PHARMACEUTICAL COMBINATION FOR THE TREATMENT OF MYELOPROLIFERATIVE NEOPLASMS
20230158032 · 2023-05-25
Inventors
Cpc classification
A61K31/519
HUMAN NECESSITIES
A61K31/519
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K31/519
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
The present invention relates to the treatment of myeloproliferative neoplasms through targeted elimination of malignant clones and overcome of diseases persistence. The treatment is based on a combination of inhibitors of mRNA splicing and processing factors together with Jak inhibitors.
Claims
1. A method for the treatment of a myeloproliferative neoplasm, comprising administering to a patient a combination comprising: at least one inhibitor of a mRNA splicing and processing factor, and at least one JAK inhibitor.
2. The method according to claim 1, wherein the at least one inhibitor of a mRNA splicing and processing factor is selected from the group comprising a Cpsf7 inhibitor, a Cstf2 inhibitor, a Hnrnpk inhibitor, a Hnrnpu inhibitor, a Pcbp1 inhibitor, a Polr2a inhibitor, a Rbm39 inhibitor, a Rbm8a inhibitor, a Sf3b1 inhibitor, a Snrnp200 inhibitor, a Srrm1 inhibitor, a Srsf2 inhibitor, a Srsf6 inhibitor, a Srsf9 inhibitor, a Srsf11 inhibitor, and a Ybx1 inhibitor.
3. The method according to claim 1, wherein the at least one inhibitor of a mRNA splicing and processing factor is a Ybx1 inhibitor.
4. The method according to claim 1, wherein the at least one inhibitor of a mRNA splicing and processing factor is selected from the group comprising a mRNA expression inhibitor, a protein expression inhibitor, a post-translational modification inhibitor, a protein arginine methyl transferase inhibitor, and a functional inhibitor.
5. The method according to claim 1, wherein the myeloproliferative neoplasm is selected from the group comprising polycythemia vera, primary myelofibrosis, idiopathic myelofibrosis, essential thrombocythemia, chronic myeloid leukemia, acute myeloid leukemia, chronic eosinophilic leukemia, hypereosinophilic syndrome, chronic myelomonocytic leukemia, atypical chronic myelogenous leukemia, chronic neutrophilic leukemia systemic mastocytosis, juvenile myelomonocytic leukemia, and myeloma, post-polycythemia vera myelofibrosis or post-essential thrombocythemia myelofibrosis.
6. The method according to claim 1, wherein the myeloproliferative neoplasm is caused by and/or associated with a JAK2V617F mutation.
7. The method according to claim 1, wherein the myeloproliferative neoplasm is persistent to JAK-inhibitor.
8. The method according to claim 1, wherein the JAK inhibitor is selected from the group consisting of ruxolitinib, pacritinib, NS-018, CEP-33779, NVP-BVB808, TG101209, fedratinib, momelotinib, baricitinib, AZD960, AZD1480, tofacitinib, gandotinib, XL019, NVP-BSK805, peficitinib, pyridone 6, filgotinib, itacitinib, decernotinib, janex1, and JAK3-IN-1.
9. A combination comprising: at least one inhibitor of a mRNA splicing and processing factor, and at least one JAK inhibitor.
10. A pharmaceutical composition comprising at least one inhibitor of a mRNA splicing and processing factor, and at least one JAK inhibitor, together with at least one pharmaceutically acceptable vehicle, excipient and/or diluent.
11. The pharmaceutical composition according to claim 10, wherein the at least one inhibitor of a mRNA splicing and processing factor is selected from the group comprising a Cpsf7 inhibitor, a Cstf2 inhibitor, a Hnrnpk inhibitor, a Hnrnpu inhibitor, a Pcbp1 inhibitor, a Polr2a inhibitor, a Rbm39 inhibitor, a Rbm8a inhibitor, a Sf3b1 inhibitor, a Snrnp200 inhibitor, a Srrm1 inhibitor, a Srsf2 inhibitor, a Srsf6 inhibitor, a Srsf9 inhibitor, a Srsf11 inhibitor, and a Ybx1 inhibitor.
12. The pharmaceutical composition according to claim 10, wherein the at least one inhibitor of a mRNA splicing and processing factor is a Ybx1 inhibitor.
13. The pharmaceutical composition according to claim 10, wherein the at least one inhibitor of a mRNA splicing and processing factor is selected from the group comprising a mRNA expression inhibitor, a protein expression inhibitor, a post-translational modification inhibitor, a protein arginine methyl transferase inhibitor, and a functional inhibitor.
14. The pharmaceutical composition according to claim 10, wherein the JAK inhibitor is selected from the group consisting of ruxolitinib, pacritinib, NS-018, CEP-33779, NVP-BVB808, TG101209, fedratinib, momelotinib, baricitinib, AZD960, AZD1480, tofacitinib, gandotinib, XL019, NVP-BSK805, peficitinib, pyridone 6, filgotinib, itacitinib, decernotinib, janex1, and JAK3-IN-1.
15. (canceled)
Description
DESCRIPTION OF THE FIGURES
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307]
[0308]
[0309]
[0310]
[0311]
EXAMPLES
Methods
Cell Culture
[0312] Murine Ba/F3 cells stably expressing Jak2WT and Jak2V617F, human SET-2 and HEL 92.1.7 cells (purchased from DSMZ, Braunschweig, Germany) were cultured in RPMI 1640 medium (Life Technologies, Carlsbad, Calif., USA) supplemented with 10% FBS (Life Technologies) in a humid atmosphere of 5% CO2 at 37° C. Cell lines were tested and maintained mycoplasma free throughout the study. Primary murine cells were cultured in StemSpan SFEM medium (Stemcell Technologies, Vancouver, Canada) supplemented with cytokines (100 ng/ml SCF, 10 ng/ml TPO, 6 ng/ml IL-3 and 10 ng/ml IL-6; Pepro Tech, Rocky Hill, N.J., USA). The functional inhibitors were GSK3326595 (Cat #58664, Selleckchem), Indisulam (Cat # SML1125, Sigma Aldrich), Herboxidiene (Cat #Cay25136, Biomol, Cayman chemicals), and Pladienolide B (Cat #6070, Tocris).
