NOVEL TUMOR-SPECIFIC ANTIGENS FOR ACUTE LYMPHOBLASTIC LEUKEMIA (ALL) AND USES THEREOF

20230158132 · 2023-05-25

Assignee

Inventors

Cpc classification

International classification

Abstract

Acute lymphoblastic leukemia (ALL) has not benefited from innovative immunotherapies, mainly because of the lack of actionable immune targets. Novel tumor-specific antigens (TSAs) specifically expressed by ALL cells are described herein. Most of the TSAs described herein derives from aberrantly expressed unmutated genomic sequences, such as intronic and intergenic sequences, which are not expressed in normal tissues. Nucleic acids, compositions, cells, antibodies and vaccines derived from these TSAs are described. The use of the TSAs, nucleic acids, compositions, antibodies, cells and vaccines for the treatment of leukemia such as ALL is also described.

Claims

1. A leukemia tumor antigen peptide (TAP) comprising one of the following amino acid sequences: TABLE-US-00008 SEQ SEQ SEQ ID ID ID Sequence NO: Sequence NO: Sequence NO: NEQTTILY  1 LLGLPQPPK 31 GEFLVPLSL 61 ALFSNEVSL  2 LSSRLPLGK 32 GEVDGAQQAM 62 FIPDLFTEL  3 NLLFSRVFK 33 IEEVSQGLL 63 FLLDHILTI  4 STGVLTVLK 34 IESEDFGFWSL 64 FLLESRETL  5 SVFDRTNNR 35 LENSGFILI 65 FLLPTSLSL  6 SVVPHPLQK 36 REPLEILITL 66 FLLSDELLL  7 TTSSIYIRK 37 EETDAYKSL 67 GLATAVWLL  8 LYTFIKHEF 38 SELQLPVTF 68 GLLTASIFL  9 SYFDPSYSNF 39 QEIATSHNI 69 GTLCLLTFI 10 SYLASFLLY 40 AQFLLFIA 70 KLLQPLPIT 11 VYSPSPLNF 41 FEISSVTTA 71 LLQNLIVLL 12 VYTQVSAF 42 KEVGGLRSA 72 LLSLYLVSI 13 YSVLTVTF 43 TEFGPVIG 73 LMLLFVVLL 14 NLGLFLSY 44 ISLPALEVL 74 SLANETHTL 15 AVGGFRSSW 45 LPSPPLPPSL 75 VLLDFPALL 16 SQVQAVLLAW 46 LYLPSVVLI 76 VLLSKILYP 17 QTNSGSLAR 47 RPPAPLLPVL 77 WLVEKLSGV 18 DVAGVGMPK 48 SLHYSVSL 78 YLFAHSIIL 19 DVMASLARV 49 SLPDHQGVL 79 YLGYAVAV 20 EVGAVFAVL 50 EAVSQGKDF 80 YLQEISLRL 21 VVADILLSV 51 YSSYLSIHY 81 SLLGIGLLA 22 SSLSGPVSSL 52 ASLGLSLAL 82 AAMESPIQSK 23 AFRVIVAL 53 LCHRTPPSL 83 ALFGFVGFPNK 24 EHYNKVVVM 54 LSISPFQAI 84 ALFVLTSIK 25 VQAQVLEAI 55 GWGGSPLYL 85 ATSLTIQEK 26 NNMAIIYSY 56 YFDPSYSNF 86 AVAVPLLPR 27 EPSHSINVY 57 ISLSSIVSV 87 GTISGGFFK 28 IPVGSGLGYVL 58 LSISSLVSV 88 GVANSLLK 29 DHDIGVYSV 59 GVSPVLFLK 30 HFEWQPPL 60 or a nucleic acid encoding said leukemia TAP.

2. The leukemia TAP or nucleic acid of claim 1, wherein said leukemia TAP binds to: (a) an HLA-A*01:01 molecule and comprises the amino acid sequence of SEQ ID NO: 1; (b) an HLA-A*02:01 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 2-22; (c) an HLA-A*11:01 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 23-37; (d) an HLA-24*:02 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 38-43; (e) an HLA-A*29:02 molecule and comprises the amino acid sequence of SEQ ID NO: 44; (f) an HLA-A*32:01 molecule and comprises the amino acid sequence of SEQ ID NO: 45 or 46; (g) an HLA-A*66:01 molecule and comprises the amino acid sequence of SEQ ID NO: 47; (h) an HLA-A*68:01 molecule and comprises the amino acid sequence of SEQ ID NO: 48; (i) an HLA-B*07:02 molecule and comprises the amino acid sequence of SEQ ID NO: 52; (j) an HLA-B*08:01 molecule and comprises the amino acid sequence of SEQ ID NO:53; (k) an HLA-B*14:02 molecule and comprises the amino acid sequence of SEQ ID NO: 54; (1) an HLA-B*15:10 molecule and comprises the amino acid sequence of SEQ ID NO: 55; (m) to an HLA-B*18:01 molecule and comprises the amino acid sequence of SEQ ID NO: 56; (n) an HLA-B*35:01 molecule and comprises the amino acid sequence of SEQ ID NO: 57 or 58; (o) an HLA-B*39:01 molecule and comprises the amino acid sequence of SEQ ID NO: 59 or 60; (p) an HLA-B*40:01 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 61-66; (q) an HLA-B*44:02 molecule and comprises the amino acid sequence of SEQ ID NO: 67 or 68; (r) an HLA-B*49:01 molecule and comprises the amino acid sequence of SEQ ID NO: 69; (s) an HLA-B*50:01 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 70-73; (t) an HLA-C*01:02 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 74-79; (u) an HLA-C*02:02 molecule and comprises the amino acid sequence of SEQ ID NO: 80 or 81; (v) an HLA-C*03:04 molecule and comprises the amino acid sequence of any one of SEQ ID NOs: 82-84; (w) an HLA-C*04:01 molecule and comprises the amino acid sequence of SEQ ID NO: 85 or 86; or (x) an HLA-C*15:02 molecule and comprises the amino acid sequence of SEQ ID NO: 87 or 88.

3-26. (canceled)

27. The leukemia TAP or nucleic acid of claim 1, wherein the TAP is encoded by a sequence located a non-protein coding region of the genome.

28. The leukemia TAP or nucleic acid of claim 27, wherein said non-protein coding region of the genome is an untranslated transcribed region (UTR).

29. The leukemia TAP or nucleic acid of claim 27, wherein said non-protein coding region of the genome is an intron.

30. The leukemia TAP or nucleic acid of claim 27, wherein said non-protein coding region of the genome is an intergenic region.

