COMPOSITION FOR PREVENTING OR TREATING DISEASES CAUSED BY OVEREXPRESSION OF CHEMOKINE CX3CL1, CONTAINING DEATH RECEPTOR INHIBITOR AS ACTIVE INGREDIENT

Abstract

The present invention relates to a composition for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 (fractalkine) comprising a death receptor 5 (DR5) inhibitor as an active ingredient, a method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 comprising administering a DR5 expression or activity inhibitor to a patient in need of prevention or treatment of diseases caused by overexpression of chemokine CX.sub.3CL1 in a therapeutically effective amount, and a use for prevention or treatment of diseases caused by overexpression of chemokine CX.sub.3CL1 of a DR5 expression or activity inhibitor.

Claims

1-9. (canceled)

10. A composition for inhibiting expression of chemokine CX.sub.3CL1, comprising an inhibitor of expression or activity of death receptor 5 (DR5) as an active ingredient.

11. The composition for inhibiting expression of chemokine CX.sub.3CL1 according to claim 10, wherein the DR5 protein binds to Fas ligand to increase an expression of CX.sub.3CL1.

12. The composition according to claim 10, wherein the inhibitor of expression or activity of DR5 is siRNA, shRNA, miRNA, ribozyme, DNAzyme, PNA (peptide nucleic acids), anti-sense oligonucleotide, peptide, an antibody, an aptamer, natural extract or a chemical substance.

13. The composition according to claim 12, wherein the inhibitor of DR5 is an antibody or siRNA.

14. The composition according to claim 12, wherein the inhibitor of DR5 binds to a CRD2 domain of DR5, a CRD3 domain of DR5, or both a CRD2 domain and a CRD3 domain.

15. The composition according to claim 13, wherein the antibody binds to the 53rd to 181st amino acid part in the amino acid sequence of SEQ ID NO: 1.

16. The composition according to claim 13, wherein the antibody binds to a CRD2 domain of DR5 consisting of the 101st to 120th amino acid sequence of SEQ ID NO: 1, a CRD3 domain of DR5 consisting of the 143th to 160th amino acid sequence of SEQ ID NO: 1, or both the CRD2 and CRD3 domains.

17. (canceled)

18. A screening method of a therapeutic agent for diseases caused by overexpression of chemokine CX.sub.3CL1, comprising reacting a candidate substance to a biological sample overexpressing chemokine CX.sub.3CL1; and measuring an activity or expression of death receptor 5 (DR5) in the sample, wherein the candidate substance is determined as the therapeutic agent for diseases caused by overexpression of chemokine CX.sub.3CL1, when the DR5 activity or expression is decreased in the sample treated with the candidate substance, or is decreased than the DR5 activity in the sample without being treated with the candidate substance.

19. The screening method according to claim 18, wherein the disease caused by overexpression of chemokine CX.sub.3CL1 is arthritis, cardiovascular disease, cancer, or HIV infection.

20. A method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1, comprising administering an inhibitor of expression or activity of DR5 to a patient in need of prevention or treatment of diseases caused by overexpression of chemokine CX.sub.3CL1 in a therapeutically effective amount.

21. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 20, wherein the inhibitor of expression or activity of DR5 is siRNA, shRNA, miRNA, ribozyme, DNAzyme, PNA (peptide nucleic acids), anti-sense oligonucleotide, peptide, an antibody, an aptamer, natural extract, or a chemical substance.

22. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 20, wherein the inhibitor of expression or activity of DR5 is an antibody or siRNA.

23. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 20, wherein the inhibitor of expression or activity of DR5 binds to a CRD2 domain of DR5, a CRD3 domain of DR5, or both a CRD2 domain and a CRD3 domain.

24. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 22, wherein the antibody binds to the 53rd to 181st amino acid part in the amino acid sequence of SEQ ID NO: 1.

25. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 22, wherein the antibody binds to a CRD2 domain of DR5 consisting of the 101st to 120th amino acid sequence of SEQ ID NO: 1, a CRD3 domain of DR5 consisting of the 143th to 160th amino acid sequence of SEQ ID NO: 1, or both the CRD2 and CRD3 domains.

