SPINACH PLANT HAVING NOVEL DOWNY MILDEW RESISTANCE GENE
20250234825 ยท 2025-07-24
Inventors
- Yo NAKAMURA (Yokohama-shi, JP)
- Ryo KIMURA (Yokohama-shi, JP)
- Yuichi SUGIHARA (Yokohama-shi, JP)
- Yosuke MORITAMA (Yokohama-shi, JP)
Cpc classification
International classification
A01H1/04
HUMAN NECESSITIES
Abstract
The present invention provides a spinach plant having resistance to a broad range of races, a method for producing said spinach plant, and the like. The present invention provides a downy mildew resistant spinach plant having a downy mildew resistance RPF-SK1 gene in at least one allele, wherein in the RPF-SK1 gene: (a) the SNP identified by chr3_1215815 is cytosine, (b) the SNP identified by chr3_1215855 is thymine, (c) the SNP identified by chr3_1216014 is cytosine, (d) the SNP identified by chr3_1216093 is guanine, the SNP identified by chr3_1216094 is guanine, and the SNP identified by chr3_1216095 is adenine, (e) the SNP identified by chr3_1216288 is adenine, or (f) the SNP identified by chr3_1216291 is guanine.
Claims
1. A downy mildew resistant spinach plant having a downy mildew resistance RPF-SK1 gene in at least one allele, wherein in the RPF-SK1 gene: (a) a SNP identified by chr3_1215815 is cytosine, (b) a SNP identified by chr3_1215855 is thymine, (c) a SNP identified by chr3_1216014 is cytosine, (d) a SNP identified by chr3_1216093 is guanine, a SNP identified by chr3_1216094 is guanine, and a SNP identified by chr3_1216095 is adenine, (e) a SNP identified by chr3_1216288 is adenine, or (f) a SNP identified by chr3_1216291 is guanine.
2. The downy mildew resistant spinach plant according to claim 1, wherein the RPF-SK1 gene is either homozygous or heterozygous.
3. The downy mildew resistant spinach plant according to claim 1, wherein the plant is resistant to at least downy mildew races Pfs1, Pfs2, Pfs3, Pfs4, Pfs5, Pfs6, Pfs7, Pfs8, Pfs9, Pfs10, Pfs11, Pfs12, Pfs13, Pfs14, Pfs15, Pfs16, Pfs17, Pfs18, Pfs19, and a race indicated by UA1014 type.
4. The downy mildew resistant spinach plant according to claim 1, wherein the plant is resistant to at least races indicated by downy mildew races indicated by Be2105B type and PV2144 type.
5. The downy mildew resistant spinach plant according to claim 1, wherein the downy mildew resistant spinach plant is derived from an interspecific hybrid plant of Spinacia tetrandra and a cultivated species of spinach.
6. The downy mildew resistant spinach plant according to claim 1, having downy mildew resistance derived from a plant specified in accession number FERM BP-22426.
7. The downy mildew resistant spinach plant according to claim 1, having at least one type of downy mildew resistance gene besides the RPF-SK1 gene.
8. A downy mildew resistant spinach plant that is a downy mildew resistant spinach plant specified in accession number FERM BP-22426, a hybrid plant obtained using the downy mildew resistant spinach plant as a parent, or a progeny of either of these plants.
9. A method for predicting downy mildew resistance of a spinach plant, or screening downy mildew resistant spinach plants, the method comprising investigating genotypes of at least one SNP selected from the group consisting of chr3_1215815, chr3_1215855, chr3_1216014, chr3_1216093, chr3_1216094, chr3_1216095, chr3_1216288 and chr3_1216291 of a test spinach plant, and predicting that the test spinach plant will have a high probability of exhibiting downy mildew resistance or selecting the test spinach plant as a downy mildew resistant spinach plant, in those cases where, in at least one allele: (a) a SNP identified by chr3_1215815 is cytosine, (b) a SNP identified by chr3_1215855 is thymine, (c) a SNP identified by chr3_1216014 is cytosine, (d) a SNP identified by chr3_1216093 is guanine, a SNP identified by chr3_1216094 is guanine, and a SNP identified by chr3_1216095 is adenine, (e) a SNP identified by chr3_1216288 is adenine, or (f) a SNP identified by chr3_1216291 is guanine.
10. (canceled)
11. The method for producing the downy mildew resistant spinach plant according to claim 1, the method having: a first crossing step of crossing a spinach plant having an RPF-SK1 gene and an arbitrary spinach plant, a second crossing step of obtaining a segregating population by subjecting an F1 individual obtained in the first crossing step to self-pollination, backcrossing, or interspecific crossing or intraspecific crossing with a spinach plant different from the parent used in the first crossing step, and a selection step of selecting a spinach plant having an RPF-SK1 gene from the segregating population.
12. The method for producing a downy mildew resistant spinach plant according to claim 11, wherein the arbitrary spinach plant, or the parent used in the interspecific crossing or intraspecific crossing in the second crossing step is a spinach plant having at least one type of downy mildew resistance gene besides the RPF-SK1 gene.
13. A portion of a plant body of the downy mildew resistant spinach plant according to claim 1.
14. A leaf of the downy mildew resistant spinach plant according to claim 1.
15. A seed of the downy mildew resistant spinach plant according to claim 1.
16. A kit which is used for selecting the downy mildew resistant spinach plant according to claim 1, the kit comprising: a forward primer and a reverse primer for conducting PCR amplification of a region including chr3_1215815 to chr3_1216291 of a test spinach plant, wherein the downy mildew resistant spinach plant has an RPF-SK1 gene.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0059]
[0060]
[0061]
[0062]
[0063]
DESCRIPTION OF EMBODIMENTS
[0064] In the present invention and the present description, a spinach plant describes a plant that is classified as belonging to the genus Spinacia. Examples of wild species of spinach include Spinacia tetrandra and Spinacia turkestanica and the like. Further, examples of cultivated species of spinach include Spinacia oleracea L. and the like. In the present invention and the present description, these cultivated species describe plants of varieties used in cultivation, and include not only phenotypically uniform open pollinated lines, but also F1 varieties.
