NOVEL-PEPTIDE-BASED ANTICANCER IMMUNOTHERAPEUTIC AGENT
20250228951 ยท 2025-07-17
Assignee
Inventors
- Hyunsu BAE (Seoul, KR)
- Ik-Hwan HAN (Namyangju-si, KR)
- Moonkyu KANG (Namyangju-si, KR)
- Heekyung LEE (Yongin-si, KR)
- Jeongyoon CHOI (Seoul, KR)
- IIseob CHOI (Seoul, KR)
- Juwon YANG (Seoul, KR)
- Hongseo CHOI (Seoul, KR)
- Jin Sun SHIN (Seoul, KR)
Cpc classification
G01N33/57484
PHYSICS
A61K47/55
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C07K16/2845
CHEMISTRY; METALLURGY
A61K47/64
HUMAN NECESSITIES
A61K47/6425
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K47/6851
HUMAN NECESSITIES
C07K2317/73
CHEMISTRY; METALLURGY
A61K47/65
HUMAN NECESSITIES
G01N2333/70553
PHYSICS
C07K2317/76
CHEMISTRY; METALLURGY
C07K14/70553
CHEMISTRY; METALLURGY
A61K47/6849
HUMAN NECESSITIES
C07K2317/92
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K47/55
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
A61K47/68
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
A61K47/65
HUMAN NECESSITIES
Abstract
The present disclosure relates to a novel-peptide-based anticancer immunotherapeutic agent, and to use, as an anticancer immunotherapeutic agent, of melittin, a variant thereof, analogues thereof, or a conjugate in which a drug is linked thereto. The melittin, the variant thereof or the analogues thereof, of the present disclosure, specifically bind to ITGB2, which is expressed on the cell membrane of M2 tumor-associated macrophages, so as to kill the M2 tumor-associated macrophages, and a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated as a drug to the melittin, the variant thereof, or the analogues thereof remarkably increases apoptotic effects of the M2 tumor-associated macrophages, and thus can be used as an anticancer composition for suppressing tumor growth and metastasis.
Claims
1. A pharmaceutical composition for removing tumor-associated macrophages (TAMs) in a tumor microenvironment, comprising as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof.
2. The pharmaceutical composition of claim 1, wherein the tumor-associated macrophages are M2 tumor-associated macrophages expressing Integrin beta 2 (IGBT2).
3. The pharmaceutical composition of claim 1, wherein the melittin, the variant thereof or the analogues thereof specifically bind to an active conformation in which CD18 is extended.
4. The pharmaceutical composition of claim 1, wherein the melittin, the variant thereof or the analogues thereof bind to amino acids at positions 449, and 466 to 565 of ITGB2.
5. The pharmaceutical composition of claim 1, wherein the melittin includes an amino acid sequence of SEQ ID NO: 1.
6. The pharmaceutical composition of claim 1, wherein the variant of the melittin includes an amino acid sequence of SEQ ID NO: 2.
7. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is linked by a linker.
8. The pharmaceutical composition of claim 7, wherein the linker includes an amino acid sequence of SEQ ID NO: 3.
9. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition includes a peptide including an amino acid sequence of SEQ ID NO: 5 or 6.
10. The pharmaceutical composition of claim 1, wherein the pro-apoptotic peptide is selected from the group consisting of KLA, alpha-defensin-1, BMAP-28, Brevenin-2R, Buforin IIb, cecropin A-Magainin 2 (CA-MA-2), Cecropin A, Cecropin B, chrysophsin-1, D-K6L9, Gomesin, Lactoferricin B, LLL27, LTX-315, Magainin 2, Magainin II-bombesin conjugate (MG2B), Pardaxin, and combinations thereof.
11. The pharmaceutical composition of claim 1, wherein the anticancer drug is selected from the group consisting of 7-ethyl-10-hydroxy-camptothecin (SN-38), daunorubicin, doxorubicin, epirubicin, idarubicin, pixantrone, sabarubicin, valrubicin, paclitaxel, docetaxel, mechloethamine, chlorambucil, phenylalanine, mustard, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), Streptozotocin, busulfan, thiotepa, cisplatin, carboplatin, dactinomycin (actinomycin D), plicamycin, mitomycin C, vincristine, vinblastine, teniposide, topotecan, iridotecan, uramustine, melphalan, bendamustine, dacarbazine, temozolomide, altretamine, duocarmycin, nedaplatin, oxaliplatin, satraplatin, triplatin tetranitrate, 5-fluorouracil, 6-mercaptopurine, capecitabine, cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, thioguanine, etoposide, mitoxantrone, izabepilone, vindesine, vinorelbine, estramustine, maytansine, mertansine (DM1), DM4, dolastatin, auristatin E, auristatin F, monomethyl auristatin E (MMAE), monomethyl auristatin F, and derivatives thereof.
12. A pharmaceutical composition for preventing or treating cancer, comprising as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof.
13. The pharmaceutical composition for treating or preventing cancer of claim 12, wherein the cancer is any one selected from the group consisting of brain tumor, melanoma, myeloma, non-small cell lung cancer, oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, TNBC (Triple Negative Breast Cancer), lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cervical cancer, ovarian cancer, colorectal cancer, small intestine cancer, rectal cancer, fallopian tube carcinoma, perianal cancer, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymph adenocarcinoma, bladder cancer, gallbladder cancer, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem gliomas and pituitary adenomas.
14. The pharmaceutical composition for preventing or treating cancer of claim 12, wherein the cancer is anticancer drug-resistant cancer.
15. The pharmaceutical composition for preventing or treating cancer of claim 12, wherein the pharmaceutical composition is administered to a patient in whom the expression of ITGB2 is upregulated in M2 macrophages compared to M0 macrophages and M1 macrophages.
16. A method for treating cancer, comprising administering to a subject suffering from cancer a pharmaceutically effective amount of a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof.
17. (canceled)
Description
DESCRIPTION OF DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
BEST MODE OF THE INVENTION
[0047] Hereinafter, embodiments of the present disclosure will be described in detail with reference to the accompanying drawings. However, the following embodiments are presented as examples for the present disclosure, and when it is determined that a detailed description of well-known technologies or configurations known to those skilled in the art may unnecessarily obscure the gist of the present disclosure, the detailed description thereof may be omitted, and the present disclosure is not limited thereto. Various modifications and applications of the present disclosure are possible within the description of claims to be described below and the equivalent scope interpreted therefrom.
[0048] Terminologies used herein are terminologies used to properly express preferred embodiments of the present disclosure, which may vary according to a user, an operator's intention, or customs in the art to which the present disclosure pertains. Therefore, these terminologies used herein will be defined based on the contents throughout the specification. Throughout the specification, unless explicitly described to the contrary, when a certain part comprises a certain component, it will be understood to further include another component but not the exclusion of other components.
[0049] All technical terms used in the present disclosure, unless otherwise defined, are used as the meaning as commonly understood by those skilled in the related art of the present disclosure. In addition, although preferred methods and samples are described herein, similar or equivalent methods and samples thereto are also included in the scope of the present disclosure. The contents of all publications disclosed as references in this specification are incorporated in the present disclosure.
[0050] Throughout the present specification, general one-letter or three-letter codes for naturally existing amino acids are used, and generally allowed three-letter codes for other amino acids, such as -aminoisobutyric acid (Aib) and N-methylglycine (Sar) are also used. The amino acids mentioned herein as abbreviations are also described as follows according to the IUPAC-IUB nomenclature.
