Membrane-Type Metalloprotease Inhibitory Protein and Pharmaceutical and Pharmaceutical Composition Containing Same, and Respective Uses Thereof
20230159624 · 2023-05-25
Inventors
Cpc classification
C07K14/8146
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
The present application discloses a membrane-type metalloprotease inhibitory protein T1.sup.PrαTACE and use thereof, which can be used for preparing drugs targeting MT1-MMP or TACE endonuclease. The present application discloses an antitumor pharmaceutical composition, comprising BHK-21 cells and an artificial basal membrane which expresses T1.sup.PrαTACE protein.
Claims
1. A membrane-type metalloprotease inhibitory protein T1.sup.PrαTACE having an amino acid sequence as shown in Seq ID No. 1.
2. A use of the membrane-type metalloprotease inhibitory protein T1.sup.PrαTACE of claim 1 in the preparation of anti-tumor drugs with MT1-MMP and TACE endoproteinase as potential targets.
3. A drug, comprising the membrane-type metalloprotease inhibitory protein T1.sup.PrαTACE of claim 1 and a pharmaceutically acceptable excipient.
4. The drug of claim 3, wherein the excipient is a carrier, a solvent, a emulsifier, a dispersant, a humectant, an adhesive, a stabilizer, a colorant or a flavor.
5. The drug of claim 3, wherein the drug is an injection, a tablet, a capsule, an electuary, a drop, a granule or an ointment.
6. An anti-tumor pharmaceutical composition, comprising BHK-21 cells expressing the T1.sup.PrαTACE protein of claim 1 and an artificial basal membrane.
7. The pharmaceutical composition of claim 6, wherein the BHK-21 cells expressing the T1.sup.PrαTACE protein have a final concentration of 300,000 cells/mL to 625,000 cells/mL.
8. The pharmaceutical composition of claim 6, wherein the artificial basal membrane has a mass percentage of 30 wt % to 60 wt %.
9. The pharmaceutical composition of claim 6, further comprising Dulbecco's medium (DMEM) with 2% to 10% of fetal bovine serum.
10. The pharmaceutical composition of claim 6, wherein the pharmaceutical composition comprises: BHK-21 cells expressing the T1.sup.PrαTACE protein at a final concentration of 300,000 cells/mL to 625,000 cells/mL; 30 wt % to 60 wt % of an artificial basal membrane and Dulbecco's medium with 5% of fetal bovine serum.
11. The pharmaceutical composition of claim 6, wherein the artificial basal membrane is Matrigel® matrigel.
12. The pharmaceutical composition of claim 6, wherein the BHK+T1.sup.PrαTACE cells cultured in Dulbecco's medium containing fetal bovine serum are mixed with the matrigel before use.
13. A use of the pharmaceutical composition of claim 6 for preparing a drug for the treatment or prevention of tumors.
14. The use of claim 13, wherein the tumor is selected from renal cancer, cervical cancer, breast cancer, lung cancer, rectal cancer, ovarian cancer, liver cancer, gastric cancer and leukemia.
15. The use of claim 14, wherein the renal cancer comprises renal cell carcinoma.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0040]
[0041]
(1) An N-terminal “inhibitory domain” that binds directly to the catalytic clefts of MT1-MMP (K.sub.i.sup.app 7.70 nM, Table 1) and TACE (K.sub.i.sup.app 0.14 nM, Table 1).
(2) A C-terminal glycosylphosphatidylinositol (GPI) anchor that tethers the TIMP to the cell membrane and thus, to the vicinity of MT1-MMP and TACE.
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
DETAILED DESCRIPTION
[0053] Specific embodiments of the present application is described in detail below with reference to the drawings.
I. MATERIALS
[0054] 1. Experimental Animal
NOD-SCID mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.)