31. The leukemia TAP or nucleic acid of claim 27, wherein said non-protein coding region of the genome is a long non-coding RNAs

32. A combination comprising at least two of the leukemia TAPs or nucleic acids defined in claim 1.

33. The leukemia TAP or nucleic acid of claim 1, which is a nucleic acid encoding the leukemia TAP.

34. The leukemia TAP or nucleic acid of claim 33, wherein said nucleic acid is an mRNA or a component of a viral vector.

35. A vehicle comprising the leukemia TAP or nucleic acid of claim 1.

36. A composition comprising the leukemia TAP or nucleic acid of claim 1, and a pharmaceutically acceptable carrier.

37. A vaccine comprising the leukemia TAP or nucleic acid of claim 1, and an adjuvant.

38-41. (canceled)

42. An isolated cell expressing at its surface major histocompatibility complex (MHC) class I molecules comprising the leukemia TAP of claim 1 in their peptide binding groove.

43-44. (canceled)

45. A T-cell receptor (TCR) or an antibody or an antigen-binding fragment thereof that specifically recognizes MHC class I molecules expressed at the surface of the cell of claim 42.

46. (canceled)

47. The TCR, antibody or antigen-binding fragment thereof according to claim 45, wherein the antibody or antigen-binding fragment thereof is a bispecific antibody or antigen-binding fragment thereof, and wherein the bispecific antibody or antigen-binding fragment thereof also specifically binds to a T cell signaling molecule.

48-50. (canceled)

51. An isolated cell expressing at its cell surface the TCR of claim 45.

52. (canceled)

53. A cell population comprising at least 0.5% of the isolated cell as defined in claim 51.

54. A method of treating lymphoblastic leukemia in a subject comprising administering to the subject an effective amount of: (i) a leukemia tumor antigen peptide (TAP) comprising one of the following amino acid sequences: TABLE-US-00009 SEQ SEQ SEQ ID ID ID Sequence NO: Sequence NO: Sequence NO: NEQTTILY  1 LLGLPQPPK 31 GEFLVPLSL 61 ALFSNEVSL  2 LSSRLPLGK 32 GEVDGAQQAM 62 FIPDLFTEL  3 NLLFSRVFK 33 IEEVSQGLL 63 FLLDHILTI  4 STGVLTVLK 34 IESEDFGFWSL 64 FLLESRETL  5 SVFDRTNNR 35 LENSGFILI 65 FLLPTSLSL  6 SVVPHPLQK 36 REPLEILITL 66 FLLSDELLL  7 TTSSIYIRK 37 EETDAYKSL 67 GLATAVWLL  8 LYTFIKHEF 38 SELQLPVTF 68 GLLTASIFL  9 SYFDPSYSNF 39 QEIATSHNI 69 GTLCLLTFI 10 SYLASFLLY 40 AQFLLFIA 70 KLLQPLPIT 11 VYSPSPLNF 41 FEISSVTTA 71 LLQNLIVLL 12 VYTQVSAF 42 KEVGGLRSA 72 LLSLYLVSI 13 YSVLTVTF 43 TEFGPVIG 73 LMLLFVVLL 14 NLGLFLSY 44 ISLPALEVL 74 SLANETHTL 15 AVGGFRSSW 45 LPSPPLPPSL 75 VLLDFPALL 16 SQVQAVLLAW 46 LYLPSVVLI 76 VLLSKILYP 17 QTNSGSLAR 47 RPPAPLLPVL 77 WLVEKLSGV 18 DVAGVGMPK 48 SLHYSVSL 78 YLFAHSIIL 19 DVMASLARV 49 SLPDHQGVL 79 YLGYAVAV 20 EVGAVFAVL 50 EAVSQGKDF 80 YLQEISLRL 21 VVADILLSV 51 YSSYLSIHY 81 SLLGIGLLA 22 SSLSGPVSSL 52 ASLGLSLAL 82 AAMESPIQSK 23 AFRVIVAL 53 LCHRTPPSL 83 ALFGFVGFPNK 24 EHYNKVVVM 54 LSISPFQAI 84 ALFVLTSIK 25 VQAQVLEAI 55 GWGGSPLYL 85 ATSLTIQEK 26 NNMAIIYSY 56 YFDPSYSNF 86 AVAVPLLPR 27 EPSHSINVY 57 ISLSSIVSV 87 GTISGGFFK 28 IPVGSGLGYVL 58 LSISSLVSV 88 GVANSLLK 29 DHDIGVYSV 59 IPLNPFSSL 92 GVSPVLFLK 30 HFEWQPPL 60 or a nucleic acid encoding said TAP; (ii) a combination comprising at least two of the leukemia TAP or nucleic acids defined in (i); (iii) a vehicle comprising the leukemia TAP or nucleic acid defined in (i), or the combination defined in (ii); (iv) a composition comprising the leukemia TAP or nucleic acid defined in (i), the combination defined in (ii); or the vehicle defined in (iii); (v) a vaccine comprising the leukemia TAP or nucleic acid defined in (i), the combination defined in (ii); the vehicle defined in (iii) or the composition defined in (iv); and an adjuvant; (vi) a cell expressing at its surface major histocompatibility complex (MHC) class I molecules comprising the leukemia TAP defined in (i) or the combination defined in (ii) in their peptide binding groove; (vii) a cell or cell population expressing at its surface a TCR that specifically recognizes MHC class I molecules comprising the leukemia TAP defined in (i) or the combination defined in (ii) in their peptide binding groove; or (viii)[[(ix) an antibody or an antigen-binding fragment thereof that specifically recognizes MHC class I molecules comprising the leukemia TAP defined in (i) or the combination defined in (ii) in their peptide binding groove.

55. (canceled)

56. The method of claim 54, wherein said lymphoblastic leukemia is acute lymphoblastic leukemia (ALL).

57. The method of claim 56, wherein the ALL is B-ALL.

58. The method of claim 54, further comprising administering at least one additional antitumor agent or therapy to the subject.

59. The method of claim 58, wherein said at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, an immune checkpoint inhibitor, radiotherapy or surgery.

60-72. (canceled)

73. The vehicle of claim 35, which is a liposome.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0050] In the appended drawings:

[0051] FIG. 1A shows the workflow for the analysis of native and TMT-labeled MHC I peptides. B-LCL cells were lysed and MHC I peptides purified by immunopurification. Half of the purified peptides were labeled with TMT, and both native and TMT-labeled peptides were analyzed by LC-MS/MS.

[0052] FIG. 1B shows the distribution of unique peptides and FIG. 1C shows their corresponding PEAKS scores.

[0053] FIG. 1D shows the number of identifications for unique and common peptides according to the charge state. Correlation of retention time (e) and intensity (f) for native and TMT-labeled MHC I peptides.

[0054] FIGS. 2A-C show the fragmentation patterns of native and TMT-labeled MHC I peptides. FIG. 2A shows the distribution of sequence ions according to fragment ion types. FIG. 2B shows the identification of MHC I peptides for different HLA allele groups. FIG. 2C shows the average number of a, b, and y-type fragment ions identified for each HLA allele group.

[0055] FIG. 3A is a schematic of workflow for the analysis of native and TMT-labeled MHC I peptides. Human B-ALL cells (10H080) were transplanted into NSG mice, spleen was excised 30-60 d post-injection, and leukemic cells isolated by density gradient. B-ALL cells were lysed and MHC I peptides isolated by immunoaffinity purification. Half of the purified peptides were subjected to TMT labeling prior to LC-MS/MS analyses of both native and TMT-labeled peptides.