[0051] Alanine: A; Arginine: R; Asparagine: N; Aspartic acid: D; Cysteine: C; Glutamic acid: E; Glutamine: Q; Glycine: G; Histidine: H; Isoleucine: I; Leucine: L; Lysine: K; Methionine: M; Phenylalanine: F; Proline: P; Serine: S; Threonine: T; Tryptophan: W; Tyrosine: Y; and Valine: V.
[0052] In one aspect, the present disclosure relates to a pharmaceutical composition for removing tumor-associated macrophages (TAMs) in a tumor microenvironment, including as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof.
[0053] In one embodiment, the tumor-associated macrophages may be M2 tumor-associated macrophages expressing Integrin beta 2 (IGBT2).
[0054] In one embodiment, the composition may remove only M2 macrophages without removing M1 macrophages.
[0055] In one embodiment, the melittin may include an amino acid sequence of SEQ ID NO: 1.
[0056] In one embodiment, the variant of melittin may be a peptide in which amino acids at positions 1 to 7 are deleted from the amino acid sequence of SEQ ID NO: 1, and may include an amino acid sequence of SEQ ID NO: 2.
[0057] In one embodiment, the ITGB2 may include an amino acid sequence of SEQ ID NO: 7 or 8.
[0058] In one embodiment, the melittin, the variant thereof or the analogues thereof may specifically bind to an active conformation in which ITGB2 (CD18) is extended.
[0059] In one embodiment, the melittin, the variant thereof or the analogues thereof may bind to amino acids at positions 466 to 565 of ITGB2.
[0060] In one embodiment, the composition may include a peptide including an amino acid sequence of SEQ ID NO: 5 or 6.
[0061] In one embodiment, the conjugate in which the pro-apoptotic peptide or the anticancer drug is conjugated to the melittin, the variant thereof or the analogues thereof may be a peptide-drug conjugate (PDC). The PDC may be Melittin-dKLA including an amino acid sequence of SEQ ID NO: 5, may be TB511 including an amino acid sequence of SEQ ID NO: 6, or may be M-DM1 in which a drug DM1 is conjugated to maleimide-modified melittin.
[0062] In one embodiment, LEU (6) of TB511 may bind to LEU (528), THR (538), LEU (556), CYS (557) and PHE (558) sites of ITGB2, and TRP (12) of TB511 may bind to GLU (466), ILE (469), CYS (470) and ARG (471) of ITGB2.
[0063] In one embodiment, the pro-apoptotic peptide or anticancer drug may bind to the melittin, the variant thereof or the analogues thereof covalently via a linker or non-covalently without a linker.
[0064] In one embodiment, the linker may include an amino acid sequence of SEQ ID NO: 3.
[0065] In one embodiment, the melittin, the variant thereof or the analogues thereof may further include a targeting sequence, a tag, a labeled residue or an amino acid sequence designed for a specific purpose to increase the half-life or stability.
[0066] In one embodiment, the pro-apoptotic peptide may be selected from the group consisting of KLA, alpha-defensin-1, BMAP-28, Brevenin-2R, Buforin IIb, cecropin A-Magainin 2 (CA-MA-2), Cecropin A, Cecropin B, chrysophsin-1, D-K6L9, Gomesin, Lactoferricin B, LLL27, LTX-315, Magainin 2, Magainin II-bombesin conjugate (MG2B), Pardaxin, and combinations thereof, more preferably D-type isomer KLA, and may include an amino acid sequence of SEQ ID NO: 4.
[0067] In one embodiment, the anticancer drug may be selected from the group consisting of 7-ethyl-10-hydroxy-camptothecin (SN-38), daunorubicin, doxorubicin, epirubicin, idarubicin, pixantrone, sabarubicin, valrubicin, paclitaxel, docetaxel, mechloethamine, chlorambucil, phenylalanine, mustard, cyclophosphamide, ifosfamide, carmustine (BCNU), lomustine (CCNU), Streptozotocin, busulfan, thiotepa, cisplatin, carboplatin, dactinomycin (actinomycin D), plicamycin, mitomycin C, vincristine, vinblastine, teniposide, topotecan, iridotecan, uramustine, melphalan, bendamustine, dacarbazine, temozolomide, altretamine, duocarmycin, nedaplatin, oxaliplatin, satraplatin, triplatin tetranitrate, 5-fluorouracil, 6-mercaptopurine, capecitabine, cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, thioguanine, etoposide, mitoxantrone, izabepilone, vindesine, vinorelbine, estramustine, maytansine, mertansine (DM1), DM4, dolastatin, auristatin E, auristatin F, monomethyl auristatin E (MMAE), monomethyl auristatin F, and derivatives thereof, and may be DM1 or MMAE.
[0068] In one embodiment, the pro-apoptotic peptide or the anticancer drug may be linked to the melittin, the variant thereof or the analogues thereof by a chemical linker or a direct bond, and the chemical linker may be linked to the pro-apoptotic peptide or the anticancer drug through an amine group, a carboxyl group or a sulfhydryl group on the melittin, the variant thereof or the analogues thereof.
[0069] In one embodiment, the chemical linker may include a functional group selected from carbodiimide, N-hydroxysuccinimide ester (NHS ester), imidoester, pentafluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, vinylsulfone, and combinations thereof at both terminals, and may be selected from 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), N,N-dicyclohexylcarbodiimide (DCC), succinimidyl acetylthioacetate (SATA), Sulfo-SMCC (sulfosuccinimidyl-4-(NDmaleimidomethyl)cyclohexane-1-carboxylate), DMA (dimethyl adipimidate.Math.2HCl), DMP (dimethylpimelimidate.Math.2HCl), DMS (dimethyl Suberimidate.Math.2HCl), DTBP (dimethyl 3,3-dithiobispropionimidate.Math.2HCl), sulfo-SIAB (sulfosuccinimidyl (4-iodoacetyl)aminobenzoate), SIAB (succinimidyl (4-iodoacetyl)aminobenzoate), SBAP (succinimidyl 3-(bromoacetamido) propionate), SIA (succinimidyl iodoacetate), SM (PEG) n (succinimidyl-([N-maleimidopropionamido]-#ethyleneglycol ester, n=2, 4, 6, 8, 12, or 24), SMCC (succinimidyl-4-(N-Dmaleimidomethyl)cyclohexane-1-carboxylate), LCSMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), sulfo-EMCS (N-cester), EMCS (N-asulfo-GMBS (N-yester), GMBS (N- ester), sulfo-KMUS (N-Kester), sulfo-MBS (m-maleimidobenzoyl-Nhydroxysulfosuccinimide ester), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), sulfo-SMPB (sulfosuccinimidyl 4-(p-maleimidophenyl) butyrate), SMPB (succinimidyl 4-(pmaleimidophenyl) butyrate), AMAS (N--imidoacet-oxysuccinimide ester), BMPS (N--maleimidopropyloxysuccinimide ester), SMPH (succinimidyl 6-[(-maleimidopropionamido) hexanoate]), PEG12-SPDP (2-pyridyldithiol-tetraoxaoctatriacontane-N-hydroxysuccinimide), PEG4-SPDP, sulfo-LCSPDP (sulfosuccinimidyl 6-[3-(2-pyr)idyldithio)propionamido]hexanoate), SPDP (succinimidyl 3-(2-pyridyldithio) propionate), LC-SPDP (succinimidyl 6-[3-(2-pyridyldithio)propionamido]hexanoate), SMPT (4-succinimidyloxycarbonyl-alpha-methyl-alpha (2-pyridyldithio) toluene), DSS (disuccini)midylsuberate), BS(PEG)5 (bis(succinimidyl) penta (ethylene glycol)), BS(PEG)9 (bis(succinimidyl) nona (ethylene glycol)), BS3 (bis[sulfosuccinimidyl]suberate), BSOCOES (bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone), PDPH (3-(2-pyridyldithio)propionyl hydrazide), DSG (disuccinimidyl glutarate), DSP (dithiobis[succinimidyl propionate]), BM(PEG)n (1,8-bismaleimido-ethyleneglycol, n=2 or 3), BMB (1,4-bismaleimidobutane), BMDB (1,4-bismaleimidyl-2,3-dihydroxybutane), BMH (bismaleimidohexane), BMOE (bismaleimidoethane), DTME (dithiobismaleimidoethane), TMEA (tris(2-maleimidoethyl)amine), DSS (disuccinimidyl suberate), DST (disuccinimidyl tartarate), DTSSP (3,3-dithiobis[sulfosuccinimidylpropionate]), EGS (ethylene glycol bis[succinimidylsuccinate]), sulfo-EGS (ethylene glycol bis[sulfosuccinimidylsuccinate]) and TSAT (tri s-succinimidylaminotriacetate), DFDNB (1,5-difluoro-2,4-dinitrobenzene), and combinations thereof.