[0065] In the present invention and the present description, downy mildew describes a disease caused by a pathogen belonging to the family Peronosporaceae. The main pathogenic organisms responsible for spinach downy mildew are denoted Pfs (Peronospora farinosa f. sp. spinaciae), and currently, races Pfs1 to Pfs19 have been numbered. In addition to these races, many unnumbered races also exist, such as the races that exhibit pathogenicity of the UA1014, Be2105B and PV2144 types.
[0066] In the present invention and the present description, the terminology chrX_Y (wherein X and Y are integers) of a spinach plant means the nucleotide base, within the genome of the spinach plant, which corresponds with base Y of chromosome X (also called the Xth chromosome) in the reference genome (Spinach genome sequence (v1)) published in SpinachBase (http://spinachbase.org/). The nucleotide base corresponding with base Y of chromosome X in the SpinachBase reference genome in any particular spinach plant can be determined by aligning the nucleotide sequence of the genomic DNA of the spinach plant with the nucleotide sequence of the SpinachBase reference genome so as to achieve the highest degree of homology (sequence identity).
[0067] Accordingly, the chromosome X of any particular spinach plant can be indicated as the chromosome X of the spinach plant determined by aligning the nucleotide sequence of the genomic DNA of the spinach plant with the nucleotide sequence of the SpinachBase reference genome so as to achieve the highest degree of homology (sequence identity).
[0068] In the present invention and the present description, the term chromosome includes not only the entire chromosome, but also portions thereof. In other words a portion of a chromosome may sometimes simply be referred to as a chromosome.
[0069] An X gene locus is a site occupied by the X gene in the chromosome. Accordingly, in the present invention and the present description, a spinach plant having an X gene locus is a spinach plant having a site occupied by the X gene within the chromosome and has the same meaning as a spinach plant having an X gene.
[0070] In the present invention and the present description, a production method can also be called a development method or a breeding method. In other words, the terms production, development and breeding may all be used with the same meaning.
[0071] In the present invention and the present description, the expression portion of the plant body includes the cells and tissues of the plant body, and specific examples include the leaves, seeds, flowers, stems, roots, and fruit and the like. In addition, protoplasts obtained from cells of the plant body are also included.
<Downy Mildew Resistant Spinach Plant>
[0072] The downy mildew resistant spinach plant according to the present invention is a spinach plant, other than Spinacia tetrandra, having an RPF-SK1 gene which is a downy mildew resistance gene located on the RPF gene locus of the wild species of spinach known as Spinacia tetrandra line RNR140003. The RPF-SK1 gene has one of the following SNPs within the RPF gene of the spinach plant: [0073] (a) the SNP identified by chr3_1215815 is cytosine, [0074] (b) the SNP identified by chr3_1215855 is thymine, [0075] (c) the SNP identified by chr3_1216014 is cytosine, [0076] (d) the SNP identified by chr3_1216093 is guanine, the SNP identified by chr3_1216094 is guanine, and the SNP identified by chr3_1216095 is adenine, [0077] (e) the SNP identified by chr3_1216288 is adenine, or [0078] (f) the SNP identified by chr3_1216291 is guanine.
[0079] The RPF-SK1 gene is a novel downy mildew resistance gene that imparts resistance to at least all of the downy mildew races Pfs1 through Pfs19, and the races indicated by UA1014, Be2105B and PV2144 types. Although a variety of RPF genes have already been reported as downy mildew resistance genes, in order to achieve resistance to a broad range of races, these RPF genes have required the use of multiple RPF alleles. The RPF-SK1 gene can, with a single allele, impart resistance to all of the downy mildew races Pfs1 through Pfs19, and the UA1014, Be2105B and PV2144 types, and is therefore a particularly superior downy mildew resistance gene with resistance not seen conventionally, making it extremely useful in the development of a downy mildew resistant spinach.
[0080] The RPF-SK1 gene is a gene that is dominantly inherited by progeny. As a result, a spinach plant according to the present invention may be a spinach plant in which the RPF-SK1 gene is homozygous, namely a spinach plant having a homozygous RPF-SK1 gene, or a spinach plant having a heterozygous RPF-SK1 gene. Because a spinach plant according to the present invention has the RPF-SK1 gene, which is a single dominant downy mildew resistance gene which alone is capable of imparting resistance to an extremely broad range of downy mildew races, said spinach plant exhibits excellent performance as a downy mildew resistant spinach.
[0081] The downy mildew resistant spinach plant according to the present invention can be developed by introducing the RPF-SK1 gene into the genomic DNA of a spinach plant other than Spinacia tetrandra. This introduction of the RPF-SK1 gene into the genomic DNA can be achieved, for example, by introducing a chromosome fragment that includes the site where the RPF-SK1 gene is located (the RPF-SK1 gene locus) in the Spinacia tetrandra line RNR140003. There are no limitations on the site within the chromosome into which the chromosome fragment including the RPF-SK1 gene locus is introduced, and an extrachromosomal site is also possible. For example, the downy mildew resistant spinach plant according to the present invention includes spinach plants in which a chromosome fragment including the RPF-SK1 gene locus has been used to substitute a region within chromosome 3 that corresponds with that fragment, as well as spinach plants in which a chromosome fragment including the RPF-SK1 gene locus has been introduced by translocation or the like into a region other than a region corresponding with the RPF-SK1 gene locus within chromosome 3 of Spinacia tetrandra. Examples of the chromosome fragment including the RPF-SK1 gene locus include the nucleotide shown in SEQ ID NO: 3, 4 and 5, and Table 1.
[0082] Introduction of the RPF-SK1 gene into the genomic DNA may be conducted by cross breeding methods using Spinacia tetrandra as a parent, or by genetic modification methods such as genome editing.
[0083] For example, the downy mildew resistant spinach plant according to the present invention may be a plant derived from an interspecific hybrid plant of Spinacia tetrandra and a spinach plant other than Spinacia tetrandra, wherein the plant has downy mildew resistance derived from the RPF-SK1 gene. The term interspecific hybrid plant includes plants produced by crossing of different species of plants belonging to the genus Spinacia, as well as somatic cell hybrid plants produced by interspecific cell fusion of plants of the genus Spinacia, and grafted hybrid plants obtained by interspecific grafting of plants of the genus Spinacia. Further, the expression interspecific hybrid plant of Spinacia tetrandra and a spinach plant other than Spinacia tetrandra includes not only the interspecific hybrid plants mentioned above, but also the progeny of those interspecific hybrid plants.
