CULTURE MEDIUM FOR INDUCING INCREASE IN PLASMID COPY NUMBER AND USE THEREOF
20230159940 · 2023-05-25
Assignee
Inventors
- Fanglong ZHAO (Zhenjiang, CN)
- Yanqiu MA (Zhenjiang, CN)
- Man WANG (Zhenjiang, CN)
- Fan LIU (Zhenjiang, CN)
- Cheng-hsien WU (Zhenjiang, CN)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a culture medium for inducing an increase in a plasmid copy number and use thereof. The culture medium for inducing an increase in a plasmid copy number of the present invention has a plasmid extraction concentration increased by from 45 to 95% compared with a conventional method for inducing a plasmid copy number, and has a plasmid extraction concentration increased by from 110 to 440% compared with an induction method using a culture medium without glucose and arabinose. The culture medium plays an important role in inducing an increase in a plasmid copy number and achieving high-throughput production.
Claims
1. A culture medium for inducing an increase in a plasmid copy number, comprising tryptone, a yeast extract, glucose, sodium chloride, and arabinose.
2. The culture medium for inducing an increase in a plasmid copy number according to claim 1, wherein the glucose has a concentration of from 0.1 to 10 g/L, preferably from 1 to 5 g/L, and more preferably from 0.5 to 2 g/L.
3. The culture medium for inducing an increase in a plasmid copy number according to claim 1, wherein the arabinose has a concentration of from 0.1 to 10 g/L, preferably from 1 to 5 g/L, and more preferably from 0.3 to 0.75 g/L.
4. The culture medium for inducing an increase in a plasmid copy number according to claim 1, wherein the tryptone has a concentration of from 1 to 15 g/L, and preferably from 5 to 10 g/L.
5. The culture medium for inducing an increase in a plasmid copy number according to claim 1, wherein the yeast extract has a concentration of from 1 to 15 g/L, and preferably from 5 to 10 g/L.
6. The culture medium for inducing an increase in a plasmid copy number according to claim 1, wherein the sodium chloride has a concentration of from 1 to 15 g/L, and preferably from 5 to 10 g/L.
7. The culture medium for inducing an increase in a plasmid copy number according to any one of claims 1 to 6, further comprising one or more of magnesium chloride, potassium chloride, ferric chloride, or calcium chloride.
8. The culture medium for inducing an increase in a plasmid copy number according to any one of claims 1 to 7, wherein the plasmid is a plasmid comprising a replication origin oriV.
9. The culture medium for inducing an increase in a plasmid copy number according to claim 8, wherein the plasmid is a single-copy plasmid comprising a replication origin oriV, preferably a pCCIBAC plasmid.
10. A method for inducing an increase in a plasmid copy number, comprising the following steps: Step (1): transforming Escherichia coli with a plasmid; and Step (2): inoculating the Escherichia coli obtained in Step (1) into the culture medium according to any one of claims 1 to 9 for culturing under conditions suitable for culture.
11. The method for inducing an increase in a plasmid copy number according to claim 10, wherein in Step (1), the plasmid is transformed into competent Escherichia coli.
12. The method for inducing an increase in a plasmid copy number according to claim 10, wherein in Step (1), the Escherichia coli is EPI300 or EPI400 Escherichia coli.
13. The method for inducing an increase in a plasmid copy number according to claim 10, wherein in Step (2), a culture temperature is from 25 to 37° C., and a culture time is from 4 to 6 h.
14. Use of the culture medium according to any one of claims 1 to 9 in inducing an increase in a plasmid copy number.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
DETAILED DESCRIPTION
[0050] The present invention is further described below with reference to the specific implementations.
[0051] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.
[0052] Unless otherwise specified, the materials and reagents used in the following examples can be commercially available.