[0056] FIG. 3B shows the distribution of unique identification for native and TMT-labeled peptides. FIG. 3C shows the identification of MHC I peptides for different HLA allele groups. FIG. 3D shows the number of TMT-labeled peptides identified from an increasing amount of isolated B-ALL cells.

[0057] FIG. 4A depicts a pie chart showing the translational reading frame (inner circle) and the detailed genomic origin (outer circle) of TSAs (n=92) identified from a total of 17 ALL samples.

[0058] FIG. 4B shows a mirror plot of IESEDFGFWSL for TMT-labeled endogenous TSA (bottom) and its corresponding synthetic peptides (top). Retention time and Pearson correlation coefficient are shown.

[0059] FIG. 5A depicts an experimental workflow showing the TMT labeling scheme for the endogenous MHC I peptides (TMT-126) and the synthetic peptides of increasing amounts (TMT127C-TMT131). Note that TMT 127C is left empty to determine the extent of interfering ions. Samples are analyzed in triplicates using LC-MS/MS with SPS, FAIMS, and MS2 only.

[0060] FIG. 5B shows the MiHA expression levels (#molecule/cell) obtained for all three LC-MS/MS approaches. Error bar indicates standard deviation observed on measurements.

[0061] FIG. 6A shows a comparison of the number of native and TMT-labeled MHC I peptides identified under different gradient elution conditions.

[0062] FIG. 6B depicts Venn diagrams showing the overlap of identified MHC I peptides for different gradient elution conditions.

[0063] FIG. 6C shows the overlap in the number of identifications for native and TMT-labeled MHC I peptides across replicate injections.

[0064] FIGS. 7A-F show comparison of MHC I peptide intensities obtained between different gradient elution conditions. Native MHC I peptides intensities at 90 and 180 min (FIG. 7A) 90 and 240 min (FIG. 7B) and 180 and 240 min (FIG. 7C) gradient elution. TMT-labeled MHC I peptides intensities at 90 and 180 min (FIG. 7D) 90 and 240 min (FIG. 7E) and 180 and 240 min (FIG. 7F) gradient elution.

[0065] FIG. 8 shows the distribution of fragment ions for native and TMT-labeled MHC I peptides from B-LCL cells.

[0066] FIG. 9A depicts a Venn diagram showing the number of identified MHC I peptides for 20, 60 and 100 million B-ALL cells (triplicate injection).

[0067] FIG. 9B shows the overlap of peptide identification across triplicate injection.

[0068] FIGS. 10A-V show mirror plots of all TMT-labeled aeTSA peptides identified from 10H080 sample and their synthetic counterparts.

DISCLOSURE OF INVENTION

[0069] Terms and symbols of genetics, molecular biology, biochemistry and nucleic acid used herein follow those of standard treatises and texts in the field, e.g. Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like. All terms are to be understood with their typical meanings established in the relevant art.

[0070] The articles “a” and “an” are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. Throughout this specification, unless the context requires otherwise, the words “comprise,” “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0071] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All subsets of values within the ranges are also incorporated into the specification as if they were individually recited herein.

[0072] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.

[0073] The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0074] No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0075] Herein, the term “about” has its ordinary meaning. The term “about” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value, or encompass values close to the recited values, for example within 10% or 5% of the recited values (or range of values).

[0076] In the studies described herein, the present inventors have identified TSA candidates from an ALL specimen using a proteogenomic-based approach using isobaric peptide labeling with tandem mass tag (TMT). A large fraction of these TSAs derived from aberrantly expressed unmutated genomic sequences which are not expressed in normal tissues, such as non-exonic sequences (e.g., intronic and intergenic sequences). The novel ALL TSA candidates identified herein may be useful, e.g., for leukemia T-cell based immunotherapy.

[0077] Accordingly, in an aspect, the present disclosure relates to a leukemia tumor antigen peptide (or leukemia tumor-specific peptide) comprising, or consisting of, one of the following amino acid sequences:

TABLE-US-00006 SEQ SEQ SEQ ID ID ID Sequence NO: Sequence NO: Sequence NO: NEQTTILY 1 LLGLPQPPK 31 GEFLVPLSL 61 ALFSNEVSL 2 LSSRLPLGK 32 GEVDGAQQAM 62 FIPDLFTEL 3 NLLFSRVFK 33 IEEVSQGLL 63 FLLDHILTI 4 STGVLTVLK 34 IESEDFGFWSL 64 FLLESRETL 5 SVFDRTNNR 35 LENSGFILI 65 FLLPTSLSL 6 SVVPHPLQK 36 REPLEILITL 66 FLLSDELLL 7 TTSSIYIRK 37 EETDAYKSL 67 GLATAVWLL 8 LYTFIKHEF 38 SELQLPVTF 68 GLLTASIFL 9 SYFDPSYSNF 39 QEIATSHNI 69 GTLCLLTFI 10 SYLASFLLY 40 AQFLLFIA 70 KLLQPLPIT 11 VYSPSPLNF 41 FEISSVTTA 71 LLQNLIVLL 12 VYTQVSAF 42 KEVGGLRSA 72 LLSLYLVSI 13 YSVLTVTF 43 TEFGPVIG 73 LMLLFVVLL 14 NLGLFLSY 44 ISLPALEVL 74 SLANETHTL 15 AVGGFRSSW 45 LPSPPLPPSL 75 VLLDFPALL 16 SQVQAVLLAW 46 LYLPSVVLI 76 VLLSKILYP 17 QTNSGSLAR 47 RPPAPLLPVL 77 WLVEKLSGV 18 DVAGVGMPK 48 SLHYSVSL 78 YLFAHSIIL 19 DVMASLARV 49 SLPDHQGVL 79 YLGYAVAV 20 EVGAVFAVL 50 EAVSQGKDF 80 YLQEISLRL 21 VVADILLSV 51 YSSYLSIHY 81 SLLGIGLLA 22 SSLSGPVSSL 52 ASLGLSLAL 82 AAMESPIQSK 23 AFRVIVAL 53 LCHRTPPSL 83 ALFGFVGFPNK 24 EHYNKVVVM 54 LSISPFQAI 84 ALFVLTSIK 25 VQAQVLEAI 55 GWGGSPLYL 85 ATSLTIQEK 26 NNMAIIYSY 56 YFDPSYSNF 86 AVAVPLLPR 27 EPSHSINVY 57 ISLSSIVSV 87 GTISGGFFK 28 IPVGSGLGYVL 58 LSISSLVSV 88 GVANSLLK 29 DHDIGVYSV 59 GVSPVLFLK 30 HFEWQPPL 60