[0084] In the present invention and the present description, the expression progeny of a spinach plant includes descendants obtained by intraspecific crossing of the spinach plant, as well as individuals obtained with the spinach plant as a parent and the descendants thereof, somatic cell hybrid plants obtained by cell fusion of cells of the spinach plant and cells of a plant of a different variety and the descendants thereof, and individuals obtained by grafting using the spinach plant as either the stock or the scion and the descendants thereof. The term descendants includes both individuals obtained by intraspecific crossing and individuals obtained by interspecific crossing. Further, the expression individuals obtained with the plant as a parent means individuals obtained by intraspecific crossing, interspecific crossing, cell fusion or grafting, with the plant acting as a parent.
[0085] For example, the downy mildew resistant spinach plant according to the present invention may be developed by crossing Spinacia tetrandra and a spinach plant other than Spinacia tetrandra. In an F1 individual obtained by interspecific crossing with Spinacia tetrandra as a parent, at least one allele has the RPF-SK1 gene derived from Spinacia tetrandra. Because the RPF-SK1 gene is a dominant gene, F1 individuals having a chromosome 3 derived from Spinacia tetrandra will have downy mildew resistance derived from the RPF-SK1 gene.
[0086] There are no limitations on the spinach plant used as material in developing the downy mildew resistant spinach plant according to the present invention, and any spinach plant having the RPF-SK1 gene found in the Spinacia tetrandra line RNR140003 may be used. Examples of the Spinacia tetrandra line other than RNR140003 include progeny lines that have inherited the RPF-SK1 gene from RNR140003.
[0087] There are no limitations on the parent crossed with Spinacia tetrandra in order to develop the downy mildew resistant spinach plant according to the present invention, provided the parent is a spinach plant other than Spinacia tetrandra, but a cultivated species of spinach plant that is cultivated as a crop is preferred. Spinacia tetrandra is a wild species, and in terms of use as a crop, characteristics such as the germination properties, pollen quality, leaf color and leaf shape are inferior to the cultivated species of spinach. By using a cultivated species of spinach as the parent for crossing with Spinacia tetrandra, the characteristics of the resulting downy mildew resistant spinach plant, other than the downy mildew resistance, approach more preferred characteristics for an agricultural crop. Examples of cultivated species of spinach plants include Spinacia oleracea L., and interspecific hybrid spinach plants developed using Spinacia oleracea L. as a parent.
[0088] The downy mildew resistant spinach plant according to the present invention may also be a progeny of an F1 individual obtained by interspecific crossing of Spinacia tetrandra and a spinach plant other than Spinacia tetrandra. For example, an F1 seed is obtained by crossing Spinacia tetrandra and a cultivated species of spinach plant, and a plant obtained by growing the obtained F1 seed is then subjected to either self-pollination or backcrossing with an individual of a cultivated species of spinach plant to obtain seeds. Subsequently, an individual having the RPF-SK1 gene is selected from plants obtained by growing the obtained seeds. By repeating the process of subjecting the selected plant individual to self-pollination or crossing with a cultivated species of spinach plant, and then selecting an individual having the RPF-SK1 gene from the progeny obtained upon crossing, a phenotypically uniform open pollinated variety of downy mildew resistant spinach plant can be obtained. The self-pollination, crossing with a cultivated species of spinach plant, cultivation and seed production may be conducted using typical methods employed in spinach cultivation.
[0089] Selection of an individual having the RPF-SK1 gene from progeny obtained by crossing can be achieved, for example, by investigating the downy mildew resistance. Specifically, Pfs of each of the various races may be used to separately inoculate the leaves of a test plant for which downy mildew resistance is to be investigated, and observation then made as to whether or not the disease develops. If a symptom of downy mildew does not develop, that test plant may be evaluated as having resistance to the inoculated race. A plant from among the progeny obtained by crossing that exhibits resistance to at least all of the downy mildew races Pfs1 through Pfs19, and the races indicated by UA1014, Be2105B and PV2144 types may then be selected as an individual having the RPF-SK1 gene.
[0090] Selection of an individual having the RPF-SK1 gene from progeny obtained by crossing can also be achieved, for example, by using a method for investigating whether the genomic DNA includes a chromosome fragment that includes the RPF-SK1 gene. Specifically, identification can be made by using a DNA marker within the RPF-SK1 gene locus of the spinach plant.
[0091] In the present invention and the present description, a DNA marker is a marker that can detect differences in DNA sequences on chromosomes to discriminate between chromosome fragments derived from different varieties or lines. Examples of DNA markers include SNP (Single Nucleotide Polymorphism) markers, SSR (Simple Sequence Repeats) markers and RFLP (Restriction Fragment Length Polymorphism) markers.
[0092] DNA marker detection can be achieved using typical methods. For example, using DNA extracted from each plant individual as a template, a nucleotide amplification reaction may be conducted using a polymerase and a primer capable of hybridizing specifically with a specific SNP or SSR, and an electrophoresis method or the like then used to detect the presence or absence of an amplification product, thus enabling identification of each polymorphism. Alternatively, DNA extracted from each plant individual may be subjected to a restriction enzyme treatment, and an electrophoresis method or the like then used to detect the DNA fragment pattern, thus enabling identification of each polymorphism. Primers capable of hybridizing specifically with a specific SNP or SSR can be designed by typical methods using widely used primer design tools, in accordance with the nucleotide sequence of the genomic DNA of the spinach, and the nucleotide sequence of the SNP or SSR that represents the detection target, and can then be synthesized using methods well known in the technical field.
