USE OF LNCRNA XR_595534.2 IN PREPARATION OF MEDICINE FOR TREATMENT OR PREVENTION OF CHRONIC PAIN

Abstract

The present invention provides use of lncRNA XR_595534.2 in the preparation of a medicine for the treatment or prevention of chronic pain. In the present invention, trigeminal neuralgia induced by chronic constriction injury of infraorbital nerve in rats is used as a pain model. A specifically and differentially highly expressed long-chain non-coding RNA gene lncRNA XR_595534.2 is screened in the model. An interfering RNA targeting lncRNA XR_595534.2 is provided for disease treatment. The present invention discovers for the first time that lncRNA XR_595534.2, which is specifically and differentially highly expressed in a pain model, has significantly reduced expression by stereotactic injection of an interfering RNA to relieve the pain behavior, and is useful in the preparation of a medicine for the treatment or prevention of trigeminal neuralgia, neuropathic pain, migraine and cancer pain where lncRNA-XR595534.2 is a target.

Claims

1. Use of lncRNA XR_595534.2 in the preparation of a medicine for the treatment or prevention of chronic pain.

2. The use according to claim 1, wherein the chronic pain is selected from the group consisting of trigeminal neuralgia, migraine, neuropathic pain and cancer pain.

3. The use according to claim 1, wherein the use comprising preparing a medicine that interferes with the expression of lncRNA XR_595534.2, with lncRNA XR_595534.2 as a therapeutic target.

4. An interfering RNA, wherein the interfering RNA targets and interferes with the expression of lncRNA XR_595534.2 according to claim 1.

5. The interfering RNA according to claim 4, wherein the interfering RNA comprises the nucleotide sequence CCGUGAACUGAAGCUUCAU.

6. The interfering RNA according to claim 5, wherein a sense strand of the interfering RNA comprises the nucleotide sequence: 5′-CCGUGAACUGAAGCUUCAU-3′, and an antisense strand of the interfering RNA comprises the nucleotide sequence: 5′-AUGAAGCUUCAGUUCACGG-3′.

7. The interfering RNA according to claim 6, wherein the interfering RNA comprises a dangling base TT; and the dangling base is located at the 3′-terminus of the sense strand and the antisense strand of the interfering RNA.

8. The interfering RNA according to claim 7, wherein in the interfering RNA comprising the dangling base TT, the sequence of the sense strand is: 5′-CCGUGAACUGAAGCUUCAUTT-3′; and the sequence of the antisense strand is: 5′-AUGAAGCUUCAGUUCACGGTT-3′.

9. The interfering RNA according to claim 4, wherein the interfering RNA is modified by cholesterol, phosphorylation, sulfhydrylization and any combination thereof.

10. A medicine for the treatment of chronic pain, comprising 0.1-100 wt % of the interfering RNA according to claim 4 and 0-99.9 wt % of a pharmaceutical adjuvant.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG. 1A shows the mechanical pain threshold in a rat model of chronic constriction injury of infraorbital nerve (CCI-ION).

[0019] FIG. 1B shows high-throughput sequencing results demonstrating the differentially highly expressed lncRNAs in the TG tissue of a CCI-ION model rat.

[0020] FIG. 2 shows that the expression of lncRNA XR_595534.2 in TG tissue of a CCI-ION model rat is significantly increased, as determined by fluorescence quantitative PCR.

[0021] FIG. 3 shows that stereotactic injection of a siRNA interfering sequence in TG can effectively reduce the expression level of lncRNA XR_595534.2 in the TG tissue of a CCI-ION model rat.

[0022] FIG. 4 shows that stereotactic injection of a siRNA interfering sequence in TG can significantly reverse the mechanical hyperalgesia in a CCI-ION model rat in an animal behavior test.

[0023] FIG. 5A shows that stereotactic injection of siRNA interfering sequence in TG can effectively reduce the level of lentivirus overexpressing lncRNA XR_595534.2 in the TG tissue of a normal rat.