[0078] In general, peptides such as tumor antigen peptides (TAPs) presented in the context of HLA class I vary in length from about 7 or 8 to about 15, or preferably 8 to 14 amino acid residues. In some embodiments of the methods of the disclosure, longer peptides comprising the TAP sequences defined herein are artificially loaded into cells such as antigen presenting cells (APCs), processed by the cells and the TAP is presented by MHC class I molecules at the surface of the APC. In this method, peptides/polypeptides longer than 15 amino acid residues can be loaded into APCs, are processed by proteases in the APC cytosol providing the corresponding TAP as defined herein for presentation. In some embodiments, the precursor peptide/polypeptide that is used to generate the TAP defined herein is for example 1000, 500, 400, 300, 200, 150, 100, 75, 50, 45, 40, 35, 30, 25, 20 or 15 amino acids or less. Thus, all the methods and processes using the TAPs described herein include the use of longer peptides or polypeptides (including the native protein), i.e. tumor antigen precursor peptides/polypeptides, to induce the presentation of the “final” 8-14 TAP following processing by the cell (APCs). In some embodiments, the herein-mentioned TAP is about 8 to 14, 8 to 13, or 8 to 12 amino acids long (e.g., 8, 9, 10, 11, 12 or 13 amino acids long), small enough for a direct fit in an HLA class I molecule. In an embodiment, the TAP comprises 20 amino acids or less, preferably 15 amino acids or less, more preferably 14 amino acids or less. In an embodiment, the TAP comprises at least 7 amino acids, preferably at least 8 amino acids or less, more preferably at least 9 amino acids.

[0079] The term “amino acid” as used herein includes both L- and D-isomers of the naturally occurring amino acids as well as other amino acids (e.g., naturally-occurring amino acids, non-naturally-occurring amino acids, amino acids which are not encoded by nucleic acid sequences, etc.) used in peptide chemistry to prepare synthetic analogs of TAPs. Examples of naturally occurring amino acids are glycine, alanine, valine, leucine, isoleucine, serine, threonine, etc. Other amino acids include for example non-genetically encoded forms of amino acids, as well as a conservative substitution of an L-amino acid. Naturally-occurring non-genetically encoded amino acids include, for example, beta-alanine, 3-amino-propionic acid, 2,3-diaminopropionic acid, alpha-aminoisobutyric acid (Aib), 4-amino-butyric acid, N-methylglycine (sarcosine), hydroxyproline, ornithine (e.g., L-ornithine), citrulline, t-butylalanine, t-butylglycine, N-methylisoleucine, phenylglycine, cyclohexylalanine, norleucine (Nle), norvaline, 2-napthylalanine, pyridylalanine, 3-benzothienyl alanine, 4-chlorophenylalanine, 2-fluorophenylalanine, 3-fluorophenylalanine, 4-fluorophenylalanine, penicillamine, 1,2,3,4-tetrahydro-isoquinoline-3-carboxylix acid, beta-2-thienylalanine, methionine sulfoxide, L-homoarginine (Hoarg), N-acetyl lysine, 2-amino butyric acid, 2-amino butyric acid, 2,4,-diaminobutyric acid (D- or L-), p-aminophenylalanine, N-methylvaline, homocysteine, homoserine (HoSer), cysteic acid, epsilon-amino hexanoic acid, delta-amino valeric acid, or 2,3-diaminobutyric acid (D- or L-), etc. These amino acids are well known in the art of biochemistry/peptide chemistry. In an embodiment, the TAP comprises only naturally-occurring amino acids.

[0080] In embodiments, the TAPs described herein include peptides with altered sequences containing substitutions of functionally equivalent amino acid residues, relative to the herein-mentioned sequences. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity (having similar physico-chemical properties) which acts as a functional equivalent, resulting in a silent alteration. Substitution for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, positively charged (basic) amino acids include arginine, lysine and histidine (as well as homoarginine and ornithine). Nonpolar (hydrophobic) amino acids include leucine, isoleucine, alanine, phenylalanine, valine, proline, tryptophan and methionine. Uncharged polar amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine. Negatively charged (acidic) amino acids include glutamic acid and aspartic acid. The amino acid glycine may be included in either the nonpolar amino acid family or the uncharged (neutral) polar amino acid family. Substitutions made within a family of amino acids are generally understood to be conservative substitutions. The herein-mentioned TAP may comprise all L-amino acids, all D-amino acids or a mixture of L- and D-amino acids. In an embodiment, the herein-mentioned TAP comprises all L-amino acids.

[0081] In an embodiment, in the sequences of the TAPs comprising or consisting of one of sequences of SEQ ID NOs: 1-88, the amino acid residues that do not substantially contribute to interactions with the T-cell receptor may be modified by replacement with other amino acid whose incorporation does not substantially affect T-cell reactivity and does not eliminate binding to the relevant MHC.

[0082] The TAP may also be N- and/or C-terminally capped or modified to prevent degradation, increase stability, affinity and/or uptake. Thus, in another aspect, the present disclosure provides a modified TAP of the formula Z.sup.1—X—Z.sup.2, wherein X is a TAP comprising, or consisting of, one of the amino acid sequences of SEQ ID NOs: 1-88.

[0083] In an embodiment, the amino terminal residue (i.e., the free amino group at the N-terminal end) of the TAP is modified (e.g., for protection against degradation), for example by covalent attachment of a moiety/chemical group (Z.sup.1). Z.sup.1 may be a straight chained or branched alkyl group of one to eight carbons, or an acyl group (R—CO—), wherein R is a hydrophobic moiety (e.g., acetyl, propionyl, butanyl, iso-propionyl, or iso-butanyl), or an aroyl group (Ar—CO—), wherein Ar is an aryl group. In an embodiment, the acyl group is a C.sub.1-C.sub.16 or C.sub.3-C.sub.16 acyl group (linear or branched, saturated or unsaturated), in a further embodiment, a saturated C.sub.1-C.sub.6 acyl group (linear or branched) or an unsaturated C.sub.3-C.sub.6 acyl group (linear or branched), for example an acetyl group (CH.sub.3—CO—, Ac). In an embodiment, Z.sup.1 is absent. The carboxy terminal residue (i.e., the free carboxy group at the C-terminal end of the TAP) of the TAP may be modified (e.g., for protection against degradation), for example by amidation (replacement of the OH group by a NH.sub.2 group), thus in such a case Z.sup.2 is a NH.sub.2 group. In an embodiment, Z.sup.2 may be an hydroxamate group, a nitrile group, an amide (primary, secondary or tertiary) group, an aliphatic amine of one to ten carbons such as methyl amine, iso-butylamine, iso-valerylamine or cyclohexylamine, an aromatic or arylalkyl amine such as aniline, napthylamine, benzylamine, cinnamylamine, or phenylethylamine, an alcohol or CH.sub.2OH. In an embodiment, Z.sup.2 is absent. In an embodiment, the TAP comprises one of the amino acid sequences of SEQ ID NOs: 1-88. In an embodiment, the TAP consists of one of the amino acid sequences of SEQ ID NOs: 1-88, i.e. wherein Z.sup.1 and Z.sup.2 are absent.