[0070] In the present disclosure, it is preferable that the peptide has the amino acid sequence, but is not limited thereto. According to a preferred embodiment of the present disclosure, the peptide preferably has a high ratio of the amino acid of 50% or more, preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, and most preferably 100%.
[0071] In the present disclosure, the peptide of the present disclosure may further include an amino acid sequence designed for a specific purpose of increasing a targeting sequence, a tag, labeled residues, a half-life or peptide stability. In addition, the peptide of the present disclosure may be linked to coupling partners such as effectors, drugs, prodrugs, toxins, peptides, and delivery molecules.
[0072] In the present disclosure, the peptide may be prepared in the form of a pharmaceutically acceptable salt. Specifically, the salt may be formed by adding acids, for example, an inorganic acid (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, etc.), an organic carboxylic acid (e.g., acetic acid, haloacetic acids such as trifluoroacetic acid, propionic acid, maleic acid, succinic acid, malic acid, citric acid, tartaric acid, salicylic acid), and an organic sulfonic acid including an acidic sugar (glucuronic acid, galacturonic acid, gluconic acid, ascorbic acid), an acidic polysaccharide (e.g., hyaluronic acid, chondroitin sulfate, arginic acid), a sulfonic acid sugar ester such as chondroitin sulfate (e.g., methanesulfonic acid, p-toluene sulfonic acid).
[0073] The term conjugate of the present disclosure refers to a conjugate in which the pro-apoptotic peptide or the anticancer drug is conjugated to the melittin, the variant thereof, or the analogue peptide thereof, which may target M2-type tumor-associated macrophages. The conjugate may bind to targeting M2-type macrophages to damage the mitochondria of macrophages and thus suppress tumor growth and metastasis and selectively suppress angiogenesis in the surrounding area to inhibit cancer.
[0074] That is, the conjugate of the present disclosure may have improved anticancer activity compared to an anticancer drug, but is not limited thereto.
[0075] In the present disclosure, the conjugate may link the pro-apoptotic peptide to the melittin, the variant thereof, or the analogues thereof via a GGGGS linker (SEQ ID NO: 3), or may link the anticancer drug such as Doxorubicin, Methotrexate, Entinostat, Cladribine, Pralatrexate, and Lorlatinib via a SPDP linker. In addition, among the anticancer drugs, Maytansine DM1, Maytansine DM3, and Maytansine DM4 may be directly linked and conjugated without a linker, but are not limited thereto.
[0076] That is, the conjugate of the present disclosure may be in a form in which the melittin, the variant thereof, or the analogues thereof is conjugated to an anticancer drug via a chemical linker or directly, but is not limited thereto.
[0077] The term melittin (MEL) of the present disclosure is a peptide that constitutes the main component of bee venom. The term bee venom (BV) used herein is a mixture of acidic and basic secretions fabricated in the abdomen of Apis mellifera and has a colorless bitter liquid form, and main ingredients thereof include melittin, apamin, and mast cell degranulating (MCD) peptide as peptides, phospholipase A2 (PLA2) as an enzyme, and the like, and further include various trace ingredients. Therefore, the melittin of the present disclosure may be isolated from the bee venom of Apis mellifera, but is not limited thereto.
[0078] The term peptide used herein refers to an amino acid polymer, which may include not only natural amino acids but also non-protein amino acids as components.
[0079] As used herein, the term variant refers to a corresponding amino acid sequence that contains at least one amino acid difference (substitution, insertion or deletion) compared to a reference substance. In specific embodiments, the variant has high amino acid sequence homology and/or conservative amino acid substitution, deletion and/or insertion compared to a reference sequence.
[0080] As used herein, the term peptide analogues may include analogues in which the side chain or the alpha-amino acid backbone of an amino acid is substituted with one or more other functional groups. Examples of side chain or backbone modified peptide analogues may include hydroxyproline or N-methyl glycine peptoids in which a pyrrolidine ring is substituted with a hydroxy group, but are not limited thereto. Types of peptide analogues are well known in the art.
[0081] The protein variant according to the present disclosure is interpreted to include a variant in which an amino acid residue is conservatively substituted at a specific amino acid residue position.
[0082] As used herein, the conservative substitution means a modification of a variant that includes substituting one or more amino acids with amino acids having similar biochemical properties that do not cause loss of biological or biochemical functions of the melittin protein variant. The conservative amino acid substitution is a substitution that replaces an amino acid residue with an amino acid residue having a similar side chain. Kinds of amino acid residues having similar side chains are defined in the art and well known. These kinds include amino acids having basic side chains (e.g., lysine, arginine, histidine), amino acids having acidic side chains (e.g., aspartic acid, glutamic acid), amino acids having uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having beta-branched side chains (e.g., threonine, valine, isoleucine), and amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0083] Specifically, the peptides according to the present disclosure may be prepared by a standard synthetic method, a recombinant expression system, or any other methods in the art. Accordingly, the peptides according to the present disclosure may be synthesized by many methods including, for example, the following methods: [0084] (a) a method of synthesizing a peptide by stages or by fragment assembly by means of a solid phase or liquid phase method and isolating and purifying a final peptide product; [0085] (b) a method of expressing a nucleic acid construct encoding the peptide in a host cell, and recovering an expression product from a host cell culture; or [0086] (c) a method of performing the expression of the nucleic acid construct encoding the peptide within a cell-free tube, and recovering an expression product; or [0087] a method of obtaining fragments of the peptide in any combination of (a), (b) and (c), and then linking the fragments to obtain a peptide, and recovering the corresponding peptide.
[0088] In one aspect, the present disclosure provides a pharmaceutical composition for preventing or treating cancer, including as an active ingredient a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof.
[0089] In one embodiment, the cancer may be any one or more selected from the group consisting of brain tumor, melanoma, myeloma, non-small cell lung cancer, oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, TNBC (Triple Negative Cancer), lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cervical cancer, ovarian cancer, colorectal cancer, small intestine cancer, rectal cancer, fallopian tube carcinoma, perianal cancer, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymph adenocarcinoma, bladder cancer, gallbladder cancer, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma, and may be anticancer drug-resistant cancer.
[0090] In one embodiment, the composition may be administered to a patient in whom the expression of ITGB2 is upregulated in M2 macrophages, compared to M0 macrophages and M1 macrophages.
[0091] In one embodiment, the composition may be a targeted anticancer drug.
