METHODS FOR CIRCULARIZING LINEAR DOUBLE STRANDED NUCLEIC ACIDS

Abstract

A method, in particular an in vitro method, for the circularization of a double stranded DNA nucleic acid. Also, a circularized double stranded DNA nucleic acid obtainable by the method. Another aspect pertains to a host cell comprising a circularized double stranded DNA nucleic acid obtainable by the method. Further, therapeutic and non-therapeutic uses of a circularized double stranded DNA nucleic acid obtainable by the method. Finally, a kit for the circularization of a double stranded DNA nucleic acid.

Claims

1-15. (canceled)

16. A method for the circularization of a double stranded DNA nucleic acid, said method comprising the steps of: a) providing a linear or circular double stranded DNA nucleic acid comprising a nucleic acid of the following formula (I):
NHR1-SOR1x-HR1-TBC-HR2-SOR2y-NHR2  (I), wherein: TBC represents a core double stranded DNA nucleic acid to be circularized; HR1 and HR2 represent identical homologous double stranded DNA nucleic acids of identical orientation; SOR1x and SOR2y represent nucleic acids having a length of about 5 bp to about 60 bp comprising a site of restriction capable of generating 3′ overhangs having a length of at least 4 nucleotides and having as 3′ terminal nucleotide A, T or G; and x and y are 0 or 1; when x and y are 1, TBC further comprises 2 sites of nicking restriction on different DNA strands of the formula (I) each located about 0 nucleotide to about 100 nucleotides respectively from the 3′ end of HR1 and from the 3′ end of HR2; NHR1 and NHR2 represent distinct non-homologous double stranded DNA nucleic acids having a length of 0 bp to about 200 bp; b1) when x and y are 0, digesting the circular double stranded DNA nucleic acid comprising a nucleic acid of formula (I) from step a), in the presence of a restriction enzyme that cleaves a restriction site that is not located in any one of HR1, HR2 and TBC, so as to obtain a linearized nucleic acid; b2) when x and y are 1, optionally digesting the circular double stranded DNA nucleic acid comprising a nucleic acid of formula (I) from step a), in the presence of a restriction enzyme that cleaves a restriction site that is not located in any one of HR1, HR2 and TBC, so that to generate a linearized nucleic acid; digesting the circular, linear or linearized nucleic acid in the presence of (i) a polypeptide with nickase activity capable of introducing a nick within TBC, and (ii) restriction enzyme(s) capable of digesting the corresponding site of restriction in SOR1 and SOR2; c) recessing both ends of identical orientation of the nucleic acid obtained at step b1) or step b2), in the presence of a polypeptide having a 3′-5′ nuclease activity, so that HR1 and HR2 are capable of forming overlapping overhangs; d) annealing the DNA nucleic acid obtained at step c), thereby generating 2 gaps, 2 nicks, or 1 nick and 1 gap; e) filling the 1 or 2 gaps generated at step d), step e) being optional when 2 nicks are generated at step d); f) optionally removing the NHR1 and NHR2 at both 5′ ends, when the length of the NHR1 and NHR2 is superior to 0 bp; and g) sealing at least one nick, so as to obtain a circularized double stranded DNA nucleic acid, in which at least one strand is continuous.

17. The method according to claim 16, wherein step b) or step c) is preceded by, or concomitantly performed with, a step comprising incubating the linear double stranded DNA nucleic acid of step a) with an alkaline phosphatase and/or a polypeptide with a type I exonuclease activity.

18. The method according to claim 16, wherein step d) is performed in the presence of divalent and/or trivalent cations.

19. The method according to claim 16, wherein step e) is performed in the presence of a DNA polymerase with no strand displacement activity and with no 5′ to 3′ exonuclease activity and dNTPs and/or of oligonucleotides with 5′-phosphate having a length of about 8 nucleotides to about 100 nucleotides and being complementary to the nucleic acids of the gaps, provided the polypeptide having a 3′-5′ nuclease activity has been inactivated.

20. The method according to claim 16, wherein step f) is performed in the presence of a polypeptide having a 5′-3′ nuclease activity.

21. The method according to claim 16, wherein step f) is performed in the presence of Exonuclease VII (Exo VII), RecJ, or Flap endonuclease 1 (FEN1).

22. The method according to claim 16, wherein step g) is performed in the presence of a mesophilic DNA ligase.

23. The method according to claim 16, wherein step g) is performed in the presence of a T4 DNA ligase.

24. The method according to claim 16, wherein said method further includes a step of binding the double stranded DNA nucleic acid to one or more non-nucleic acid moiety (moieties), so as to generate a functionalized binding of the double stranded DNA nucleic acid.

25. The method according to claim 24, wherein said double stranded DNA nucleic acid is a functionalized circularized double stranded DNA nucleic acid.

26. The method according to claim 24, wherein said one or more non-nucleic acid moiety (moieties) is selected in the group comprising linkers, polypeptides, particles, surfaces, and combinations thereof.