Primary Patient Samples
[0313] Patient samples and healthy donor controls were obtained after informed consent and according to the Helsinki declaration from the Tumor Banks in Jena and Magdeburg, approved by the respective local ethics committee (Ethics Committe, University Hospital Jena #4753/04-16 and Ethics Committee, Medical Faculty, OvGU Magdeburg #115/08).
Focused Lentiviral shRNA Library Screen
[0314] In brief, the Mission TRC lentiviral pLKO.1 shRNA vectors (Sigma Aldrich) targeting the top 15 hits of mRNA processing and splicing factors enriched in Jak2V617F were selected) and lentiviruses were individually produced per shRNA by co-transfecting with 3rd generation packaging plasmids pMDL, pRSV and pVSVG in HEK293T cells seeded in a 10 cm culture dishes. In total were used 74 shRNAs, 4-5 different shRNAs per each target (SEQ ID NO. 1-144), and 4 non targeting controls (Sigma Aldrich, catalog number: SHC016, SHC016V). Sequences for Cpsf7 were bought from Sigma Aldrich, catalog number SHCLNG-NM_172302, SEQ ID NOs 1-10. The viruses were collected at 48 hours and 72 hours after transfection, syringe filtered through a 0.45 μm syringe filter, concentrated using 30K Amicon Ultra-15 centrifugal filters (Merck) and the target murine BaF3 Jak2V617 cells were infected with polybrene (8 mg/ml, Sigma). For screening purpose 200,000 murine BaF3 Jak2V617 cells in 2 ml RPMI media with 10% heat-inactivated FBS (Invitrogen) were seeded in each well of a 6 well plates. Concentrated virus was added per well (with polybrene 8 mg/ml), centrifuged at 500×g for 1 hour at 35° C., subsequently 48 hrs after transduction cells were 1 μg/ml puromycin selected for 2 days. On day 3, cells were washed, viable cells were counted and plated in 96 well plates (8 technical replicates per sample condition per experiment. In addition, each experiment was performed in technical duplicates for growth assay with and without Jak2 inhibitor Ruxolitinib (0.5 μM). The plates were incubated at 37° C. and 5% CO2 for 72 hours and subjected to Cell Titre 96 aqueous one solution (Promega) according to the manufacture's protocol. Further viable cells were counted after 72 hours with the countess automated cell counter (ThermoFischer Scientific) using trypan blue. Western blot was carried out to assess knock down efficiency on protein level for Pcbp1 and Ybx1. For data analysis, the 8 technical duplicates were averaged and the values were normalized against non-target controls included in each plates. The analysis of the normalized data between biological replicates showed correlation coefficient between r=0.963 to 0.988 indicating high reproducibility of the procedure. Targets were considered potential candidates if 2 or more shRNA responded only in the Jak2 inhibitor treated group but not in the untreated controls of all the biological replicate experiments performed. Using these criteria, we choose our candidates for further characterization.
Inactivation of Murine and Human Ybx1
[0315] In order to inactivate Ybx1, 4 shRNAs targeting mouse Ybx-1 (SEQ ID NO. 137-144) and 4 shRNAs targeting human Ybx-1 (SEQ ID NO. 159-162, Sigma-Aldrich, St. Louis, Mo., USA) were validated and the two selected shRNAs (mouse Ybx1: SEQ ID NO: 141, 143; human Ybx1: SEQ ID NO: 159, 160) were used thereafter using respective non-targeting controls. In brief, Ba/F3, SET-2, and HEL cells were lentiviral transduced with lentiviral particles by centrifuging the cells at 872×g for 1.5 hours at 33° C. The cells were cultured for 2 days, puromycin selected for 48 hours and seeded (5×10.sup.6 cells) followed by inhibitor treatment or addition of diluent control as indicated below. Cells were harvested and Ybx-1 knock-down was checked by qPCR and western blotting.
Jak-i Dose Dependent Cell Growth and Viability in Ybx1-Inactivated Cells.
[0316] To analyse Jak inhibitor dose dependent cell growth and viability, murine BaF3 Jak2V617F cells treated with a non-targeting shNT control or shYbx1 (two different shRNA targeting Ybx1, sh1 and sh2) were counted with the Countess™ automated cell counter (Thermo Fischer Scientific) using trypan blue in 96 well plates after 2 days of 1 μg/ml puromycin selection. 3×10.sup.4 viable cells per well (8 technical replicates per sample condition) in 96 well plate were seeded in RPMI medium with 10% heat-inactivated FBS and exposed to different concentrations of the Jak2 inhibitor Ruxolitinib ranging between 1 nM-10 μM. The plates were incubated at 37° C. and 5%002 for 72 hours and subjected to Cell Titer 96 Aqueous One Solution (Promega) according to the manufacture's protocol. Viable cells were counted after 72 hours by trypan blue. Determination of IC.sub.50 inhibitory concentration of the Jak-i was calculated using GraphPad Prism.