[0055] 2. Drugs and Reagents
[0056] 2.1 Drugs: puromycin; basal membrane Matrigel®, from BD Bioscience; BHK-21 cell strain (Shanghai cell bank GNHa10). CaKi-1 cells (Shanghai cell bank TChu135). HeLa cells (Shanghai cell bank TChu187); medium: 5% fetal bovine serum, penicillin-streptomycin solution (1×) and DMEM medium.
[0057] 2.2 Reagents: TIMP-1 antibody (Abcam), MT1-MMP antibody (Abcam), TACE antibody (Abcam), Alexa Fluor488 anti-mouse secondary antibody (Invitrogen), Alexa Fluor555 anti-rabbit secondary antibody (Invitrogen), ProLong® Antifade reagent with DAPI (Thermo Fisher), 38% paraformaldehyde (Sigma), porcine Oregon Green® 488-conjugated gelatin (Thermoscientific), lipofectamine transfection kit (Invitrogen), propylene glycol methyl ether acetate (PMA), phosphate substrate (Sigma), TNF-α Elisa kit (Sino Bio), EcoR I endonuclease (Thermoscientific), Xho I endonuclease (Thermoscientific), Apa I endonuclease (Thermoscientific), Nde I endonuclease (Thermoscientific), related gene sequences and primers synthesized by Sangon Biotech (Shanghai) Co. Ltd.
[0058] 2.3 Instruments: LS-55 fluorescence spectrometer (PerkinElmer Life Sciences). C1-Si laser confocal microscope (Nikon), upright fluorescence microscope (Nikon), inverted fluorescence microscope (Nikon), multifunctional Microplate Reader (Thermoscientific); FACSAriaII cell sorter (BD Bioscience), automatic cell counter (Invitrogen).
II. EXAMPLE
Example 1: Inhibitory Effects of T1.SUP.PrαTACE .on MT1-MMP and TACE
[0059] The study was performed according to the methods disclosed in the following references: [0060] 1. Lee M H, Rapti M. Knauper V. Murphy G. Threonine 98, the pivotal residue of tissue inhibitor of metalloproteinases (TIMP)-1 in metalloproteinase recognition. J. Biol. Chem. 2004:279(17):17562-69. [0061] 2. Lee M H, Rapti M. Murphy G. Unveiling the surface epitopes that render tissue inhibitor of metalloproteinase-1 inactive against membrane type 1-matrix metalloproteinase. J. Biol. Chem. 2003; 278(41):40224-30.
[0062] Specific procedures are as follows.
1. MT1-MMP (R&D, 918-MP-010) and TACE (R&D, 930-ADB-010) proteins were purchased from R&D Systems.
2. The N-terminal (i.e. the inhibitory) domain of wild type TIMP-1 (GenBank: S68252.1) was prepared by PCR amplification using the following primers (synthesized by Sangon Biotech): forward primer: 5′-GAACCATATGTGCACCTGTGTACCACCCCACCCA-3′ (Nde I restriction site is marked, as shown in Seq ID No. 3), and reverse primer: 5′-TCAACTGCTCGAGTTAATGATGATGATGATGATGATGATGGGCTATCTGGGACCGC AGGGACTG-3′ (Xho I restriction site is underlined, as shown in Seq ID No. 4).
3. Likewise, the N-terminal domain of T1.sup.PrαTACE was prepared by PCR amplification, wherein the forward primer was 5′-GAAC CATATGTGCACCTGTTCCCCACCCCACCCA-3′ as shown in Seq ID No. 5, and the reverse primer is the same to that for wild type TIMP-1.
4. TIMP-1 and T1.sup.PrαTACE PCR amplicons were digested with Nde I and Xho I and cloned into a pRSET-c expression vector (Invitrogen) to generate expression plasmids bearing the TIMP cDNAs. The plasmids were sequenced (Sangon Biotech (Shanghai) Co. Ltd.) to ensure that no unwanted mutation had been accidentally introduced during the PCR amplification process.
5. pRSET-c plasmids containing the N-terminal domains of TIMP-1 and T1.sup.PrαTACE were transformed into BL21(DE3)pLys competent cells for protein expression.