Example 1
[0053] The pCCIBAC plasmid (shown as SEQ ID NO: 1) included a replication origin oriV. The pCCIBAC plasmid was transformed into competent EPI300 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of sodium chloride, 2 g/L of glucose, and 0.75 g/L of arabinose. The bacteria were cultured at 220 r/min and 25° C. for 5 h. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Example 2
[0054] The pCCIBAC plasmid included a replication origin oriV. The plasmid was transformed into competent EPI400 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 5 g/L of tryptone, 10 g/L of yeast extract, 5 g/L of sodium chloride, 1 g/L of glucose, and 0.6 g/L of arabinose. The bacteria were cultured at 220 r/min and 30° C. for 5 h. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Example 3
[0055] The pCCIBAC plasmid included a replication origin oriV. The pCCIBAC plasmid was transformed into competent EPI300 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 10 g/L of yeast extract, 10 g/L of sodium chloride, 0.5 g/L of glucose, and 0.3 g/L of arabinose. The bacteria were cultured at 220 r/min and 37° C. for 5 h. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Example 4
[0056] The pCCIBAC plasmid included a replication origin oriV. The plasmid was transformed into competent EPI400 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 10 g/L of yeast extract, 5 g/L of sodium chloride, 2 g/L of glucose, and 1 g/L of arabinose. The bacteria were cultured at 220 r/min and 30° C. for 5 h. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Example 5
[0057] The pCCIBAC plasmid included a replication origin oriV. The plasmid was transformed into competent EPI400 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 10 g/L of yeast extract, 5 g/L of sodium chloride, 10 g/L of glucose, and 5 g/L of arabinose. The bacteria were cultured at 220 r/min and 30° C. for 5 h. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Example 6
[0058] The pCCIBAC plasmid included a replication origin oriV. The plasmid was transformed into competent EPI400 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 10 g/L of yeast extract, 5 g/L of sodium chloride, 10 g/L of glucose, and 2 g/L of arabinose. The bacteria were cultured at 220 r/min and 30° C. for 5 h. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Comparative Example 1 (without Glucose and Arabinose)
[0059] The pCCIBAC plasmid included a replication origin oriV. The pCCIBAC plasmid was transformed into competent EPI300 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 10 g/L of yeast extract, and 10 g/L of sodium chloride. The bacteria were cultured at 220 r/min and 30° C. After the inoculation, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
Comparative Example 2 (Conventional Method for Inducing a Plasmid Copy Number)
[0060] The pCCIBAC plasmid included a replication origin oriV. The pCCIBAC plasmid was transformed into competent EPI300 Escherichia coli by chemical transformation. The transformed Escherichia coli was cultured in the LB culture medium (in which components were 10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of sodium chloride) overnight, and then was inoculated at an inoculation rate of 5% into a culture medium in which components were 10 g/L of tryptone, 10 g/L of yeast extract, and 10 g/L of sodium chloride. The bacteria were cultured at 220 r/min and 30° C. for 12 h, and then, were used as a seed solution. Re-inoculation was performed with the seed solution, and OD600 after the re-inoculation was 0.2. Then, the bacteria were cultured at 30° C. for 1 h, and arabinose was added to make the concentration be 0.2 g/L. The culture was continued for 5 h, 6 OD600 bacteria were taken every 1 h for plasmid extraction. The plasmid extraction was performed by using the standard procedure of the plasmid extraction kit AxyGEN Miniprep Kit (Lot #17718KA1). The result of the plasmid extraction was shown in
[0061] After the plasmid extraction, plasmid concentrations were measured by using Nano Drop oneC (Thermo Fisher Scientific). Results were shown in Table 1.
TABLE-US-00001 TABLE 1 Plasmid extraction concentration (ng/μL) Time 1 h 2 h 3 h 4 h 5 h Comparative 12.5 15.4 13.2 16.4 16.4 Example 1 Example 1 14.5 20.2 48.6 55.4 78.5 Example 2 14.3 15.4 46.4 74.5 88.5 Example 3 12.8 13.3 37.8 62.3 68.4 Example 4 21.2 18.3 18.4 35.6 42.2 Example 5 18.4 15.3 28.4 34.1 34.4 Example 6 13.1 17.4 25.2 33.8 41.5 Comparative 12.5 24.8 27.8 38.3 58.4 Example 2
[0062] The comparison of the plasmid extraction concentrations between Examples 1 to 6 and Comparative Example 1 was shown in Table 2. After glucose and arabinose were added into the culture medium, the concentration of the extracted plasmids increased rapidly. After culture in the culture medium for 5 h, the plasmid extraction concentrations increased by from 110 to 440%. Especially, when the concentration of glucose was from 0.5 to 2 g/L and the concentration of arabinose was from 0.3 to 0.75 g/L, after culture in the culture medium for 5 h, the plasmid extraction concentrations increased by from 317 to 440%. It indicates that the culture medium provided by the present invention is suitable for inducing an increase in a plasmid copy number and greatly improving the plasmid yield.
