Method for generating genome-edited chickens

12369569 ยท 2025-07-29

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for generating a genome-edited chicken is provided, relating to the technical field of genetic engineering. Ovarian injection in situ is conducted on a hen, where a gene editing reagent is injected into ovarian medulla of the hen that is close to laying eggs, such that the exogenously-injected gene editing reagent can enter developing ovarian follicles through blood circulation. In resulting Go individuals, a chimera chicken with both somatic cells and germ cells edited is successfully and efficiently obtained, with an editing efficiency of the Go individuals reaching up to 36.36%. Compared with a traditional primordial germ cell (PGC)-mediated method, the ovarian injection in situ is time-saving and labor-saving, convenient and rapid, low-cost, and highly safe.

Claims

1. A method for generating a gene-edited chicken with a IHH gene knockout, comprising the following steps: injecting a gene editing reagent into ovarian medulla of a hen 10 days to 15 days before the hen lays egg such that a G.sub.1 hen is obtained, artificially inseminating the G.sub.1 hen such that fertilized eggs are obtained, and artificially hatching the fertilized eggs such that a G.sub.0 population is obtained; and detecting gene editing results in the G0 population to identify the gene-edited chicken; wherein the gene editing reagent comprises a Cas9 protein, at least two guide RNA (gRNA), and a buffer, and the Cas9 protein and each gRNA of the at least two gRNA form a ribonucleoprotein (RNP); wherein a combined editing efficiency of the at least two gRNA is detected using a chicken tool cell line before the gene editing reagent is injected, and wherein the at least two gRNA have a combined editing efficiency greater than or equal to 45%; wherein each gRNA of the at least two gRNA target sequences are in the IHH gene; and wherein the at least two gRNA comprise the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 3.

2. The method according to claim 1, wherein the Cas9 protein and the gRNA are at a molar ratio of 1:(1-2), and the Cas9 protein is injected at a concentration of 3.5 g/L.

3. The method according to claim 1, wherein the buffer comprises 20 mM of 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) and 500 mM of NaCl.

4. The method according to claim 1, wherein the buffer comprises 20 mM of 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) and 500 mM of NaCl.

5. The method according to claim 1, wherein the Cas9 protein is isolated from prokaryotic cells expressing the Cas9 protein and purified by Ni-NTA affinity chromatography.

6. The method according to claim 1, wherein the chicken tool cell line comprises DF-1 cells.

7. The method according to claim 1, wherein the hen injected with the gene editing reagent is fasted on the same day of the injection.

8. The method according to claim 1, further comprising: mating a G.sub.0 gene-edited rooster obtained from the method of claim 1 with a G.sub.0 gene-edited hen obtained from the method of claim 1 such that a homozygous gene-edited chicken is obtained.

9. The method according to claim 1, wherein a process of detecting the gene editing result comprises steps 1) and/or 2): 1) observing a phenotype of an individual in the G.sub.0 population according to a mutation effect produced after the gene editing; and 2) determining a gene editing event and a mutant type of the individual in the G.sub.0 population.

10. The method according to claim 9, wherein a process for the determining in step 2) comprises PCR amplification and/or sequencing.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) To illustrate the embodiments of the present application or the technical solutions in the prior art more clearly, the drawings required in the embodiments will be briefly introduced below.

(2) FIG. 1A-FIG. 1D show a gRNA design targeting the Indian Hedgehog (IHH) gene and the detection results of editing efficiency in DF-1 cells.

(3) FIG. 2 shows the phenotypes of some IHH mutants and the editing detection results of the gRNA-R3 target site.

(4) FIG. 3A-FIG. 3D show the TA cloning results of the IHH gene mutants.

(5) FIG. 4 shows the detection results of gene editing in the G.sub.0 individuals of hens injected with pX330 plasmid in their ovaries.

(6) FIG. 5 A-FIG. 5E show the detection results of Cas9 gene in different tissues and IHH gene editing in gonads of G.sub.0 mutant individuals.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(7) The present disclosure provides a method for generating gene-edited chickens, including the following steps: injecting a gene editing reagent into ovarian medulla of a hen to obtain a G.sub.1 hen; where the hen that will lay the first egg after injection of 10 to 15 days are chosen to be operated; the genome editing reagent includes a reagent for gene editing using CRISPR/Cas9 RNP; crossing the G. 1 hen with wild-type roosters to obtain fertilized eggs, and hatching the fertilized eggs artificially to obtain a G.sub.0 population; and detecting gene editing results in the G.sub.0 population to obtain the gene-edited chickens.

(8) In the present disclosure, a gene editing reagent is injected into ovarian medulla of a hen 10 days to 15 days before laying the first egg to obtain a G.sub.1 hen. The gene editing reagent includes a reagent for gene editing using CRISPR/Cas9 RNP; the reagent for gene editing using CRISPR/Cas9 RNP preferably includes a Cas9 protein and a gRNA; the Cas9 protein is preferably injected at a concentration of 3.5 g/L; the Cas9 and the gRNA are at a molar ratio of preferably 1:(1-2), more preferably 1:1. When injecting Cas9 RNP, a buffer (Storage Buffer) preferably includes the following components at the final concentrations: 20 mM of HEPES and 500 mM of NaCl. On the day of injection, the Cas9 protein and the gRNA are preferably prepared immediately after thawing, and the reagent is prepared in a centrifuge tube, incubated at 37 C. for 5 min, and then transferred into a disposable sterile syringe to ensure that the Cas9 RNP is injected into the ovary of the hen within 1 h. If there are two or more gRNAs, each of the gRNAs is preferably incubated with an equal volume of the Cas9 protein to form RNPs and then mixed and transferred into a disposable sterile syringe for ovarian injection.