[0092] The pharmaceutical composition of the present disclosure may be used as a single therapy, but may also be used in combination with other conventional biological therapy, chemotherapy or radiation therapy, and may treat more effectively cancer in the case of such concurrent therapy. In the case of using the present disclosure for preventing or treating cancer, a chemotherapeutic agent that may be used with the composition includes cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluorouracil, vincristin, vinblastin, methotrexate, and the like. Radiation therapy that may be used together with the composition of the present disclosure includes X-ray irradiation and -ray irradiation.
[0093] As used herein, the term prevention means all actions that inhibit or delay the occurrence, spread, and recurrence of cancer by administration of the pharmaceutical composition according to the present disclosure.
[0094] The therapeutically effective amount of the composition of the present disclosure may vary depending on many factors, for example, an administration method, a target site, a condition of a patient, and the like. Accordingly, when used in the human body, a dose should be determined as an appropriate amount in consideration of both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These matters to be considered when determining the effective amount are described in, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E. W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
[0095] The pharmaceutical composition of the present disclosure is administered in a pharmaceutically effective amount. As used herein, the pharmaceutically effective amount refers to an amount enough to treat the disease at a reasonable benefit/risk ratio applicable to medical treatment and enough not to cause side effects. An effective amount level may be determined according to factors including patient's health status, the type and severity of a disease of a patient, the activity of a drug, the sensitivity to a drug, an administration method, a time of administration, a route of administration, an emission rate, duration of treatment, and simultaneously used drugs, and other factors well-known in the medical field. The composition of the present disclosure may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiply. It is important to administer an amount capable of obtaining a maximum effect with a minimal amount without side effects by considering all the factors, which may be easily determined by those skilled in the art.
[0096] The pharmaceutical composition of the present disclosure may include a carrier, a diluent, an excipient, or a combination of two or more thereof, which are commonly used in biological agents. As used herein, the term pharmaceutically acceptable refers to exhibiting non-toxic properties to normal cells or humans exposed to the composition. The carrier is not particularly limited as long as the carrier is suitable for in vivo delivery of the composition, and may be used by combining, for example, compounds described in Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, a Ringer's solution, buffered saline, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and one or more of these components, and if necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostat may be added. In addition, the pharmaceutical composition may be prepared in injectable formulations such as an aqueous solution, a suspension, and an emulsion, pills, capsules, granules, or tablets by further adding a diluent, a dispersant, a surfactant, a binder, and a lubricant. Furthermore, the pharmaceutical composition may be prepared preferably according to each disease or ingredient using a suitable method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
[0097] In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group including oral formulations, external formulations, suppositories, sterile injection solutions and sprays.
[0098] The composition of the present disclosure may include a carrier, a diluent, an excipient, or a combination of two or more thereof, which are commonly used in biological agents. The pharmaceutically acceptable carrier is not particularly limited as long as the carrier is suitable for in vivo delivery of the composition, and may be used by combining, for example, compounds described in Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, a Ringer's solution, buffered saline, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and one or more of these ingredients, and if necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostat may be added. In addition, the pharmaceutical composition may be prepared in injectable formulations such as an aqueous solution, a suspension, and an emulsion, pills, capsules, granules, or tablets by further adding a diluent, a dispersant, a surfactant, a binder, and a lubricant. Furthermore, the pharmaceutical composition may be prepared preferably according to each disease or ingredient using a suitable method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
[0099] The composition of the present disclosure may further contain one or more active ingredients exhibiting the same or similar functions. The composition of the present disclosure includes 0.0001 to 10 wt %, preferably 0.001 to 1 wt % of the protein, based on the total weight of the composition.
[0100] The pharmaceutical composition of the present disclosure may further include a pharmaceutically acceptable additive. At this time, the pharmaceutically acceptable additive may be used with starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, talc and the like. The pharmaceutically acceptable additive according to the present disclosure is preferably included in an amount of 0.1 parts by weight to 90 parts by weight based on the composition, but is not limited thereto.
[0101] The composition of the present disclosure may be administered parenterally (e.g., applied intravenously, subcutaneously, intraperitoneally or topically) or orally according to a desired method, and the dose may vary depending on the weight, age, sex, and health condition of a patient, a diet, an administration time, an administration method, an excretion rate, the severity of a disease, etc. A daily dose of the composition according to the present disclosure is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and more preferably administered once to several times a day.
[0102] Liquid formulations for oral administration of the composition of the present disclosure correspond to suspensions, internal solutions, emulsions, syrups, etc., and may include various excipients, such as wetting agents, sweeteners, fragrances, preservatives, and the like, in addition to water and liquid paraffin, which are commonly used simple diluents. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized agents, suppositories, and the like.
[0103] In one aspect, the present disclosure relates to a method for removing M2-type tumor-associated macrophages, including treating M2 tumor-associated macrophages in a test tube with the composition of the present disclosure.
[0104] In one aspect, the present disclosure relates to a composition for diagnosing cancer including the composition of the present disclosure.
[0105] In one aspect, the present disclosure relates to a kit for diagnosing cancer including a composition for diagnosing cancer of the present disclosure.
[0106] In the present disclosure, the term kit for diagnosing cancer refers to a kit including the composition for diagnosing cancer of the present disclosure. Accordingly, the expression kit for diagnosing cancer can be used interchangeably or in combination with the composition for diagnosing cancer. As used herein, the term diagnosis refers to determining the susceptibility of a subject to a specific disease or disorder, determining whether a subject currently has a specific disease or disorder, determining the prognosis of a subject suffering from a specific disease or disorder (e.g., identifying a pre-metastatic or metastatic cancer state, determining a stage of cancer, or determining the responsiveness of cancer to treatment), or therametrics (e.g., monitoring the condition of a subject to provide information about treatment efficacy).
[0107] The melittin, the variant thereof or the analogues thereof of the present disclosure specifically bind to ITGB2 expressed on the cell membrane of M2 tumor-associated macrophages to kill M2 tumor-associated macrophages by the melittin, the variant thereof or the analogues thereof or a drug (pro-apoptotic peptide or anticancer drug) linked thereto, thereby suppressing the growth and metastasis of tumors and selectively suppressing angiogenesis in the vicinity, thereby exhibiting anticancer activity, and thus can be used as theranostic agents for the diagnosis of cancer that have anticancer activity and specifically bind to M2 tumor-associated macrophages. In addition, it can be used as an anticancer adjuvant administered simultaneously, separately, or sequentially with anticancer drugs. Furthermore, since the melittin, the variant thereof or the analogues thereof specifically bind to M2 tumor-associated macrophages and thus can also be used as drug delivery vehicles targeting the melittin, the variant thereof or the analogues thereof.
[0108] In one aspect, the present disclosure relates to a method for providing information for diagnosing cancer, including contacting a biological sample isolated from a subject with a composition of the present disclosure; and comparing the biological sample with a normal control sample.
[0109] In one embodiment, the method may further include determining that the test subject is cancer if the level of M2 tumor-associated macrophages in the biological sample isolated from the subject is higher than that in the normal control sample.
[0110] As used herein, the term sample refers to a biological sample obtained from a subject or patient. Sources of the biological sample may be fresh, frozen and/or preserved organ or tissue samples or solid tissue from biopsies or aspirates; blood or any blood component; and cells at any time point of conception or development in a subject.
[0111] In one aspect, the present disclosure relates to a method for treating cancer, including administering to a subject suffering from cancer a pharmaceutically effective amount of a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof.
[0112] In one embodiment, the subject may be a patient in whom the expression of ITGB2 is upregulated in M2 macrophages, compared to M0 macrophages and M1 macrophages.
[0113] In one aspect, the present disclosure relates to a use of a conjugate in which a pro-apoptotic peptide or an anticancer drug is conjugated to melittin, a variant thereof, or analogues thereof for the preparation of a pharmaceutical composition for preventing or treating cancer.
