assessed on the downstream amplification.
[0393] Several efficient sample preparation methods contain components like SDS or Proteinase K that are highly inhibitory for the downstream amplification reaction, and therefore are not applicable for direct amplification from biological sample lysates but require additional step of purification of the nucleic acids.
[0394] To estimate potential inhibitory effect of different lysate preparation methods (alkaline, enzymatic, detergent lysis) and of antimicrobial peptides on downstream application efficiency, we have performed LAMP isothermal amplification in the presence of different lytic agents (
[0395] Addition of the lysozyme to the LAMP reaction had a very modest effect on the amplification efficiency. However, in combination with lysis enhancing agents (polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether or EDTA), isothermal amplification efficiency was significantly reduced. Alkaline lysis components had a major effect on the isothermal amplification, reducing LAMP activity up to 25 times (
[0396] Antimicrobial peptides are often forming cationic amphiphilic structure to interact with the negatively charged lipid bilayer. α-helical, β-turn, antiparallel β-sheet and β-hairpin structures are frequently found in natural DNA/RNA binding proteins. Thus antimicrobial proteins carry the potential to interfere with amplification through binding of the template DNA. Addition of magainin analogues MSI-78 and MSI-594 had indeed quite severe inhibiting effect on the amplification efficiency (
Example 6—Inhibitory Data
[0397] Some samples may contain inhibitory components that will cause a failure of assay, specifically amplification reaction resulting in a false negative diagnosis results and thus influencing sensitivity of the assay. Current invention contains balanced sample pre-treatment and lysis components cocktail that also serves anti-inhibitory behaviour. Using this developed lysis mixture (cocktail) that consists in urine (treated): [0398] 0.1 μM AMP (Cecropin P1) [0399] 10 mM EDTA [0400] 0.4% TX100 (surfactant)
[0401] in comparison of untreated urine samples shows as well a significant suppressing of inhibitory effect while the samples were spiked with CT (Chlamydia trachomatis) DNA, particularly 13% of samples. Thus within pre-treatment procedure is not only important a lysis of hosts and pathogen cells, it is also important to suppress inhibitory effects caused by sample matrix and its high variability among different patients.
TABLE-US-00011 untreated urine + CT- treated urine + CT- DNA DNA True positive 33 38 False negative 5 0 Inhibition in % 13 0
Example 7—Neisseria gonorrhoeae Cross Reactivity
[0402] The present inventors have developed several primer sets for NG detection while using the same method as described for example 1 for Chlamydia trachomatis. The presently preferred ones are listed below. The set LOD (limit of detection) is 230 copies/rxn (per reaction). Also a cross reactivity (important to evaluate a chance for false positives) against other Neisseria strains was evaluated and results are as follows:
[0403] Cross-Reactivity (Focus to Neisseria Strains)
TABLE-US-00012 Cross Primer N. spp. copies/rxn reactivity 2086 N. cinerea 50,000 − N. flava − N. meningitidis (serogroup B) − N. meningitidis (serogroup Y) − N. lactamica + N. perflava −
[0404] Cross Reactivity is Only for N. lactamica that is Actually Rare Strain to be Found in Urine
[0405] The very same cross reactivity was assessed with other primer sets as well and they showed higher cross reactivity rate, results are following:
TABLE-US-00013 Cross Primer N. spp. copies/rxn reactivity 1430 N. cinerea 50,000 + N. flava + N. meningitidis (serogroup B) − N. meningitidis (serogroup Y) − N. lactamica + N. perflava +
[0406] Crossreactivity with N. cinereal, N. flava, N. lactamica, N.
TABLE-US-00014 Cross Primer N. spp. copies/rxn reactivity 16S rRNA N. cinerea 50,000 + id07 N. flava + N. meningitidis (serogroup B) + N. meningitidis (serogroup Y) + N. lactamica + N. perflava +
[0407] Although this primer set showed the best LOD (77 copies/rxn) it has cross reactivity with all tested Neisseria-strains and thus not very suitable for diagnostic purposes.
TABLE-US-00015 TABLE 1 Primers to detect NG hypothetical protein 2086 target NG_hypothetical protein 2086 5′->3′ 2086_LD39_F3 GCTCTGACTCCATTATCCTATG 2086_LD39_B3 GCATTCAGACGTGCTTCTA 2086_LD39_FIP TTGCCGCCTAAGGTTCCGAGCTATGGCA TTAGGATTGTC 2086_LD39_BIP TGGAACGAGCCAAGGTGTTCTCTTGCAT CAACTGTTCCAT 2086_LD39_LF GCGGTCATTGACGAAATGG 2086_LD39_LB GGCTACAAGTGATAAGGTGCT
TABLE-US-00016 TABLE 2 Primers to detect NG hypothetical protein 1430_LD31 target NG-hypothetical protein 1430_LD31 5′->3′ 1430_LD31_F3 AATCAAGAATACCGCCTCAC 1430_LD31_B3 AGTTCTACGAACACTTGCTG 1430_LD31_FIP TTGGAGATGTGGCGTTCGGA CGACATCAACAACGACC 1430_LD31_BIP CGGAAGCAGGCGTCATCAGT TGTTTGGTCGCAAGGA 1430_LD31_LF TGTCCAATGCGTCGTTGA 1430_LD31_LB CGCCATGCCGACAATTAC
TABLE-US-00017 TABLE 3 Primers to detect NG 16S rRNA id07 target. NG-16S rRNA id07 5′->3′ 16S_id07_F3 GACGTCAAGTCCTCATGG 16S_id07_B3 CGGTTACCCTACCTACTTCT 16S_id07_FIP TTGTGAGATTGGCTCCGCTCTCACACGT CATACAATGGTC 16S_id07_BIP TCGAGTGCATGAAGTCGGAATCGAACGT ATTCACCGCAGT 16S_id07_LF GCTTGGCTACCCTCTGTAC 16S_id07_LB CTAGTAATCGCAGGTCAGCAT
[0408] Cross Reactivity is Only for N. lactamica that is Actually Rare Strain to be Found in Urine
[0409] The very same cross reactivity was assessed with other primer sets as well and they showed higher cross reactivity rate, results are following: [0410] Using the very same lysis mixture (that is 0.1 μM AMP/10 mM EDTA/0.4% TX100 in urine) for NG detection, the sensitivity and the specificity is following:
TABLE-US-00018 Neisseria gonorrhoeae Specificity in % 100% with 43 true negative urine samples Sensitivity in % 83.3% with 12 true positive urine samples
[0411] Using the very same lysis mixture (that is 0.1 μM AMP/10 mM EDTA/0.4% TX100 in urine) for NG detection, the sensitivity and the specificity is following:
TABLE-US-00019 Neisseria gonorrhoeae Specificity in % 100% with 43 true negative urine samples Sensitivity in % 83.3% with 12 true positive urine samples