[0093] Examples of DNA markers used in the selection of individuals having the RPF-SK1 gene include SNPs of chr3_1215815, chr3_1215855, chr3_1216014, chr3_1216093, chr3_1216094, chr3_1216095, chr3_1216288, and chr3_1216291. However, chr3_1216093, chr3_1216094 and chr3_1216095 represent a sequence of three nucleotides specific to the RPF-SK1 gene, and this combination of three SNPs acts as a DNA marker that can be used in the selection of individuals having the RPF-SK1 gene. For these SNPs, the genotype of the RPF-SK1 gene and the genotype of the reference genome published in SpinachBase are shown in Table 1. In Table 1, G means guanine, C means cytosine, A means adenine, and T means thymine.
TABLE-US-00001 TABLE 1 Genotype of Genotype of SNP RPF-SK1 gene reference genome chr3_1215815 C A chr3_1215855 T C chr3_1216014 C G chr3_1216093, chr3_1216094, chr3_1216095 GGA GGC chr3_1216288 A G chr3_1216291 G T
[0094] Identification of the nucleotides of these SNPs can be made, for example, using Kompetitive Allele Specific PCR (KASP) genotyping assay (manufactured by LGC Genomics GmbH). Further, the nucleotides of these SNPs can also be identified by conducting a PCR amplification of a region including chr3_1215815 to chr3_1216291 using genomic DNA extracted from a test spinach plant as a template, and then identifying the nucleotide sequence of the obtained amplification product.
[0095] For example, among downy mildew resistant spinach plants according to the present invention, spinach plants having a fragment that includes the RPF-SK1 gene locus of the Spinacia tetrandra line RNR140003 either homozygously or heterozygously have at least one allele in which the SNP identified by chr3_1215815 is cytosine, the SNP identified by chr3_1215855 is thymine, the SNP identified by chr3_1216014 is cytosine, the three consecutive SNPs identified by chr3_1216093 to chr3_1216095 are guanine-guanine-adenine, the SNP identified by chr3_1216288 is adenine, and the SNP identified by chr3_1216291 is guanine.
[0096] The downy mildew resistant spinach plant according to the present invention preferably has characteristics other than the downy mildew resistance, and particularly characteristics as a crop, that are either the same as, or similar to, cultivated species of spinach. Examples of these characteristics as a crop include taste, leaf shape, yield, and ease of cultivation and the like. The expression characteristics as a cultivated species means that the characteristics as a crop are characteristics that are suited to use of the plant as an agricultural crop.
[0097] The downy mildew resistant spinach plant according to the present invention preferably also has at least one type of downy mildew resistance gene besides the RPF-SK1 gene. The RPF-SK1 gene can alone impart resistance to a broader range of races than any known resistance gene, but also incorporating another downy mildew resistance gene can be expected to contribute to suppressing the appearance of new races that may break through this resistance. Although there are no limitations on the downy mildew resistance gene besides the RPF-SK1 gene, in the case of heterozygotes, examples include the RPF1 gene to RPF15 gene, the R6 gene, and the R15 gene and the like.
[0098] The downy mildew resistant spinach plant according to the present invention may be either the entirety or a portion of the plant body. In other words, the downy mildew resistant spinach plant according to the present invention includes the entire plant body of the spinach plant having the RPF-SK1 gene, the above ground portion of the spinach plant, and the tissues of the spinach plant. Further, the downy mildew resistant spinach plant according to the present invention also includes cells obtained from any tissue of the spinach plant having the RPF-SK1 gene. Examples of this tissue include the embryo, meristem cells, callus, pollen, leaves, anthers, stem, petioles, roots, root apices, fruit, seeds, flowers, cotyledons, and hypocotyl and the like.
[0099] Further, cells harvested from the tissues of the downy mildew resistant spinach plant according to the present invention are also useful. These cells have the genomic DNA of the spinach plant and are plant cells having the RPF-SK1 gene. The spinach plant cell having the RPF-SK1 gene may be either a single cell, or a cell cluster composed of a plurality of cells. The spinach plant cells having the RPF-SK1 gene may be harvested from any of the tissues of the spinach plant, or may be a cell mixture containing a mixture of cells harvested from different tissues. Examples of these tissues include the same tissues as those described above. Among these possibilities, single cells derived from the tissue of leaf blades or petioles are preferred.
[0100] The downy mildew resistance of the downy mildew resistant spinach plant according to the present invention exhibits dominant expression. As a result, by conducting interspecific crossing or intraspecific crossing using the downy mildew resistant spinach plant according to the present invention as a parent, novel lines of spinach plants having downy mildew resistance derived from the RPF-SK1 gene can be developed.
<Method for Screening Downy Mildew Resistant Spinach Plants>
[0101] A method for screening downy mildew resistant spinach plants according to the present invention includes investigating whether a test spinach plant has the RPF-SK1 gene, and then selecting the test spinach plant as a downy mildew resistant spinach plant in those cases where the test plant is determined as having the RPF-SK1 gene. In the method for screening downy mildew resistant spinach plants according to the present invention, the determination as to whether the test spinach plant has the RPF-SK1 gene can be made on the basis of the genotype of a DNA marker for the RPF-SK1 gene locus or a region within the vicinity thereof, or the genotype of a DNA marker strongly linked with these DNA markers. In those cases where, in at least one allele, the genotype of a DNA marker for the RPF-SK1 gene locus or a region within the vicinity thereof or a DNA marker strongly linked with these DNA markers has the same genotype as that of a Spinacia tetrandra such as RNR140003 which has an RPF-SK1 gene and exhibits downy mildew resistance, the test spinach plant may be selected as a downy mildew resistant spinach plant.
[0102] Examples of DNA markers that can be used for determining the presence or absence of the RPF-SK1 gene include the SNPs shown in Table 1. Among these, at least one SNP from the spinach plant selected from the group consisting of the SNP identified by chr3_1215815, the SNP identified by chr3_1215855, the SNP identified by chr3_1216014, the SNP identified by chr3_1216093, the SNP identified by chr3_1216094, the SNP identified by chr3_1216095, the SNP identified by chr3_1216288, the SNP identified by chr3_1216291, and SNPs genetically strongly linked to these SNPs is ideal as the DNA marker for determining the presence or absence of the RPF-SK1 gene. For example, in those cases where, in at least one allele, (a) the SNP identified by chr3_1215815 is cytosine, (b) the SNP identified by chr3_1215855 is thymine, (c) the SNP identified by chr3_1216014 is cytosine, (d) the SNP identified by chr3_1216093 is guanine, the SNP identified by chr3_1216094 is guanine, and the SNP identified by chr3_1216095 is adenine, (e) the SNP identified by chr3_1216288 is adenine, or (f) the SNP identified by chr3_1216291 is guanine, the test spinach plant may be selected as a downy mildew resistant spinach plant.