26-31. (canceled)

32. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 22, wherein the disease is one or more selected from the group consisting of arthritis, cardiovascular diseases, cancer, HIV infection, primary biliary cirrhosis, renal disorder, allograft rejection, hypertension, eye disease, chronic pancreatitis, neuropathic pain, Sjogren syndrome, chronic obstructive pulmonary disease, emphysema, pulmonary fibrosis, atopic dermatitis, and lupus nephritic.

33. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 26, wherein the disease is atherosclerosis, coronary artery disease, carotid artery disease, stroke, or carotid atherosclerosis.

34. The method for preventing or treating diseases caused by overexpression of chemokine CX.sub.3CL1 according to claim 26, wherein the cancer is colorectal cancer or lung cancer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0063] FIG. 1 (A) shows the result of confirming the expression of DR5 gene in each cell by real-time PCR, after isolating synovial cells (Adherent cell/Adh.) and normal immunocytes (Supernatant cell/Sup.) in the joint obtained from the normal mouse (Normal) and arthritis-induced mouse (RA), and FIG. 1 (B) shows the result of confirming the expression of DR5 surface protein in the synovial cells of the joint obtained from the arthritis-induced mouse (RA) by flow cytometry, and FIG. 1 (C) shows the result of confirming the expression of DR5 surface protein in hFLS (human fibroblast-like synoviocytes) by flow cytometry.

[0064] FIG. 2 shows the experimental result for confirming FasL-DR5 intercombination, and FIG. 2 (A) shows the result of verifying the interaction of FasL-DR5 by confirming that FasL-IgG binding is inhibited, when FasL binding to hFLS is inhibited by treating an anti-DR5 antibody, and FIG. 2 (B) is the result of confirming the IgG signal strength on the cell surface treated with IgG-combined FasL after DR5 knock down in hFLS by treating siRNA by flow cytometry.

[0065] FIG. 3 shows the result of confirming secretion of CX.sub.3CL1 by ELISA after treating FasL and TRAIL to hFLS alone or in combination.

[0066] FIG. 4 (A) shows the result of measuring the amount of secreted CX.sub.3CL1 by ELISA after inhibiting the interaction of FasL and DR5 by treating an anti-DR5 antibody to hFLS, and FIG. 4 (B) shows the result of measuring the amount of secreted CX.sub.3CL1 by ELISA, after treating an anti-DR5 antibody to mouse synovial cells and then treating FasL.

[0067] FIG. 5 (A) is a graph showing the result of reduced expression of DR5 surface protein on the cell surface of hFLS due to DR5 siRNA treatment, and FIG. 5 (B) is a graph showing the result of reduced secretion of CX.sub.3CL1 in hFLS due to DR5 siRNA treatment.

[0068] FIG. 6 shows the result of confirming that the disease symptoms induced by sFasL injection, when sFasL is injected and an anti-DR5 antibody is injected at the same time to a FasL-mutated gld mouse which is a FasL deficient mouse. It shows the changes of arthritis symptoms in gld mouse treated with K/B×N serum, gld mouse treated with K/B×N serum and sFasL, and gld mouse treated with K/B×N serum, sFas ligand and anti-DR5 antibody (anti-DR5), and (A) is the graph measuring the thickness of the joint and (B) is the graph measuring clinical indexes.

[0069] FIG. 7a shows huDR5-CRD2 and huDR5-CRD3 which are candidate sites where huDR5 protein amino acid sequence and sFasL are expected to bind, and the 111th, 114th, 119th, 120th, 148th, 150th, 153rd and 156th amino acids are Alanine-substituted mutation occurring sites.

[0070] FIG. 7b shows the 1st to 840th sequence of SEQ ID NO: 4 that is the huDR5 DNA sequence, and the polynucleotide consisting of the 334th to 363rd sequence and the polynucleotide consisting of the 445th to 471st sequence are mutation occurring sites.

[0071] FIG. 8a shows immunogen sites of the huDR5-CRD2 and huDR5-CRD3 and DR5 FACS antibody, which are candidate sites where huDR5 protein amino acid sequence, sFasL are expected to bind.

[0072] FIG. 8b shows the result of performing flow cytometry using human FasL where an immunoglobulin (IgG) that binds to huDR5 is combined, after expressing DR5 where huDR5-CRD2 or huDR5-CRD3 is mutated.

[0073] FIG. 9 shows a schematic diagram of a mechanism model which facilitates expression of sCX.sub.3CL1 as sFasL binds to a DR5 receptor of human-derived FLS and induces inflammation as this sCX.sub.3CL1 increases expression of chemokine such as CCL2, CCL3, CXCL10 and the like from immunocytes.