[0084] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*01:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 1.

[0085] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*02:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 2-22. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes.sup.43), the above-identified TAP may further bind to HLA-A*02:05, HLA-A*02:06 and/or HLA-A*02:07 molecules.

[0086] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*11:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 23-37. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-A*03:01, HLA-A*31:01 and/or HLA-A*68:01 molecules.

[0087] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*24:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 38-43. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-A*23:01 molecules. In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*29:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 44. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-A*30:02 and/or HLA-B*15:02 molecules.

[0088] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*32:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 45 or 46. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*57:01 and/or HLA-B*58:01 molecules.

[0089] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*66:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 47. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-A*25:01 and/or HLA-A*26:01 molecules.

[0090] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*68:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 48. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-A*11:01, HLA-A*31:01, HLA-A*33:01 and/or HLA-A*33:03 molecules.

[0091] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-A*68:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 49-51.

[0092] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*07:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 52. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*35:02, HLA-B*35:03, HLA-B*55:01 and/or HLA-B*56:01 molecules.

[0093] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*08:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 53.

[0094] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*14:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 54. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*39:01 molecules.

[0095] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*15:10 molecule, comprising or consisting of the sequence of SEQ ID NO: 55.

[0096] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*18:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 56. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*40:01, HLA-B*44:02, HLA-B*44:03 and/or HLA-B*45:01 molecules.

[0097] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*35:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 57 or 58. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*15:02, HLA-B*35:02, HLA-B*35:03 and/or HLA-B*53:01 molecules.

[0098] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*39:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 59 or 60. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*14:02 and/or HLA-B*38:01 molecules.

[0099] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*40:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 61-66. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*18:01, HLA-B*40:02, HLA-B*41:02, HLA-B*44:02, HLA-B*44:03 and/or HLA-B*45:01 molecules.

[0100] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*44:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 67 or 68. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*18:01, HLA-B*40:01, HLA-B*40:02, HLA-B*41:02, HLA-B*44:03 and/or HLA-B*45:01 molecules.

[0101] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*49:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 69.

[0102] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-B*50:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 70-73.

[0103] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-C*01:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 74-79.

[0104] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-C*02:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 80 or 81.

[0105] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-C*03:04 molecule, comprising or consisting of the sequence of SEQ ID NO: 82-84. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-B*46:01, HLA-C*03:02, HLA-C*03:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C*15:02 and/or HLA-C*16:01 molecules.

[0106] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-C*04:01 molecule, comprising or consisting of the sequence of SEQ ID NO: 85 or 86. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-C*07:02 and/or HLA-C*14:02 molecules.

[0107] In another aspect, the present disclosure provides a leukemia TAP (or tumor-specific peptide), preferably an ALL TAP, binding to an HLA-C*15:02 molecule, comprising or consisting of the sequence of SEQ ID NO: 87 or 88. Because HLA alleles show promiscuity (certain HLA alleles present similar epitopes), the above-identified TAP may further bind to HLA-C*03:03, HLA-C*03:04, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02 and/or HLA-C*12:03 molecules.

[0108] In an embodiment, the TAP is encoded by a sequence located a non-protein coding region of the genome. In an embodiment, the TAP is encoded by a sequence located in an untranslated transcribed region (UTR), i.e. a 3′-UTR or 5′-UTR region. In another embodiment, the TAP is encoded by a sequence located in an intron. In another embodiment, the TAP is encoded by a sequence located in an intergenic region. In another embodiment, the TAP is encoded by a sequence located in an exon and originates from a frameshift.

[0109] The TAPs of the disclosure may be produced by expression in a host cell comprising a nucleic acid encoding the TAPs (recombinant expression) or by chemical synthesis (e.g., solid-phase peptide synthesis). Peptides can be readily synthesized by manual and/or automated solid phase procedures well known in the art. Suitable syntheses can be performed for example by utilizing “T-boc” or “Fmoc” procedures. Techniques and procedures for solid phase synthesis are described in for example Solid Phase Peptide Synthesis: A Practical Approach, by E. Atherton and R. C. Sheppard, published by IRL, Oxford University Press, 1989. Alternatively, the MiHA peptides may be prepared by way of segment condensation, as described, for example, in Liu et al., Tetrahedron Lett. 37: 933-936, 1996; Baca et al., J. Am. Chem. Soc. 117: 1881-1887, 1995; Tam et al., Int. J. Peptide Protein Res. 45: 209-216, 1995; Schnolzer and Kent, Science 256: 221-225, 1992; Liu and Tam, J. Am. Chem. Soc. 116: 4149-4153, 1994; Liu and Tam, Proc. Natl. Acad. Sci. USA 91: 6584-6588, 1994; and Yamashiro and Li, Int. J. Peptide Protein Res. 31: 322-334, 1988). Other methods useful for synthesizing the TAPs are described in Nakagawa et al., J. Am. Chem. Soc. 107: 7087-7092, 1985. In an embodiment, the TAP is chemically synthesized (synthetic peptide). Another embodiment of the present disclosure relates to a non-naturally occurring peptide wherein said peptide consists or consists essentially of an amino acid sequences defined herein and has been synthetically produced (e.g. synthesized) as a pharmaceutically acceptable salt. The salts of the TAPs according to the present disclosure differ substantially from the peptides in their state(s) in vivo, as the peptides as generated in vivo are no salts. The non-natural salt form of the peptide may modulate the solubility of the peptide, in particular in the context of pharmaceutical compositions comprising the peptides, e.g. the peptide vaccines as disclosed herein. Preferably, the salts are pharmaceutically acceptable salts of the peptides.

[0110] In an embodiment, the herein-mentioned TAP is substantially pure. A compound is “substantially pure” when it is separated from the components that naturally accompany it. Typically, a compound is substantially pure when it is at least 60%, more generally 75%, 80% or 85%, preferably over 90% and more preferably over 95%, by weight, of the total material in a sample. Thus, for example, a polypeptide that is chemically synthesized or produced by recombinant technology will generally be substantially free from its naturally associated components, e.g. components of its source macromolecule. A nucleic acid molecule is substantially pure when it is not immediately contiguous with (i.e., covalently linked to) the coding sequences with which it is normally contiguous in the naturally occurring genome of the organism from which the nucleic acid is derived. A substantially pure compound can be obtained, for example, by extraction from a natural source; by expression of a recombinant nucleic acid molecule encoding a peptide compound; or by chemical synthesis. Purity can be measured using any appropriate method such as column chromatography, gel electrophoresis, HPLC, etc. In an embodiment, the TAP is in solution. In another embodiment, the TAP is in solid form, e.g., lyophilized.