(9) In the present disclosure, a candidate gRNA is preferably designed according to the target gene. The activity of the candidate gRNA is preferably identified on a chicken tool cell line, and a gRNA with an editing efficiency of not less than 45% is preferably selected to ensure that the target gRNA used for ovarian injection in vivo can achieve gene editing. This step is to screen for gRNAs with higher activity at the cellular level. The chicken tool cell line preferably includes a DF-1 cell line.

(10) In the present disclosure, a large amount of the gRNA is preferably prepared by in vitro transcription. Two 10 L in vitro transcription reaction systems can meet the gRNA injection requirements for one chicken. Preferably, the Cas9 protein is prepared by prokaryotic expression and the Cas9 protein is purified by Ni-NTA affinity chromatography, which is not only low-cost but also allows for designing different forms of Cas9 fusion proteins as needed.

(11) In the present disclosure, after obtaining the Cas9 protein and the gRNA, in vitro cleavage is preferably conducted to verify the activity of the Cas9 protein and the gRNA. There are certain requirements for the age and ovarian development status of the hens to be injected. The hens that are close to laying eggs (hens 10 days to 15 days before laying eggs), about 15 to 17 weeks old, are selected depending on the breed of the hens selected. The advantages of selecting hens that are close to laying eggs are: 1) the ovarian follicles of hens close to laying have not yet developed into pre-ovulatory ovarian follicles. When the ovarian injection is conducted, there may be no pre-ovulatory ovarian follicles hindering operative view formed by the surgical incision, making it easy to find the location of the ovaries and determine the position when injecting exogenous materials, which is conducive to the injection operation. 2) When the ovarian follicles of hens close to laying egg, the ovary develops into small yellow follicles and large yellow follicles, the oocyte enter into the rapid yolk deposition phase. The injected exogenous protein is more easily taken up by the ovarian follicles and the G.sub.0 editing efficiency can be improved at this time.

(12) In the present disclosure, the injection (ovarian injection in situ) is preferably conducted in the morning and hens to be operated on are preferably fasted on the same day of the operation. This is to prevent the full intestine from hindering the surgical view formed by the incision and to prevent accidents during the operation. The specific method is preferably step 7 in Example 1. The injection has low operating threshold and can be conducted by any technician in the field without the need for professional personnel to operate.

(13) In the present disclosure, after a G.sub.1 hen is obtained and the G.sub.1 hen lays the first egg, the G. 1 hen is inseminated artificially to obtain fertilized eggs. The fertilized eggs are artificially hatched to obtain the G.sub.0 population. The injection on the hens does not affect the fertility rate and hatchability rate of the eggs.

(14) In the present disclosure, after obtaining the G.sub.0 population, gene editing events in the G.sub.0 population are detected to obtain the gene-edited chicken. A process of detecting the gene editing events preferably includes: after hatching, detecting the offspring of the operated G.sub.1 hens at both phenotypic and genetic levels. Phenotypically, the phenotype of the individuals in the G.sub.0 population is preferably observed based on mutation effect produced by the modified functional gene. At the genetic level, blood is preferably collected from 1-day-old chicks by the carotid artery blood sampling to extract genomic DNA, and the gRNA site of the target gene is amplified by PCR. The gene-edited individual is identified using LabChip GXII Touch microfluidic capillary electrophoresis system, and the HT DNA High Sensitivity Labchip and supporting reagents are preferably used. The Indel types of the edited individuals are detected using TA cloning and other methods, and the edited individual is confirmed to be kept for breeding. Thus, a chimeric chicken is obtained in the G.sub.0 individuals, in which both somatic cells and germ cells are edited.

(15) In the present disclosure, the method further preferably includes: mating G.sub.0 roosters with G.sub.0 hens each other among the gene-edited chicken to obtain homozygous gene-edited chickens.

(16) In order to further illustrate the present disclosure, the method for generating gene-edited chickens provided by the present disclosure will be described in detail below in conjunction with accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present disclosure.

Example 1

(17) In nature, the loss of a single copy of the IHH gene causes the Xingyi bantam chicken to exhibit a creeping phenotype, characterized by pronounced chondrodystrophy characteristic with short shanks and small wings. This mutation can be identified in the embryonic stage. Homozygous deletion of the IHH gene can cause chicken embryo death during early embryonic development, indicating that mutation of the IHH gene can affect embryonic development and exhibit an easily observed mutant phenotype. The IHH gene as a target gene facilitates to screen edited individuals from a phenotypical perspective. 1. gRNA design and vector construction: in order to disturb the function of the chicken IHH gene as much as possible, 2 gRNA combinations targeting the first exon of the chicken IHH gene were designed to achieve fragment knockout. Three gRNA sites were designed, where gRNA-R1 was located at the end of the first exon, and gRNA-R2 and gRNA-R3 were located at the front end and middle end of the first exon, respectively. The gRNA-R1 was separately combined with gRNA-R2 and gRNA-R3 (represented as IHH-gR2+gR1 and IHH-gR3+gR1) to construct a pX330-dual gRNA knockout plasmid. The sequences and positions of the gRNA are shown in FIG. 1A and FIG. 1B, specifically: gRNA-R1: 5-tacctgggtcatgagccggt-3 (SEQ ID NO: 1); gRNA-R2: 5-cggcggcaataaatagcgaa-3 (SEQ ID NO: 2); gRNA-R3: 5-gcgagcgggatgagcttgcg-3 (SEQ ID NO: 3).

(18) A construction process of the pX330-dual gRNA knockout plasmid included: (1) when a pX330-dual gRNA knockout vector was first constructed, sequences that could transcribe the dual gRNAs were obtained by gene synthesis, specifically: IHH-gR2+gR1: 5-ATCGGAAGACCTCACCGcggcggcaataaatagcgaaGTTTTAGAGCTAGAAATAGCAAGTTAAAA TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAGGGC CTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGG AATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATA ATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCG TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGt acctgggtcatgagccggtGTTTGGGTCTTCATCG-3 (SEQ ID NO: 4); IHH-gR3+gR1: 5-ATCGGAAGACCTCACCgcgagcgggatgagcttgcgGTTTTAGAGCTAGAAATAGCAAGTTAAAAT AAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAGGGCC TATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGA ATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAA TTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGT AACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGta cctgggtcatgagccggtGTTTGGGTCTTCATCG-3 (SEQ ID NO: 5).