DETAILED DESCRIPTION OF THE INVENTION

[0074] Hereinafter, the prevent invention will be described in more detail by examples. However, these examples are intended to illustrate the present invention only, and the scope of the present invention is not limited by these examples.

Example 1. Identification Membrane Protein which Binds to sFas Ligand (DR5)

[0075] Until now, it has been known that FasL binds to its receptor, Fas, and induces apoptosis of target cells, and thereby it causes joint inflammation. In addition, in the previous research of the present inventors, it has been revealed that FasL controls expression of chemokine with a new mechanism different from conventional inflammation induction of apoptosis of Fas-FasL, and also, it has been determined that FasL itself acts as chemokine attracting inflammatory cells. However, in the previous research, it has not been specifically revealed how FasL controls occurrence of inflammation by binding to which membrane protein in the new inflammation causing mechanism by FasL.

[0076] Accordingly, the present inventors have performed the protein identification experiment in order to find a protein binding to sFasL (soluble Fas Ligand) in the new inflammation causing mechanism by FasL.

[0077] At first, after obtaining synovium of an arthritis patient in vitro and then digesting with collagenase and culturing for 3 days, adherent cells were isolated to obtain human fibroblast-like synoviocytes (hFLS). By reacting biotinylated sFasL obtained by biotinylation of the obtained hFLS and recombinant human Fas ligand (R&D Systems 126-FL-010) with Sulfo-NHS-SS-Biotin—Thermo Scientific #21331, sFasL and hFLS targeting receptor protein were combined. Then, after cross-linking using a cross-linking agent (bis(sulfosuccinimidyl)suberate; BS3), cell lysis was conducted.

[0078] Then, to isolate sFasL-combined hFLS target protein, avidin purification was performed, and thereby the biotinylated sFas ligand recombinant protein and hFLS targeting receptor protein combined thereto were isolated together. After that, the sample was separated by SDS-PAGE and the gel was fractionized, and then peptides were extracted by the in-gel digestion method.

[0079] After analyzing the extracted peptides repeatedly twice using high resolution Hybrid quadrupole-orbitrap mass spectrometer, proteins which were not shown in the control group (Biotinylated Fc) and were shown only in the experimental group at least once were selected using SEQUEST algorithm. Proteins known to be present in cell membrane or extracellular matrix among selected proteins were sorted using classification by Uniprot database, and among them, DR5 was identified.

Example 2. Confirmation of Expression of DR5 Surface Protein in hFLS and Joint Synovial Cells of Arthritis-Induced Mouse

[0080] In order to confirm the expression of DR5 surface protein in human-derived FLS (hFLS) and joint synovial cells of the arthritis-induced mouse, flow cytometry and real-time PCR were conducted. In real-time PCR, Applied Biosystems 7500 Real Time PCR System was used, and F: GGGCCACAGGGACACCTT/R: GCATCTCGCCCGGTTTT were used as primers, and they were reacted by 40 cycles of 50° C. for 2 minutes, 95° C. for 2 minutes, 95° C. for 15 seconds and then 60° C. for 1 minutes.

[0081] Then, after isolating synovial cells (Adherent cell/Adh.) and normal immunocytes (Supernatant cell/Sup.) in the joint obtained from the normal mouse (Normal) and arthritis-induced mouse (RA), respectively, expression of DR5 gene was compared in each cell. The experimental result was shown in FIG. 1.

[0082] As confirmed in FIG. 1 (A), the relative expression of DR5 surface protein in synovial cells of the joint obtained from the arthritis-induced mouse was increased than that in the normal mouse, and as confirmed by the flow cytometry result of FIG. 1 (B) and (C), it was confirmed that the DR5 surface protein was expressed in the arthritis-induced mouse synovial cells (Adherent cells) and hFLS.

[0083] Therefore, it could be seen that the expression of DR5 surface protein was increased in hFLS and cells obtained from a joint of arthritis-induced mouse, specifically in synovial cell, compared to the normal mouse.

Example 3. Confirmation of FasL-DR5 Intercombination

[0084] 3-1. DR5 Antibody Treatment

[0085] In order to confirm whether FasL and membrane protein DR5 actually bind, an anti-DR5 antibody (R&D systems AF631) was treated to hFLS to interrupt binding to cell surface DR5 of FasL.