27. A circularized double stranded DNA nucleic acid obtainable by a method according to claim 16.

28. The circularized double stranded DNA nucleic acid according to claim 27, wherein said nucleic acid is functionalized and/or relaxed.

29. A host cell comprising a circularized double stranded DNA nucleic acid obtainable by a method according to claim 16.

30. A method for implementing gene therapy, and/or DNA vaccination, and/or cell therapy, and/or genome editing, and/or production of induced pluripotent stem cells, and/or transfection or transformation of cultured cells; or for the storage of data, and/or for the sequencing of nucleic acids, and/or for the production of rolling circle DNA, and/or for the production of proteins, and/or for the production of RNA, and/or in metabolic pathway engineering, and/or in molecular biology, and/or for the transformation of bacteria, and/or for the production of viruses, said method comprising at least the following steps: a) providing a linear or circular double stranded DNA nucleic acid comprising a nucleic acid of the following formula (I):
NHR1-SOR1x-HR1-TBC-HR2-SOR2y-NHR2  (I), wherein: TBC represents a core double stranded DNA nucleic acid to be circularized; HR1 and HR2 represent identical homologous double stranded DNA nucleic acids of identical orientation; SOR1x and SOR2y represent nucleic acids having a length of about 5 bp to about 60 bp comprising a site of restriction capable of generating 3′ overhangs having a length of at least 4 nucleotides and having as 3′ terminal nucleotide A, T or G; and x and y are 0 or 1; when x and y are 1, TBC further comprises 2 sites of nicking restriction on different DNA strands of the formula (I) each located about 0 nucleotide to about 100 nucleotides respectively from the 3′ end of HR1 and from the 3′ end of HR2; NHR1 and NHR2 represent distinct non-homologous double stranded DNA nucleic acids having a length of 0 bp to about 200 bp; b1) when x and y are 0, digesting the circular double stranded DNA nucleic acid comprising a nucleic acid of formula (I) from step a), in the presence of a restriction enzyme that cleaves a restriction site that is not located in any one of HR1, HR2 and TBC, so as to obtain a linearized nucleic acid; b2) when x and y are 1, optionally digesting the circular double stranded DNA nucleic acid comprising a nucleic acid of formula (I) from step a), in the presence of a restriction enzyme that cleaves a restriction site that is not located in any one of HR1, HR2 and TBC, so that to generate a linearized nucleic acid; digesting the circular, linear or linearized nucleic acid in the presence of (i) a polypeptide with nickase activity capable of introducing a nick within TBC, and (ii) restriction enzyme(s) capable of digesting the corresponding site of restriction in SOR1 and SOR2; c) recessing both ends of identical orientation of the nucleic acid obtained at step b1) or step b2), in the presence of a polypeptide having a 3′-5′ nuclease activity, so that HR1 and HR2 are capable of forming overlapping overhangs; d) annealing the DNA nucleic acid obtained at step c), thereby generating 2 gaps, 2 nicks, or 1 nick and 1 gap; e) filling the 1 or 2 gaps generated at step d), step e) being optional when 2 nicks are generated at step d); f) optionally removing the NHR1 and NHR2 at both 5′ ends, when the length of the NHR1 and NHR2 is superior to 0 bp; and g) sealing at least one nick, so as to obtain a circularized double stranded DNA nucleic acid, in which at least one strand is continuous.

31. A kit for the circularization of a double stranded DNA nucleic acid, said kit comprising: a) a polypeptide having a 3′-5′ nuclease activity; b) a polypeptide having a 5′-3′ nuclease activity; c) a DNA polymerase; d) a mesophilic DNA ligase; and optionally, e) one or more buffer(s).

32. The kit according to claim 31, wherein said kit comprises at least two vials: the first vial comprising the polypeptide having a 3′-5′ nuclease activity; and optionally alkaline phosphatase and/or a polypeptide with a type I exonuclease activity; the second vial comprising a DNA ligase; and optionally a polypeptide having a 5′-3′ nuclease activity, and/or a DNA polymerase with no strand displacement activity and with no 5′ to 3′ exonuclease activity, ATP and dNTPs.

33. The kit according to claim 31, wherein said kit further comprises one or more primer(s) selected in the group consisting of a primer of sequence SEQ ID NO. 43 and a primer of sequence SEQ ID NO. 44.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0383] FIG. 1 is a scheme illustrating one embodiment of the invention. The starting dsDNA nucleic acid comprises TBC, HR2, NHR2. Following a PCR step, with suitable primers, an amplicon of formula NHR1-HR1-TBC-HR2-NHR2 is obtained. Said amplicon is incubated with Exo III nuclease in order to generate 5′-overhangs. An annealing step generate a circular DNA nucleic acid comprising 2 gaps and 2 non-hybridized 5′-overhangs. The 2 gaps are then filled in the presence of a DNA polymerase and the 5′-overhangs are further removed in the presence of nuclease with 5′-3′ activity (Exo 5′-3′), hereby generating a circular dsDNA comprising 2 nicks. These 2 nicks are finally sealed in the presence of a ligase. The final product is circularized dsDNA nucleic acid, in which the 2 strands are continuous.