(19) The sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5 were cloned into a pUC57 vector separately, and the vector was used as a template for PCR amplification of dual gRNA. (2) The dual-gRNA transcript sequences were amplified by PCR using KOD One PCR Master Mix (TOYOBO), where primer sequences included: IHH-gR2+gR1-F: 5-atcggaagacctcaccgcggcggcaataaatagcgaagttttagagctagaaatag-3 (SEQ ID NO: 6); IHH-gR2+gR1-R: 5-cgatgaagacccaaacaccggctcatgacccaggtacggtgtttcgtcctttcc-3 (SEQ ID NO: 7); IHH-gR3+gR1-F: 5-atcggaagacctcaccgcgagcgggatgagcttgcggttttagagctagaaatag-3 (SEQ ID NO: 8); the primer sequence of IHH-gR3+gR1-R was shown in SEQ ID NO: 7. (3) The pX330 linearized vector obtained by BbsI digestion and the PCR product of the dual gRNAs treated with BbsI were ligated with T4 ligase. The ligated products were transformed into Escherichia coli DH5a competent cells, and single clones were identified by Sanger sequencing. The endotoxin-free plasmids were extracted from successful recombinant bacterial cultures to obtain knockout vectors pX330-gRNA-(R2+R1) and pX330-gRNA-(R3+R1). 2. DF-1 cell transfection: chicken DF-1 cells were recovered and cultured. The day before transfection, the DF-1 cells were seeded into a 6-well plate. On the next day, when the cell confluence reached to 60% to 70%, The two kinds of pX330-dual gRNA vectors constructed in step 1 were co-transfected with PiggyBac transposon plasmids and transposase plasmids into DF-1 cells, respectively, with a mass ratio of 3:3:1. Transfection was conducted using a FuGENE HD transfection reagent (PROMEGA) according to the instructions. After 48 h, 1.5% puromycin was used to screen positive cells. After 3 days, when all negative cells died, the cells were collected and the genomic DNA was extracted. Primers were designed to amplify the fragments containing gRNA target sites, where the primer sequences were: F: 5-aatttcccctctcactcc-3 (SEQ ID NO: 9); R: 5-ctttgccatcctactctg-3 (SEQ ID NO: 10).

(20) The editing efficiency of different gRNA combinations was detected by 1.5% agarose gel electrophoresis, and the results are shown in FIG. 1C. The fragment deletion efficiency of the gRNA-R1 and gRNA-R3 combination was 48.4%, while the fragment deletion efficiency of the gRNA-R1 and gRNA-R2 combination was 23.8%. Therefore, the gRNA-R1 and gRNA-R3 combination with a higher editing efficiency was selected for ovarian injection in vivo. 3. Preparation of gRNA: the above 2 gRNAs were respectively cloned into the linearized pX330 vector obtained by BbsI digestion to obtain pX330-gR1 and pX330-gR3 plasmids. The plasmids were used as templates for PCR amplification, where an upstream primer contained a T7 promoter and the gRNA sequence, and a downstream primer included ployA sequence and the partial reverse complementary sequence of the gRNA scaffold on the pX330 vector, specifically:

(21) T7_IHH_gR1_F: 5-TAATACGACTCACTATAGGGtacctgggtcatgagccggt-3 (SEQ ID NO: 11); T7_IHH-gR3_F: 5-TAATACGACTCACTATAGGGgcgagcgggatgagcttgcg-3 (SEQ ID NO: 12); the sequence of T7_uni_R was 5-AAAAAAgcaccgactcggtgccac-3 (SEQ ID NO.13);

(22) 5-TAATACGACTCACTATAGGG-3 (SEQ ID NO: 14) in the upstream primer was the T7 promoter sequence, AAAAAA in the downstream primer was the polyA tail sequence as a transcription termination sequence, and 5-gcaccgactcggtgccac-3 (SEQ ID NO: 15) was a partial sequence of the gRNA scaffold.

(23) The PCR product was purified to serve as DNA templates for gRNA in vitro transcription. According to the instructions of a MEGAshortscript T7 transcription kit (THERMO FISHER SCIENTIFIC, catalog number AM1354), the gRNA was purified using phenol-chloroform method and the obtained gRNA was dissolved in nuclease-free water. The concentration and OD value of gRNA were measured by NanoDrop 2000, where the concentration of gRNA is (1-5) g/L, and could satisfy the injection requirements. 4. Preparation of Cas9 protein: the 2NLS sequence was gene-synthesized and cloned into the pET28a-Cas9 plasmid (ADDGENE plasmid, #53261) to obtain the pET28a-Cas9-2NLS plasmid. The construction process of the pET28a-Cas9-2NLS prokaryotic expression vector included: (1) vector linearization: the pET28a-Cas9 plasmid was double-digested with MreI and XhoI, and the digested product was then performed gel purification. (2) PCR amplification of partial Cas9 sequence: primers Cas9-tyF: 5-caagcgcatgctggccagcgccggcgagctgcagaagggca-3 (SEQ ID NO: 16) and Cas9-tyR: 5-tctcgtacagaccggtgatgctctggtggatcagggtg-3 (SEQ ID NO: 17) were designed and synthesized, and a part of the Cas9 sequence in the pET28a-Cas9 plasmid was PCR-amplified using KOD One PCR Master Mix, and the product was purified. (3) 2NLS sequence gene synthesis and PCR amplification: the 2NLS sequence was gene-synthesized and cloned into a pUC57 vector backbone; where the 2NLS sequence was as follows: 5-catcaccggtctgtacgagacccgcatcgacctgagccagctgggcggcgacggcggctccggacctccaaagaaaaagagaaaagtaga ggacccaaagaaaaagagaaaagtatacccctacgacgtgcccgactacgcctgttaactcgagcaccac-3 (SEQ ID NO: 18). Using this as the PCR template, primers 2NLS-tyF: 5-catcaccggtctgtacgagacccgcatcgacctga-3 (SEQ ID NO: 19) and 2NLS-tyR: 5-cagtggtggtggtggtggtgctcgagttaacaggcgtagtcgg-3 (SEQ ID NO: 20) were designed and synthesized, and PCR amplification was conducted using KOD One PCR Master Mix, and the product was purified. (4) Homologous recombination: pEASY-Basic Seamless Cloning and Assembly Kit (Beijing TransGen Biotech Co., Ltd.) was used to insert partial Cas9 sequence and 2NLS sequence into the pET28a-Cas9 linearized vector by homologous recombination. Transformation, single clone identification, and plasmid extraction were then conducted to obtain the pET28a-Cas9-2NLS prokaryotic expression vector, which was used for prokaryotic expression and purification of the target protein.