[0086] Then, IgG-combined FasL was treated, and the IgG signal strength on the surface was confirmed by flow cytometry, and the result was shown in FIG. 2 (A). As could be seen in FIG. 2 (A), it could be seen that the signal strength by IgG was decreased when the anti-DR5 antibody was treated, and FasL-DR5 binding was reduced when the DR5 activity was inhibited by the anti-DR5 antibody.

[0087] 3-2. Knock-Down Using siRNA Against DR5

[0088] In order to confirm whether FasL and membrane protein DR5 actually bind, siRNA (Sigma Aldrich MISSION siRNA; SASI_Hs01_00040567) was treated to hFLS, and using an electroporator (Neon transfection system, Thermo Fisher Scientific), expression of DR5 was knocked-down.

[0089] Then, after treating IgG-combined FasL, the IgG signal strength on the surface was confirmed by flow cytometry, and the result was shown in FIG. 2 (B). As could be seen in FIG. 2 (B), it could be seen that the signal strength by IgG was decreased when siRNA was treated, that is the signal strength by IgG was decreased as binding of Fas ligands was reduced, when expression of DR5 was reduced on the hFLS surface.

[0090] From the above results, it was confirmed that FasL and DR5 interactively bound specifically each other.

Example 4. Confirmation of Increase of Chemokine CX.SUB.3.CL1 Expression by FasL DR5 Binding

[0091] In order to confirm chemokine where its expression is increased by FasL-DR5 binding, 200 ng/ml of each of FasL and TRAIL was treated to hFLS alone or in combination for 24 hours, and then the secretion of CX.sub.3CL1 was confirmed according to the protocol provided by the manufacturer of ELISA (R&D systems DY365), and the result was shown in FIG. 3. As could be seen in FIG. 3, it was confirmed that the amount of CX.sub.3CL1 was not increased when TRAIL known as a common ligand of DR5 was treated, but the amount of CX.sub.3CL1 was increased when FasL was treated.

[0092] From that, it could be seen that the expression of chemokine CX.sub.3CL1 was increased in hFLS by binding of FasL and DR5. It was confirmed that CX.sub.3CL1 was one of chemokines causing inflammation, and facilitated the secretion of CX.sub.3CL1 of hFLS cells during FasL-DR5 binding to cause inflammation.

Example 5. Confirmation of Decrease of Chemokine Expression by FasL-DR5 Inhibition

[0093] In order to confirm whether the secretion of chemokine CX.sub.3CL1 which is secreted when FasL is treated is decreased, when the interaction of FasL and DR5 is inhibited, the following experiment was performed.

[0094] 5-1. DR5 Antibody Treatment

[0095] After treating an antibody against 0.5 ug/ml of DR5 (R&D Systems AF631) to hFLS or mouse synovial cells for 1 hour and treating FasL 200 ng/mL, the amount of CX.sub.3CL1 secreted was confirmed by ELISA, and the result was shown in FIG. 4. FIG. 4 (A) shows the treatment of the DR5 antibody to hFLS and the expression of CX.sub.3CL1 was reduced in the anti-DR5 than Isotype (Goat IgG, R&D Systems AB-108-C), and FIG. 4 (B) shows the treatment of the anti-DR5 antibody to mouse synovial cells and it could be seen that the expression of CX.sub.3CL1 in the anti-DR5 was also reduced.

[0096] 5-2. siDR5 Knock-Down

[0097] siRNA (Sigma Aldrich MISSION siRNA; SASI_Hs01_00040567) was treated to hFLS, and the expression of DR5 was knocked-down using an electroporator (Neon transfection system, Thermo Fisher Scientific), and as a result, as could be seen in FIG. 5 (A), it was confirmed that the expression of cell surface DR5 surface protein of hFLS was reduced by DR5 siRNA treatment.

[0098] Then, after treating FasL 200 ng/mL for 24 hours, and the amount of secreted CX.sub.3CL1 was confirmed by ELISA, and as a result, as could be seen in FIG. 5 (B), it was confirmed that the amount of CX.sub.3CL1 secreted by FasL treatment was decreased compared to the control group.