[0103] By preparing a kit form of a primer set for identifying the genotype of a DNA marker used for determining the presence or absence of the RPF-SK1 gene, and then using that kit, the determination of the presence or absence of the RPF-SK1 gene, and subsequent selection of downy mildew resistant spinach plants can be performed more easily. For example, a forward primer and reverse primer for conducting PCR amplification of a region including chr3_1215815 to chr3_1216291 from within the genomic DNA of the spinach plant may be included in a kit for selecting spinach plants having the RPF-SK1 gene. Further, a kit combining a primer set for identifying the genotype of the SNP identified by chr3_1215815, a primer set for identifying the genotype of the SNP identified by chr3_1215855, a primer set for identifying the genotype of the SNP identified by chr3_1216014, a primer set for identifying the genotypes of the three consecutive SNPs identified by chr3_1216093, chr3_1216094 and chr3_1216095, a primer set for identifying the genotype of the SNP identified by chr3_1216288, or a primer set for identifying the genotype of the SNP identified by chr3_1216291 is useful for identifying the genotypes of these SNPs to enable determination of the presence or absence of the RPF-SK1 gene in a test spinach plant.
<Method for Predicting Downy Mildew Resistance of Spinach Plants>
[0104] A method for predicting the downy mildew resistance of a spinach plant according to the present invention includes investigating whether a test spinach plant has the RPF-SK1 gene, and in those cases where the test plant is determined as having the RPF-SK1 gene, predicting that the test spinach plant will have a high probability of exhibiting downy mildew resistance. In the method for predicting the downy mildew resistance of a spinach plant according to the present invention, the determination as to whether the test spinach plant has the RPF-SK1 gene can be made on the basis of the genotype of a DNA marker for the RPF-SK1 gene locus or a region within the vicinity thereof, or the genotype of a DNA marker strongly linked with these DNA markers. In those cases where, in at least one allele, the genotype of a DNA marker for the RPF-SK1 gene locus or a region within the vicinity thereof or a DNA marker strongly linked with these DNA markers has the same genotype as that of a Spinacia tetrandra such as RNR140003 which has an RPF-SK1 gene and exhibits downy mildew resistance, the test spinach plant may be determined as having the RPF-SK1 gene, whereas in those cases where the genotype differs from that of a Spinacia tetrandra such as RNR140003 which has an RPF-SK1 gene and exhibits downy mildew resistance, the test spinach plant may be determined as lacking the RPF-SK1 gene.
[0105] Examples of DNA markers that can be used for determining the presence or absence of the RPF-SK1 gene include the SNPs shown in Table 1. For example, in those cases where, in at least one allele, (a) the SNP identified by chr3_1215815 is cytosine, (b) the SNP identified by chr3_1215855 is thymine, (c) the SNP identified by chr3_1216014 is cytosine, (d) the SNP identified by chr3_1216093 is guanine, the SNP identified by chr3_1216094 is guanine, and the SNP identified by chr3_1216095 is adenine, (e) the SNP identified by chr3_1216288 is adenine, or (f) the SNP identified by chr3_1216291 is guanine, the test spinach plant may be predicted as having the RPF-SK1 gene and having a high probability of exhibiting downy mildew resistance. Primer sets and kits for identifying the genotypes of DNA markers used in determining the presence or absence of the RPF-SK1 gene may employ the same primer sets and kits as those described above.
<Method for Producing Downy Mildew Resistant Spinach Plant>
[0106] By conducting cross-pollination using a spinach plant having the RPF-SK1 gene as a material, downy mildew resistance derived from the RPF-SK1 gene can be introduced into a spinach plant not having the RPF-SK1 gene, thus producing a novel downy mildew resistant spinach plant. The RPF-SK1 gene, which is a single dominant resistance gene, can be easily introduced into an arbitrary line, meaning the breeding of spinach varieties can be accelerated. For example, by using a spinach plant having a homozygous RPF-SK1 gene as a parent, varieties having resistance to a broader range of races can be more easily developed. Furthermore, the RPF-SK1 gene can be combined with another single dominant resistant allele in a different gene locus from the RPF-SK1 gene locus in the same haplotype.
[0107] The method for producing a downy mildew resistant spinach plant according to the present invention is a method that utilizes cross breeding using a spinach plant having the RPF-SK1 gene as a parent. Specifically, the method has a first crossing step of crossing a spinach plant having the RPF-SK1 gene and an arbitrary spinach plant, a second crossing step of obtaining a segregating population by subjecting an F1 individual obtained in the first crossing step to self-pollination, backcrossing, or interspecific crossing or intraspecific crossing with a spinach plant different from the parent used in the first crossing step, and a selection step of selecting a spinach plant having the RPF-SK1 gene from the segregating population. The self-pollination, backcrossing, interspecific crossing, intraspecific crossing, spinach plant cultivation and seed production may be conducted using typical methods employed in spinach cultivation.
[0108] Spinacia tetrandra may be used as the spinach plant having the RPF-SK1 gene used as a parent in the first crossing step, and the downy mildew resistant spinach plant of the present invention described above may also be used. In the present invention, the spinach plant having the RPF-SK1 gene used as a parent is preferably a downy mildew resistant spinach plant that has the RPF-SK1 gene, and also combines the characteristics of a cultivated species.
[0109] There are no limitations on the arbitrary spinach plant used as a parent in the first crossing step, or the arbitrary spinach plant used as a parent for the interspecific crossing or intraspecific crossing in the second crossing step, and any appropriate type of spinach plant lacking the RPF-SK1 gene may be used. In the present invention, the use of a cultivated species of spinach plant as this parent is preferred. For example, by using a downy mildew resistant spinach plant having the RPF-SK1 gene while also combining the characteristics of a cultivated species, and a cultivated species of spinach plant lacking the RPF-SK1 gene as parents, conducting crossing of these two parents, and then subjecting an obtained F1 individual to self-pollination, backcrossing, or interspecific crossing or intraspecific crossing with a cultivated species of spinach plant different from the parent used in the first crossing step, a novel spinach line having downy mildew resistance derived from the RPF-SK1 gene as well as the favorable characteristics of a cultivated species can be developed comparatively easily.