6. The binding affinities of TIMP-1 and T1.sup.PrαTACE were tested on MT1-MMP and TACE with a LS-55 fluorescence spectrofluorimeter.
[0063] Results are shown in Table 1.
TABLE-US-00001 TABLE 1 Inhibitory Affinities of Wild Type TIMP-1 (inhibitory domain) and T1.sup.PrαTACE (inhibitory domain) on MT1-MMP and TACE (K.sub.i.sup.app, unit: nM) TIMP-1 T1.sup.PrαTACE MT1-MMP 178 ± 20 7.70 ± 2.84 TACE 356 ± 87 0.14 ± 0.06
Kinetic analysis shows that the binding affinities of T1.sup.PrαTACE on MT1-MMP and TACE was substantially stronger than that of the wild type TIMP-1.
[0064] Table 1 shows the inhibitory effects of wild type TIMP-1 and T1.sup.PrαTACE on MT1-MMP and TACE. By measuring the changes in the intensity of the fluorescent substrate (Mca-K-P-L-G-L-Dpa-A-R-NH2, R&D Systems) with a LS-55 fluorescence spectrofluorimeter, the affinity of the TIMPs on MT1-MMP and TACE were measured and calculated. Data show that the affinity of T1.sup.PrαTACE for MT1-MMP and TACE (K.sub.i.sup.app was 7.70 nM and 0.14 nM, respectively) was significantly higher than that of the wild type TIMP-1 (K.sub.i.sup.app>150 nM in both occasions).
Example 2: Co-Localization of T1.SUP.PrαTACE .with MT1-MMP and TACE on the Cell Surface
[0065] 1. Lentiviruses carrying TIMP-1 and T1.sup.PrαTACE cDNAs were prepared as follows:
a. Wild type TIMP-1 (GenBank: S68252.1) was amplified by PCR using the following primers: forward primer: 5′-GCAGCAGAATTCACCATGGCCCCCTTTGAGCCCCTGGCT-3′ (EcoR I restriction site is underlined, as shown in Seq ID No. 6), and reverse primer: 5′-TCAACTGGGGCCCTTAGGCTATCTGGGACCGCAGGGACTG-3′ (Apa I restriction site is underlined, as shown in Seq ID No. 7).
b. Likewise, T1.sup.PrαTACE cDNA was similarly prepared, wherein the forward primer was identical to that for TIMP-1, the reverse primers were composed of three overlapping primers {circle around (1)}5′-GGCCTGAGATTCCCTCTCGTACTGGGCTATCTGGGACCGCAGGGACTG-3′, as shown in Seq ID No. 8: {circle around (2)} 5′-CACAGGTGGGGAGGAGAAGAGGACCATGCTCGATCCTCTCTGGTAATAGGCCTGA GATTCCCTCTCGTACTG-3′, as shown in Seq ID No. 9; and {circle around (3)} 5′-TAAACGGGCCCTCATCCCACTATTAGGAAGATGAGGAAAGAGATCAGGAGGATCA CAGGTGGGGAGGAGAAG AGGAC-3′, as shown in Seq ID No. 10. In short, one forward and three (overlapping) reverse primers were used to generate T1.sup.PrαTACE cDNA that carries a GPI signal peptide at the C-terminus.
c. The PCR amplicons were digested with EcoR I and Apa I for insertion into pLVX-puro (Takara) vector. The plasmids were sequenced to ensure that no unwanted mutation had been introduced during the PCR amplification process.
d. pLVX-puro plasmids containing TIMP-1 and T1.sup.PrαTACE cDNAs were extracted and purified with a Maxiprep plasmid kit (AXYGEN) for downstream packaging application.
e. Lenti-X One-Shot Packaging mix (Takara 631276) was dissolved in 0.5 ml sterile water and mixed with 10 μg of TIMP-1 or T1.sup.PrαTACE plasmid DNA.
f. The packaging-plasmid mix were added to Lenti-X 293T cells in 10 cm cell culture plates to allow for viral packaging in a humidified cell culture incubator. Media containing lentivirus was harvested 3 days later.
g. CaKi-1 cells were transduced with lentivirus containing TIMP-1/T1.sup.PrαTACE and stably transduced cells were obtained by selection with puromycin (1 μg/mL).