(24) The pET28a-Cas9-2NLS prokaryotic expression vector was transformed using the BL21(DE3) Escherichia coli strain and then plated onto LB agar plates containing 50 g/ml kanamycin and incubate at 37 C. overnight. Single clones were picked and transferred to 20 mL of 2YT medium containing 50 g/ml kanamycin, and then incubate at 37 C. with shaking at 200 rpm overnight. The culture was transferred into 1 L of 2YT medium containing 50 g/ml kanamycin and was continue to be shaken at 200 rpm and 37 C. until OD.sub.600 value reaches about 0.6. Then the culture was allowed to return to room temperature for 30 min, and 0.5 M IPTG solution was added to make a final concentration of 0.5 mM. The culture was then incubated at 16 C. and 120 rpm for 20 h. The obtained culture was centrifuged at 8,000 g for 10 min at 4 C. to harvest bacterial cell pellet, and the bacterial cell pellet were added with a lysis buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 0.1% Trixon -100, 1 mg/mL lysozyme, and 1 mM PMSF) to lyse the cells by sonication, and then centrifuged at 12,000 rpm and 4 C. for 30 min to collect a supernatant, which contained soluble Cas9-2NLS proteins.

(25) The supernatant was combined with Ni Sepharose 6 Fast Flow filler (CYTIVA) at 4 C. for 1 h and eluted with 10, 20, 50, 100, and 250 mM imidazole buffers separately. The 250 mM imidazole buffer (20 mM Tris-HCl, 500 mM NaCl, and 250 mM imidazole) was collected and a 50-kDa MWCO concentration column was used to exchange the buffer of the purified protein with storage buffer. When the volume of the solution in the concentration column was less than 500 L, the protein storage buffer (20 mM HEPES, 500 mM NaCl) was added to exchange the imidazole buffer, and centrifuged at 4,000 g and 4 C. until the volume of the solution was less than 1 mL. The solution was transferred into a 1.5 mL centrifuge tube and the concentration of Cas9-2NLS protein was determined with the Bradford assay. The protein was aliquot according to the amount used for each chicken, and then quickly frozen in liquid nitrogen and stored at 80 C. Generally, 1 clone was inoculated into 1 L of 2YT medium, and the Cas9 protein produced by the cultured bacterial cells could satisfy the injection dosage of 2 to 3 hens. 5. In vitro cleavage activity assessment: the target sequence containing gRNA site was amplified from the chicken genomic DNA, and the PCR product was purified. 200 ng of PCR product, 400 ng of gRNA, 1 g of Cas9 protein, and 2 L of 10 Reaction Buffer were added to a 20 L reaction system. The reaction mixture was incubated at 37 C. for 1 h and then at 70 C. for 10 min. The product was detected by 1.5% agarose gel electrophoresis. The results are shown in FIG. 1D. 6. Preparation of Cas9 RNP: a 200 L reaction system included 3.5 g/L of Cas9 protein, equimolar volumes of gRNA-R1 and gRNA-R3 (a molar ratio of Cas9 protein to gRNA was 1:1), 20 mM of HEPES, and 500 mM of NaCl. Each gRNA was mixed with an equal molar of Cas9 protein in a volume of 100 L and incubated at 37 C. for 5 min to form RNPs, and two kinds of Cas9 RNP were mixed to 200 L and transferred into a 1 mL disposable sterile syringe. 7. Ovarian injection in situ: (1) hens that were close to laying eggs were selected. In this example, 16-weeks-old hens with developing small yellow follicles were selected for injection. (2) The ovarian injection in situ was conducted in the morning, and the hen was fasted on the day of operation. Before the operation, an anesthetic (ketamine, mixed with saline in a volume ratio of 1:3, injection volume: 0.05 mL to 0.08 mL) was injected into the breast muscle of the hen to allow muscle anesthesia. When the hen was tired, the tip of an endotracheal tube was inserted into the trachea of the hen, and the tail of the endotracheal tube was connected to a universal animal anesthesia machine (R620-S1-IECS, RWD LIFE SCIENCE) to provide the hen with a mixed gas of oxygen and isoflurane. The hen was held by two operators, where one held the head and wings of the hen, while the other held legs of the hen and assisted the third operator to conduct the ovarian injection in situ operation. The left side body of the hen was allowed to face the third operator upward. The feathers on the front side of the left leg of the hen were plucked, an opening position was determined, and a line was drawn at the front edge of the left leg, skin was cut at the line with a scalpel, and hemostatic forceps were pierced between the last but one and the last but two ribs to form a 2 cm long incision, and the incision was expanded by a distractor to expose a field of vision. The peritoneum or air sac of the hen was cut with a scalpel, and a membrane structure was cut on the surface of ovary to expose the ovary. The reagent for gene editing using CRISPR/Cas9 RNP was injected into the ovarian medulla using a 1 mL disposable sterile syringe with an extended syringe needle, where multiple-point injections were adopted generally, with an injection volume of 200 L for about 15 injections. The distractor was removed, the incision was sutured with an absorbable surgical suture, and the resulting wound was wiped with iodine to allow disinfection. The hens that underwent the operation were given water and feed after they regained consciousness and continued to be raised in single cages normally. 8. Incubation of fertilized eggs and detection: incubation of eggs: the hens were raised in single cages normally after the ovarian injection in situ was conducted. After the hens laid the first egg, they were inseminated with pooled semen. After the first insemination, fertilized eggs were collected from the 3rd day and the hens were inseminated every 5 days. A batch of fertilized eggs was hatched every 7 days, with a total of 6 to 8 batches. The incubator was set at a constant temperature (37.8 C.) and constant humidity (60%) with turning the eggs every 2 h. The eggs were transferred to a hatcher tray on the 18th day of incubation and the chicks will hatch on the 22nd day. When they hatch, a wing number was placed on the right wing of the newborn chicks to distinguish them from each other.