[0024] FIG. 5B shows that the mechanical pain threshold in a normal rat is significantly reduced after stereotactic injection of lentivirus overexpressing lncRNA XR_595534.2 in TG, and the stereotactic injection of siRNA in TG can significantly reverse the pain behavior of a rat.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] The specific implementation of the present invention will be described in further detail below in conjunction with the examples. The following examples are used to illustrate the present invention, but not to limit the protection scope of the present invention.

Example 1: High-Throughput Sequencing Results Show that lncRNA is Differentially and Highly Expressed in the TG Tissue of a CCI-ION Model Rat

[0026] (1) Chronic constriction injury model of infraorbital nerve (CCI-ION) Healthy adult male Sprague-Dawley rats, weighing 180-250 grams, were provided by the Laboratory Animal Center of Suzhou University. The approved sanitary-level document number from the Animal Center is SYXK (Su) 2007-0035. The animals were allowed to adapt to the breeding environment for three days and undergo adaptive stimulation training before the experiment. The model was established by routine laboratory methods: the rats were anesthetized by intraperitoneal injection with 4% chloral hydrate in a dose of 1 ml/100 g, and the rats were immobilized on the operating bench in a supine position, and cut horizontally with a sterile blade at the left maxillary first molar level upper jaw. A blunt curved glass rod was used to carefully separate the surrounding tissues until the infraorbital nerve was exposed. 5-0 suture was used for ligation at both ends, with a distance of 2 mm and a moderate strength. After the operation, the blood stains were wiped with a cotton ball, and penicillin sodium was applied to prevent infection. In the sham group, the infraorbital nerve was only bluntly separated without ligation according to the above method.

[0027] (2) Determination of the Mechanical Pain Threshold at the Rat's Whisker Pad

[0028] The rat's whisker pad was stimulated with von Frey filament (Stoelting company, model NC12775) until the rat showed an escape behavior as a positive reaction. Starting from 1 gram, the rat's whisker pad was stimulated continuously for 5 times. If there were three positive reactions, a lower level mechanical stimulation was given; if no positive reactions shown, a higher level mechanical stimulation was given. 15 grams was set as the maximum mechanical stimulus intensity and the stimulation proceeded under double-blind conditions. The minimum intensity of a positive reaction in experimental animals was regarded as the mechanical pain threshold of rats. The calculation formula of the final pain threshold is: 50% threshold (g)=(10.sup.[Xf+Kδ])/10000.

[0029] (3) High-Throughput Sequencing

[0030] After anesthesia, the rat was decapitated and placed on ice to expose its TG. A sterile scalpel and micro dissecting forceps were used to pick the TG from the surgical side, from which fibronectin was carefully removed. The TG from the surgical side was immediately placed in a 1.5 ml sterile centrifuge tube and shipped to the company while cooled by dry ice. After RNA extraction, sample detection, library construction, library inspection and computer sequencing, bioinformatics analysis was performed to screen the differentially expressed lncRNAs in the TG tissue of the CCI-ION model rat. The sequencing process was completed by Shanghai Ouyi Company.

[0031] As shown in FIG. 1A, 16 SD rats were divided into 2 groups with 8 rats in each group. The first group was the sham group, and the second group was the CCI-ION model group. Compared with the sham group, the mechanical pain threshold at the whisker pad of rats in the CCI-ION model group is significantly reduced from day 14 and through day 28 (*** p<0.001 vs. the sham group, N=8). As shown in FIG. 1B, 3 rats in the sham group and 3 rats in the CCI-ION model group were selected on day 14, and TG was used for high-throughput sequencing to screen the differentially expressed lncRNAs in the TG tissue of the rats in the CCI-ION model group. The high-throughput sequencing results show that compared with the rats in the sham group, lncRNA XR_595534.2 out of the first 20 lncRNAs differentially expressed in the TG tissue of the CCI-ION model rats is increased most significantly (*p<0.05, **p<0.01, ***p<0.001 vs. sham group, n=3).