[0114] Hereinafter, the present disclosure will be described in more detail with reference to the following Examples. However, the following Examples are only intended to embody the contents of the present disclosure, and the present disclosure is not limited thereto.
MODES OF THE INVENTION
Example 1. Synthesis of Peptides Targeting M2 Tumor-Associated Macrophages (M2 TAMs)
[0115] Melittin and TAMpep826 in Table 1 below were synthesized and supplied by GenScript (Piscataway, NJ, USA), and dissolved in D-PBS at 5 mg/ml for use in subsequent experiments.
TABLE-US-00001 TABLE1 SEQ ID Name Sequence NO: Description Melittin GIGAVLKV 1 Melittin LTTGLPAL peptide ISWIKRKR QQ TAMpep8 VLTTGLP 2 Peptideinwhich 26 ALISWIK first7amino RKRQQ acidsofmelittin areremoved
Example 2. M2 TAM Targeting Analysis
2-1. Confirmation of Affinity of Melittin to M2 TAM
[0116] To confirm whether the melittin fabricated in Example 1 specifically bound to M2 tumor-associated macrophages (M2 TAMs), a human monocyte cell line THP-1 was differentiated into M0, M1, and M2 macrophages, and treated with FITC-conjugated melittin, and then confirmed by flow cytometry. Specifically, THP-1 cells were treated with 100 nM phorbol 12-myristate 13-acetate (PMA) at 37 C. for 24 hours (M0 macrophages), and the differentiated M0 macrophages were incubated with 100 nM LPS and 20 ng/ml IFN- at 37 C. for 72 hours to be differentiated into M1 macrophages (M1), and incubated with 20 ng/ml IL-4 and IL-13 at 37 C. for 72 hours to be differentiated into M2 macrophages (M2). The differentiated cells were treated with 50 nM FITC-conjugated melittin for 1 hour, detected with BD FACS CantoII instruments (BD biosciences, San Jose, CA, USA), and analyzed with FlowJo software (BD biosciences).
[0117] As a result, FITC-positive cells were significantly increased in M2 macrophages compared to M0 and M2 macrophages (
2-2. Identification of M2 TAM Binding Target Protein of Melittin
[0118] To determine which protein of M2 macrophages was involved in the specific binding of melittin to M2 macrophages, biotin-conjugated melittin (melittin-biotin) was synthesized. THP-1 cells (510.sup.6 cells) were differentiated into M0, M1, and
[0119] M2 macrophages, and then collected using a scraper, washed by centrifugation (300g, 5 min), and cell membrane proteins of macrophages were obtained using a cell membrane protein extraction kit (Thermo Fisher scientific). The proteins reacted with melittin-biotin (200 g) in which biotin bound to melittin at room temperature (20 to 24 C.) for 1 hour, and then the proteins bound to melittin were obtained using a streptavidin resin (Thermo Fisher scientific). To remove the salt, 100 l each of 100% methanol, 0.1% formic acid, and 80% CAN were added to an 18 Micro Spin-Column, and the sample was loaded onto the prepared column, and added with 50 l of 0.1% formic acid to remove unnecessary substances. Thereafter, 100 l of 80% CAN was added to elute the peptides. After desalting, the solution was completely removed by drying with a Speed-vac, and analyzed by LC-MS/MS using a UPLC-Exactive equipment (Thermo Fisher Scientific) under the conditions shown in Table 2 below. Data were analyzed for proteins upregulated in M1 and M2 macrophages compared to M0 macrophages using MaxQuant and Mass Profiler Professional (MPP). For data analysis, LC-MS/MS data for each sample were analyzed using Proteome Discoverer, and performed by LFQ (Label-Free Quantification) using a human database of Uniprot as the database. Modifications included Oxidation (M), Carbamyl (N-term), and Carbamidomethyl (C), and the Baseline option was set to none.
TABLE-US-00002 TABLE 2 Parameters Conditions Trapping Column C.sub.18 3 m, 100 , 75 m 2 cm Analytical PepMap RSLC C.sub.18 Column 2 m, 100 , 75 m 50 cm Mobile Phase A: Water with 0.1% formic acid B: 80% ACN with 0.1% formic acid Gradient Time 0 14 120 120.1 130 130.1 180 (min) Solvent 4 4 40 96 96 4 4 B(%) Column 300 nL/min Flow Rate Mass Range 400-2000 m/z
[0120] As a result, 53 proteins were upregulated in M2/M0 and 123 proteins were upregulated in M1/M0 (
2-3. Identification of M2 TAM Binding Target Protein of TAMpep826
[0121] As in Example 2-2 above, TAMpep826-biotin reacted with cell membrane proteins extracted from M0, M1, and M2 macrophages to identify target proteins through LC-MS/MS proteomics.
[0122] As a result, ITGB2, among the cell membrane proteins, was found to be expressed at a higher level in M2 macrophages than in M0 and M1 macrophages (
Example 3. Confirmation of ITGB2 Expression in M2 Macrophages
3-1. Confirmation of ITGB2 mRNA Expression
[0123] Real-time polymerase chain reaction was performed to evaluate the mRNA expression levels of ITGB2 in M0, M1, and M2 macrophages and TAMs. Specifically, RNA was extracted from cells differentiated into M0, M1, or M2 macrophages using an easy-BLUE total RNA Extraction Kit (iNtRON), and cDNA was synthesized using CycleScript-Reverse Transcriptase (Bioneer). Primers for an Actin or ITGB2 gene (Table 3) were used and real-time PCR (CFX96, Bio-rad) was performed under the conditions of
TABLE-US-00003 TABLE3 Target Forward/ Sequences cDNA Reverse (5to3) -Actin F GTGCTATGTTGCTCTAGACTTCG R ATGCCACAGGATTCCATACC ITGB2 F GAGGTCAGGAGGATTTGGGG R TACAAGTGTTGGGGAGCCAG
[0124] As a result, mRNA expression of ITGB2 was significantly increased in M2 macrophages and TAMs compared to M0 and M1 (
3-2. Confirmation of ITGB2 Protein Expression
[0125] Western blot analysis was performed to evaluate the protein expression levels of ITGB2 in M0, M1, and M2 macrophages and TAMs. Specifically, proteins were extracted from each cell differentiated into M0, M1, and M2 macrophages using a Proprep solution (iNtRON), and the proteins were transferred to the membrane by electrophoresis. The membrane was blocked in 5% BSA, treated with a primary antibody (ITGB2) for 24 hours at 4 C., treated with a secondary antibody for 1 hour at room temperature, and then treated with the D-Plus ECL Pico System (Dong-In LS), and protein bands were photographed using the Davinch-Chemi imaging system (Intoxia).
[0126] As a result, it was shown that the protein expression of ITGB2 was significantly increased in M2 macrophages and TAMs compared to M0 and M1 (
3-3. Confirmation of ITGB2 Protein Expression by Immunofluorescence
[0127] Immunofluorescence analysis was performed to evaluate the protein expression levels of ITGB2 in M0, M1, and M2 macrophages and TAMs. Specifically, each cell differentiated into M0, M1, and M2 macrophages was fixed with 4% formalin, washed with PBS, blocked in 5% BSA, and then treated with a primary antibody (ITGB2) for 24 hours at 4 C. and a secondary antibody for 2 hours at room temperature and stained. After DAPI mounting, the stained cells were photographed with fluorescence using LSM800 (Zeiss).