[0066] 2. Co-localization of T1.sup.PrαTACE with MT1-MMP and TACE on the Cell Surface
The study was performed according to the method disclosed in the following document: Jiang B, Zhang Y, Liu J, et al. Ensnaring membrane type 1-matrix metalloproteinase (MT1-MMP) with tissue inhibitor of metalloproteinase (TIMP)-2 using the haemopexin domain of the protease as a carrier: a targeted approach in cancer inhibition. Oncotarget, 2017, 8(14): 22685.
[0067] Specific procedures are as follows.
(1) CaKi-1 cells stably expressing TIMP-1 and T1.sup.PrαTACE were seeded on a chamber slide and cultured for 2 days at 37° C.
(2) The cells were fixed in 4% paraformaldehyde for 10 minutes followed by rinsing with PBS for 3 times.
(3) Following a 2-hour blocking with 5% bovine serum albumin (BSA)/PBS, two antibody pairs TIMP-1+MT1-MMP or TIMP-1+TACE were added to the slide for overnight incubation at 4° C.
(4) The slide was rinsed three times with PBS, 5 minutes each.
(5) Anti-mouse/rabbit secondary antibodies were added to the slide. Incubation was allowed at room temperature for 2 hours.
(6) Following rinsing with PBS, the slides were mounted in ProLong® Antifade reagent and inspected under a confocal laser scanning microscope.
[0068] Result: As shown in
Example 3: T1.SUP.PrαTACE .Inhibits Gelatin Degradation by MT1-MMP in HT1080 Cells
[0069] The study was performed according to the methods disclosed in the following document: Jiang B, Zhang Y, Liu J, et al. Ensnaring membrane type 1-matrix metalloproteinase (MT1-MMP) with tissue inhibitor of metalloproteinase (TIMP)-2 using the haemopexin domain of the protease as a carrier: a targeted approach in cancer inhibition. Oncotarget, 2017, 8(14): 22685.
[0070] Specific procedures are as follows:
1. HT1080 cells were infected with lentivirus bearing TIMP-1 and T1.sup.PrαTACE genes as described under Example 2.1. Using the same procedures, HT1080 cells stably expressing TIMP-1 and T1.sup.PrαTACE were generated.
2. Nunc® LabTek II Chamber Slides® were pre-coated with fluorescent gelatin (0.5 mg/mL; overnight).
3. Following rinsing with PBS, the cells were fixed with 4% paraformaldehyde for 10 minutes.
4. The slides were rinsed with PBS for 5 times to ensure the complete removal of paraformaldehyde
5. HT1080 cells stably transduced with TIMP-1 or T1.sup.PrαTACE were seeded on the chamber slides and incubated overnight at 37° C.
6. The cells were fixed with paraformaldehyde and washed with PBS following the procedure in steps (3) and (4) above.
7. Cell membrane permeabilization was carried out by incubation with cold methanol for 20 min; wash slides with PBS for three times.
8. The slides were blocked with 5% BSA in 0.3% Triton X-100 before MT1-MMP antibody was added for overnight incubation at 4° C.
9. Following washing with PBS, the cells were incubated with a secondary antibody at room temperature for 2 hours.
[0071] Result:
Example 4: T1.SUP.PrαTACE .Inhibits TACE-Mediated TNF-α and HB-EGF Shedding
[0072] The study was performed according to the method disclosed in the following document: Duan J X, Rapti M, Tsigkou A, Lee M H. Expanding the activity of tissue inhibitors of metalloproteinase (TIMP)-1 against surface-anchored metalloproteinases by the replacement of its C-terminal domain: Implications for anti-cancer effects [J]. PloS one, 2015, 10 (8): e0136384.