TABLE-US-00002 TABLE 2 Percentages of increases of plasmid extraction concentrations of Examples 1 to 6 compared with Comparative Example 1 Time 1 h 2 h 3 h 4 h 5 h Example 1 16% 31% 268% 238% 379% Example 2 14% 0% 252% 354% 440% Example 3 2% −14% 186% 280% 317% Example 4 70% 19% 39% 117% 157% Example 5 47% −1% 115% 108% 110% Example 6 5% 13% 91% 106% 153%
[0063] Compared with Comparative Example 2 (the conventional method for inducing a plasmid copy number), Examples 1 to 6 had simple operations and greatly improved plasmid extraction concentrations. As shown in Table 3, when the concentration of glucose was from 0.5 to 2 g/L and the concentration of arabinose was from 0.3 to 0.75 g/L, after extraction for 3 h, the plasmid extraction concentrations increased by from 36 to 75% compared to the conventional method, and after extraction for 4 h, the plasmid extraction concentrations increased by from 45 to 95% compared to the conventional method. Especially, when the concentration of glucose was 1 g/L and the concentration of arabinose was 0.6 g/L, after extraction for 4 h, the plasmid extraction concentrations increased by 95% compared to the conventional method.
TABLE-US-00003 TABLE 3 Percentages of increases of plasmid extraction concentrations of Examples 1 to 6 compared with Comparative Example 2 Time 1 h 2 h 3 h 4 h 5 h Example 1 16% −19% 75% 45% 34% Example 2 14% −38% 67% 95% 52% Example 3 2% −46% 36% 63% 17% Example 4 70% −26% −34% −7% −28% Example 5 47% −38% 2% −11% −41% Example 6 5% −30% −9% −12% −29%
TABLE-US-00004 SEQ ID NO: 1 pCCIBAC vector sequence gcggccgcaaggggttcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagc agattgtactgagagtgcaccatatgcggtgtgaaataccacacagatgcgtaaggagaaaataccgcatcag gcgccattcgccattcagctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagct ggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaa acgacggccagtgaattgtaatacgactcactatagggcgaattcgagctcggtacccggggatcctctagagt cgacctgcaggcatgcaagcttgagtattctatagtctcacctaaatagcttggcgtaatcatggtcatagctgttt cctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggt gcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgcc agctgcattaatgaatcggccaacgcgaaccccttgcggccgcccgggccgtcgaccaattctcatgtttgaca gcttatcatcgaatttctgccattcatccgcttattatcacttattcaggcgtagcaaccaggcgtttaagggcacca ataactgccttaaaaaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccga catggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataa tatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactc acccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaa cacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaac gtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgc catacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatt tttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaa atgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagctt ccttagctcctgaaaatctcgataactcaasaaatacgcccggtagtgatcttatttcattatggtgaaagttggaa cctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacacca ggatttatttattctgcgaagtgatcttccgtcacaggtatttattcgcgataagctcatggagcggcgtaaccgtc gcacaggaaggacagagaaagcgcggatctgggaagtgacggacagaacggtcaggacctggattgggg aggcggttgccgccgctgctgctgacggtgtgacgttctctgttccggtcacaccacatacgttccgccattcct atgcgatgcacatgctgtatgccggtataccgctgaaagttctgcaaagcctgatgggacataagtccatcagtt caacggaagtctacacgaaggtttttgcgctggatgtggctgcccggcaccgggtgcagtttgcgatgccgga gtctgatgcggttgcgatgctgaaacaattatcctgagaataaatgccttggcctttatatggaaatgtggaactga