(26) Sample collection and DNA extraction: leg tissue or gonad tissue of chicken embryos was obtained on the 12.5 embryonic days to detect gene editing events. Blood was collected from 1-day-old chicks by carotid artery method after hatching. Genomic DNA was extracted using the cell/tissue/blood genomic DNA extraction kit (TIANGEN Biotech (Beijing) Co., Ltd.). The leg tissue or blood was added to 200 L of GA solution, and then ground using a homogenizer after adding grinding beads. 220 L of a mixed solution of proteinase K and GB solution was added; and after sufficient oscillation, the resulting mixture was bathed in 70 C. water and incubated for 2 h to 3 h, and the subsequent genomic DNA extraction operation was conducted according to the instructions.

(27) PCR amplification: detection of gene editing events was conducted on individuals with obvious mutation phenotypes. The extracted genomic DNA was used as a template and PrimeSTAR HS DNA Polymerase with GC Buffer (TAKARA) was used to amplify the IHH-gR3 target site using specific primers. The specific primer sequences were: F: 5-gcccttcgctatttattg-3 (SEQ ID NO: 21); R: 5-cgtgagctccttgaagcg-3 (SEQ ID NO: 22). A LabChip GXll Touch microfluidic capillary electrophoresis system was used to identify whether mutations occurred.

(28) TA cloning: PrimeSTAR HS DNA Polymerase with GC Buffer (TAKARA) was used to amplify the genomic DNA of the individuals with mutations, where primer pairs included F: 5-gcccttcgctatttattgccgc-3 (SEQ ID NO: 23); R: 5-ggataaactcgctgctctgccca-3 (SEQ ID NO: 24). A PCR product was purified, and a corresponding system was prepared using pEASY-Blunt Cloning Kit (Beijing TransGen Biotech Co., Ltd.), and incubated at 37 C. to allow cloning. The colones were picked for Sanger sequencing and the sequencing results were aligned with the reference sequence. The partial results are shown in Table 1.

(29) TABLE-US-00001 TABLE 1 Detection results of TA cloning Individual No. No. of TA clones No. of mutations Mutation ratio 3-28 17 9 52.94% 3-30 24 2 8.33% 4-22 20 4 20.00%

(30) Table 1 shows that the individual mosaicism rate was at 8.33% to 52.94%. 9. Ovarian injection editing results: Embryonic detection: chicken embryo phenotype and IHH gene editing were detected in the embryonic stage, and the results were shown in FIG. 2 and FIGS. 3A-3D. In FIG. 2, wt represented the wild-type; DF-1 represented the positive control; numbers starting with N represented embryonic detection, and DNA template for PCR amplification not specified was extracted from the leg tissue; numbers 34496, 7079, and 7081 represented blood genomic DNA from 3 edited hens raised to sexual maturity; 7077 represented 1 edited rooster raised to sexual maturity, and its semen genomic DNA was extracted for detection. G.sub.0 chicken embryos showed abnormal phenotypes such as early death, transparent edema, limb dysplasia, and eye dysplasia (FIG. 2). These results showed that these individuals had undergone gene editing (FIG. 2, FIGS. 3A-3D), indicating that the obtained by ovarian injection in situ could obtain G.sub.0 gene-edited individuals with immediate manifestation of mutant phenotypes in. The gonads of chicken embryos were also edited, indicating that both the somatic cells and germ cells of the gene-edited individuals obtained by ovarian injection in situ were edited. According to statistics, in the case of using the ovarian injection in situ to target the IHH gene for editing, the gene editing efficiency of the G.sub.0 offspring could reach up to 36.36% for the injected hens (Table 2).

(31) TABLE-US-00002 TABLE 2 G.sub.0 editing efficiency of ovarian injection in situ of Cas9 RNP targeting chicken IHH gene No. No. of No. of No. of G.sub.0 Hen of unfertilized fertilized Fertility G.sub.0 editing No. eggs eggs eggs rate mutants efficiency A1 4 0 4 100.00% 1 25.00% A2 41 1 40 97.56% 11 27.50% A3 32 0 32 100.00% 2 6.25% A4 32 0 32 100.00% 1 3.13% A5 6 0 6 100.00% 1 16.67% A6 24 2 22 91.67% 8 36.36% A7 35 3 32 91.43% 2 6.25% A8 24 1 23 95.83% 8 34.78% Total 198 7 191 96.46% 34 17.80%

(32) Individual detection of chicks: some of the fertilized eggs were incubated until they hatched, and some of the chickens were raised until they reached sexual maturity. Currently, 4 chimeras were obtained, including 3 hens and 1 rooster. After detection, the blood of the hens and the semen of the roosters were edited (FIG. 2) and left for mating with each other to obtain next generation.