[0099] Taken the above results together, it could be seen that FasL bound to DR5 and the expression of CX.sub.3CL1 was increased by this DR5 binding, and when interrupting FasL-DR5 interaction, the expression of CX.sub.3CL1 was reduced. Thereby, it could be confirmed that when the DR5 antibody was treated, or DR5 was knocked-down to interrupt binding between DR5 and FasL, the expression of intracellular inflammation causing chemokine CX.sub.3CL1 was reduced to inhibit inflammation occurrence, and it was effective in inhibiting arthritis symptoms not only in the early stage of occurrence of inflammation, particularly arthritis, but also after occurrence.

Example 6. Test of Alleviation of Arthritis Symptoms when Injecting the Anti-DR5 Antibody

[0100] In order to confirm the alleviation of arthritis symptoms when injecting the anti-DR5 antibody to the arthritis mouse model induced by FasL, at first, serum was collected and prepared from blood in FasL deficient gld mouse (Central experimental animal) and K/B×N mouse that arthritis was naturally caused (obtained by crossbreeding KRN TCR transgenic mouse and NOD mouse provided from Drs.D.Mathis and C.Benoist of Harvard medical school, Boston, Mass.).

[0101] To the gld mouse, 1) K/B×N serum obtained above was injected (−), and 2) K/B×N serum and sFas ligand ((−)+sFas ligand)) was injected, and 3) K/B×N serum, sFas ligand and an anti-DR5 antibody (anti-DR5) were injected for 10 days, and the thickness of each joint was measured with a caliper (Manostat, Switzerland), and a clinical index was measured.

[0102] The clinical index referred to the followings: [0103] 0: no joint swelling, [0104] 1: swelling of one finger joint, [0105] 2: mild swelling of wrist or ankle, [0106] 3: severe swelling of wrist or ankle.

[0107] The thickness of the joint and the clinical index measured as above were shown in FIG. 6. As confirmed in FIG. 6 (A), when the serum and sFasL were treated to the gld mouse, the joint began to be swell from the 4th day and the highest index could be observed at day 9˜10. However, when the serum and sFasL and the anti-DR5 were treated together to the gld mouse, little swelling of the joint could be observed. In addition, as confirmed in FIG. 6 (B), also in case of the clinical index, when treating sFasL and anti-DR5 together to the gld mouse, the clinical index remained at 3-4 points, and little swelling of the joint could be observed.

[0108] From the above results, it could be confirmed that the blockage of binding of DR5-FasL by anti-DR5 treatment inhibited the inflammation reaction, and it could be used as an agent for preventing and treating inflammation including arthritis.

Example 7. Confirmation of sFasL-DR5 Binding Sites Through DR5 Mutagenesis

[0109] In order to confirm the binding sites of sFasL and DR5, huDR5 (SEQ ID NO: 1 in Table 1)-cloned piRES3-Puro vector was used as a template, and using Overlap PCR method, in the candidate sites where sFasL was expected to bind in the huDR5 protein amino acid sequence (See FIG. 7a) (selecting sites where the ligand of DR5, TRAIL binds conventionally as the candidate sites), huDR5-CRD2 (334-363 in the total sequence) or huDR5-CRD3 (445-471 in the total sequence), the amino acids shown in blue in FIG. 7b were substituted with alanine and then were cloned, to prepare huDR5 mutation DNA (See FIG. 7b and Table 1).

[0110] After transfecting mutated huDR5 DNA to mouse cells and expressing each of DR5 where huDR5-CRD2 was mutated (Table 1, SEQ ID NO: 4), or DR5 where huDR5-CRD3 was mutated (Table 1, SEQ ID NO: 5), flow cytometry was performed using human FasL where an immunoglobulin (IgG) binding only to cells expressing huDR5 was combined (huFasL-IgG), and the result was shown in FIG. 8b.

[0111] As could be seen in FIG. 8b, huFasL-IgG did not bind to huDR5 where CRD2 or CRD3 was mutated, and therefrom, it could be confirmed that the binding sites between FasL-DR5 bound using CRD3 and CRD3 of DR5 similar to TRAIL.