[0384] FIG. 2 is a scheme illustrating one embodiment of the invention. The starting dsDNA nucleic acid is plasmid comprising a nucleic acid of formula NHR1-SOR1-HR1-TBC-HR2-SOR2-NHR2. The starting dsDNA nucleic acid is digested in the presence of restriction enzymes cleaving the corresponding restriction sites on SOR1 and SOR2, and in the presence of nicking restriction enzymes, that cleave the nick restriction sites on each strand of TBC. One nick restriction site is localized at distance of the 3′ end of HR1, and the other nick restriction site is localized at 0 nucleotide of the 3′ end of HR2. The resulting nucleic acid comprises 2 nicks and 2 3′-overhangs, which cannot be digested by the Exo III nuclease. Digestion by Exo III nuclease generates a dsDNA nucleic acid with 3′-overhangs, since digestion initiated at the nick restriction sites. Annealing generates a circular dsDNA nucleic acid with 1 gap and 1 nick. The gap is filled by the mean of an oligonucleotide, which results in a dsDNA nucleic acid having 3 nicks, which are sealed in the presence of a ligase.

[0385] FIG. 3 is a scheme illustrating one embodiment of the invention. The starting dsDNA nucleic acid comprises TBC, HR2, NHR2′, wherein NHR2′ represent partial NHR2. Following a PCR step, with suitable primers, an amplicon of formula NHR1-HR1-TBC-HR2-NHR2 is obtained. NHR1 further comprises a restriction site. Said amplicon is incubated with the restriction enzyme that cleaves the restriction site within NHR1, which generates a dsDNA nucleic acid of formula HR1-TBC-HR2-NHR2, in which the HR1 presents a 5′-overhang. The resulting dsDNA nucleic acid is digested in the presence of an Exo III nuclease in order to generate 5′-overhangs. An annealing step generates a circular dsDNA nucleic acid comprising 2 gaps and 1 non-hybridized 5′-overhangs, formed of NHR2. The 2 gaps are filled in the presence of a DNA polymerase, generating 2 nicks. In said embodiment, the 5′-overhangs is not removed, and a ligase seals only one of the 2 nicks, generating a circular dsDNA nucleic acid, in which only one of two strands is continuous, also named “rolling circle DNA”. The NHR2 5′-overhang may be useful as an index, e.g., when the rolling circle DNA is intended to be employed for data storage.

[0386] FIG. 4 is a photograph showing the efficacy of intramolecular annealing of dsDNA with respect to the annealing temperature. Lane L: ladder (the 1.5 kbp, 5.0 kbp and 20.5 kbp nucleic acids are represented on the left side); lane 1: 80° C.; lane 2: 75° C.; lane 3: 70° C.; lane 4: 65° C.; lane 5: 60° C.; lane 6: 55° C.; lane 7: 50° C. Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dsDNA; b: trimers; c: dimers; d: linear DNA (3.8 kbp).

[0387] FIG. 5 is a photograph showing that the treatment of non-purified PCR product with Exo III, rSAP and Exo I improves the output of intramolecular annealing of dsDNA. Lane L: ladder; lane K: control, amplicons DNA before treatments and without purification (linear; 3.8 kbp); lane A: 12 min treatment on ice with mix of 5u Exo I+1u rSAP+25u Exo III in 50 μL of final 0.5×MgAcetate containing 5 μL of PCR product; lane B: 3 min treatment on ice with mix of 5u ExoI+1u rSAP+25u Exo III in 50 μL of final 0.5×MgAcetate containing 5 μL of PCR product; lane 1: only 5u Exo I treatment at 37° C. for 20 min and 25u Exo III on ice for 3 min or 10 min; lane 2: 1 u rSAP treatment at 37° C. during 20 min and 25u Exo III on ice during 3 min or 10 min; lane 3: simultaneous treatment with 1u rSAP and 5u Exo I at 37° C. for 20 min and 25u Exo III on ice during 3 min or 10 mM; lane 4: 25 u Exo III on ice during 3 mM or 10 mM (no rSAP and no Exo I treatments). Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dsDNA; b: dimers; c: linear DNA (3.8 kbp).

[0388] FIG. 6 is a photograph showing the stability of intramolecularly annealed dsDNA with respect to the ratio DNA/Exo III. Lane L: ladder; lane K: control, amplicons DNA before treatments; lane 1: 100 ng/10 μL; lane 2: 300 ng/10 μL; lane 3: 700 ng/10 μL; lane 4: 900 ng/10 μL. Amounts of Exo III are indicated in the upper part of the photograph (10u, 20u and 40u). Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dsDNA; b: dimers; c: linear DNA (3.8 kbp).

[0389] FIG. 7 is a photograph showing the efficiency of intramolecular annealing of dsDNA in the presence of Exo I. Lane L: ladder; lane 1: 10 u Exo III; lane 2: 40 u Exo III. Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dimeric dsDNA; b: intramolecularly annealed monomeric dsDNA; c: linear DNA (3.8 kbp).