Comparative Example 1

(33) In situ injection of the pX330 gene-editing plasmid into the ovaries of hens could also obtain chimeras in the G.sub.0 individuals in which both somatic cells and germ cells were edited, but the editing efficiency in the G.sub.0 individuals was low, at 1.71%. Since pX330 contained the Cas9 gene sequence, G.sub.0 individuals could carry the Cas9 gene. The specific plan was as follows: 1. Ovarian injection in situ: pX330-gRNA-(R2+R1) and pX330-gRNA-(R3+R1) knockout vectors obtained in step 1 of Example 1 were directly injected into the ovaries of hens according to the ovarian injection in situ in step 7. The pX330-gRNA-(R3+R1) plasmid was set to injection dose of 100 g/hen (hens numbered A10 to A19) and 200 g/hen (hens numbered A20 to A29), with 10 hens in each treatment; while the pX330-gRNA-(R2+R1) plasmid was injected into the ovaries of 2 hens, with an injection dose of 100 g/hen (hens numbered S11 and S12). 2. Incubation of fertilized eggs and detection: the incubation of fertilized eggs was the same as that in Example 1. Sample collection and DNA extraction were the same as those in Example 1. Cas9 gene detection: the extracted blood genomic DNA was used as a template to allow PCR amplification of the Cas9 gene with specific primers using PrimeSTAR HS (Premix), where the primer sequences included: Cas9-F: 5-cctgagcgaactggataaggcc-3 (SEQ ID NO: 25), Cas9-R: 5-ctcttggcgatcatcttccgca-3 (SEQ ID NO: 26).

(34) PCR amplification of IHH target gene: for Cas9 positive individuals, PrimeSTAR HS DNA Polymerase with GC Buffer was used to amplify the sequence including the two target sites with specific primers. Agarose gel electrophoresis was used to detect whether the pX330 plasmid injected into the ovaries in vivo could produce fragment deletions. The primer sequences were as follows: for the treatment of hen ovary injection of pX330-gRNA-(R2+R1) plasmid, the sequences of the detection primer pair are shown in SEQ ID NO: 9 and SEQ ID NO: 10; for the treatment of hen ovary injection of pX330-gRNA-(R3+R1) plasmid, the sequences of the detection primer pair are shown in SEQ ID NO: 21 and SEQ ID NO: 22.

(35) T7E1 assay detection: for Cas9-positive individuals, the editing events of a single gRNA site were detected using a T7E1 assay. The fragments containing the target sites gRNA-R1, gRNA-R2, and gRNA-R3 were PCR amplified using genomic DNA as a template and the corresponding specific primers. The amplified products were digested with T7E1 enzyme, and the results of 1.5% agarose gel electrophoresis was performed color invert using ImageJ software to analyze the mutant ratio. Primer sequences are shown in Table 3.

(36) TABLE-US-00003 TABLE 3 Primer sequences for T7E1 assay Primer name Primer sequence (5-3) SEQ ID NO: Product length (bp) IHH-gR1-F2 gctcatcccgctcgcctacaa 27 655 IHH-gR1-R2 ggataaactcgctgctctgccca 24 IHH-gR3-F gcccttcgctatttattg 21 472 IHH-gR3-R cgtgagctccttgaagcg 22 IHH-gR2-F atctcttcaatttcccctctcac 28 456 IHH-gR2-R gcacccgctcagcagcagcagca 29

(37) TA cloning: TA cloning in Example 1 was conducted on the mutant individuals confirmed by T7E1. 3. Results of editing events: the gene editing results of the G.sub.0 individuals by injecting the pX330 plasmid into the hen's ovary are shown in FIG. 4 and Table 4, where the G.sub.0 individuals without G.sub.0 chick wing number but with hatching batch number were dead embryos that were not successfully hatched. PCR was conducted on the Cas9 and IHH gene to detect the modification of these 2 genes in the G.sub.0 individual. In the treatment of plasmid, the size of PCR fragment of the IHH gene was 1,009 bp, and 1254 bp in the treatment of pX330-gRNA-(R3+R1) and pX330-gRNA-(R2+R1) plasmid, respectively. T7E1 assays were performed on the PCR products of gRNA-R1, gRNA-R3, and gRNA-R2 target sequences with lengths of 655, 472, and 456 bp, respectively. Asterisks indicated gene-edited individuals.

(38) TABLE-US-00004 TABLE 4 G.sub.0 editing efficiency of ovarian injection in situ of pX330 plasmid targeting chicken IHH gene No. of G.sub.0 No. dead individuals Dosage No. of Injection No. of embryos carrying No. of G.sub.0 (g/ hens volume of G.sub.0 Fertility (embryo, Cas9 chimeras Injected plasmid hen) injection (L) eggs chicks rate %) (No., %) (No., %) pX330-gRNA- 100 10 200 311 250 80.39% 21(8.40%) 7(2.80%) 3(1.20%) (R3 + R1) pX330-gRNA- 200 10 400 332 277 83.43% 14(5.05%) 3(1.08%) 2(0.72%) (R3 + R1) pX330-gRNA- 100 2 200 60 55 91.67% 8(14.55%) 4(7.27%) 5(9.09%) (R2 + R1) Total 22 703 582 82.79% 43(7.38%) 14(2.40%) 10(1.71%)

(39) As shown in FIG. 4, 14 G.sub.0 chicks or embryos were detected to carry the Cas9 gene, of which 11 were from the 100 g/hen treatment and 3 were from the 200 g/hen treatment, indicating that the efficiency of G.sub.0 offspring carrying the Cas9 gene was higher when the injection dose was 100 g/hen.