Drug Combination Treatments
[0317] Viable BaF3 Jak2V617F cells were seeded at a density of 30,000 cells per well in RPMI medium with 10% heat inactivated FBS and exposed to Ruxolitinib (0.5 μM) alone or in combination with different concentration of the Mknk1 inhibitor CGP57380 (Sigma), MEK/ERK inhibitor Trametinib (Novartis), PI3K inhibitor LY294002, and p38 MAP kinase inhibitor SB203580 (Merck) and incubated for 72 hours. Cell Titer 96 Aqueous One Solution was added to the plates according to the manufacture's protocol and measurements were performed after 4 hours. The plates were read at 490 nm in Tecan Infinite M200 and the responses were analyzed using GraphPad Prism.
Apoptosis Assays
[0318] Cells stably infected with either non-targeting or Ybx1 specific shRNA were seeded in six-well plates and selected for 24 hours with puromycin. Primary murine lineage-depleted cells or FACS-sorted human CD34.sup.+ cells were incubated in 48 well plates. Inhibitor treatment was performed at concentrations as indicated for 48 hours unless otherwise stated. Apoptosis was measured by flow cytometry on a BD FACS Canto™ cytometer using Annexin V in combination with SYTOX™ Blue or SYTOX™ Green as dead cell stains.
Proliferation Assay with PCNA
[0319] After puromycin selection of murine BaF3 Jak2V617F treated with non-targeting shNT or shYbx1, cells were washed twice with ice cold 1×PBS, fixed in 70% ethanol and permeabilized with 0.1% Tween-20. The cells were stained with PCNA-Alexa fluro488 conjugate (Biozol) on ice for 20 min and measured by flow cytometry (
MTS Assay
[0320] 3×10.sup.4 viable cells per well (8 technical replicates per sample condition) in 96 well plate were seeded in RPMI medium with 10% heat-inactivated FBS and exposed to different concentrations of the Jak inhibitor, mRNA splicing and processing factor inhibitor or MEK inhibitors. The plates were incubated at 37° C. and 5% CO2 for 72 hours and subjected to Cell Titer 96 Aqueous One Solution (Promega) according to the manufacture's protocol and measurements were performed after 4 hours. The plates were read at 490 nm in Tecan Infinite M200 and the responses were analyzed using Graph Pad Prism.
Cell Cycle Analysis
[0321] For cell cycle measurements, 2×10.sup.6 murine BaF3 Jak2V617F cells stably expressing shNT or shYbx1 were washed in ice cold 1×PBS twice, fixed in ice cold 70% ethanol for 30 minutes on ice and stored at 4° C. After collection of biological replicates, samples were Ribonuclease A treated and stained with Propidium Iodide (PI). The PI stained cells were measured using BD Canto flow cytometer and data analyzed in FlowJo.
ROS Measurements Using Carboxy-H.SUB.2.DFFDA
[0322] In brief, 1×10.sup.6 murine BaF3 Jak2V617F cells stably expressing shNT or shYbx1 were washed twice with 1×PBS and resuspended in 20 μM carboxy-H2DFFDA for 30 mins in dark at room temperature. Thereafter, the cells were washed thrice in 1×PBS and measured using BD FACSCanto™ cytometer. Data were analyzed in FlowJo.
DNA Damage Analysis Using yH2AX pS139
[0323] 1×10.sup.6 murine BaF3 Jak2V617F cells stably expressing shNT or shYbx1 cells were seeded on Poly-L-Lysin coated dishes for 2-4 hours, washed in PBS, fixed with 4% Paraformaldehyde, blocked in blocking buffer (0.2% Triton-X, 1% BSA and 5% Normal rabbit serum) and incubated over night with rabbit yH2AX pS139 antibody (#CST 2577) overnight. After overnight incubation, samples were washed and incubated with secondary antibody (anti-rabbit-Alexa 568). DAPI was used for nuclear staining (NucBlue, ThermoScientific). Positive control samples were prepared by exposing the BaF3 Jak2VF cells stably expressing shNT to 20 mins UV under the cell culture hood. Imaging was performed using Zeiss LSM 780 microscope and processed in Zen Black software tool.
Label Free Phospho-Proteome Sample Preparation
[0324] Samples were collected as quadruplicate biological replicates for each condition, lysed in Guanidinium chloride (Gmdcl) buffer (6M Gdmcl, 100 mM Tris pH8.5, 10 mM TCEP and 40 mM CAA), heated for 5 mins at 95° C. and cooled on ice for 15 min. Lysed samples were then sonicated (Branson probe sonifier output 3-4, 50% duty cycle, 10×30 sec) and heated again. Proteins were precipitated with acetone, and quantified by bicinchoninic acid BCA assay. A protein sample of 2 mg was digested with LysC and Trypsin overnight at room temperature and phosphopeptides enriched by TiO.sub.2 beads. The enriched peptides were desalted, washed and eluted on StageTips with 2 layers of SDB-RPS material with elution buffer (80% Acetonitrile and 5% NH.sub.4OH). The eluted peptides were vacuum centrifuged until dryness and reconstituted in 2% ACN/0.1% TFA. All the samples were stored in −20° C. until measurement.
Phosphoproteome of Primary Patient Samples
[0325] In brief, peripheral blood samples from patients with Jak2 mutated myeloproliferative neoplasms were collected, granulocytes isolated, and treated with DMSO or Ruxolitinb 0.5 μM for 2 hours (either in vitro or in vivo). Cells were lysed and processed in 4% SDC buffer (4% SDC, 100 mM Tris pH8.5, 10 mM TCEP and 40 mM CAA), heated for 5 mins at 95° C. and cooled on ice for 15 min. Lysed samples were sonicated, heated again for 5 mins and BCA quantified. Approximately 350 μg of proteins were digested with LysC and Trypsin overnight at room temperature and phosphopeptides were enriched by TiO.sub.2 beads as described elsewhere.