[0390] FIG. 8 is a photograph showing the efficiency of intramolecular annealing of dsDNA with respect to the amount of T4 DNA Polymerase. Lane 1: purified amplicon 1.8 kbp 110 ng/10 μL; lane 2: purified amplicon 3.8 kbp 140 ng/10 μL; lane 3: non-purified PCR product with amplicon 3.8 kbp 2 μL in 10 μL of reaction (Exo III+Exo I+rSAP). No treatment. indicates the absence of any treatment. Temperature of treatment is indicated at the upper part of the photograph. Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dsDNA; b: dimers; c: linear DNA (3.8 kbp); d: dimers; e: dimers with filled gaps; f: linear DNA (1.8 kbp).

[0391] FIG. 9 is a photograph showing the efficiency of circularization with respect to the ratio between DNA ligase, Exo VII and T4 DNA Polymerase. The buffer contains 2 mM ATP and 2 mM dNTP. Lane A: Amplified fragment before circularization; lane B: After Exo III 100u for 5 mM at RT° of 3000 ng of DNA in 100 μL 0.5×MgAcetate buffer and anneal 88° C. for 5 min, 50° C. for 15 min; lane 1: 40 u DNA Ligase, 1u Exo VII and 5u T4 Pol; lane 2: 40 u DNA Ligase, 0.1u Exo VII and 5u T4 Pol; lane 3: 40 u DNA Ligase, 0.01u Exo VII and 5u T4 Pol; lane 4: 40 u DNA Ligase, 1u Exo VII and 0.5u T4 Pol; lane 5: 40 u DNA Ligase, 0.1u Exo VII and 0.5u T4 Pol; lane 6: 40 u DNA Ligase, 0.01u Exo VII and 0.5u T4 Pol; lanes 1-6: 300 ng of DNA in 20 μL. Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dsDNA; b: dimers; c: linear DNA (3.8 kbp).

[0392] FIG. 10 is showing the efficiency of circularization with respect to the ratio between DNA ligase, Exo VII and T4 DNA Polymerase. The buffer contains 2 mM ATP and 2 mM dNTP. Lane A: Amplified fragment before circularization; lane B: After Exo III 100u for 5 mM at RT° of 3000 ng of DNA in 100 μL 0.5×MgAcetate buffer and anneal 88° C. for 5 min, 50° C. for 15 min; lane 1: 200 u DNA Ligase, 5u Exo VII and 2.5u T4 Pol; lane 2: 100 u DNA Ligase, 2.5u Exo VII and 1.25u T4 Pol; lane 3: 50 u DNA Ligase, 1.25u Exo VII and 0.6u T4 Pol; lane 4: 25 u DNA Ligase, 0.6u Exo VII and 0.3u T4 Pol; lane 5: 12 u DNA Ligase, 0.3u Exo VII and 0.15u T4 Pol; lane 6: 6 u DNA Ligase, 0.15u Exo VII and 0.07u T4 Pol; lane 7: 3 u DNA Ligase, 0.07u Exo VII and 0.04u T4 Pol; lane 8: 1.5u DNA Ligase, 0.04u Exo VII and 0.02u T4 Pol; lanes 1-8: 300 ng of DNA in 20 μL. Arrows indicate the nature of the nucleic acid; a: intramolecularly annealed dsDNA; b: dimers; c: linear DNA (3.8 kbp).

[0393] FIG. 11 is a scheme illustrating one embodiment of the invention. 5′ phosphates ends and thiophosphate nucleotide analogues may be introduced in the HR1 and HR2 and circularization may be obtained via a two-step process.

[0394] FIG. 12 is a scheme illustrating one embodiment of the invention in the presence of thiophosphate nucleotide analogues in the linear double stranded nucleic acid to be circularized.

[0395] FIG. 13 is a scheme illustrating circularization process of FIG. 13, in which the step of recessing the ends of the linear double stranded nucleic acid to be circularized by Lambda exonuclease, ExoI et ExoIII are further detailed.

[0396] FIG. 14 is a photograph showing the efficiency of DNA molecules circularization as being depend on magnesium concentration. The DNA molecules were incubated with Exonuclease III in a buffer containing different magnesium acetate (MgAc) concentration (from 0 mM to 26 mM) for 2 mM at 30° C., 10 mM at 75° C., 5 mM at 60° C. and 1 mM 4° C., successively. Lane 1: molecular weight marker (see corresponding indication on a side in bp); lane 2: 0 mM MgAc; lane 3: 2 mM MgAc; lane 4: 6 mM MgAc; lane 5: 10 mM MgAc; lane 6: 14 mM MgAc; lane 7: 18 mM MgAc; lane 8: 22 mM MgAc; lane 9: 26 mM MgAc; lane 10: molecular weight marker is relaxed circular DNA of a plasmid 3868 bp obtained by treatment with a nickase Nt.BbvCI; lane 11: molecular weight marker (in bp). Arrows indicate the nature of the nucleic acid; a: circular 4,528 bp nucleic acid; b: concatemers of the 4,528 bp fragments; c: linear 4,528 bp fragment; d: linear 1,901 bp (from the plasmid backbone).