gtggatatgctgtttttgtctgttaaacagagaagctggctgttatccactgagaagcgaacgaaacagtcggga aaatctcccattatcgtagagatccgcattattaatctcaggagcctgtgtagcgtttataggaagtagtgttctgtc atgatgcctgcaagcggtaacgaaaacgatttgaatatgccttcaggaacaatagaaatcttcgtgcggtgttac gttgaagtggagcggattatgtcagcaatggacagaacaacctaatgaacacagaaccatgatgtggtctgtcc ttttacagccagtagtgctcgccgcagtcgagcgacagggcgaagccctcgagctggttgccctcgccgctgg gctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcggc cggccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacac ttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtgga gctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctg gggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgaca cttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaa tccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttat aaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttct cgaaccctcccggtcgagtgagcgaggaagcaccagggaacagcacttatatattctgcttacacacgatgcc tgaaasaacttcccttggggttatccacttatccacggggatatttttataattattttttttatagtttttagatcttcttttt tagagcgccttgtaggcctttatccatgctggttctagagaaggtgttgtgacaaattgccctttcagtgtgacaaa tcaccctcaaatgacagtcctgtctgtgacaaattgcccttaaccctgtgacaaattgccctagaagaagctgttt tttcacaaagttatccctgcttattgactcttttttatttagtgtgacaatctaaaaacttgtcacacttcacatggatctg tcatggcggaaacagcggttatcaatcacaagaaacgtaaaaatagcccgcgaatcgtccagtcaaacgacct cactgaggcggcatatagtctctcccgggatcaaaaacgtatgctgtatctgttcgttgaccagatcagaaaatct gatggcaccctacaggaacatgacggtatctgcgagatccatgttgctaaatatgctgaaatattcggattgacct ctgcggaagccagtaaggatatacggcaggcattgaagagtttcgcggggaaggaagtggttttttatcgccct gaagaggatgccggcgatgaaaaaggctatgaatcttttccttggtttatcaaacgtgcgcacagtccatccaga gggctttacagtgtacatatcaacccatatctcattcccttctttatcgggttacagaaccggtttacgcagtttcgg cttagtgaaacaaaagaaatcaccaatccgtatgccatgcgtttatacgaatccctgtgtcagtatcgtaagccgg atggctcaggcatcgtctctctgaaaatcgactggatcatagagcgttaccagctgcctcaaagttaccagcgta tgcctgacttccgccgccgcttcctgcaggtctgtgttaatgagatcaacagcagaactccaatgcgcctctcata cattgagaaaaagaaaggccgccagacgactcatatcgtattttccttccgcgatatcacttccatgacgacagg atagtctgagggttatctgtcacagatttgagggtggttcgtcacatttgttctgacctactgagggtaatttgtcac agttttgctgtttccttcagcctgcatggattttctcatactttttgaactgtaatttttaaggaagccaaatttgagggc agtttgtcacagttgatttccttctctttcccttcgtcatgtgacctgatatcgggggttagttcgtcatcattgatgag ggttgattatcacagtttattactctgaattggctatccgcgtgtgtacctctacctggagtttttcccacggtggata tttcttcttgcgctgagcgtaagagctatctgacagaacagttcttctttgcttcctcgccagttcgctcgctatgctc ggttacacggctgcggcgagcgctagtgataataagtgactgaggtatgtgctcttcttatctccttttgtagtgttg ctcttattttaaacaactttgcggttttttgatgactttgcgattttgttgttgctttgcagtaaattgcaagatttaataaa aaaacgcaaagcaatgattaaaggatgttcagaatgaaactcatggaaacacttaaccagtgcataaacgctgg tcatgaaatgacgaaggctatcgccattgcacagtttaatgatgacagcccggaagcgaggaasataacccgg cgctggagaataggtgaagcagcggatttagttggggtttcttctcaggctatcagagatgccgagaaagcagg gcgactaccgcacccggatatggaaattcgaggacgggttgagcaacgtgttggttatacaattgaacaaatta atcatatgcgtgatgtgtttggtacgcgattgcgacgtgctgaagacgtatttccaccggtgatcggggttgctgc ccataaaggtggcgtttacaaaacctcagtttctgttcatcttgctcaggatctggctctgaaggggctacgtgtttt gctcgtggaaggtaacgacccccagggaacagcctcaatgtatcacggatgggtaccagatcttcatattcatg cagaagacactctcctgcctttctatcttggggaaaaggacgatgtcacttatgcaataaagcccacttgctggcc ggggcttgacattattccttcctgtctggctctgcaccgtattgaaactgagttaatgggcaaatttgatgaaggta aactgcccaccgatccacacctgatgctccgactggccattgaaactgttgctcatgactatgatgtcatagttatt