[0111] In another aspect, the disclosure further provides a nucleic acid (isolated) encoding the herein-mentioned TAPs or a tumor antigen precursor-peptide. In an embodiment, the nucleic acid comprises from about 21 nucleotides to about 45 nucleotides, from about 24 to about 45 nucleotides, for example 24, 27, 30, 33, 36, 39, 42 or 45 nucleotides. “Isolated”, as used herein, refers to a peptide or nucleic molecule separated from other components that are present in the natural environment of the molecule or a naturally occurring source macromolecule (e.g., including other nucleic acids, proteins, lipids, sugars, etc.). “Synthetic”, as used herein, refers to a peptide or nucleic molecule that is not isolated from its natural sources, e.g., which is produced through recombinant technology or using chemical synthesis. In an embodiment, the nucleic acid (DNA, RNA) encoding the TAP of the disclosure comprises any one of the sequences defined in SEQ ID NOs: 93-180 or a corresponding RNA sequence. In an embodiment, the nucleic acid encoding the TAP is an mRNA molecule.

[0112] A nucleic acid of the disclosure may be used for recombinant expression of the TAP of the disclosure, and may be included in a vector or plasmid, such as a cloning vector or an expression vector, which may be transfected into a host cell. In an embodiment, the disclosure provides a cloning, expression or viral vector or plasmid comprising a nucleic acid sequence encoding the TAP of the disclosure. Alternatively, a nucleic acid encoding a TAP of the disclosure may be incorporated into the genome of the host cell. In either case, the host cell expresses the TAP or protein encoded by the nucleic acid. The term “host cell” as used herein refers not only to the particular subject cell, but to the progeny or potential progeny of such a cell. A host cell can be any prokaryotic (e.g., E. coli) or eukaryotic cell (e.g., insect cells, yeast or mammalian cells) capable of expressing the TAPs described herein. The vector or plasmid contains the necessary elements for the transcription and translation of the inserted coding sequence, and may contain other components such as resistance genes, cloning sites, etc. Methods that are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding peptides or polypeptides and appropriate transcriptional and translational control/regulatory elements operably linked thereto. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y. “Operably linked” refers to a juxtaposition of components, particularly nucleotide sequences, such that the normal function of the components can be performed. Thus, a coding sequence that is operably linked to regulatory sequences refers to a configuration of nucleotide sequences wherein the coding sequences can be expressed under the regulatory control, that is, transcriptional and/or translational control, of the regulatory sequences. “Regulatory/control region” or “regulatory/control sequence”, as used herein, refers to the non-coding nucleotide sequences that are involved in the regulation of the expression of a coding nucleic acid. Thus, the term regulatory region includes promoter sequences, regulatory protein binding sites, upstream activator sequences, and the like. The vector (e.g., expression vector) may have the necessary 5′ upstream and 3′ downstream regulatory elements such as promoter sequences such as CMV, PGK and EFIa promoters, ribosome recognition and binding TATA box, and 3′ UTR AAUAAA transcription termination sequence for the efficient gene transcription and translation in its respective host cell. Other suitable promoters include the constitutive promoter of simian vims 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), HIV LTR promoter, MoMuLV promoter, avian leukemia virus promoter, EBV immediate early promoter, and Rous sarcoma vims promoter. Human gene promoters may also be used, including, but not limited to the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. In certain embodiments inducible promoters are also contemplated as part of the vectors expressing the TAP. This provides a molecular switch capable of turning on expression of the polynucleotide sequence of interest or turning off expression. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, or a tetracycline promoter. Examples of vectors are plasmid, autonomously replicating sequences, and transposable elements. Additional exemplary vectors include, without limitation, plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or PI-derived artificial chromosome (PAC), bacteriophages such as lambda phage or M13 phage, and animal viruses. Examples of categories of animal viruses useful as vectors include, without limitation, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (e.g., SV40). Examples of expression vectors are Lenti-X™ Bicistronic Expression System (Neo) vectors (Clontrch), pCIneo vectors (Promega) for expression in mammalian cells; pLenti4A/5-DEST™, pLenti6/V5-DEST™, and pLenti6.2N5-GW/lacZ (Invitrogen) for lentivirus-mediated gene transfer and expression in mammalian cells. The coding sequences of the TAPs disclosed herein can be ligated into such expression vectors for the expression of the TAP in mammalian cells.

[0113] In certain embodiments, the nucleic acids encoding the TAP of the present disclosure are provided in a viral vector. A viral vector can be those derived from retrovirus, lentivirus, or foamy virus. As used herein, the term, “viral vector,” refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain the coding sequence for the various proteins described herein in place of nonessential viral genes. The vector and/or particle can be utilized for the purpose of transferring DNA, RNA or other nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.

[0114] In embodiment, the nucleic acid (DNA, RNA) encoding the TAP of the disclosure is comprised within a liposome or any other suitable vehicle.

[0115] In another aspect, the present disclosure provides an MHC class I molecule comprising (i.e. presenting or bound to) one or more of the TAP of SEQ ID NOs: 1-88. In an embodiment, the MHC class I molecule is an HLA-A1 molecule, in a further embodiment an HLA-A*01:01 molecule. In an embodiment, the MHC class I molecule is an HLA-A2 molecule, in a further embodiment an HLA-A*02:01 molecule. In another embodiment, the MHC class I molecule is an HLA-A11 molecule, in a further embodiment an HLA-A*11:01 molecule. In an embodiment, the MHC class I molecule is an HLA-A24 molecule, in a further embodiment an HLA-A*24:02 molecule. In an embodiment, the MHC class I molecule is an HLA-A29 molecule, in a further embodiment an HLA-A*29:02 molecule. In an embodiment, the MHC class I molecule is an HLA-A32 molecule, in a further embodiment an HLA-A*32:01 molecule. In an embodiment, the MHC class I molecule is an HLA-A66 molecule, in a further embodiment an HLA-A*66:01 molecule. In an embodiment, the MHC class I molecule is an HLA-A68 molecule, in a further embodiment an HLA-A*68:01 or HLA-A*68:02 molecule. In another embodiment, the MHC class I molecule is an HLA-B07 molecule, in a further embodiment an HLA-B*07:02 molecule. In another embodiment, the MHC class I molecule is an HLA-B08 molecule, in a further embodiment an HLA-B*08:01 molecule. In another embodiment, the MHC class I molecule is an HLA-B14 molecule, in a further embodiment an HLA-B*14:02 molecule. In another embodiment, the MHC class I molecule is an HLA-B15 molecule, in a further embodiment an HLA-B*15:10 molecule. In another embodiment, the MHC class I molecule is an HLA-B18 molecule, in a further embodiment an HLA-B*18:01 molecule. In another embodiment, the MHC class I molecule is an HLA-B35 molecule, in a further embodiment an HLA-B*35:01 molecule. In another embodiment, the MHC class I molecule is an HLA-B39 molecule, in a further embodiment an HLA-B*39:01 molecule. In another embodiment, the MHC class I molecule is an HLA-B40 molecule, in a further embodiment an HLA-B*40:01 molecule. In another embodiment, the MHC class I molecule is an HLA-B44 molecule, in a further embodiment an HLA-B*44:02 molecule. In another embodiment, the MHC class I molecule is an HLA-B49 molecule, in a further embodiment an HLA-B*49:01 molecule. In another embodiment, the MHC class I molecule is an HLA-B50 molecule, in a further embodiment an HLA-B*50:01 molecule. In another embodiment, the MHC class I molecule is an HLA-001 molecule, in a further embodiment an HLA-C*01:02 molecule. In another embodiment, the MHC class I molecule is an HLA-C02 molecule, in a further embodiment an HLA-C*02:02 molecule. In another embodiment, the MHC class I molecule is an HLA-C03 molecule, in a further embodiment an HLA-C*03:04 molecule. In another embodiment, the MHC class I molecule is an HLA-004 molecule, in a further embodiment an HLA-C*04:01 molecule. In another embodiment, the MHC class I molecule is an HLA-C15 molecule, in a further embodiment an HLA-C*15:02 molecule.