(40) In the treatments with plasmid injection doses of 100 g/hen and 200 g/hen, gene editing events was detected in 8 (2.62%) and 2 (0.72%) individuals, respectively, indicating that the injection dose of 100 g/hen had a higher efficiency in the G.sub.0 offspring. In the treatment of pX330-gRNA-(R3+R1) plasmid injection, 5 individuals were gene edited, among which 2 unhatched embryos (A16-3-4, A25-3-5) had obvious fragment deletions, 1 embryo (6100) had a mutation at the gRNA-R1 target site, and 2 chicks (50981, 50980) had a mutation at the gRNA-R3 target site. In the treatment of pX330-gRNA-(R2+R1) plasmid injection, gene editing occurred in 5 individuals, of which 2 chicks (60935, 50976) had fragment deletions, and 4 chicks (60935, 60957, 50954, 50955) had mutations at the gRNA-R1 target site (FIG. 4 and Table 4). The above results showed that increasing the plasmid dosage could not significantly improve the Cas9 positivity rate in the G.sub.0 offspring, and the choice of gRNA combination could affect the editing efficiency of fragment deletion, and not both gRNAs could work at the same time.

(41) In order to detect whether the Cas9 gene also existed in other tissues, 9 tissues including heart, liver, spleen, lung, kidney, breast muscle, leg muscle, comb, and gonad were collected from 3 chicks (50980, 50981, and 50955), and genomic DNA was extracted and the Cas9 gene was amplified. The results are shown in FIG. 5A, where pX330 plasmid and H.sub.2O were used as DNA templates for positive and negative controls, respectively. The Cas9 gene was detected in the heart, spleen, lung, comb, and gonad of chicks 50980 and 50981 (FIG. 5A), indicating that the 2 chicks were chimeras; while the Cas9 gene was not detected in the tissues of chick 50955. Since the gRNA-R3 target site was edited in the blood of individuals 50980 and 50981, in order to evaluate whether the editing could be inherited to the next generation (G.sub.1), the gonads of these 2 chickens were used to detect whether the gRNA-R3 and gRNA-R1 target sites were mutated. The results of T7E1 assay showed that only the gRNA-R3 target site was mutated in these 2 individuals, which was consistent with the detection results in the blood (FIG. 5B). The Sanger sequencing results also showed that these 2 individuals had a 3-bp deletion in the signal peptide sequence upstream of the gRNA-R3 target site, resulting in loss of the 10th amino acid leucine (FIG. 5C), which might affect the secretion of IHH protein. These results suggested that it was feasible to create gene-edited chickens by ovarian injection in situ, but the editing efficiency required to be further improved.

Example 2

(42) Compared with Example 1, except for the different Cas9 proteins used for ovarian injection, the other steps were the same. A construction process of the pET28a-4NLS-Cas9-2NLS prokaryotic expression vector included: (1) Vector linearization: the pET28a-Cas9-2NLS prokaryotic expression vector was digested with NdeI and KpnI, and the digestion products were purified. (2) 4NLS sequence amplification: the 4NLS sequence was synthesized by Beijing Tsingke Biotech Co., Ltd. and cloned into the pUC57 vector backbone. The 4NLS sequence was as follows: 5-cagccatatgcccaagaaaaagcgcaaagtgggtggcagcccgaagaagaagcgcaaagtgggcggcagtccgaaaaagaaacgcaaag tgggcggtagcccgaagaagaagcgcaaagtgggtatccacggtgtcccagcagccaccatggacaagaagtacagcatcggcctggacat cggtaccaacagc-3 (SEQ ID NO: 30). Using this plasmid as a PCR template, primers 4NLS-F: 5-ggaattccatatgcccaagaaaaagcgca-3 (SEQ ID NO: 31) and 4NLS-R: 5-cggggtaccgatgtccaggccga-3 (SEQ ID NO: 32) were designed and synthesized. KOD One PCR Master Mix was used for PCR amplification, purification, followed by double restriction digestion with NdeI and KpnI, purification. (3) Ligation and cloning: the T4 ligase was used to allow ligation and cloning to obtain the pET28a-4NLS-Cas9-2NLS prokaryotic expression vector.

(43) The protein purification of 4NLS-Cas9-2NLS was the same as that of Cas9-2NLS in Example 1.

(44) The effects of ovarian injection in situ of 4NLS-Cas9-2NLS RNP are shown in Table 5.

(45) TABLE-US-00005 TABLE 5 G.sub.0 editing efficiency of injection of 4NLS-Cas9-2NLS RNP targeting chicken IHH gene No. No. of No. of No. of G.sub.0 Hen of unfertilized fertilized Fertility G.sub.0 editing No. eggs eggs eggs rate mutants efficiency B1 40 1 39 97.50% 0 0.00% B2 33 1 32 96.97% 2 6.25% B3 36 0 36 100.00% 1 2.78% B4 43 3 40 93.02% 3 7.50% B5 34 6 28 82.35% 5 17.86% B6 36 0 36 100.00% 9 25.00% B7 14 3 11 78.57% 1 9.09% B8 30 5 25 83.33% 7 28.00% Total 266 19 247 92.86% 28 11.34%

(46) Tables 1 and 5 show that Cas9 protein was not limited to proteins using 2 nuclear localization signals, and similar effects could be achieved using 4NLS-Cas9-2NLS.

Example 3

(47) A method similar to Example 1 was adopted, except that Cas9 RNP was prepared as follows: 41.27 mg of chloroquine diphosphate (SIGMA ALDRICH) was dissolved in 1 mL of Cas9 protein buffer (20 mM HEPES, 500 mM NaCl) to a concentration of 80 mM. When preparing Cas9-2NLS RNP, the corresponding volume was calculated such that the final concentration of chloroquine diphosphate was 2 mM, and the protein was prepared immediately before use and placed at room temperature away from light. The editing results are shown in Table 6.