Deep-Proteome Quantification.
[0326] Proteome samples of phosphoproteome analysis were collected after TiO.sub.2 enrichment. In brief, cells were lysed in 1% SDC buffer (1% SDC, 100 mM TrispH8.0, 40 mM CAA and 10 mM TCEP), heated for 5 mins at 95° C., cooled on ice for 15 mins and sonicated (Branson probe sonifier output 3-4, 50% duty cycle, 10×30 sec). 25 μg were digested with LysC and Trypsin overnight and peptides were eluted on Stage Tips with 3 layers of SDB-RPS material with elution buffer. The eluted peptides were vacuum centrifuged until dryness and reconstituted in 2% acetonitril (ACN)/0.1% trifluoro acetic acid (TFA). All the samples were stored in −20° C. until measurement.
Drug-Perturbed Phosphoproteome Profiling
[0327] In order to profile the kinase inhibitor action on Jak2V617F cells, murine Jak2V617F BaF3 were treated with 0.5 μM Jak2 inhibitor Ruxolitinib (Selleckchem, S1378) for 2 hours and 10 μM MEK inhibitor PD0325901 (Sigma), 10 μM p38 inhibitor SB203580 (Merck), 20 μM JNK inhibitor SP600125 (Sigma), 50 μM PI3K inhibitor LY294002 (Merck), 10 μM AKT inhibitor MK2206 (Enzo Life) and 100 nM mTOR inhibitor Torin-1 (Millipore) for 1 hour. The cells were lysed in Gmdcl buffer and processed as mentioned in the phospho-proteome sample preparation protocol.
Liquid Chromatography (LC)-MS/MS Measurement
[0328] For the LC-MS/MS analysis, Q-Exactive mass spectrometer with a nanospray ion source connected online to an Easy-nLC 1000 HPLC system was used. Peptides were separated on an in-house prepared 50 cm C18 columns (75 μM inner diameter with 1.9 μM C18 ReproSil particle, Dr. Maisch GmbH) in a 140 minute gradient between 5%-65% in buffer B (0.5% formic acid, 80% acetonitrile). The column temperature was maintained at 50° C. using column oven (in-house made). Peptides were analyzed with a full scan (300-1600 m/z, R=60,000 at 200 m/z) at a target of 3e6 ions, followed by high energy collisional disassociation-based fragmentation (HCD) of top10 most abundant isotope patterns with a charge MS/MS scan, detected in the orbitrap detector (R=15,000 at 200 m/z). Dynamic exclusion of sequenced peptides was set to 40 s and apex trigger (4 to 7 s) were on. All data were acquired using X-caliber software (Thermoscientific).
Data Processing with Maxquant
[0329] Mass spectrometric raw files were processed using the Andromeda search engine integrated into Maxquant 15 environment (1.5.5.2 version). The MS/MS spectra were matched against the mouse (UniProt FASTA 2015_08) database with an FDR<0.01 at the level of proteins, peptides and modifications. The search included fixed modification for carbamidomethyl and in the variable modifications table phosphoSTY was added additionally for the phosphorylated peptide search to the default settings. Peptides with at least seven amino acids were considered for identification. Maximum two missed cleavages were allowed for protease digestion. Match between run was enabled with the matching window of 1 min to transfer peptide identification to across runs based on normalized retention time and high mass accuracy.
Phosphoproteome Data Analysis
[0330] Perseus16 software (1.5.2.11 version) environment was used for all Maxquant output table analysis. For phosphoproteome analysis, sample for class-I phosphosites (localization probability >0.75) and required a minimum of 3 or 4 valid values in each of the biological quadruplicates Statistical analysis of was performed on the logarithmized intensities values. Significance was assessed by Student's t-test using permutation-based FDR, to identify the significantly regulated phosphosites. In group comparisons two sample t-test or for multiple samples comparison ANOVA test was performed with permutation-based FDR cut-off 0.01 or 0.05. The significantly regulated phosphosites were filtered, Z-scored and represented as either unsupervised hierarchical clustered heat maps or profile plot. Annotations were extracted from UniprotKB, Gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and Reactome. Kinase-substrates relationships were extracted from phosphosite plus database (phosphosite.org). Fischer exact test was performed to discover motifs and annotations that are significantly regulated in the sample groups. For phosphosite occupancy calculation, the proteome and phosphoproteome of corresponding samples were matched in maxquant to estimate occupancy, occupancy ratio and occupancy error scale using the extracted signal difference of modified peptide, unmodified peptide and the corresponding protein ratios (described earlier, 8). Phosphoprotein network architecture were obtained using String database and further networks and sub-networks were analyzed and visualized in Cytoscape.
Ybx1 Interactome Preparation
[0331] For Ybx1 affinity purification, cells were lysed in 150 mM NaCl, 50 mM Tris (pH7.5), 5% glycerol, 1% IGPAL-CA-630 (Sigma), protease inhibitors (EDTA free, Roche), 1% Benzonase, and 1 mM MgCl2 for 30 min on ice. 1 mg of total lysate was incubated with validated Ybx1 antibody (Abcam #76149) overnight and 30p1 of rec-protein A sepharose 4B conjugates (Invitrogen) for 2 hours. Non-specific binders were removed by three washes with wash buffer 1 (150 mM NaCl, 50 mM Tris (pH7.5), 5% glycerol, 0.05% IGPAL-CA-630) and three washes with wash buffer 11 (150 mM NaCl, 50 mM Tris (pH7.5)).
[0332] The bound proteins were on-beads digested with Trypsin and LysC overnight. The peptides were desalted on C18 Stage tips and analyzed by mass spectrometry.