[0116] In an embodiment, the TAP (e.g., SEQ ID NOs: 1-88) is non-covalently bound to the MHC class I molecule (i.e., the TAP is loaded into, or non-covalently bound to the peptide binding groove/pocket of the MHC class I molecule). In another embodiment, the TAP is covalently attached/bound to the MHC class I molecule (alpha chain). In such a construct, the TAP and the MHC class I molecule (alpha chain) are produced as a synthetic fusion protein, typically with a short (e.g., 5 to 20 residues, preferably about 8-12, e.g., 10) flexible linker or spacer (e.g., a polyglycine linker). In another aspect, the disclosure provides a nucleic acid encoding a fusion protein comprising a TAP defined herein fused to a MHC class I molecule (alpha chain). In an embodiment, the MHC class I molecule (alpha chain)—peptide complex is multimerized. Accordingly, in another aspect, the present disclosure provides a multimer of MHC class I molecule loaded (covalently or not) with the herein-mentioned TAP. Such multimers may be attached to a tag, for example a fluorescent tag, which allows the detection of the multimers. A great number of strategies have been developed for the production of MHC multimers, including MHC dimers, tetramers, pentamers, octamers, etc. (reviewed in Bakker and Schumacher, Current Opinion in Immunology 2005, 17:428-433). MHC multimers are useful, for example, for the detection and purification of antigen-specific T cells. Thus, in another aspect, the present disclosure provides a method for detecting or purifying (isolating, enriching) CD8.sup.+ T lymphocytes specific for a TAP defined herein, the method comprising contacting a cell population with a multimer of MHC class I molecule loaded (covalently or not) with the TAP; and detecting or isolating the CD8.sup.+ T lymphocytes bound by the MHC class I multimers. CD8.sup.+ T lymphocytes bound by the MHC class I multimers may be isolated using known methods, for example fluorescence activated cell sorting (FACS) or magnetic activated cell sorting (MACS).

[0117] In yet another aspect, the present disclosure provides a cell (e.g., a host cell), in an embodiment an isolated cell, comprising the herein-mentioned nucleic acid, vector or plasmid of the disclosure, i.e. a nucleic acid or vector encoding one or more TAPs. In another aspect, the present disclosure provides a cell expressing at its surface an MHC class I molecule (e.g., an MHC class I molecule of one of the alleles disclosed above) bound to or presenting a TAP according to the disclosure. In one embodiment, the host cell is a eukaryotic cell, such as a mammalian cell, preferably a human cell. a cell line or an immortalized cell. In another embodiment, the cell is an antigen-presenting cell (APC). In one embodiment, the host cell is a primary cell, a cell line or an immortalized cell. In another embodiment, the cell is an antigen-presenting cell (APC). Nucleic acids and vectors can be introduced into cells via conventional transformation or transfection techniques. The terms “transformation” and “transfection” refer to techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection and viral-mediated transfection. Suitable methods for transforming or transfecting host cells can for example be found in Sambrook et al. (supra), and other laboratory manuals. Methods for introducing nucleic acids into mammalian cells in vivo are also known, and may be used to deliver the vector or plasmid of the disclosure to a subject for gene therapy.

[0118] Cells such as APCs can be loaded with one or more TAPs using a variety of methods known in the art. As used herein “loading a cell” with a TAP means that RNA or DNA encoding the TAP, or the TAP, is transfected into the cells or alternatively that the APC is transformed with a nucleic acid encoding the TAP. The cell can also be loaded by contacting the cell with exogenous TAPs that can bind directly to MHC class I molecule present at the cell surface (e.g., peptide-pulsed cells). The TAPs may also be fused to a domain or motif that facilitates its presentation by MHC class I molecules, for example to an endoplasmic reticulum (ER) retrieval signal, a C-terminal Lys-Asp-Glu-Leu sequence (see Wang et al., Eur J Immunol. 2004 December; 34(12):3582-94).

[0119] In another aspect, the present disclosure provides a composition or peptide combination/pool comprising any one of, or any combination of, the TAPs defined herein (or a nucleic acid encoding said peptide(s)). In an embodiment, the composition comprises any combination of the TAPs defined herein (any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more TAPs), or a combination of nucleic acids encoding said TAPs). Compositions comprising any combination/sub-combination of the TAPs defined herein are encompassed by the present disclosure. In another embodiment, the combination or pool may comprise one or more known tumor antigens.

[0120] Thus, in another aspect, the present disclosure provides a composition comprising any one of, or any combination of, the TAPs defined herein (e.g., SEQ ID NOs: 1-88) and a cell expressing a MHC class I molecule (e.g., a MHC class I molecule of one of the alleles disclosed above). APC for use in the present disclosure are not limited to a particular type of cell and include professional APCs such as dendritic cells (DCs), Langerhans cells, macrophages and B cells, which are known to present proteinaceous antigens on their cell surface so as to be recognized by CD8.sup.+ T lymphocytes. For example, an APC can be obtained by inducing DCs from peripheral blood monocytes and then contacting (stimulating) the TAPs, either in vitro, ex vivo or in vivo. APC can also be activated to present a TAP in vivo where one or more of the TAPs of the disclosure are administered to a subject and APCs that present a TAP are induced in the body of the subject. The phrase “inducing an APC” or “stimulating an APC” includes contacting or loading a cell with one or more TAPs, or nucleic acids encoding the TAPs such that the TAPs are presented at its surface by MHC class I molecules. As noted herein, according to the present disclosure, the TAPs may be loaded indirectly for example using longer peptides/polypeptides comprising the sequence of the TAPs (including the native protein), which is then processed (e.g., by proteases) inside the APCs to generate the TAP/MHC class I complexes at the surface of the cells. After loading APCs with TAPs and allowing the APCs to present the TAPs, the APCs can be administered to a subject as a vaccine. For example, the ex vivo administration can include the steps of: (a) collecting APCs from a first subject, (b) contacting/loading the APCs of step (a) with a TAP to form MHC class I/TAP complexes at the surface of the APCs; and (c) administering the peptide-loaded APCs to a second subject in need for treatment.