(48) TABLE-US-00006 TABLE 6 G.sub.0 editing efficiency of injection of Cas9-2NLS RNP (2 mM chloroquine diphosphate) targeting chicken IHH gene No. No. of No. of No. of G.sub.0 Hen of unfertilized fertilized Fertility G.sub.0 editing No. eggs eggs eggs rate mutants efficiency C1 32 0 32 100.00% 3 9.38% C2 24 2 22 91.67% 0 0.00% C3 36 0 36 100.00% 5 13.89% C4 33 1 32 96.97% 1 3.13% C5 32 0 32 100.00% 0 0.00% C6 34 0 34 100.00% 3 8.82% C7 32 0 32 100.00% 0 0.00% C8 13 2 11 84.62% 0 0.00% Total 236 5 231 97.88% 12 5.19%

(49) As shown in Table 6, when an endosomal escape agent such as chloroquine diphosphate was added to the buffer during the preparation of Cas9 RNP, the G.sub.0 editing efficiency was not affected.

Example 4

(50) A method similar to Example 1 was adopted, except that Cas9 protein used for ovarian injection was a recombinant fusion protein of Cas9 and fluorescent protein expressed by the pET28a-Cas9-mNG prokaryotic expression vector. A construction process of the pET28a-Cas9-mNG prokaryotic expression vector included: (1) Vector linearization: the procedures were the same as step 4 in Example 1. (2) PCR amplification of Cas9 sequence was similar to step 4 in Example 1, except that the primers were Cas9-mNG-CF (SEQ ID NO: 16) and Cas9-mNG-CR: 5-gtcgtaggggtatacttttctctttttctttgggtcctctacttttctctttttcttt-3 (SEQ ID NO. 33). (3) PCR amplification of mNG sequence: the G4S*2-mNG-NLS sequence was synthesized by Beijing Tsingke Biotech Co., Ltd. and cloned into the pUC57 vector backbone, where G4S was a flexible linker of GGGGS (SEQ ID NO: 34), G was glycine, and S was serine. 2 G4S flexible linkers were added to reduce the interference between Cas9 and mNG proteins in spatial conformation, and NLS was a nuclear localization signal. The G4S*2-mNG-NLS sequence was as follows: 5-ggtggtggcggtagcggcggcggcggtagtatggtcagcaaaggcgaagaggacaacatggcaagtctgccggcaacccacgaactgcat atttttggcagcatcaacggcgtcgacttcgatatggtaggtcaaggtaccggtaatccgaacgacggttacgaagagctgaacctgaagagca ccaaaggcgatctgcaatttagtccgtggattctggttccgcacattggttacggcttccatcagtatctgccgtatccggacggtatgagtccgttt caggcagcgatggtagatggttctggttatcaggtccatcgtaccatgcagtttgaagacggcgcaagtctgaccgttaactatcgctacacctac gaaggcagccatatcaaaggcgaagcgcaggttaaaggtaccggttttccggctgacggtccggttatgaccaatagtctgaccgctgctgatt ggtgtcgtagcaaaaagacctacccgaacgacaagaccatcatctccaccttcaagtggagctacaccaccggtaacggtaaacgctatcgta gtaccgcacgtaccacctatacctttgctaaaccgatggcggcgaactatctgaaaaaccaaccgatgtacgtcttccgcaagaccgaactgaa gcacagcaaaaccgagctgaacttcaaagaatggcagaaagcgttcaccgacgttatgggtatggacgaactgtacaagccgaagaagaagc gcaaagtg-3 (SEQ ID NO: 35). Using this plasmid as a PCR template, primers Cas9-mNG-mF: 5-gaaaagtatacccctacgacgtgcccgactacgcctgtggtggtggcggtagcggcggc-3 (SEQ ID NO: 36) and Cas9-mNG-mR: 5-ggtggtggtggtggtgctcgagcactttgcgcttcttcttcggcttgtacagttcgtcc-3 (SEQ ID NO: 37) were designed and synthesized. The mNG sequence was amplified by PCR using KOD One PCR Master Mix, and the product was purified. (4) Homologous recombination: pEASY-Basic Seamless Cloning and Assembly Kit (Beijing TransGen Biotech Co., Ltd.) was used to clone partial Cas9 sequence obtained in step (2) and mNG sequence obtained in step (3) into the pET28a-Cas9 linearized vector by homologous recombination. Transformation, single clone identification, and plasmid extraction were then conducted to obtain the pET28a-Cas9-mNG prokaryotic expression vector.

(51) The protein purification of Cas9-mNG was the same as that of Cas9-2NLS in Example 1.

(52) The effects of ovarian injection in situ of Cas9-mNG RNP are shown in Table 7.

(53) TABLE-US-00007 TABLE 7 G.sub.0 editing efficiency of ovarian injection in situ of Cas9-mNG RNP targeting chicken IHH gene No. No. of No. of No. G.sub.0 Hen of unfertilized fertilized Fertility of G.sub.0 editing No. eggs eggs eggs rate mutants efficiency CNG-1 49 1 48 97.96% 4 8.33% CNG-2 45 1 44 97.78% 1 2.27% CNG-3 34 0 34 100.00% 9 26.47% CNG-4 43 1 42 97.67% 6 14.29% CNG-5 45 0 45 100.00% 1 2.22% Total 216 3 213 98.61% 21 9.86%

(54) As shown in Table 7, the Cas9 protein was fused with a fluorescent protein, such as mNeongreen, to form the Cas9-mNG protein that could also achieve similar gene editing effects.

(55) Although the present application has been described in detail through the above examples, the examples are merely some rather than all of the examples of the present application. All other examples obtained by a person based on these examples without creative efforts shall fall within the protection scope of the present application.