[0397] FIG. 15 is a photograph showing that the method according to the invention provides high yields of circularized DNA molecules at high concentration of DNA molecules. The DNA molecules were incubated with Exonuclease III in 30 mM magnesium acetate buffer for 2 mM at 30° C., 10 mM at 75° C., 5 mM at 60° C. and 1 min at 4° C., successively. 30 ng/μL of DNA molecules in 12 μL reaction volume were treated with 20u of Exonuclease III (lane 3) and 150 ng/μL DNA molecules in 50 μL were treated with 100u of Exonuclease III (lane 4). Lane 1: molecular weight markers (bp; see corresponding indication on a side); lane 2: relaxed circular DNA of a plasmid 3,868 bp obtained by treatment with a nickase Nt.BbvCI; lane 3: DNA molecules treated at 30 ng/μL concentration; lane 4: DNA molecules treated at 150 ng/μL concentration; lane 5: molecular weight marker. Arrows indicate the nature of the nucleic acid; a: circularized 4,528 bp DNA molecule; b: linear 1,901 bp fragment (from the plasmid backbone).

[0398] FIG. 16 is a set of photographs showing that the DNA molecules produced with the circularization method according to the invention promote an increased efficiency of cell transfection. FIG. 16A: Human osteosarcoma cells (HOS ATCC® CRL-1543™) transfected with circular 4,528 bp DNA molecules (black bars) display higher percentage of GFP-positive cells compared to parental 6,711 bp plasmid DNA (white bars) at all tested transfection conditions. The transfection conditions were 1,000 ng, 750 ng, 500 ng or 250 ng of DNA molecules applied for transfection per well in 24-well plate. FIG. 16B: Lung carcinoma cells of A549 cell line (ATCC® CCL185™) transfected with circular 4,528 bp DNA molecules (black bars) display higher percentage of GFP-positive cells compared to parental 6,711 bp plasmid DNA (white bars) in all tested transfection conditions.

EXAMPLES

[0399] The present invention and disclosure are further illustrated by the following examples.

Example 1: Embodiments According to the Invention

[0400] FIGS. 1, 2 and 3 illustrate three embodiments for obtaining a circularized dsDNA nucleic acid according to the invention (see the corresponding legends).

Example 2: Protocol for Circularizing a DNA Nucleic Acid

[0401] 1) Use one PCR tube to treat 1 μg to 9 μg of purified amplicons or 25 μL of raw PCR product in final 100 μL of 0.5×MgAcetate buffer with 10u to 200u of Exo III at 0° C. to 4° C. during 5 to 10 minutes. Optionally, treat simultaneously with 1u to 20u of Exo I in order to eliminate unused primers and with 1u to 10u rSAP in order to eliminate unused dNTP. The thermal treatments are preferentially performed in the PCR machine. The result of this step is the mild degradation of 3′-ends of double stranded molecules.

[0402] 2) For denaturation, heat the tube at 88° C. during 5 minutes. Next for annealing, cool the tube to 45° C.-60° C. during at least 10 minutes (depending on melting temperature of the designed complementary sequence). The “universal” annealing step may be performed by gradual decrease of the temperature from 88° C. to 45° C. as following: 88° C. for 5 mM, 65° C. for 10 mM, 60° C. for 10 mM, 55° C. for 10 mM, 50° C. for 10 mM, 45° C. for 10 mM, successively. Complete the thermal treatments with cooling the tube to 4° C. The result of this step is the production of intramolecularly annealed dsDNA which contain single-stranded gaps and single-stranded overhangs. In some embodiments, this product may be directly applied for transformation of competent bacteria using an electroporation or thermal shock.

[0403] 3) Add the mixture of enzymes (40u DNA Ligase, 1u Exonuclease VII and 5u T4 polymerase) diluted in a Buffer containing ATP (final concentration in reaction 1 mM-5 mM) and dNTP (final concentration in reaction 1 mM-5 mM) in order to repair and seal the gaps. Incubate at room temperature during 30 mM to 1 hour.

[0404] This product may be directly applied for transfection of cells in culture using a kit for transfection such as Lipofectamine® or for transformation of competent bacteria using an electroporation or thermal shock.

[0405] 4) Add an exonuclease which will eliminate the molecules containing termini (preferentially EcoV/RecBCD but may be also Exonuclease VIII truncated or Lambda Exonuclease). Treat during 30 mM at 37° C. Stop the reaction with 25 mM EDTA and/or thermal treatment 70° C. for 30 mM This product may be directly applied for transfection of cells in culture using a kit for transfection such as Lipofectamine® or for transformation of competent bacteria using an electroporation or thermal shock.

[0406] 5) To clean-up treated samples use one of the following steps: Column clean up or Running the reaction on an agarose gel, and then extracting the DNA or Performing a phenol/chloroform extraction followed by ethanol precipitation.