[0128] As a result, the protein of ITGB2 showed higher expression levels in M2 macrophages and TAMs compared to M0 and M1 (
Example 4. Confirmation of Interaction Between M2 TAM Targeting Peptide and ITGB2
4-1. Confirmation of ITGB2 Expression on M2 Macrophage Cell Membrane
[0129] To determine whether ITGB2 was expressed on the cell membrane of M2 macrophages, cell membrane proteins and cytosol proteins were isolated and extracted from M2 macrophages, respectively, and reacted with biotinylated TAMpep826 to evaluate the expression of ITGB2 by Western blot analysis. As a result, it was shown that the ITGB2 protein was expressed on the cell membrane of M2 macrophages (
4-2. Confirmation of Interaction Between TAMpep826 and ITGB2
[0130] To determine whether TAMpep826 interacted with ITGB2 in M2 macrophages, the expression of ITGB2 was evaluated through competitive reaction of TAMpep826 and biotinylated TAMpep826. Specifically, cells differentiated into M2 macrophages were collected with a scraper, the cells were washed by centrifugation (300g, 5 min), and the cell membrane proteins of macrophages were obtained using a cell membrane protein extraction kit (Thermo Fisher scientific). After pretreatment with TAMpep826 or scramble peptide for each concentration (0.001, 0.01, 0.1, 1, and 10 g) for 1 hour, the proteins reacted with biotin-conjugated TAMpep826 (200 g) at room temperature (20 to 24 C.) for 1 hour, and then the proteins bound to TAMpep826 were obtained using Dynabeads M-280 Streptavidin (Thermo Fisher scientific). The expression of ITGB2 was confirmed by Western blot analysis of the proteins.
[0131] As a result, when pretreated with the scrambled peptide, the expression of ITGB2 bound to biotinylated TAMpep826 was not affected, whereas when pretreated with TAMpep826, ITGB2 expression was suppressed depending on a concentration (
4-3. Confirmation of Interaction Between TAMpep826 and ITGB2 Using Immunofluorescence
[0132] To determine whether ITGB2 and TAMpep826 were co-localized on the cell membrane of M2 macrophages, immunofluorescence analysis was performed using FITC-conjugated TAMpep826. As a result, it was shown that TAMpep826 and ITGB2 were intensively distributed in the cell membrane of M2 macrophages (
4-4. Identification of Binding Sites of TB511 and ITGB2
[0133] Based on a sequence of a cysteine rich region of CD18 (ITGB2) (uniport_p05107, Cystein-rich tandem repeats region: 449-617), a tertiary structure was constructed using a trRosetta algorithm (https://yanglab.nankai.edu.cn/trRosetta/). Thereafter, a docking simulation of TB511 and CD18 was performed using a CD18 PDB file created by trRosetta and an amino acid sequence of TB511 via a CABS-dock server (http://biocomp.chem.uw.edu.pl/CABSdock/). Among 10 models generated from the docking simulation result, a representative model was selected based on an alanine substitution result of the TB511 sequence (
[0134] As a result, it was predicted that LEU (6) of TB511 bound to LEU (528), THR (538), LEU (556), CYS (557) and PHE (558) sites of CD18, and TRP (12) of TB511 bound to GLU (466), ILE (469), CYS (470) and ARG (471) of CD18. In addition, it was shown that when LEU (6) and TRP (12) of TB511 were each substituted with alanine to simulate binding to CD18, both the two regions did not bind to any sequence of CD18. Accordingly, LEU (6) and TRP (12) of TB511 are key parts in the docking between TB511 and CD18, and TB511 can be predicted to bind to positions 466 to 565 of CD18 (
Example 5. Synthesis of ITGB2 Binding Moieties
5-1. Synthesis of ITGB2-Binding Peptide-Drug Conjugate (PDC)
[0135] Melittin-dKLA and TB511 peptides in Table 4 below were synthesized and supplied by GenScript (Piscataway, NJ, USA) and were dissolved in D-PBS at 5 mg/ml and used in subsequent experiments. dKLA was linked through amide bonds between peptides, and a linker consisting of four glycines and one serine was placed in the middle to separate two ends so as to minimize the interaction and folding between melittin or TAMpep826 and dKLA. In addition, a D-enantiomer other than an L-enantiomer of KLA was used to minimize degradation in the body. In addition, in order to fabricate M-DM1, maleimide-modified melittin (GenScript, Beijing, China) (100 M, 1 mL, 0.1 mmol) dissolved in 25 mM of a sodium borate buffer (25 mM NaCl, 1 mM EDTA, pH 8.0) was added with DM1 (Mertansine) (MedChem Express, Princeton) (1.1 equivalents, 10 mM in DMF) and dimethylformamide (DMF), and reacted at 37 C. for 1 hour. Then, the product was filtered three times by ultrafiltration in Dulbecco's phosphate-buffered saline (DPBS; Welgene), and thus DM1 bound to the N-terminus of maleimide-modified melittin M to fabricate PDC, which was named as M-DM1. 5 L of the fabricated M-DM1 was injected by reverse-phase high-performance liquid chromatography (HPLC) using a Poroshell 120 C18 column (2.7 m, 350 mm, Agilent, Santa Clara, CA, USA) at a flow rate of 0.5 mL/min, and then the characteristics were analyzed.
TABLE-US-00004 TABLE4 SEQ ID Name Sequence NO: Description Melittin GIGAVLKVLTTGLPALI 1 Melittinpeptide SWIKRKRQQ TAMpep826 VLTTGLPALISWIKRKR 2 Peptideinwhichfirst7 QQ aminoacidsofmelittinare removed Linker GGGGS 3 dKLA d[KLAKLAKKLAKLAK] 4 Pro-apoptosispeptide Melittin- GIGAVLKVLTTGLPALI 5 Peptidewithlinkerand dKLA SWIKRKRQQ-GGGGS- drugdKLAattachedto d[KLAKLAKKLAKLAK] melittin TB511 VLTTGLPALISWIKRKR 6 Peptidewithlinkerand QQ-GGGGS- drugdKLAattachedto d|KLAKLAKKLAKLAK] TAMpep826 M-DM1 PDCconjugatedwithdrug DM1tomaleimide- modifiedmelittin
5-2. Synthesis of ITGB2-Binding Antibody-Drug Conjugate (ADC)
5-2-1. ADC Fabrication of Anti-CD18 Antibody and DM1
[0136] To fabricate an antibody that specifically bound to an active conformation of CD18, one of the macrophage-1 antigens (Mac-1), in M2 TAM (
5-2-2. ADC Fabrication of Anti-CD18 Antibody and Monomethyl Auristatin E (MMAE)
[0137] In Example above, the purified anti-CD18 antibody was buffer-replaced with PBS (pH 7.4), and in order to partially reduce the disulfide bonds of the CD18 antibody, 1 mM DTT (66.7 M) was mixed with an anti-CD18 antibody (1 mg/ml, 6.67 M) at a ratio of 1:10 and reacted at 37 C. for 1 to 2 hours, and then buffer-replaced with PBS (pH 7.4). The partially reduced anti-CD18 antibody (1 mg/ml, 6.67 M) was mixed with 10 mM Suo-Val-Cit-PAB-MMAE (MedChemExpress) at a ratio of 1:20 to 1:40, reacted at 4 C. for 12 hours, and buffer-replaced with PBS (pH 7.4). The amount of vc-MMAE (248 nm) bound to an anti-CD18 antibody (280 nm) was measured using UV-Vis spectroscopy, and a drug antibody ratio (DAR) of DM1 to the anti-CD18 antibody was calculated, and the DAR value was 2.8 to 5.4. The ADC fabricated by binding the anti-CD18 antibody and MMAE was named as CD18-MMAE.