[0073] Specific procedures are as follows:
1. 1×10.sup.5 of unmodified, TIMP-1 or T1.sup.PrαTACE-transduced HT1080 cells were seeded in triplicates in a 24-well plate and cultured overnight.
2. 0.1 μg of HB-EGF/TNF-α plasmid was transfected into the cells and cultured for 2 days.
3. To induce shedding by TACE, the culture medium was replaced with fresh DMEM containing 200 ng/mL phorbol-12-myristate-13-acetate (PMA) (or no PMA as controls).
Shedding was allowed for 3 hours at 37° C.
4. Media containing shed HB-EGF/TNF-α was collected and used for analysis.
5. Colorimetric assay on HB-EGF (−PMA/+PMA 200 ng/ml) was conducted by adding the media to an alkaline phosphate substrate in diethanolamine buffer at 37° C. until a change in color was detected.
6. The amount of HB-EGF released was read by a microplate reader
7. The amount of shed TNF-α (−PMA/+PMA 200 ng/ml) was assayed using a TNF-α ELISA kit (Sino Bio).
[0074] Result: The lower level of soluble HB-EGF and TNF-α detected in T1.sup.PrαTACE media indicates that T1.sup.PrαTACE is more efficient at TACE inhibition than wild type TIMP-1.
Example 5: Unlike Wild Type TIMP-1. T1.SUP.PrαTACE .has No Cell Potentiation Activity
[0075] Materials: T175 flasks (Corning), cell count wafers (Invitrogen), 1 ml syringes
[0076] Reagents: 0.4% trypan blue solution (Sigma), DMEM
[0077] Instruments: automatic cell counter (Invitrogen), caliper, balance
[0078] Method:
1. Unmodified CaKi-1 cells and CaKi-1 cells stably expressing wild type TIMP-1 or T1.sup.PrαTACE were cultured in 20-cm dishes until the number of cells required was reached.
2. The cells were resuspended in DMEM to the concentration of 2×10.sup.6 cells/mL for each cell type.
3. NOD/SCID mice were randomly divided into three groups, namely: control group, TIMP-1 group and T1.sup.PrαTACE group, each consisting of eight mice.
4. 2×10.sup.5 of cells (equivalent to 0.1 mL of cell suspension) were injected subcutaneously into the left and right flanks of the mouse abdomens.
5. Tumor formation was monitored for 35 days with a digital caliper.
6. At the end of the experiment, the mice were sacrificed and the tumors collected and weighed.
[0079] Results:
Example 6: Preparation and Detection of BHK-21 Cells Expressing T1.SUP.PrαTACE .(Named BHK+T1.SUP.PrαTACE.)
[0080] 1. BHK-21 cells were transduced with lentivirus bearing T1.sup.PrαTACE or wild type TIMP-1 genes as described in Example 2.1. Stable cell line selection was carried out with puromycin (named BHK+T1.sup.PrαTACE hereafter).
2. BHK+T1.sup.PrαTACE cells were seeded onto a chamber slide, fixed, blocked, rinsed and incubated overnight with TIMP-1 antibody (Abcam, ab1827).
3. The slide was rinsed three times with PBS and incubated with a secondary antibody at room temperature for 2 hours.
4. Following washing with PBS, the cells were inspected with a fluorescence microscope.
Result:
Lower panel: whilst no trace of TIMP-1 could be found on the surface of unmodified BHK-21 cells. TIMP-1 was found to be present in abundance on the surface of BHK+T1.sup.PrαTACE cells.
Example 7: BHK+T1.SUP.PrαTACE.:Matrigel® Composition Inhibits CaKi-1 Renal Carcinoma Cell Proliferation
[0081] Method:
1. For the ease of identification, Caki-1 cells were stably transduced with a lentivirus bearing a RFP (purchased from Genomeditech Co., Ltd.).