[0407] 6) This product may be directly applied for transfection of cells in culture using a kit for transfection such as Lipofectamine® or for electroporation of cells in culture or for transformation of competent bacteria using an electroporation or thermal shock.

[0408] Unless specified otherwise, the buffer 0.5×MgAcetate Buffer (work dilution) is as follows: [0409] 25 mM Potassium Acetate (0-25 mM) [0410] 10 mM Tris-Acetate (10-50 mM) [0411] 5 mM Magnesium Acetate (5-15 mM) [0412] 50 μg/ml BSA (0-50 μg/ml) [0413] pH 7.9 at 25° C. (pH 7.5-9.0).

[0414] This buffer is to be added at the step 1 of the protocol. This buffer preferentially contains ATP (final concentration in reaction 1 mM-5 mM) and dNTP (final concentration in reaction 1 mM-5 mM) if optional treatment with rSAP was void at the first step of the protocol.

[0415] A modified Mg/Acetate Buffer may be added at the step 3) of the protocol (Magnesium Acetate concentration may be at 0-1 mM and Potassium Acetate may be at 0-50 mM).

[0416] This buffer preferentially contains ATP (final concentration in reaction 1 mM-5 mM) and dNTP (final concentration in reaction 1 mM-5 mM) if ATP and dNTP were absent in the 0.5× Mg/Acetate Buffer to be added at the step 1 of the protocol.

Example 3: Annealing Temperature Range

[0417] a) Experimental Design

[0418] Purified amplicons (3.8 kbp) 200 ng in 10 μL of 0.5×Acetate Buffer were treated with 10u Exo III during 3 min on ice. Annealing was performed as following: 88° C. for 5 mM, annealing temperature (80° C., 75° C., 70° C., 65° C., 60° C., 55° C. and 50° C.) for 3 mM, 3° C. for 10 sec. The melting temperature of the termini's complementary sequence (the sequence of M13 primer binding site) is 45° C.-50° C.

[0419] b) Results (FIG. 4)

[0420] FIG. 4 shows that intramolecularly annealed dsDNA (see arrow a) can be obtained at every annealing temperature tested. However, lower temperatures (60° C., 55° C. and 50° C.) result in a higher efficacy of intramolecular annealing (see the intensity of the intramolecularly annealed dsDNA (arrow a), as compared to the other forms (linear (arrow d); dimer (arrow c) and trimer (arrow b)).

Example 4: ExoI and rSAP Treatment Improved Intramolecular Annealing Starting from Raw, Non-Purified PCR Product

[0421] a) Experimental Design

[0422] The experiments have been performed as follows: 5 μL of raw PCR product was diluted to 50 μL of 0.5×MgAcetate buffer. Enzymes Exo I and rSAP were added or not and incubated if necessary, at 37° C. during 20 mM. There was added 25u of Exo III, incubated for 3 mM or 10 mM or 12 mM and annealed using thermal treatment 88° C. for 5 min, 50° C. for 3 min, 4° C. for 1 min.

[0423] b) Results (FIG. 5)

[0424] The rSAP dephosphorylates dNTP nucleotides so that the polymerase from PCR reaction does not repair the degraded 3′-DNA strands. In addition, Exo I eliminates unused primers so that they do not compete with homologous sequences during circularization by annealing. The treatments by only Exo I or only rSAP during 20 min at 37° C. prior Exo III treatment and annealing display slight improvement or no improvement of intramolecular annealing as compared to the non-treated control DNA (see intense lower bands and relatively weak upper bands on Lanes 1, 2 and 4 in FIG. 5). The probes treated with rSAP, Exo I and Exo III show improvement of intramolecular annealing as compared to the non-treated control DNA (see weak lower bands and relatively intense upper bands on Lanes A, B and 3 in FIG. 5).

[0425] As a conclusion, non-purified PCR product can be intramolecularly annealed in the presence of a mix of Exo I, Exo III and rSAP.

Example 5: Efficiency of Intramolecular Annealing with Respect to Amounts of Amplicon and Exo III

[0426] a) Experimental Design

[0427] 100 ng to 900 ng of purified amplicons (3.8 kbp) were treated with different concentrations of Exo III (10u, 20u, 40u) in 10 μL of reaction volume and incubated during 5 minutes on ice. Annealing was performed at 88° C. for 5 min, 50° C. for 3 min, 3° C. for 1 min.

[0428] b) Results (FIG. 6)

[0429] FIG. 6 shows that the treatments at high Exo III concentrations lead to significant degradation of intramolecularly annealed dsDNA (compare the Lanes 1 to 4 after 10u, 20u and 40u of Exo III concentration (arrow a)). It was observed a correlation between the higher Exo III concentration and the weaker intensity of upper major band (arrow a; intramolecularly annealed dsDNA). Efficient intramolecular annealing was obtained for 100 ng and 300 ng amplicons after treatment with 10u Exo III (compare the intensity of the upper band and the central band on Lanes 1-2 to Lines 3-4 after 10u Exo III treatment in FIG. 6).