Example 2: The Expression of lncRNA XR_595534.2 in the TG Tissue of a CCI-ION Model Rat was Significantly Increased as Determined by Fluorescence Quantitative PCR

[0032] (1) Establishment of Chronic Constriction Injury Model of Infraorbital Nerve (CCI-ION) (See Example 1)

[0033] (2) Real-Time Fluorescence Quantitative PCR

[0034] RNA extraction: TG of the rat was extracted by a sterile tool and then placed in a 1.5 ml sterile centrifuge tube. 1 ml of Trizol was added. The tissue was homogenized, and placed on ice for 30 min. 100 μl of chloroform was added and centrifuged for 20 min at 4° C. and 12,000 rpm. The upper aqueous phase was pipetted into a new centrifuge tube. An equal volume of isopropanol was added and placed in a refrigerator at −20° C. for 20 min, and then centrifuged for 15 min at 4° C. and 12,000 rpm. The supernatant was discarded. 75% ethanol was added to wash the pellet, and the resultant material was centrifuged for 5 min at 7500 rpm and 4° C. The supernatant was discarded, and 20 μl of DEPC-treated water was added to dissolve the pellet. Finally, NanoDrop 2000 was used to measure RNA concentration.

[0035] Fluorescence quantitative PCR: The extracted RNA was reverse transcripted into cDNA using 5×PrimeScript RT Master Mix. The parameters are: reverse transcription at 42° C. for 15 min; and denaturation at 85° C. for 2 min. Subsequently, fluorescence quantitative PCR was performed, and the cycle parameters were: 40 cycles of pre-denaturation at 95° C. for 15 min; denaturation at 94° C. for 15 seconds; annealing at 60° C. for 30 seconds, and extension at 72° C. for 30 seconds. The experimental results are calculated by 2.sup.ΔΔCT. For lncRNA XR_595534.2, forward primer sequence: GGCTTGTCAGTATGAGCAGTTAGAA (SEQ ID NO: 5); and reverse primer sequence: AATTGTCCTGTGTTCCTGGTTC (SEQ ID NO: 6). For GAPDH, forward primer sequence: GTGCTGAGTATGTCGTGGAGT (SEQ ID NO: 7); and reverse primer sequence: GCAGTGATTGAG SEQ ID NO: 8). The primers were synthesized by Ruibo Biotech. Trizol was purchased from Takara, the reverse transcription kit was purchased from Takara, and the SYBR fluorescent dye was purchased from Bimake.

[0036] As shown in FIG. 2, 3 rats in the sham group and 3 rats in the CCI-ION model group were selected. RNA was extracted from the TG tissue of the rat from sham group and CCI-ION model group at day 7, CCI-ION model group at day 14, CCI-ION model group at day 21 and CCI-ION model group at day 28. The detection results by fluorescence quantitative PCR show that compared with the sham group, the expression of lncRNA XR_595534.2 in the TG of rats in the CCI-ION model group is increased significantly after day 14, and through day 28 (**p<0.01, ***p<0.001 vs. sham group, n=3).

Example 3: siRNA Interfering Sequence can Effectively Reduce the Expression of lncRNA XR_595534.2 in the TG of CCI-ION Model Rat

[0037] (1) RNA extraction (see Example 2);

[0038] (2) Real-time fluorescence quantitative PCR (see Example 2);

[0039] (3) Stereotactic injection of siRNA interfering sequence in TG of rats: After anesthesia, the rat was fixed on a brain stereotaxic device. The scalp was cut with a scalpel. H.sub.2O.sub.2 was added to corrode the tissue, and the coronal and sagittal sutures were exposed. The point of intersection of the coronal and sagittal sutures, namely the bregma, was used as the origin for positioning: 3 mm backward from the bregma point, 3 mm left to the midline, and 11.7 mm below the skull surface. The lncRNA XR_595534.2 siRNA (lncRNA-siRNA) and control siRNA (NC-siRNA) (purchased from Gemma Gene) were injected with a final concentration of 50 μm/l. 3 μl was injected for each rat, and the injection was finished in 5 min. The needle was left for 10 min.