RNA Sequencing
[0333] Transcriptome profiling of BaF3 Jak2VF cells stably expressing shNT or shYbx1 cells was performed using a strand-specific RNA sequencing protocol described previously. In brief, total RNA was isolated using 2×10.sup.6 cells using NucleoSpin RNA Kit according to the Manufacturer's protocol (Macherey Nagel). RNA library for sequencing was prepared using NEBNext Poly(A) mRNA Magnetic Isolation Module. The quality was analyzed on a Bioanalyzer (Agilent 2100 Bioanalyzer) high sensitivity DNA assay. Samples were sequenced on Illumina Nexseq500 and multiplexed reads were demultiplexed on the basis of their barcodes. Sequencing reads were filtered, trimmed and then mapped to the Ensembl gene annotation and the mouse genome assembly GRCm38 using STAR aligner with ENCODE settings in two-pass mode considering splice junctions across all samples in the second mapping step. Gene counts were quantified using feature Counts 28 and differential expression calculated with the limma-voom pipeline. Gene and transcript expression levels were quantified using RSEM. Event level differential splicing was calculated with the EventPointer package in R.
Ybx1 Conditional Knock Out Genotyping and Gene Expression by qPCR
[0334] Genotyping of tails and fetal livers was performed using the following primers: Ybx1_cond_for (GCCTAAGGATAGTGAAGTTTCTGG SEQ ID NO 145), Ybx1_con_rev (CCTAGCACACCTTAATCTACAGCC, SEQ ID NO 146), Cre_for (CGTATAGCCGAAATTGCCAG, SEQ ID NO 147), Cre_rev (CAAAACAGGTAGTTATTCGG, SEQ ID NO 148). Genotyping PCR was performed using the Dream Taq Green PCR Master Mix (2×) (Thermo Fisher Scientific, Waltham, Mass., USA) following the manufacturers' protocol.
Histology Staining and Immunohistochemistry
[0335] Formalin-fixed and paraffin-embedded bone marrow biopsies with proven myeloproliferative neoplasia or primary samples without histopathologic abnormalities were retrieved from the archival files of the Institute of Pathology, Otto-von-Guericke University Medical Center, Magdeburg, Germany. All MPNs were diagnosed and classified according to the World Health Organization (WHO) 2008 classification in synopsis with clinical data and presentation. The study comprises of biopsies derived from 76 MPN patients (PV (n=23), ET (n=32) and MF (n=21)) compared to healthy donor controls (n=18) or BCRABL positive CML (n=17). Immunohistochemistry was performed using a monoclonal Rabbit-anti-human Ybx1 antibody (Abcam; ab76149) in a dilution of 1:100.
Hematopoietic Progenitor Cell Assays
[0336] Colony formation assay: For investigation of colony formation in methylcellulose, LSK (Lin−Sca1+KIT+) cells were sorted from bone marrow of the respective donor mice as previously described. 1×10.sup.3 cells were seeded in MethoCult M3434 (Stem Cell Technologies), respectively. Colony numbers were counted on day 10 after plating using standard methods. Spleen colony formation assays (CFU-S12): bone marrow cells were collected from donor mice and 1×10.sup.2 LSK cells were FACS sorted and injected via tail vein into lethally irradiated (12Gy TBI) C57BL/6 recipient mice. At day 12 post-injection, spleens from recipient mice were harvested and stained with Bouin's fixative solution (Sigma-Aldrich), and colonies were counted using standard methods.
Experimental Animals
[0337] All mice were housed under pathogen-free conditions in the accredited Animal Research facility at the Animal Research Facility of the Otto-von-Guericke University—Medical Faculty, Magdeburg. All experiments were approved by the Landesverwaltungsamt Saxony-Anhalt, Halle, Germany. Conventional Ybx1 knockout mice have been generated as previously described 23. Mice harboring a ‘floxed’ (flanked with loxP sites) allele of Ybx1 have been generated at Taconic-Artemis in a pure C57BL/6 background.
Transplantation Assays and In Vivo Treatment
[0338] For competitive repopulation assays 2×10.sup.6 BM cells (for Jak2WT) or 5×10.sup.4 sorted LSK cells (for Jak2V617F) of 6-8 week old Ybx1.sup.−/− or Ybx1.sup.+/+ (CD45.2) littermates and 2×10.sup.6 (CD45.1/2) competitor cells (derived from intercrossing CD45.1 animals with CD45.2 animals purchased from Charles River) were transplanted via lateral tail vein injection into lethally irradiated (12Gy, single dose) 6-8 week old Ly45.1 mice (Jackson Laboratories, Bar Harbor, Me.). For serial transplantation experiments whole BM of primary recipient mice was harvested and 2×10.sup.6 whole BMC were injected into lethally irradiated secondary recipients. Ruxolitinib was purchased at Selleckchem (Selleckchem, S1378) and formulated for administration by oral gavage as previously described. Mice received the Jak1/2 inhibitor ruxolitinib at a dose of 90 mg/kg or vehicle control by oral gavage BID. For xenografting of Jak2-mutated human cells, HEL cells were either infected with lentiviral particles for transduction of the respective shRNAs (shNT or shYbx1) or incubated for 24 hours with inhibitors as indicated. 1×10.sup.6 viable cells were injected in each irradiated (2Gy) recipient NSGS mouse via lateral tail vain injection. Engraftment and expansion of human cells was monitored weekly by the presence of hCD45-positive cells in the peripheral blood. For patient derived xenograft experiments (PDX) we used an improved model for human HSC transplantation and analysis, that has been developed by her group from immune-deficient mouse strains containing Kit mutations (NSGW41). These mice can be engrafted without prior conditioning and therefore maintain an intact niche and microenvironment. Primary bone marrow samples were acquired during routine biopsies and cells were isolated by Ficoll gradient centrifugation followed by depletion of CD3 positive cells. 1.8-2×10.sup.6 stem- and progenitor cells (HSPCs) were engrafted (pairwise) per animal. Mice were followed for 4 weeks and peripheral blood chimerism of human CD45 positive cells was measured by flow cytometry. Between weeks 4 and 20 all animals were treated for 5 days every 4 weeks with either Ruxolitinib (90 mg/kg BID per gavage) or the combination of Ruxolitinib with the MEK/ERK-inhibitor Trametinib (1 mg/kg QD per gavage).