Example 6. Confirmation of M2 TAM Binding to ITGB2 Binding PDC
[0138] To confirm the binding affinity of ITGB2 and Melittin-dKLA, an ITGB2 protein was coated on a gold thin film sensor chip, and then ITGB2 antibody and Melittin-dKLA as positive controls were run, respectively, and the reflected light was measured and surface plasmon resonance (SPR) analysis was performed. Specifically, after ITGB2 was fixed on the sensor chip surface, immobilization was performed using amine coupling under conditions shown in Table 5 below (
TABLE-US-00005 TABLE 5 coupling method Amine coupling Sensor chip HC1000M Running buffer PBS pH 7.4 flow cell 1 Activation 200 mM EDC, 100 mM NHS Blocking protein BSA Blocking 1M Ethanolamine*HCl flow cell 2 Activation 200 mM EDC, 100 mM NHS Ligand concentration 50 g/ml in 5 mM acetate buffer (pH 4.0) Target RU 5000 RU Blocking solution 1M Ethanolamine*HCl
TABLE-US-00006 TABLE 6 2) Kinetic evaluation Running buffer 1 PBS analyte name Anti-ITGB2 antibody, TAMpep concentration Anti-ITGB2 antibody 1.5625, 3.125, 6.25, 12.5, 25, 50, 100 nM TAMpep 15.625, 31.25, 62.5, 125, 250, 500, 1000 nM Binding Contact time (min) 2 min flow rate (l/min) 30 l/min setting Dissociation time (min) 5 min Stabilization time 0 (min) regeneration Regeneration solution Glycine pH 1.5 flow rate (l/min) 30 l/min Contact time (sec) 45 sec Stabilization time 2 min (min)
[0139] As a result, an equilibrium dissociation constant (KD), which was obtained by dividing a dissociation rate constant (kd) that evaluated the binding affinity between two molecules of a positive control ITGB2 antibody by an association rate constant (ka), was 1.14.sup.8, and the equilibrium dissociation constant of Melittin-dKLA was 7.86.sup.8 (
Example 7. Confirmation of M2 TAM Apoptotic Effect Through ITGB2 of PDC
7-1. Fabrication of Cell Model of ITGB2 Expression Suppression
[0140] As a cell model used to confirm whether apoptosis was induced through ITGB2 in M2 macrophages, a cell model in which the expression of ITGB2 was suppressed in M2 macrophages was fabricated using Crispr/cas9. Specifically, cells differentiated into M2 macrophages were cultured in an Opti-MEM medium. The Crispr/cas9 was mixed with Cas9 protein V2 (Thermo Fisher scientific) and gRNA (Genscript; ITGB2; Table 7) of a CRISPRMAX Reagent kit (Thermo Fisher scientific) and a Cas9 Plus Reagent (Thermo Fisher scientific), and a CRISPRMAX Reagent was diluted in the Opti-MEM medium, mixed together, and reacted for 5 to 10 minutes, and then added to cells differentiated into M2 macrophages and cultured at 37 C. for 2 to 3 days. Thereafter, the mRNA expression level of ITGB2 was confirmed.
TABLE-US-00007 TABLE7 sgRNA Sequences(5to3) ITGB2 mG*mU*mU*rCrArArCrGrUrGrA rCrCrUrUrCrCrGrGrCrGrUrUr UrUrArGrArGrCrUrArGrArA rArUrArGrCrArArGrUrUrArAr ArArUrArArGrGrCrUrArGrUrC rCrGrUrUrArUrCrArArCrUrUr GrArArArArArGrUrGrGrCrAr CrCrGrArGrUrCrGrGrUrGrCrU *mU*mU*mU
[0141] As a result, it was shown that in M2 macrophages injected with ITGB2 sgRNA, ITGB2 expression was significantly decreased compared to the control group (
7-2. Confirmation of M2 TAM Apoptosis Through ITGB2 of Melittin-dKLA
[0142] To confirm whether Melittin-dKLA bound to ITGB2 to induce apoptosis in M2 macrophages, Melittin-dKLA (1 M) was treated for 24 hours to M2 macrophages in which ITGB2 expression was suppressed by Crispr/cas9 fabricated in Example 7-1 above, and cell viability was analyzed using a CCK-8 assay. Specifically, Melittin-dKLA (1 M) reacted with ITGB2 knockdown macrophages fabricated in Example 7-1 above for 1 hour. After the reaction, the medium was replaced and cultured at 37 C. for 24 hours. To determine cell viability, a CCK-8 reagent (Enzo Life Sciences) was added in 1/10 of the medium and reacted at 37 C. for 3 hours. Absorbance was measured at 450 nm using a microplate reader (Molecular Devices).
[0143] As a result, in control M2 macrophages, cell viability was significantly reduced by Melittin-dKLA, but in M2 macrophages in which ITGB2 was knocked down, the decrease in cell viability by Melittin-dKLA was suppressed (
7-3. Confirmation of M2 TAM Apoptosis Through ITGB2 of TB511
[0144] To confirm whether TB511 (TAMpep826-dKLA) induced apoptosis through ITGB2 in M2 macrophages, TB511 reacted with M2 macrophages in which ITGB2 expression was suppressed by Crispr/cas9 fabricated in Example 7-1. As a result, the M2 macrophages showed about 50% of cell viability by TB511, but the cell viability significantly increased in cells where ITGB2 expression was suppressed (
7-4. Confirmation of Reduced Apoptosis Induction of TB511 by ITGB2 Antibody
[0145] To confirm whether TB511 induced apoptosis through ITGB2 in M2 macrophages, the M2 macrophages with suppressed ITGB2 expression fabricated in Example 7-1 were pretreated with an anti-ITGB2 antibody (Polyclonal Rabbit anti-Human ITGB2/CD18 antibody) (LS-C312785; LS Bio) (1 g) for 1 hour, and then reacted with TB511 (1 M) for 1 hour. Thereafter, the induction of apoptosis was confirmed by cell viability analysis using the CCK-8 assay, protein expression of caspase-3, an apoptosis marker, was confirmed by Western blot analysis, gene expression of caspase-3, caspase-8, and caspase-9 was confirmed by Real-time PCR, and induction of protein n expression of caspase-3 was confirmed by immunofluorescence.
[0146] As a result, the M2 macrophages showed no effect on cell viability by the ITGB2 antibody, but cell viability was significantly reduced by TB511. On the other hand, in M2 macrophages pretreated with the ITGB2 antibody, the cell viability was significantly increased by TB511 (
Example 8. Confirmation of Efficacy of PDC in 3D Cancer Organoids
8-1. Confirmation of Effect of TB511 in Breast Cancer 3D Organoids
[0147] To complement the limitations in vitro and replace in vivo, a 3D organoid mimicking a tumor microenvironment (TME) of breast cancer was fabricated and an effect of TB511 thereon was confirmed. Specifically, an RPMI-1640 culture medium was mixed to contain 3% Matrigel, and MDA-MB-231 human breast cancer cells, CAFs (Cancer-associated Fibroblasts), and THP-1 cells fabricated to express GFP using MDA-MB-231 human breast chancer cells, Cancer-associated Fibroblast (CAF), and IncucyteNuclight Lentivirus Reagents (Sartorius) were counted and dispensed into a 96 u-bottom 3-D culture plate (Sbio) at a ratio of 5:1:1 to be 200 l. After culturing, the cells were collected by centrifugation at 1200 rpm for 3 minutes and then cultured in a 37 C. incubator for 48 hours to form spheroids. From day 2 of spheroid formation, TB511 was treated every three days at concentrations of 1 M, 2 M, 4 M, and 8 M, and images were taken using a fluorescence microscope. After taking bright-field images, the spheroid area was measured using a method for measuring a Ferret diameter. In addition, the average tumor spheroid diameter was measured using an open source, and the average diameter of three spheroids was analyzed with ImageJ (software version 1.47 m). The spheroid size was analyzed by taking bright-field images (20X), and then measuring the average tumor spheroid diameter of three spheroids with ImageJ (software version 1.47 m). Additionally, on day 10 of drug treatment, immunofluorescent staining was performed by fixing spheroids and reacting with an antibody (abcam) against ki-67, a tumor proliferation factor (control staining: DAPI). For THP-1, images of GFP fluorescence expressed within the cells were taken using a confocal microscope without performing separate staining, and the number of cells expressing fluorescence was measured.