TABLE-US-00001 TABLE 1 SEQ Classification Sequence ID NO huDR5 Protein MEQRGQNAPAASGARKRHGP 1 GPREARGARPGPRVPKTLVL VVAAVLLVSAESALITQQDL APQQRAAPQQKRSSPSEGLC PPGHHISEDGRDCISCKYGQ DYSTHWNDLLFCLRCTRCDS GEVELSPCTTTRNTVCQCEE GTFREEDSPEMCRKCRTGCP RGMVKVGDCTPWSDIECVHK ESGIIIGVTVAAVVLIVAVF VCKSLLWKKVLPYLKGICSG GGGDPERVDRSSQRPGAEDN Mutation huDR5-CRD2 MEQRGQNAPAASGARKRHGP 2 Protein GPREARGARPGPRVPKTLVL VVAAVLLVSAESALITQQDL APQQRAAPQQKRSSPSEGLC PPGHHISEDGRDCISCKYGQ DYSTHWNDLLACLACTRCAA GEVELSPCTTTRNTVCQCEE GTFREEDSPEMCRKCRTGCP RGMVKVGDCTPWSDIECVHK ESGIIIGVTVAAVVLIVAVF VCKSLLWKKVLPYLKGICSG GGGDPERVDRSSQRPGAEDN VLNEIVSILQPTQVPEQEME VQEPAEPTGVNMLSPGESEH LLEPAEAERSQRRRLLVPAN EGDPTETLRQCFDDFADLVP FDSWEPLMRKLGLMDNEIKV AKAEAAGHRDTLYTMLIKWV NKTGRDASVHTLLDALETLG ERLAKQKIEDHLLSSGKFMY LEGNADSAMS Mutation huDR5-CRD3 MEQRGQNAPAASGARKRHGP 3 Protein GPREARGARPGPRVPKTLVL VVAAVLLVSAESALITQQDL APQQRAAPQQKRSSPSEGLC PPGHHISEDGRDCISCKYGQ DYSTHWNDLLFCLRCTRCDS GEVELSPCTTTRNTVCQCEE GTFREEDAPAMCAKCATGCP RGMVKVGDCTPWSDIECVHK ESGIIIGVTVAAVVLIVAVF VCKSLLWKKVLPYLKGICSG GGGDPERVDRSSQRPGAEDN VLNEIVSILQPTQVPEQEME VQEPAEPTGVNMLSPGESEH LLEPAEAERSQRRRLLVPAN EGDPTETLRQCFDDFADLVP FDSWEPLMRKLGLMDNEIKV AKAEAAGHRDTLYTMLIKWV NKTGRDASVHTLLDALETLG ERLAKQKIEDHLLSSGKFMY LEGNADSAMS huDR5 DNA atggaacaacggggacagaa 4 cgccccggccgcttcggggg cccggaaaaggcacggccca ggacccagggaggcgcgggg agccaggcctgggccccggg tccccaagacccttgtgctc gttgtcgccgcggtcctgct gttggtctcagctgagtctg ctctgatcacccaacaagac ctagctccccagcagagagc ggccccacaacaaaagaggt ccagcccctcagagggattg tgtccacctggacaccatat ctcagaagacggtagagatt gcatctcctgcaaatatgga caggactatagcactcactg gaatgacctccttttctgct tgcgctgcaccaggtgtgat tcaggtgaagtggagctaag tccctgcaccacgaccagaa acacagtgtgtcagtgcgaa gaaggcaccttccgggaaga agattctcctgagatgtgcc ggaagtgccgcacagggtgt cccagagggatggtcaaggt cggtgattgtacaccctgga gtgacatcgaatgtgtccac aaagaatcaggcatcatcat aggagtcacagttgcagccg tagtcttgattgtggctgtg tttgtttgcaagtctttact gtggaagaaagtccttcctt acctgaaaggcatctgctca ggtggtggtggggaccctga gcgtgtggacagaagctcac aacgacctggggctgaggac aatgtcctcaatgagatcgt gagtatcttgcagcccaccc aggtccctgagcaggaaatg gaagtccaggagccagcaga gccaacaggtgtcaacatgt tgtcccccggggagtcagag catctgctggaaccggcaga agctgaaaggtctcagagga ggaggctgctggttccagca aatgaaggtgatcccactga gactctgagacagtgcttcg atgactttgcagacttggtg ccctttgactcctgggagcc gctcatgaggaagttgggcc tcatggacaatgagataaag gtggctaaagctgaggcagc gggccacagggacaccttgt acacgatgctgataaagtgg gtcaacaaaaccgggcgaga tgcctctgtccacaccctgc tggatgccttggagacgctg ggagagagacttgccaagca gaagattgaggaccacttgt tgagctctggaaagttcatg tatctagaaggtaatgcaga ctctgccatgtcctaa  Mutation huDR5- atggaacaacggggacagaa 5 CRD2 