[0110] The arbitrary spinach plant used as a parent in the first crossing step, and the arbitrary spinach plant used as a parent for the interspecific crossing or intraspecific crossing in the second crossing step are preferably spinach plants having at least one type of downy mildew resistance gene other than the RPF-SK1 gene, and are more preferably cultivated species of spinach plants having at least one type of downy mildew resistance gene other than the RPF-SK1 gene. By using a spinach plant having at least one type of downy mildew resistance gene other than the RPF-SK1 gene as a parent, a novel spinach line including both the RPF-SK1 gene and another downy mildew resistance gene can be developed comparatively easily.
[0111] In the selection step, the selection of a spinach plant having the RPF-SK1 gene from the segregating population may be conducted, for example, by inoculating the leaves of a test plant separately with Pfs of each of the various races, and investigating the downy mildew resistance. A plant individual from within the segregating population that exhibits resistance to at least all of the downy mildew races Pfs1 to Pfs19, and the races indicated by the UA1014, Be2105B and PV2144 types is then selected as an individual having the RPF-SK1 gene.
[0112] Selection of an individual having the RPF-SK1 gene in the selection step may be conducted using a DNA marker for the RPF-SK1 gene locus of the spinach plant or a region in the vicinity thereof. The DNA marker and the specific method used may be the same as those described above in relation to the screening method according to the present invention.
[0113] In those cases where a plant individual including both the RPF-SK1 gene and another downy mildew resistance gene is to be selected, a DNA marker capable of identifying the presence or absence of the other downy mildew resistance gene is used together with the DNA marker described above for selection of an individual having the RPF-SK1 gene. Examples of DNA markers that may be used for identifying the presence or absence of the other downy mildew resistance gene include SNPs that exist in the gene locus of the other downy mildew resistance gene or in the vicinity thereof.
[0114] Subsequently, by repeating self-pollination of seeds collected from a selected progeny individual, a downy mildew resistant spinach plant can be obtained which exhibits more stable characteristics, and a more stable germination rate, yield, and seed productivity and the like that enable cultivation as a crop. There are no limitations on the number of repetitions of the self-pollination process provided the number is one or more, but the number of repetitions may be 2 or 3, or greater than 3.
EXAMPLES
[0115] Next, the present invention is described in further detail using a series of examples, but the present invention is not limited to the following examples.
<Race Inoculation Test for Investigating Downy Mildew Resistance>
[0116] Pfs inoculation tests on spinach plants were conducted using the method described below.
[0117] Spinach seeds were sowed in a tray filled with a culture soil Super Mix A (manufactured by Sakata Seed Corporation), and then covered with another culture soil Metro-Mix 350 (manufactured by Hyponex Japan Co., Ltd.). During sowing, seeds of a line that exhibits susceptibility to the inoculated race were also sown in each tray to provide a diseased control group. The tray was placed in a glasshouse for two weeks to raise the seedlings, and at the two-leaf stage, the seedlings were inoculated by spraying with a Pfs spore suspension (510.sup.4/mL). Following inoculation, the tray was immediately covered with a plastic cover, and monitored under conditions including a temperature of 15 C., humidity of 100% and 12-hour long days.
[0118] Seven to ten days after inoculation, once disease had been obviously confirmed in the control group, each individual was evaluated for resistance or susceptibility. Plants for which mycelia and spores had appeared on the cotyledons or true leaves, confirming disease, were evaluated as being susceptible to disease, whereas plants for which no disease could be confirmed on either the cotyledons or the true leaves were deemed resistant.
[0119] Each race of downy mildew was acquired from within Japan, from The University of Arkansas (Dr. Jim Correll) or from Naktuinbouw. Further, differentiation of each downy mildew race was conducted using known spinach varieties that exhibit different resistance patterns to the various races as differential sets. These differential sets used in differentiating resistance to each downy mildew race can be acquired from USDA (United States Department of Agriculture) and Naktuinbouw (Non-Patent Document 4).
[0120] The resistance characteristics reported for each of the various differential sets are shown in Table 2 and Table 3. In the tables, means resistance, () means medium resistance, + means disease susceptibility, and (+) means that disease symptoms and spore formation were observed only on the cotyledons, with no symptoms observed on the true leaves. Further * that the resistance results differed for each test.
TABLE-US-00002 TABLE 2 NIL NIL NIL NIL NIL Differential Viroflay 5 3 4 6 1 Race - 1 + Pfs: 2 + + + 3 + + 4 + + + 5 + + + 6 + + + + + 7 + + + + 8 + + + + + 9 + + + + 10 + + + + + + 11 + + + 12 + + + + + 13 + + + + () 14 + + + + + 15 + + + 16 + + + 17 + + + + + + 18 + + + + 19 + + + + + UA1014 + + + + + + type
TABLE-US-00003 TABLE 3 Differential NIL 2 Whale Pigeon Calandonia Meerkat Hydrus Race - 1 Pfs: 2 3 4 () 5 6 () 7 () 8 9 10 ()/+ * 11 + 12 + 13 + + 14 + + 15 ()/+ * + 16 + + + 17 + + + + () 18 + + + + + 19 + + + + + UA1014 + + (+) (+) (+) /(+) * type
Example 1
[0121] Using a wild species of the Spinacia tetrandra line RNR140003 acquired from CGN of Holland in 2015 and 2016 as a parent, a novel downy mildew resistant line was developed.
[0122] First, the Spinacia tetrandra line RNR140003 was sown, and the germinated individuals were inoculated with Pfs10. The results revealed that all individuals exhibited resistance.
[0123] Subsequently, these Spinacia tetrandra line RNR140003 individuals were crossed with the advanced parent line SDF of Spinacia oleracea L., and F1 seeds were obtained. An advanced parent line means a parent that is desirable as a parent for developing a line that exhibits favorable characteristics as a cultivated species.