[0148] As a result, it was shown that in a group that was not treated with a drug, the size of the spheroids gradually increased over time, and thus THP-1 cells, which were monocytes, differentiated into TAMs by cancer cells and TME when co-cultured with cancer cells and CAFs, thereby promoting tumor growth. On the other hand, in a group treated with TB511, it was confirmed that the size of spheroids decreased in a concentration-dependent manner from a concentration of 1 M on day (
8-2. Confirmation of Effect of TB511 in Lung Cancer 3D Organoids
[0149] Lung cancer 3D spheroids were fabricated by mixing A549 human lung cancer cells, CAFs, and THP-1 cells using the method of Example 8-1 above, and then treated with TB511 at concentrations of 1 M, 2 M, and 4 M, respectively, and the effects thereof were analyzed as in Example 8-1 above. When fabricating the spheroids, 3D spheroids were also fabricated by mixing cancer cells alone or only cancer cells+CAF cells, and the sizes of the spheroids were compared.
[0150] As a result, it was shown that the size of the spheroids was significantly increased when spheroids were formed with A549+CAF+THP-1 cells compared to when spheroids were formed with A549 cells alone or only A549+CAF cells. In addition, the size of spheroids in a TB511-treated group was significantly reduced in a concentration-dependent manner compared to a group not treated with TB511 (***p<0.001) (
8-3. Confirmation of Effect of M-DM1 in Lung Cancer 3D Organoids
[0151] In order to confirm the efficacy of M-DM1 (Mel-DM1) on lung cancer, lung cancer 3D spheroids were fabricated by mixing A549 human lung cancer cells, CAFs, and THP-1 cells using the method of Example 8-1 above, and then treated with M-DM1 at concentrations of 1 M, 2 M, and 4 M, respectively, and the effects thereof were analyzed as in Example 8-1 above.
[0152] As a result, it was shown that the size of spheroids was decreased in a concentration-dependent manner in a group treated with M-DM1 compared to a group not treated with M-DM1 (***p<0.001) (
Example 9. Confirmation of Efficacy of PDC in Anticancer Drug-Resistant 3D Cancer Organoids
9-1. Confirmation of Effect of TB511 in Anticancer Drug-Resistant Lung Cancer 3D Organoids
[0153] In order to confirm the efficacy of TB511 on Carboplatin-resistant lung cancer, 3D spheroids were formed by mixing Carboplatin-resistant A549 cells, CAFs, and THP-1 cells using the method of Example 8-1 above, and then treated with TB511 at concentrations of 1 M, 2 M, and 4 M, respectively, and the effects thereof were analyzed as in Example 8-1 above.
[0154] As a result, the size of the spheroids when the spheroids were formed with A549+CAF+THP-1 cells was significantly increased compared to when the spheroids were formed with A549-resistant cells alone or only A549+CAF cells, and the size of the spheroids in a TB511-treated group was significantly reduced in a TB511 concentration-dependent manner compared to a group not treated with TB511 (***p<0.001) (
9-2. Confirmation of Effect of TB511 in Anticancer Drug-Resistant Prostate Cancer 3D Organoids
[0155] In order to confirm the efficacy of TB511 on Docetaxel-resistant prostate cancer, 3D spheroids were formed by mixing Docetaxel-resistant PC3 prostate cancer cells, CAFs, and THP-1 cells using the method of Example 8-1 above, and then treated with TB511 at concentrations of 1 M, 2 M, and 4 M, respectively, and the effects thereof were analyzed as in Example 8-1 above.
[0156] As a result, the size of the spheroids when the spheroids were formed with PC3+CAF+THP-1 cells was significantly increased compared to when the spheroids were formed with PC3-resistant cells alone or only PC3+CAF cells, and the size of the spheroids in a TB511-treated group was significantly reduced in a TB511 concentration-dependent manner compared to a group not treated with TB511 (***p<0.001) (
Example 10. Confirmation of Efficacy of ADC in 3D Cancer Organoids
10-1. Confirmation of Effect of ADC in Breast Cancer 3D Organoids
[0157] In order to confirm the efficacy of an ITGB2-binding antibody-drug conjugate (ADC) on breast cancer, 3D spheroids were formed by mixing MDA-MB-231 human breast cancer cells, CAFs and THP-1 cells using the method of Example 8-1 above, and CD18-DM1 or CD18-MMAE, which was ADC of the present disclosure, was treated at concentrations of 10 g and 20 g, respectively, and the effects were analyzed as in Example 8-1 above.
[0158] As a result, in a group not treated with ADC, the size of breast cancer spheroids was gradually increased over time, but in a group treated with ADC, the size of spheroids was decreased on day 8 (
10-2. Confirmation of Effect of ADC in Lung Cancer 3D Organoids
[0159] In order to confirm the efficacy of an ADC on lung cancer, 3D spheroids were formed by mixing A549 human lung cancer cells, CAFs and THP-1 cells using the method of Example 8-1 above, and CD18-DM1 or CD18-MMAE, which was ADC of the present disclosure, was treated at a concentration of 10 g, respectively, and the effects were analyzed as in Example 8-1 above.
[0160] As a result, it was shown that in the group not treated with ADC, the size of spheroids was gradually increased over time, whereas in the group treated with CD18-DM1 or CD18-MMAE, the size of spheroids was decreased on day 8 (
Example 11. Confirmation of Efficacy of ADC in Anticancer Drug-Resistant 3D Cancer Organoids
11-1. Confirmation of Effect of ADC in Anticancer Drug-Resistant Lung Cancer 3D Organoids
[0161] In order to confirm the efficacy of ADC on Carboplatin-resistant lung cancer, 3D spheroids were formed by mixing Carboplatin-resistant A549 cells, CAFs, and THP-1 cells using the method of Example 8-1 above, and then treated with CD18-DM1 or CD18-MMAE at a concentration of 10 g, respectively, and the effects thereof were analyzed as in Example 8-1 above.
[0162] As a result, it was shown that in the group not treated with ADC, the size of spheroids was gradually increased over time, whereas in the group treated with CD18-DM1 or CD18-MMAE, the size of spheroids was decreased on day 8 (
11-2. Confirmation of Effect of ADC in Anticancer Drug-Resistant Prostate Cancer 3D Organoids
[0163] In order to confirm the efficacy of ADC on Docetaxel-resistant prostate cancer, 3D spheroids were formed by mixing Docetaxel-resistant PC3 prostate cancer cells, CAFs, and THP-1 cells using the method of Example 8-1 above, and then treated with CD18-DM1 or CD18-MMAE at a concentration of 10 g, respectively, and the effects thereof were analyzed as in Example 8-1 above.
[0164] As a result, it was shown that in the group not treated with ADC, the size of spheroids was gradually increased over time, whereas in the group treated with CD18-DM1 or CD18-MMAE, the size of spheroids was decreased on day 8 (