DNA cgccccggccgcttcggggg cccggaaaaggcacggccca ggacccagggaggcgcgggg agccaggcctgggccccggg tccccaagacccttgtgctc gttgtcgccgcggtcctgct gttggtctcagctgagtctg ctctgatcacccaacaagac ctagctccccagcagagagc ggccccacaacaaaagaggt ccagcccctcagagggattg tgtccacctggacaccatat ctcagaagacggtagagatt gcatctcctgcaaatatgga caggactatagcactcactg gaatgacctccttgcctgct tggcctgcaccacgtgtgct gcaggtgaagtggagctaag tccctgcaccacgaccagaa acacagtgtgtcagtgcgaa gaaggcaccttccgggaaga agattctcctgagatgtgcc ggaagtgccgcacagggtgt cccagagggatggtcaaggt cggtgattgtacaccctgga gtgacatcgaatgtgtccac aaagaatcaggcatcatcat aggagtcacagttgcagccg tagtcttgattgtggctgtg tttgtttgcaagtctttact gtggaagaaagtccttcctt acctgaaaggcatctgctca ggtggtggtggggaccctga gcgtgtggacagaagctcac aacgacctggggctgaggac aatgtcctcaatgagatcgt gagtatcttgcagcccaccc aggtccctgagcaggaaatg gaagtccaggagccagcaga gccaacaggtgtcaacatgt tgtcccccggggagtcagag catctgctggaaccggcaga agctgaaaggtctcagagga ggaggctgctggttccagca aatgaaggtgatcccactga gactctgagacagtgcttcg atgactttgcagacttggtg ccctttgactcctgggagcc gctcatgaggaagttgggcc tcatggacaatgagataaag gtggctaaagctgaggcagc gggccacagggacaccttgt acacgatgctgataaagtgg gtcaacaaaaccgggcgaga tgcctctgtccacaccctgc tggatgccttggagacgctg ggagagagacttgccaagca gaagattgaggaccacttgt tgagctctggaaagttcatg tatctagaaggtaatgcaga ctctgccatgtcctaa Mutation huDR5- atggaacaacggggacagaa 6 CRD3 DNA cgccccggccgcttcggggg cccggaaaaggcacggccca ggacccagggaggcgcgggg agccaggcctgggccccggg tccccaagacccttgtgctc gttgtcgccgcggtcctgct gttggtctcagctgagtctg ctctgatcacccaacaagac ctagctccccagcagagagc ggccccacaacaaaagaggt ccagcccctcagagggattg tgtccacctggacaccatat ctcagaagacggtagagatt gcatctcctgcaaatatgga caggactatagcactcactg gaatgacctccttttctgct tgcgctgcaccaggtgtgat tcaggtgaagtggagctaag tccctgcaccacgaccagaa acacagtgtgtcagtgcgaa gaaggcaccttccgggaaga agatgctcctgcgatgtgcg cgaagtgcgccacagggtgt cccagagggatggtcaaggt cggtgattgtacaccctgga gtgacatcgaatgtgtccac aaagaatcaggcatcatcat aggagtcacagttgcagccg tagtcttgattgtggctgtg tttgtttgcaagtctttact gtggaagaaagtccttcctt acctgaaaggcatctgctca ggtggtggtggggaccctga gcgtgtggacagaagctcac aacgacctggggctgaggac aatgtcctcaatgagatcgt gagtatcttgcagcccaccc aggtccctgagcaggaaatg gaagtccaggagccagcaga gccaacaggtgtcaacatgt tgtcccccggggagtcagag catctgctggaaccggcaga agctgaaaggtctcagagga ggaggctgctggttccagca aatgaaggtgatcccactga gactctgagacagtgcttcg atgactttgcagacttggtg ccctttgactcctgggagcc gctcatgaggaagttgggcc tcatggacaatgagataaag gtggctaaagctgaggcagc gggccacagggacaccttgt acacgatgctgataaagtgg gtcaacaaaaccgggcgaga tgcctctgtccacaccctgc tggatgccttggagacgctg ggagagagacttgccaagca gaagattgaggaccacttgt tgagctctggaaagttcatg tatctagaaggtaatgcaga ctctgccatgtcctaa