Quantification of JAK2VF Mutant Cells by Pyrosequencing
[0339] In order to assess for the relative abundance of JAK2-mutated cells within the patient derived xenograft (PDX) model, we sorted human CD45 positive cells from the bone marrow at week 20 and performed pyrosequencing for the JAK2V671F mutation. DNA isolation and whole-genome amplification were carried out on FACS-sorted hCD45 positive cells using the REPLI-g Single Cell Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Amplicons were generated using AmpliTaq Gold DNA Polymerase (Thermo Fisher Scientific, Waltham, Mass., USA; biotinylated forward primer: GAAGCAGCAAGTATGATGAGCA (SEQ ID NO 149); reverse primer: TGCTCTGAGAAAGGCATTAGAA (SEQ ID NO 150)) according to standard protocols. Samples were then analyzed by pyrosequencing (PyroMark Q96 ID, Qiagen, Hilden, Germany; sequencing primer: TCTCGTCTCCACAGA (SEQ ID NO 151)) to assess for the mutational status of the JAK2V617F variant of the individual subpopulations.
Rescue of shRNA-Inactivated Endogenous Ybx1 with Exogenous Enforced Expression of Mcl-1
[0340] Ba/F3 cells expressing EpoR (MSCV-EpoR-Neo) and Jak2V617F-GFP (MSCV-Jak2V617F-GFP) were infected with retrovirus expressing empty vector (MSCV-Puro) or Mcl-1 (MSCV-Mcl-1-Puro). Knockdown of Ybx1 was performed as indicated.
Immunoprecipitation and Immunoblotting
[0341] Ba/F3 EpoR and wild-type Jak2 or Jak2V617F, respectively, were washed twice with PBS and starved for 4 h in serum reduced (0.5%) medium at a density of 1×10.sup.6/ml. For immunoprecipitation, the TrueBlot Anti-Rabbit Ig IP Beads Kit (Rockland Immunochemicals, Gilbertsville, Pa., USA) was used following the manufacturers instruction. The following antibodies were purchased from Cell Signaling (Danvers, Mass., USA) and used at a 1:1000 dilution: p-Akt (9271), Akt (9272), p-p44/42 MAPK (9106), p44/42 MAPK (9102), p-cRaf (9427), cRaf (9422) and p-Ybx1 (Ser102) (2900). GAPDH antibody (H86504M, 1:5000) was purchased from Meridian Life Sciences (Memphis, Tenn., USA), p-Stat5 antibody (05-495, 1:1000) was purchased from Millipore (Darmstadt, Germany) and Stat5 (sc-1081, 1:100) antibody was purchased from Santa Cruz Biotechnologies (Dallas, Tex., USA). Mcl-1 antibody (600-401-394, 1:1000) was delivered by Rockland (Limerick, Pa., USA) and Ybx1 antibody (ab76149, 1:1000) was delivered by Abcam (Cambridge, UK).
Flow Cytometry
[0342] For immunophenotype analysis, peripheral blood cells, bone marrow or spleen cells were resuspended in PBS/1% FBS after erythrocyte lysis (PharmLyse™, BD Pharmingen). Unless otherwise stated, the following antibodies were used: Sorting and analysis of LSK-cells or Sca-1+ cells were performed as previously described 25,26. Biotinylated antibodies against Gr-1 (RB6-8C5), B220 (RA3-6B2), CD19 (6D5), CD3 (145-2C11), CD4 (GK1.5), CD8 (53-6.7), TER119 and IL7Ra (A7R34) (all Biolegend, San Diego, Calif., USA) were used for lineage staining. An APC-Cy7- or BV421-labeled streptavidin-antibody (Biolegend) was used for secondary staining together with an APC-anti-KIT (clone 2B8) and a FITC- or PE-anti-Sca-1 antibody (clone E13-161.7). Cells were analyzed using a FACSCantoll™ (Becton-Dickinson) cytometer. Analysis was performed using FlowJo™ software (Treestar, Ashland, Oreg.). Fix&Perm Kit (Life Technologies) was used for intracellular staining according to the manufacturer's protocol.
Immunofluorescence Analysis (Jak2-Ybx1 Co-Localization)
[0343] 2×10.sup.4 cells were washed and seeded onto adhesion slides (Marienfeld). Attached cells were fixed in PBS/2% PFA/0.01% glutaraldehyde for 15 min on ice followed by permeabilization for 10 min with PBS/0.02% Triton X100 at room temperature. After blocking for 30 min with PBS/1% BSA/0.1% Tween 20, Ybx-1 (Abcam ab76149, 1:50) or pYbx-1 labeled with Alexa488 (Ser102) (BIOSSUSA bs-3477R-A488, 1:50) was incubated in blocking solution 1 h. The samples were washed 5 times 5 min with PBS followed by incubation of Alexa Fluor 488 donkey anti-rabbit antibody (life technologies A21206, 1:200) for 1 h. After additional washing, Jak2 labeled with Cy3 (BIOSSUSA bs-0908R-Cy3, 1:50) was incubated in blocking solution for 1 h. In the following, the samples were washed, incubated with DAPI for 10 min and mounted using ProTags® Mount Fluor (quartett, 401603095). Samples were analyzed using confocal microscope Leipa SP8.