[0040] As shown in FIG. 3, 24 rats were divided into 4 groups with 6 rats in each group. The first group of rats was the sham group. The second group of rats was the CCI-ION model group, in which saline was stereotactically injected. The third group of rats was the CCI-ION model group, in which NC-siRNA (negative control siRNA) was stereotactically injected in the TG. The fourth group of rats was the CCI-ION model group, in which the siRNA interfering sequence (CCGUGAACUGAAGCUUCAU) of lncRNA XR_595534.2 siRNA (lncRNA-siRNA, Pubmed Blast results show that the siRNA sequence is specific, the lncRNA-siRNA is chemically synthesized by Ruibo biological company and modified by cholesterol to increase the membrane permeability) was stereotactically injected in the TG. After two consecutive days of injection, the TG tissues were extracted from rats of the sham group and CCI-ION model group on day 14 and CCI-ION model group+NC-siRNA injection and CCI-ION model group+siRNA injection after 3 days were subjected to fluorescence quantitative PCR. Compared with the control group, 3 days after injection with siRNA, the expression of lncRNA XR_595534.2 in the TG of rats was significantly reduced (* p<0.05, ** p<0.01 vs. sham group, .sup.##p<0.01 vs. CCI-ION model group+NC-siRNA injection). The above results show that the siRNA interfering sequence (CCGUGAACUGAAGCUUCAU) can effectively reduce the expression of lncRNA XR_595534.2 in the TG tissue of a CCI-ION model rat.

Example 4: Animal Behavior Test Shows that Stereotactic Injection of the siRNA Interfering Sequence in TG Significantly Reverses the Mechanical Hyperalgesia in a CCI-ION Model Rat

[0041] (1) Establishment of chronic constriction injury model of infraorbital nerve (CCI-ION) (see Example 1).

[0042] (2) Determination of the mechanical pain threshold in the rat's whisker pad (see Example 1).

[0043] (3) Stereotactic injection of siRNA interfering sequence in TG in a rat (see Example 3).

[0044] As shown in FIG. 4, 24 normal SD rats were divided into 4 groups with 6 rats in each group. The first group was the sham group+NC-siRNA injection, the second group was the sham group+siRNA injection; the third group was the CCI-ION model group+NC-siRNA injection, and the fourth group was the CCI-ION model group+siRNA injection (the sequence is the same as in Example 3). As shown in FIG. 4, the mechanical pain threshold in rats in the CCI-ION model group rises significantly on day 3 after siRNA injection, and this can continue to day 6 after injection (***p<0.001 vs. sham group, .sup.##p<0.01, .sup.###p<0.001 vs. CCI-ION model group+NC-siRNA injection). It shows that stereotactic injection of siRNA interfering sequence (CCGUGAACUGAAGCUUCAU) in TG can significantly alleviate the pain behavior response induced in a rat of CCI-ION model, and the siRNA has obvious analgesic effect.

Example 5: The Mechanical Pain Threshold in a Normal Rat is Significantly Reduced after they were Stereotactically Injected with Lentivirus Overexpressing lncRNA XR_595534.2 in the TG, and Injection of siRNA in the TG can Significantly Reverse the Pain Behavior in a Rat

[0045] (1) Determination of the mechanical pain threshold at the rat's whisker pad (see Example 1).

[0046] (2) Stereotactic injection of lentivirus overexpressing lncRNA XR_595534.2 (LV-lncRNA group) in normal rats was carried out and a control group (LV-NC-lncRNA group, purchased from Gemma Gene) was set. The virus titer was 1×10.sup.8 TU. Each rat was injected with 3 μl, with a duration of 5 min, and the needle was left for 10 min. The injection method for siRNA interfering sequence was the same as in Example 1.