[0124] Next, 18 of the obtained F1 seeds were sown, and the germinated individuals were inoculated with Pfs10. The results revealed that all individuals exhibited resistance, Backcrossing was then conducted using these individuals for which resistance had been confirmed as the seed parent and SDF as the pollen parent, and F1BC1 seeds were obtained. When the obtained F1BC1 seeds were sown, and the raised individuals were inoculated with Pfs10, to which SDF exhibits no resistance, resistant individuals (R) and susceptible individuals (individuals which do not exhibit resistance) (S) were obtained in a ratio of R:S=7:4.
[0125] Backcrossing was conducted using those individuals among the F1BC1 individuals for which resistance had been confirmed as the seed parent and SDF as the pollen parent, and F1BC2 seeds were obtained. When the obtained F1BC2 seeds were sown, and the raised individuals were inoculated with Pfs10, the R:S ratio was 15:28.
[0126] Another backcrossing was then conducted using those individuals among the F1BC2 individuals for which resistance had been confirmed as the seed parent and SDF as the pollen parent, and F1BC3 seeds were obtained. When the obtained F1BC3 seeds were sown, and the raised individuals were inoculated with Pfs10, the R:S ratio was 28:38.
[0127] Those F1BC3 individuals for which resistance had been confirmed were subjected to self-pollination, and F1BC3S1 seeds were obtained. When the obtained F1BC3S1 seeds were sown, and the raised individuals were inoculated with Pfs10, the R:S ratio was 18:2.
[0128] Those individuals among the F1BC3S1 individuals for which resistance had been confirmed were subjected to self-pollination, and F1BC3S2 seeds were obtained. When the obtained F1BC3S2 seeds were sown, and the raised individuals were inoculated with Pfs10, the R:S ratio was 26:0, indicating that they were fixed in a resistant genotype. All of the individuals for which resistance to Pfs10 had been confirmed were inoculated with Pfs12, and the R:S ratio was 23:0, indicating that they were fixed in a resistant genotype. In other words, the F1BC3S2 individuals all exhibited resistance to both Pfs10 and Pfs12. This line was named SDF (RNR) and seed multiplication of this line was conducted.
[0129] In each step, selection was conducted not only based on disease resistance, but also with due consideration of other factors such as the leaf color, leaf shape and leaf size, and as far as possible, those individuals having characteristics close to cultivated varieties were selected.
[0130] For the SDF (RNR) line, the applicants deposited seeds of this line in the National Institute of Technology and Evaluation (NITE) International Patent Organism Depositary (Room 120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan). The identification code appended to the SDF (RNR) line by the depositor is SSC-SPI-21-001, and the accession number is FERM BP-22426 (accession date: 13 Aug. 2021).
Example 2
[0131] Cross-pollination was conducted using the Viroflay spinach variety, which lacks resistance to any race as the seed parent, and the SDF (RNR) line developed in Example 1 as the pollen parent. The thus obtained F1 individuals were subjected to inoculation tests using Pfs1, Pfs2, Pfs3, Pfs4, Pfs5, Pfs6, Pfs7, Pfs8, Pfs10, Pfs11, Pfs12, Pfs13, Pfs14, Pfs15, Pfs16, Pfs17, Pfs18, Pfs19 and the races indicated by the UA1014, Be2105B and PV2144 types, and the resistance to these races was investigated. Spinach is a dioecious species, but lines also exist which are monoecious, in which both pistillate and staminate flowers develop within the same individual. In the production of F1 seeds using Viroflay as the seed parent, seeds resulting from Viroflay self-pollination are sometimes also included in the harvest.
[0132] The genotype of the RPF-SK1 gene of each individual was determined by using genomic DNA extracted from each individual as a template, conducting PCR using the forward primer and reverse primer shown in Table 4 under conditions including one cycle at 94 C. for 60 seconds, followed by 35 cycles including 30 seconds at 94 C., 30 seconds at 62 C. and 60 seconds at 72 C., and then one cycle at 72 C. for 60 seconds, and then confirming the nucleotide sequence of the obtained PCR product using a sequencer.
TABLE-US-00004 TABLE4 Primer Nucleotidesequence SEQIDNO Forwardprimer GGGTTATCTCAAATCACTGCCC 1 Reverseprimer TGAAGGTTGGCTGOGTTCA 2
[0133] The results are shown in Table 5. In Table 5, nt means that no test was conducted, and no data is available. In the table cell for each race in the column for the Viroflay line, indicates resistance and + indicates disease susceptibility. Of the RPF genotypes shown in Table 5, RPF-SK1 means a resistant genotype derived from Spinacia tetrandra, and rpf-0 means a susceptible genotype derived from Viroflay. Accordingly, RPF-SK1/RPF-SK1 means a resistant homozygote, rpf-0/rpf-0 means a susceptible homozygote, and RPF-SK1/rpf-0 means a resistant and susceptible heterozygote.
TABLE-US-00005 TABLE 5 Viroflay SDF (RNR) Line SDF (RNR) F1 RPF genotype RPF-SK1/RPF-SK1 RPF-SK1/rpf-0 Number of Resistant Susceptible Resistant Susceptible Viroflay individuals individuals individuals individuals individuals rpf-0/rpf-0 Race - 1 40 0 30 7 + Pfs: 2 32 0 39 0 + 3 28 0 29 0 + 4 29 0 30 0 + 5 18 0 20 0 + 6 36 0 15 0 + 7 28 0 29 0 + 8 30 0 29 0 + 9 29 0 30 0 + 10 29 0 30 0 + 11 29 0 30 0 + 12 29 0 25 0 + 13 30 0 28 0 + 14 30 0 30 0 + 15 36 0 28 0 + 16 36 0 35 0 + 17 40 0 20 0 + 18 16 0 19 0 + 19 34 0 42 0 + UA1014 24 0 27 + type Be2105B 38 0 37 0 + type PV2144 35 0 37 0 + type
[0134] As illustrated in Table 5, the F1 individuals obtained by crossing Viroflay and the SDF (RNR) line exhibited resistance to all races. In the case of Pfs1, 7 individuals were identified as susceptible, but all of these individuals exhibited only slight disease on the cotyledons (a very low percentage within the rating from 5 to 50%), indicating a resistance reaction. Based on these results, it was clear that the RPF-SK1 gene was capable of imparting dominant resistance to at least Pfs1 to Pfs19 and the races indicated by the UA1014, Be2105B and PV2144 types.