Generation of Ybx1 Phosphorylation Mutants
[0344] Phosphorylation mutants mimicking hyperphosphorylation or de-phosphorylation of Ybx1 were generated by site-directed mutagenesis at amino acid residues that were (i) highly conserved and (ii) differentially phosphorylated in the absence or presence of mutated JAK2 kinase. These aspects applied to the murine serine residues S30, S34, S172 and S174. In detail the following mutants were generated by site directed mutagenesis using a retroviral MSCV-IRES-GFP backbone (Addgene, plasmid #20672): (1) MIG-mYbx1-S30A/S34A (SEQ ID NO 152); (2) MIG-mYbx1-530A (SEQ ID NO 153); (3) MIG-mYbx1-534A (SEQ ID NO 154); (4) MIG-mYbx1-S30D/S34D (SEQ ID NO 155); (5) MIG-mYbx1-530D (SEQ ID NO 156); (6) MIG-mYbx1-534D (SEQ ID NO 157) and (7) MIGmYbx1-S172A/S174A (SEQ ID NO 158). Constructs were expressed in murine Jak2-mutated (Ba/F3-JAK2VF) cell lines. In brief, cells were infected by co-localization of virus supernatant (containing the respective constructs as indicated above) with Ba/F3-Jak2-V617F(VF) cells on retronectin-coated plates. Infection has been repeated after 24 hours and GFP-positive cells were sorted to ensure expression of the mutants in a homogeneous population.
Statistical Analysis
[0345] For survival analysis, Kaplan-Meier curves were plotted using GraphPad Prism™ version 6.0 h (GraphPad Software, SanDiego, Calif.). Differences between survival distributions were analyzed using the logrank test. Statistical analyses were performed using Student t test (normal distribution) or Mann-Whitney U test (when normal distribution was not given). P less than 0.05 was considered statistically significant (p<0.05 indicated as *, p<0.01 indicated as **, and p<0.001 indicated as ***).
Example 1. Phosphoproteomic Analysis of JAK2V617F Mutants
[0346] To identify downstream effectors of the mutant Jak2 kinase that drive the evolution of persistent clones, we performed in-depth mass spectrometry (MS)-based phosphoproteomics in murine hematopoietic cells expressing erythropoietin-receptor and either Jak2-wildtype (Jak2WT) or mutated Jak2-V617F (Jak2V617F) kinase (
Example 2. Inactivation of mRNA Splicing and Processing Factors Sensitizes Jak2V617F Mutant Cells to Treatment with Jak Inhibitors
[0347] To assess the potential functional role of protein members (n=47) of the mRNA splicing and processing pathway, we chose 15 members that were significantly phosphorylated in Jak2V617F mutant on the basis of their statistical significance, i.e. p-value (
[0348] The most prominent candidate (4 shRNAs out of 4 targeted) that sensitized Jak2V617F cells to Jak-i treatment was the pleiotropic Y-box binding protein 1 (Ybx1) (
[0349] Ybx1 was highly expressed in 76 primary bone marrow (BM) biopsies of patients diagnosed with Jak2-mutated MPN (
Example 3. Genetic Inactivation of Ybx1 In Vitro
[0350] Genetic inactivation of Ybx1 in BaF3 Jak2V617F cells, resulted in a dose-dependent reduction of in vitro proliferation after exposure to Jak-i Ruxolitinib (IC50 reduction: 1000 nM to 275 nM;
[0351] Reduction of Jak2V617F cell growth exposed to Jak-i in combination with Ybx1 inactivation could be attributed to induction of apoptosis. These findings were confirmed in Jak2V617F mutated murine (
Example 4. Genetic Inactivation of Ybx1 In Vivo
[0352] To assess Ybx1 as a potential therapeutic target in Jak2-mutated neoplasms, it was investigated if Ybx1 genetic inactivation would lead to a reduction of Jak-i persistent clones in vivo.
[0353] A conditional knockout mouse model was generated with Exon 3 of Ybx1 flanked with loxP sites crossed with conditional Jak2V617F knock-in mice harboring an inducible Mx1-Cre recombinase. Bone marrows from Ybx1F/F Jak2V617F Mx+ and Ybx1.sup.+/+ or Ybx1.sup.+/− Jak2V617F Mx.sup.+ littermate controls (CD45.2) was transplanted in a competitive manner along with 45.1 competitor cells. Following engraftment of transplanted cells, recipient animals received plpC injections to activate Mx1-Cre and genetically delete Ybx1 with concomitant Jak-i medication by gavage.
[0354] Recipients of Jak2V617F Ybx1.sup.+/+ bone marrow showed hyperleukocytosis, thrombocytosis, and onset of symptomatic myeloproliferation (splenomegaly). In contrast, Ybx1-deficient Jak2V617F clones did not lead to symptomatic disease within 16 weeks after transplantation (
[0355] Peripheral blood (PB) chimerism revealed an increasing percentage of PB CD45.2/Jak2V617F positive cells, while genetic inactivation of Ybx1 resulted in suppression or loss of the Jak2-mutated clone (
[0356] In a xenograft model of Jak2V617F mutated human cells, shRNA mediated inactivation of Ybx1 followed by saline injection did not result in significant delay of disease progression (
[0357] These data suggest that the evolution of persistent Jak2-clones under pharmacologic Jak inhibition can be disrupted in human and murine cells by eliminating Ybx1.