2. BHK+T1.sup.PrαTACE and CaKi-1 cells were premixed at the final concentration of 2.5×10.sup.5 cells/mL for each cell type (1:1 ratio) on ice in 50% Matrigel/DMEM supplemented with 5% FBS.
3. The cell-Matrigel mixture was dispensed as 8 μL micro droplets onto the center of the wells of a 24-well tissue culture plate and allowed to solidify for at least 30 minutes in a 37° C. incubator before 1 mL DMEM/5% FBS was added to the wells.
4. Incubation was allowed for up to 37 days.
5. At the end of the incubation period, the cells were inspected and photographed with a fluorescence microscope.
[0082] Results:
Control Example 1: Comparing the Inhibitory Potency of BHK-21 and BHK+T1.SUP.PrαTACE .Spheroids on Caki-1 Growth
[0083] Method:
1. BHK+T1.sup.PrαTACE group: BHK+T1.sup.PrαTACE and CaKi-1 cells were premixed at the final concentration of 2.5×10.sup.5 cells/mL for each cell type (1:1 ratio) on ice in 50% Matrigel/DMEM supplemented with 5% fetal bovine serum (FBS). The cell-Matrigel mixture was dispensed as 8 μL micro droplets onto the center of the wells of a 24-well tissue culture plate and allowed to solidify for at least 30 minutes in a 37° C. incubator before 1 mL DMEM/5% FBS was added to the wells.
2. Unmodified BHK-21 group: BHK+T1.sup.PrαTACE cells were replaced by the same number of unmodified BHK-21 cells following the exact procedure as described in step (1) above.
3. Control group: RFP-labelled CaKi-1 cells were cultured in the absence of BHK-21 cells, following the same procedure/medium as described in step (1) above.
[0084] At the end of the incubation period, the number of fluorescent CaKi-1 cells in the spheroids was counted, averaged and analyzed.
Result I:
[0085]
Result II:
[0086] At the end of the incubation, the number of RFP-labelled cancer cells in the spheroid was counted, averaged and analyzed.
[0087] As shown in Table 2: the number of surviving CaKi-1 cells in the BHK+T1.sup.PrαTACE group was only one tenth of that of the unmodified BHK-21 group (p=0.00132). The data further strengthen the finding that BHK+T1.sup.PrαTACE cells are more effective at CaKi-1 inhibition than unmodified BHK-21 cells.
TABLE-US-00002 TABLE 2 Number of Number of seeded CaKi-1 surviving CaKi-1 cells cells after 37 days CaKi-1 5,000 495,000 ± 113,812 CaKi-1 + BHK-21 5,000 850 ± 339 CaKi-1 + BHK-21 + T1.sup.PrαTACE 5,000 85 ± 13
Control Example 2: Comparing the Inhibitory Potency of BHK-21 and BHK+T1.SUP.PrαTACE .Spheroids on HeLa Cell Growth
[0088] Method: the procedure employed for HeLa cells in this case was identical to those of the Control example 1 (CaKi-1).
Result I:
[0089]
Result II:
[0090]
[0091] Table 3 show that the number of surviving HeLa cells in BHK+T1.sup.PrαTACE group was significantly lower than that of the unmodified BHK-21 group (p<0.0001).
TABLE-US-00003 TABLE 3 Number of Number of seeded HeLa surviving HeLa cells cells after 28 days HeLa-1 5,000 1,536,000 ± 195,414 HeLa + BHK-21 5,000 185,100 ± 29,639 HeLa + BHK-21 + T1.sup.PrαTACE 5,000 6,999 ± 4,858
[0092] Results from the study confirm that BHK+T1.sup.PrαTACE is more effective in inhibiting HeLa cells than unmodified BHK-21 cells.
[0093] Data presented above illustrate and describe the basic principles, main features and advantages of the present invention. It must be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and description merely describe the principles of the present invention. Various modifications and improvements may be made to the present invention without departing from the spirit and scope of the present invention. These modifications and improvements are within the scope of the present invention. The scope of the present invention is defined by the appended claims and equivalents thereof.