[0047] As shown in FIG. 5A, there were 6 rats in each group, and TG tissues were extracted respectively. After stereotactic injection of lentivirus overexpressing lncRNA XR_595534.2 (LV-lncRNA group) in the TG of a normal rat, the expression of lncRNA XR_595534.2 increases significantly. The stereotactic injection of siRNA interfering sequence (CCGUGAACUGAAGCUUCAU) in TG significantly reduces the expression level of lncRNA XR_595534.2 in the TG tissue (**p<0.01 vs. LV-NC-lncRNA group, .sup.###p<0.001 vs. LV-lncRNA group). As shown in FIG. 5B, 32 normal SD rats were divided into 4 groups with 8 rats in each group. In the first group, normal rats were stereotactically injected with siRNA interfering sequence in TG. In the second group, the rats were stereotactically injected with lncRNA XR_595534.2 null lentiviral vector (LV-NC-lncRNA group) in TG. In the third group, the rats were stereotactically injected with lncRNA XR_595534.2 expressing lentivirus (LV-lncRNA group) in TG. In the fourth group, the rats were stereotactically injected with lncRNA XR_595534.2 expressing lentivirus in TG, followed by injection of siRNA interfering sequence for 2 consecutive days after 7 days. The behavior test was carried out on days 2, 3, 4, 5, and 6 after the injection of siRNA interfering sequence to determine the mechanical pain threshold at the rat's whisker pad. The results show that the mechanical pain threshold in rats is significantly reduced (at day 7) after stereotactic injection of the lncRNA XR_595534.2 expressing lentivirus in the TG. The mechanical pain threshold of rats increases significantly 3 days after injection of siRNA, and this can continue to day 6 after injection. (**p<0.01, ***P<0.001 vs. LV-NC-lncRNA group, .sup.##p<0.01, .sup.###p<0.001 vs. LV-lncRNA group). The above results show that the analgesic effect of the siRNA interfering sequence (CCGUGAACUGAAGCUUCAU) on trigeminal neuralgia is achieved by specifically targeting and inhibiting lncRNA XR_595534.2.

[0048] In the present invention, a high-throughput sequencing method is employed. In Example 1 and Example 2, it is found that the expression of lncRNA XR_595534.2 in the TG tissue of the CCI-ION model rat changes significantly, lncRNA XR_595534.2 is expressed in the TG tissue of a rat, and the expression level of lncRNA XR_595534.2 is significantly increased after a CCI-ION model is established. In Example 3, the effect of siRNA interfering sequence (CCGUGAACUGAAGCUUCAU) on the expression of lncRNA XR_595534.2 in the TG of a rat is studied. It is found that the siRNA interfering sequence can target and inhibit the expression of lncRNA XR_595534.2 in the TG of a rat.

[0049] In Examples 4 and 5, the present invention studies the effect of siRNA interfering sequence on the mechanical pain threshold in a rat of trigeminal neuralgia model induced by CCI-ION by animal experiments. It is found that stereotactic injection of the siRNA interfering sequence in TG can alleviate CCI-ION-induced pain behavior in a rat, and has an analgesic effect. In addition, the influence of the siRNA interfering sequence on the pain threshold at rat's whisker pad induced by lentivirus overexpressing lncRNA XR_595534.2 is studied. It is found that stereotactic injection of the siRNA interfering sequence in TG can alleviate the pain behavior response of rats induced by lncRNA XR_595534.2. It is confirmed that the significant analgesic effect of siRNA interfering sequence is achieved by the targeted inhibition of lncRNA XR_595534.2.

[0050] The present invention discovers that the siRNA interfering sequence can significantly reverse the mechanical hyperalgesia in rats of the CCI-ION model by targeted inhibiting the expression of lncRNA XR_595534.2, and has an obvious analgesic effect. Therefore, the siRNA interfering sequence can also be used in the preparation of a medicine for the treatment and/or prevention of diseases where lncRNA XR_595534.2 is a target, such as trigeminal neuralgia, neuropathic pain, migraine and malignant tumors.

[0051] Preferred embodiments of the present invention are described above, which, however, are not intended to limit the present invention. It should be noted that several improvements and modifications can be made by those skilled in the art, without departing from the technical principles of the present invention. Such improvements and modifications also fall into the protection scope of the present invention.