gacagcgcgcctaacctgggtatcggcacgattaatgtcgtatgtgctgctgatgtgctgattgttcccacgcctg ctgagttgtttgactacacctccgcactgcagtttttcgatatgcttcgtgatctgctcaagaacgttgatcttaaag ggttcgagcctgatgtacgtattttgcttaccaaatacagcaatagcaatggctctcagtccccgtggatggagg agcaaattcgggatgcctggggaagcatggttctaaaaaatgttgtacgtgaaacggatgaagttggtaaaggt cagatccggatgagaactgtttttgaacaggccattgatcaacgctcttcaactggtgcctggagaaatgctcttt ctatttgggaacctgtctgcaatgaaattttcgatcgtctgattaaaccacgctgggagattagataatgaagcgtg cgcctgttattccaaaacatacgctcaatactcaaccggttgaagatacttcgttatcgacaccagctgccccgat ggtggattcgttaattgcgcgcgtaggagtaatggctcgcggtaatgccattactttgcctgtatgtggtcgggat gtgaagtttactcttgaagtgctccggggtgatagtgttgagaagacctctcgggtatggtcaggtaatgaacgt gaccaggagctgcttactgaggacgcactggatgatctcatcccttcttttctactgactggtcaacagacaccg gcgttcggtcgaagagtatctggtgtcatagaaattgccgatgggagtcgccgtcgtaaagctgctgcacttacc gaaagtgattatcgtgttctggttggcgagctggatgatgagcagatggctgcattatccagattgggtaacgatt atcgcccaacaagtgcttatgaacgtggtcagcgttatgcaagccgattgcagaatgaatttgctggaaatatttc tgcgctggctgatgcggaaaatatttcacgtaagattattacccgctgtatcaacaccgccaaattgcctaaatca gttgttgctcttttttctcaccccggtgaactatctgcccggtcaggtgatgcacttcaaaaagcctttacagataaa gaggaattacttaagcagcaggcatctaaccttcatgagcagaaaaaagctggggtgatatttgaagctgaaga agttatcactcttttaacttctgtgcttaaaacgtcatctgcatcaagaactagtttaagctcacgacatcagtttgctc ctggagcgacagtattgtataagggcgataaaatggtgcttaacctggacaggtctcgtgttccaactgagtgtat agagaaaattgaggccattcttaaggaacttgaaaagccagcaccctgatgcgaccacgttttagtctacgtttat ctgtctttacttaatgtcctttgttacaggccagaaagcataactggcctgaatattctctctgggcccactgttcca cttgtatcgtcggtctgataatcagactgggaccacggtcccactcgtatcgtcggtctgattattagtctgggacc acggtcccactcgtatcgtcggtctgattattagtctcggaccacggtcccactcgtatcgtcggtctgataatca gactgggaccacggtcccactcgtatcgtcggtctgattattagtctgggaccatggtcccactcgtatcgtcggt ctgattattagtctgggaccacggtcccactcgtatcgtcggtctgattattagtctggaaccacggtcccactcgt atcgtcggtctgattattagtctgggaccacggtcccactcgtatcgtcggtctgattattagtctgggaccacgat cccactcgtgttgtcggtctgattatcggtctgggaccacggtcccacttgtattgtcgatcagactatcagcgtga gactacgattccatcaatgcctgtcaagggcaagtattgacatgtcgtcgtaacctgtagaacggagtaacctcg gtgtgcggttgtatgcctgctgtggattgctgctgtgtcctgcttatccacaacattttgcgcacggttatgtggaca aaatacctggttacccaggccgtgccggcacgttaaccgggctgcatccgatgcaagtgtgtcgctgtcgacg agctcgcgagctcggacatgaggttgccccgtattcagtgtcgctgatttgtattgtctgaagttgtttttacgttaa gttgatgcagatcaattaatacgatacctgcgtcataattgattatttgacgtggtttgatggcctccacgcacgttg tgatatgtagatgataatcattatcactttacgggtcctttccggtgatccgacaggttacggggcggcgacctcg cgggttttcgctatttatgaaaattttccggtttaaggcgtttccgttcttcttcgtcataacttaatgtttttatttaaaat accctctgaaaagaaaggaaacgacaggtgctgaaagcgagctttttggcctctgtcgtttcctttctctgtttttgt ccgtggaatgaacaatggaagtccgagctcatcgctaataacttcgtatagcatacattatacgaagttatattcg at
[0064] The culture medium for inducing an increase in a plasmid copy number and use thereof provided in the present invention are described in detail above. The principle and implementations of the present invention are described herein through specific examples. The description about the foregoing examples is merely provided to help understand the method and core ideas of the present invention. It should be noted that a person skilled in the art may further make several improvements and modifications to the present invention without departing from the principle of the present invention. These improvements and modifications also fall within the protection scope of the claims of the present invention.