Example 6: DNA Polymerase Range

[0430] a) Experimental Design

[0431] Purified amplicons (300 ng) were treated with Exo I during 30 min at 36° C. Next, the products were treated with 10u or 40u of Exo III during 10 min at room temperature (about 20° C.) in 10 μL of 0.5×MgAcetate Buffer. Thermal treatments were made as following: 88° C. for 5 min, 50° C. for 10 min.

[0432] b) Results: (FIG. 7)

[0433] Almost all amplicons were intramolecularly annealed dsDNA after 10u and 40u treatments with Exo III (see only one major band on Lanes 1 and 2; see faint linear monomers and absence of linear dimers or trimers in FIG. 7).

Example 7: Stability of the Intramolecularly Annealed dsDNA with Respect to the Temperature of DNA Elongation

[0434] a) Experimental Design

[0435] The probes labelled with letters are produced as follows: 5 μL of intramolecularly annealed dsDNA was mixed with 1 μL of mixture T4 DNA polymerase (5u/20 μL=0.25u/μL)

[0436] b) Results (FIG. 8)

[0437] T4 DNA polymerase has less potential “to open” intramolecularly annealed dsDNA molecules and “to monomerize” linear concatemers if applied at the temperature lower than 36° C. DNA monomers appear after elongation with T4 DNA polymerase at 36° C. (see low intense band on Lane 1e in FIG. 8). Optimal temperature for T4 polymerase-dependent elongation is at 25° C. or lower (compare the major band on Lane 1 to the major lower band on Lanes 1a, 1b, 1c and 1d in FIG. 8). The phenomena of “DNA monomerisation” derives from quasi-strand-displacement activity (that is absent in T4 polymerase) at relatively high temperature. DNA-wobbling “displaces” the complementary strand in front of T4 DNA polymerase, which progressively elongates the 3′-end through “displaced” strand until “opens” the circle of intramolecularly annealed dsDNA.

Example 8: Efficiency of the DNA Circularization with Respect to the Reparation of Gaps

[0438] a) Experimental Design

[0439] The intramolecularly annealed dsDNA molecules were first treated with different ratios (see below) of three enzymes in mixtures containing DNA Ligase, Exonuclease VII and T4 polymerase in 0.5×MgAcetate buffer with 1.25 mM dNTP, 0.5 mM ATP and 300 ng of DNA in 20 μL of reaction volume during 1 hour at room temperature (FIG. 9).

[0440] The intramolecularly annealed dsDNA molecules were further treated with 1 to 2 serial dilutions of enzyme mix containing DNA Ligase, Exonuclease VII and T4 polymerase in 0.5×MgAcetate buffer with 1.25 mM dNTP, 0.5 mM ATP and 300 ng of DNA in 20 μL of reaction volume during 1 hour at room temperature. Products were alternatively treated accordingly in the presence of ExoV/RecBCD (FIG. 10).

[0441] b) Results

[0442] The results depicted in FIG. 9 show that the 10× concentrations of mixed enzymes results in a decrease of circularization (see weak bands in 1a to 6a). In other words, the reaction of the polymerase, ExoVII and the ligase results in discontinuous strands in the circular dsDNA nucleic acid. The ratios of enzymes in mixtures are near to optimal in 1 to 4.

[0443] The results depicted in FIG. 10 show that: [0444] the concentration of one or more than one of enzymes in the mix is above optimal in conditions of 1 and 2 that leads to transformation of intramolecularly annealed dsDNA and dimeric DNA into linear monomers (see intense lower band in 1 and 2 and relatively weak bands in 1a and 2a); [0445] the concentration of enzymes is near to optimal in conditions of 3 and 4 because the production of circularized DNA is at maximum after Exo V/RecBCD treatment (see intense band in 3a and 4a) and because the production of linear monomers is moderate (see intense upper band and presence of dimers in 3 and 4); [0446] the concentration of enzymes is lower than optimal in conditions of 5 to 8 because the intensity of circularized DNA band gradually decreases from 5 to 8 after Exo V/RecBCD treatment (see the band intensity in 5a, 6a, 7a and 8a).

Example 9: Example of a Two-Step Circularization Protocol (FIGS. 11-13)

[0447] FIG. 11 shows that it is possible to introduce thiophosphate nucleotide analogs (asterisks), as well as 5′ phosphate ends (Phos 5′), in the HR1 and HR2 nucleic acids by the means of appropriate oligonucleotides (primers). Upon PCR amplification with the Pfu DNA polymerase, a linear double stranded nucleic acid is obtained, which can be circularized, without the purification step, in a one step process in the presence of an inhibitor of Pfu DNA polymerase (InhibOfPfu-Pol is an oligonucleotide containing uracil nucleotides), Exonuclease III (ExoIII), Exonuclease (ExoI), Exonuclease Lamdba (ExoLambda), Hot Start Taq DNA polymerase (Hot-Start-TaqPol), Taq DNA ligase (TaqLigase), dNTPS, ATP and the appropriate buffer. In practice, the 3′ ends are recessed in the presence of ExoIII and ExoI, and the 5′ ends are recessed in the presence of Lambda exonuclease.