Example 3
[0135] Cross-pollination was conducted using Viroflay as the seed parent, and the SDF (RNR) line developed in Example 1 as the pollen parent, and the thus obtained F1 seeds were self-pollinated to produce an F2 segregating population. This F2 population was subjected to inoculation tests using Pfs3, Pfs4, Pfs8, Pfs15 and the race indicated by UA1014 type, and the resistance to these races was investigated. The results are shown in Table 6. The genotypes and the like shown in the table have the same meaning as those in Table 5.
TABLE-US-00006 TABLE 6 Viroflay SDF (RNR) F2 Segregation RPF-SK1/RPF-SK1 Line RPF-SK1/rpf-0 RPF genotype rpf-0/rpf-0 Number of Resistant Susceptible Assumed mode .sup.2 test Viroflay individuals individuals individuals of inheritance (p > 0.05) rpf-0/rpf-0 Race - 3 31 13 Single dominant 0.486 + Pfs: gene 4 79 26 Single dominant 0.955 + gene 8 37 8 Single dominant 0.263 + gene 15 33 10 Single dominant 0.792 + gene UA1014 139 44 Single dominant 0.765 + type gene
[0136] As illustrated in Table 6, the downy mildew resistance of the SDF (RNR) line to Pfs3, Pfs4, Pfs8, Pfs15 and UA1014 type segregated into a ratio of resistant individuals; susceptible individuals of close to 3:1. Accordingly, the RPF-SK1 gene was assumed to be a single dominant gene. This assumption was also supported by the results of the 2 tests (p>0.05).
Example 4
[0137] Genetic analysis and gene marker development were carried out in order to specify the chromosome location region of the RPF-SK1 gene.
[0138] First, the Viroflay line and the SDF (RNR) line developed in Example 1 were crossed, and the thus obtained F1 were self-pollinated to produce an F2 segregating population.
[0139] From this F2 segregating population, 96 individuals were subjected to inoculation tests using the race indicated by UA1014 type to investigate resistance to this race. The results revealed 76 resistant individuals and 20 susceptible individuals.
[0140] Genetic analysis of these individuals was then conducted, and a search was conducted for the region within the genome responsible for resistant homozygosis or heterozygosis in the resistant individuals, or the region within the genome responsible for susceptible homozygosis in the susceptible individuals.
[0141] Individuals that had undergone investigation of their traits were used as a linkage analysis population, and genomic DNA was extracted from each individual. Genotyping was conducted using the DNA from the linkage analysis population and SNP markers designed for the SpinachBase reference genome. The genotyping was conducted using KASP genotyping assays.
[0142] Sequence analysis of the RPF-SK1 gene confirmed that the region from chr3_1215795 to chr3_1216602 differed from the SpinachBase reference genome (Spinach genome sequence (v1)) and from the nucleotide sequences of the various WOLF genes disclosed in Patent Document 9. Alignment maps of the nucleotide sequences from chr3_1215795 to chr3_1216602 within chromosome 3 are illustrated in
TABLE-US-00007 TABLE 7 Number in FIG. 1 Gene name SEQ ID NO 1 RPF-SK1 3-5 2 CC-NBS-LRR_beta-WOLF0 genome 6-8 3 CC-NBS-LRR_beta-WOLF3 genome 9-11 4 CC-NBS-LRR_beta-WOLF5.1 genome 12-14 5 CC-NBS-LRR_beta-WOLF5.2 genome 15-17 6 CC-NBS-LRR_beta-WOLF6b genome 18-20 7 CC-NBS-LRR_beta-WOLF9 genome 21-23 8 CC-NBS-LRR_beta-WOLF11 genome 24-26 9 Spinach genome sequence (v1) 27-29 10 CC-NBS-LRR_alpha-WOLF7 genome 30-32 11 CC-NBS-LRR_alpha-WOLF2 genome 33-35 12 CC-NBS-LRR_alpha-WOLF2a genome 36-38 13 CC-NBS-LRR_alpha-WOLF6b genome 39-41 14 CC-NBS-LRR_alpha-WOLF4 genome 42-44 15 CC-NBS-LRR_alpha-WOLF4a genome 45-47 16 CC-NBS-LRR_alpha-WOLF6 genome. 48-50 17 CC-NBS-LRR_alpha-WOLF6c genome 51-53 18 CC-NBS-LRR_alpha-WOLF8 genome 54-56 19 CC-NBS-LRR_alpha-WOLF9 genome 57-59 20 CC-NBS-LRR_alpha-WOLF10 genome: 60-62 21 CC-NBS-LRR_alpha-WOLF11 genome 63-65 22 CC-NBS-LRR_alpha-WOLF12 genome 66-68 23 CC-NBS-LRR_alpha-WOLF15 genome 69-71 24 CC-NBS-LRR_alpha-WOLF16 genome 72-74 25 CC-NBS-LRR_alpha-WOLF18 genome 75-77
[0143] These results revealed that in the homozygous RPF-SK1 gene of the SDF (RNR) line, the SNP identified by chr3_1215815 was cytosine, the SNP identified by chr3_1215855 was thymine, the SNP identified by chr3_1216014 was cytosine, the SNP identified by chr3_1216093 was guanine, the SNP identified by chr3_1216094 was guanine, the SNP identified by chr3_1216095 was adenine, the SNP identified by chr3_1216288 was adenine, and the SNP identified by chr3_1216291 was guanine. At these SNPs, the genotypes for the RPF-SK1 gene differed from the reference genome and from known WOLF (RPF) genes, confirming that the RPF-SK1 gene was a novel downy mildew resistance gene.
ACCESSION NUMBERS
[0144] FERM BP-22426
SEQUENCE LISTING
[0145] PC35220_WA_sequences.xml