Example 5. Safety of Ybx1 Inactivation
[0358] To be clinically relevant, a treatment based on Ybx1 inactivation must have a suitable therapeutic index between hematopoietic stem- and progenitor cells (HSPCs) and their malignant counterpart. Fortunately, genetic inactivation of Ybx1 did not perturb steady-state haematopoiesis (
Example 6 Analysis of Ybx1-MAPK Interaction
[0359] To further gain insight into the regulation of Ybx1 by mutant Jak2, the phosphoprofile of Ybx1 was investigated in Jak2V617F cells. Following treatment with EPO and Jak-i, Ybx1 was specifically phosphorylated at several phosphosites in Jak2V617F compared to Jak2WT cells (phosphosites: pS2, pS3, pS27, pS30, pS34, pS172, and pS174). To further characterize post-translational modulators of Ybx1, phosphoproteome analysis was performed following pharmacologic short-term inhibition of several bona fide Jak2 downstream effectors AKT, JNK, MEK, mTOR, p38, PI3K, and Jak (
[0360] To corroborate the Ybx1-MAPK interaction, we performed Ybx1 affinity purification combined with quantitative interaction proteomics, which revealed 260 Jak2-VF specific interactors. Among these, ribonucleoproteins, mRNA splicing factors and ribosomal proteins were significantly enriched, which also explains the large number of interactors (p<0.05). Most notably, several bona fide members of mRNA splicing complexes were identified as Ybx-1 interactors in Jak-2 mutated cells (
Example 7 Ybx1 Phosphomutants
[0361] In order to delineate the relevance of regulation of Ybx1 phosphorylation sites, we expressed Ybx1 phospho-mutants mimicking hyper- or hypo-phosphorylated states at conserved and relevant serine residues in Jak2-mutated cells (
[0362] Expression of pS30A, pS34A and pS30A/34A double phosphomutants (but not pS30D, pS34D, pS30D/34D or pS170A/S172A mutants) resulted in reduction of nuclear Ybx1 translocation (
[0363] Consistently, MEKi treatment alone or in combination with ruxolitinib significantly prevented Ybx1 nuclear import, an effect that was not detectable on ruxolitinib treatment alone, in murine and human Jak-mutated cells (
[0364] These data suggest that MAPK signaling stabilizes nuclear Ybx1, and this notion was further supported by impaired binding of Ybx1 pS30A and pS34A-containing phosphomutants to Mapk1 (
[0365] Collectively our data demonstrate that Ybx1 undergoes Jak2V617F-Mapk1 dependent phosphorylation and that Ybx1-Mapk1 interaction is crucial for Ybx1 nuclear translocation and persists despite Jak-i treatment.
[0366] Moreover, these data show that inhibitors of Ybx1 phosphorylation could be used as therapeutic agent to sensitize Jak-mutated cells to Jak-i mediated cell death.
Example 8 Transcription Regulation by YBX1
[0367] In order to identify the transcriptional pathways controlled by Ybx1, RNA sequencing (RNAseq) analysis of murine and human Jak2-mutated cells was performed following inactivation of Ybx1 by RNA interference. Gene-ontology (GO) analysis of the differentially expressed coding genes revealed strong signatures of inflammation, chemotaxis and cytokine production but also of MAPK and ERK signaling and programmed cell death (
[0368] Given the established role of Ybx1 in mRNA splicing, altered splicing events were analysed. Results showed an increase in intron retention (IR; 70% increase, 1064 events, p<0.05 & ΔPSI>0.1) compared to other alternative splicing events (
[0369] Thus, it was analysed whether ERK-signaling molecules that had increased intron retention such as Araf, Braf and Mknk1 were regulated in Jak-mutated cells (
Example 9 Role of Ybx-1 in ERK-Signaling and Regulation of Apoptotic Factors Mcl1, Bim
[0370] Phosphoproteome profiling of Ybx1-inactivated Jak2V617F cells revealed significant downregulation of phosphosites (downregulated phosphosites, 2012 in murine and 2390 in human, (
[0371] To confirm these effects on cell signaling we investigated Jak2-dependent pathways in the presence or absence of pharmacologic Jak-i treatment. As observed on a global scale, inactivation of Ybx1 led to a considerable reduction of ERK phosphorylation in murine and human cells (
[0372] Likewise, genetic inactivation of Mknk1 by RNAi abrogated ERK signaling and sensitized the cells to Jak-i induced cell death (
[0373] In the proteome of Ybx1 depleted Jak2V617F cells, affected cellular functions besides RNA splicing and processing included positive regulation of programmed cell death and apoptosis (
Example 10 Pharmacological Modulation of Mknk1- or ERK-Signaling in Combination with Jak2 Inhibitors
[0374] Finally, pharmacological modulation of Mknk1- or ERK-signaling in combination with two different Jak-i resulted in induction of apoptosis in murine (
Example 11. Inhibition of JAK2V617F Cell Growth and Proliferation by a Synergistic Combination of Splicing Factor Inhibitors and Jak Inhibitors
[0375] Functional inhibitors of mRNA splicing and processing factors in combination with Jak inhibitors were able to synergistically inhibit JAK2V617F cell growth and proliferation. The tested functional inhibitors were GSK3326595, Indisulam, Herboxidiene and Pladienolide B.
[0376] To this aim, murine Jak2 V617F cells were incubated with a functional inhibitor at increasing concentration in the presence and absence of Jak inhibitor Ruxolitinib (0.5 μM). After 72 hours, the incubation was stopped and growth measured by MTS assay.
[0377] The results (