[0448] As shown in FIG. 12, the presence of thiophosphate nucleotide analogs does not interfere in the recessing of 3′ ends by ExoIII.

[0449] As shown in FIG. 13, Lambda exonuclease recesses 5′ ends up to the thiophosphate nucleotide analog, where it stops recessing. ExoI recesses 3′ ends until reaching the 5′ phosphate on the other strand and stops recessing, so as to form blunt ends of each ends of the linear nucleic acid. Finally, ExoIII recesses the 3′ ends.

[0450] Example 10: Circularization of Linear Double Stranded DNA

[0451] a) Experimental Design

[0452] A linear DNA for circularization is obtained by enzymatic cleavage of a cloned plasmid. The plasmid (6,711 bp) is cut at one StuI site and two BsrBI sites providing three fragments: 4,528 bp of a sequence to be circularized, 1,901 bp and 282 bp of bacterial backbone. The fragment 4,528 bp obtained by cleavage at StuI and BsrBI sites contains the sequence CCTGTGTGAAATTGTTATCCG (SEQ ID NO: 45) repeated on its both 5′ terminus and 3′ terminus. The plasmid was treated with StuI and BsrBI restriction enzymes in CutSmart® buffer from New England Biolabs® following standard protocol. The purified DNA (final concentration 30 ng/μL in 10 μL) was mixed with a buffer containing Tris-Acetate pH 8.0 73 mM, Potassium Acetate 60 mM, different Magnesium Acetate concentrations from 0 mM to 26 mM. Next, 20u of Exonuclease III in 2 μL the same buffer was added and incubated as following: 30° C. for 2 mM, 75° C. for 10 mM, 60° C. for 5 mM, 4° C. for 10 mM, successively. The product of the reaction was loaded on an agarose gel for electrophoresis.

[0453] b) Results (FIG. 14)

[0454] As shown in FIG. 14, high concentration of divalent cations, such as Magnesium acetate, leads to more efficient production of circularized DNA. When the intensities of bands that correspond to circularized 4,528 bp, linear 4,528 bp fragment and 1,901 bp fragment were compared at different magnesium concentrations, it was observed a gradual intensity decrease of linear 4,528 bp fragment, which becomes practically invisible at 26 mM concentration while the bands of circularized 4,528 bp gradually become stronger at higher magnesium concentrations and reach the highest intensity at 26 mM magnesium concentration (lane 9). In addition, the circularized relaxed DNA have very similar localization as compared to the molecular weight marker (lane 10) that corresponds to the relaxed plasmid DNA 3,868 bp obtained by treatment with the nicking enzyme Nt.BbvCI.

Example 11: Efficiency of the Circularization Method at High Concentration of DNA Molecules

[0455] a) Experimental Design

[0456] The plasmid was treated with StuI (MbiI) and BsrBI (Eco147I) restriction enzymes in Anza® buffer from Thermo Fisher Scientific® following standard protocol. The purified DNA molecules (final concentration 30 ng/μL in 10 μL or 150 ng/μL in 50 μL) were mixed with a buffer containing Tris-Acetate pH 8.0 73 mM, Potassium Acetate 60 mM, Magnesium Acetate 30 mM. Next, the Exonuclease III was added either 20u in 2 μL buffer for 30 ng/μL specimen or 0.5 μL of stock solution 200u/μL for 150 ng/μL samples. The reaction was conducted as following: 30° C. for 2 mM, 75° C. for 10 mM, 60° C. for 5 min, 4° C. for 10 min, successively. The same amount of the reaction product was loaded on agarose gel for electrophoresis.

[0457] b) Results (FIG. 15)

[0458] As shown in FIG. 15, the circularization method according to the invention provides high yields of circularized DNA molecules at increased DNA concentration, as indicated by the presence of two major bands: the circularized 4,528 bp and linear 1,901 bp both at expected molecular weight position. The linear 4,528 bp band and concatemers are not visible. These results show the scalability of the DNA circularization.

Example 12

[0459] a) Experimental Design

[0460] The DNA molecules for transfection were circular 4,528 bp DNA molecules obtained with the use of the method according to the invention and the 6,711 bp plasmid DNA molecules, the parental DNA for production of circular 4,528 bp DNA molecules (see Example 10). Both DNA molecules contain a genetic construct for eukaryotic GFP gene expression. The cells were passaged into 24-well plate at 40% to 70% confluency in standard conditions. The transfection reagent JetOptimus® (Polyplus® transfection) was applied with four amounts of DNA 1,000 ng, 750 ng, 500 ng or 250 ng following the provided protocol. The cells were analyzed under the fluorescent microscope 24 hours after the cell transfection.

[0461] b) Results (FIG. 16A-B)

[0462] As shown in FIG. 16A-B, there was obtained advanced transfection efficiency with the product of the circularization method. These results show that the circularization method according to the invention allows providing high percentages of transfected cells even at low DNA amounts per well.