[0121] The first subject and the second subject may be the same subject (e.g., autologous vaccine), or may be different subjects (e.g., allogeneic vaccine). Alternatively, according to the present disclosure, use of a TAP described herein (or a combination thereof) for manufacturing a composition (e.g., a pharmaceutical composition) for inducing antigen-presenting cells is provided. In addition, the present disclosure provides a method or process for manufacturing a pharmaceutical composition for inducing antigen-presenting cells, wherein the method or the process includes the step of admixing or formulating the TAP, or a combination thereof, with a pharmaceutically acceptable carrier. Cells such as APCs expressing a MHC class I molecule (e.g., any of the above-noted HLA molecules) loaded with any one of, or any combination of, the TAPs defined herein, may be used for stimulating/amplifying CD8.sup.+ T lymphocytes, for example autologous CD8.sup.+ T lymphocytes. Accordingly, in another aspect, the present disclosure provides a composition comprising any one of, or any combination of, the TAPs defined herein (or a nucleic acid or vector encoding same); a cell expressing an MHC class I molecule and a T lymphocyte, more specifically a CD8.sup.+ T lymphocyte (e.g., a population of cells comprising CD8.sup.+ T lymphocytes).

[0122] In an embodiment, the composition further comprises a buffer, an excipient, a carrier, a diluent and/or a medium (e.g., a culture medium). In a further embodiment, the buffer, excipient, carrier, diluent and/or medium is/are pharmaceutically acceptable buffer(s), excipient(s), carrier(s), diluent(s) and/or medium (media). As used herein “pharmaceutically acceptable buffer, excipient, carrier, diluent and/or medium” includes any and all solvents, buffers, binders, lubricants, fillers, thickening agents, disintegrants, plasticizers, coatings, barrier layer formulations, lubricants, stabilizing agent, release-delaying agents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and the like that are physiologically compatible, do not interfere with effectiveness of the biological activity of the active ingredient(s) and that are not toxic to the subject. The use of such media and agents for pharmaceutically active substances is well known in the art (Rowe et al., Handbook of pharmaceutical excipients, 2003, 4.sup.th edition, Pharmaceutical Press, London UK). Except insofar as any conventional media or agent is incompatible with the active compound (peptides, cells), use thereof in the compositions of the disclosure is contemplated. In an embodiment, the buffer, excipient, carrier and/or medium is a non-naturally occurring buffer, excipient, carrier and/or medium. In an embodiment, one or more of the TAPs defined herein, or the nucleic acids (e.g., mRNAs) encoding said one or more TAPs, are comprised within or complexed to a liposome, e.g., a cationic liposome (see, e.g., Vitor M T et al., Recent Pat Drug Deliv Formul. 2013 August; 7(2):99-110) or suitable other carriers.

[0123] In another aspect, the present disclosure provides a composition comprising one of more of the any one of, or any combination of, the TAPs defined herein (e.g., SEQ ID NOs: 1-88) (or a nucleic acid encoding said peptide(s)), and a buffer, an excipient, a carrier, a diluent and/or a medium. For compositions comprising cells (e.g., APCs, T lymphocytes), the composition comprises a suitable medium that allows the maintenance of viable cells. Representative examples of such media include saline solution, Earl's Balanced Salt Solution (Life Technologies®) or PlasmaLyte® (Baxter Internationale). In an embodiment, the composition (e.g., pharmaceutical composition) is an “immunogenic composition”, “vaccine composition” or “vaccine”. The term “Immunogenic composition”, “vaccine composition” or “vaccine” as used herein refers to a composition or formulation comprising one or more TAPs or vaccine vector and which is capable of inducing an immune response against the one or more TAPs present therein when administered to a subject. Vaccination methods for inducing an immune response in a mammal comprise use of a vaccine or vaccine vector to be administered by any conventional route known in the vaccine field, e.g., via a mucosal (e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) surface, via a parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route, or topical administration (e.g., via a transdermal delivery system such as a patch). In an embodiment, the TAP (or a combination thereof) is conjugated to a carrier protein (conjugate vaccine) to increase the immunogenicity of the TAP(s). The present disclosure thus provides a composition (conjugate) comprising a TAP (or a combination thereof), or a nucleic acid encoding the TAP or combination thereof, and a carrier protein. For example, the TAP(s) or nucleic acid(s) may be conjugated or complexed to a Toll-like receptor (TLR) ligand (see, e.g., Zom et al., Adv Immunol. 2012, 114: 177-201) or polymers/dendrimers (see, e.g., Liu et al., Biomacromolecules. 2013 Aug. 12; 14(8):2798-806). In an embodiment, the immunogenic composition or vaccine further comprises an adjuvant. “Adjuvant” refers to a substance which, when added to an immunogenic agent such as an antigen (TAPs, nucleic acids and/or cells according to the present disclosure), nonspecifically enhances or potentiates an immune response to the agent in the host upon exposure to the mixture. Examples of adjuvants currently used in the field of vaccines include (1) mineral salts (aluminum salts such as aluminum phosphate and aluminum hydroxide, calcium phosphate gels), squalene, (2) oil-based adjuvants such as oil emulsions and surfactant based formulations, e.g., MF59 (microfluidised detergent stabilised oil-in-water emulsion), QS21 (purified saponin), AS02 [SBAS2] (oil-in-water emulsion+MPL+QS-21), (3) particulate adjuvants, e.g., virosomes (unilamellar liposomal vehicles incorporating influenza haemagglutinin), AS04 ([SBAS4] aluminum salt with MPL), ISCOMS (structured complex of saponins and lipids), polylactide co-glycolide (PLG), (4) microbial derivatives (natural and synthetic), e.g., monophosphoryl lipid A (MPL), Detox (MPL+M. Phlei cell wall skeleton), AGP [RC-529] (synthetic acylated monosaccharide), DC_Chol (lipoidal immunostimulators able to self-organize into liposomes), OM-174 (lipid A derivative), CpG motifs (synthetic oligonucleotides containing immunostimulatory CpG motifs), modified LT and CT (genetically modified bacterial toxins to provide non-toxic adjuvant effects), (5) endogenous human immunomodulators, e.g., hGM-CSF or hIL-12 (cytokines that can be administered either as protein or plasmid encoded), Immudaptin (C3d tandem array) and/or (6) inert vehicles, such as gold particles, and the like.

[0124] In an embodiment, the TAP(s) (e.g., SEQ ID NOs: 1-88) or composition comprising same is/are in lyophilized form. In another embodiment, the TAP(s) or composition comprising same is/are in a liquid composition. In a further embodiment, the TAP(s) is/are at a concentration of about 0.01 μg/mL to about 100 μg/mL in the composition. In further embodiments, the TAP(s) is/are at a concentration of about 0.2 μg/mL to about 50 μg/mL, about 0.5 μg/mL to about 10, 20, 30, 40 or 50 μg/mL, about 1 μg/mL to about 10 μg/mL, or about 2 μg/mL, in the composition.

[0125] As noted herein, cells such as APCs that express an MHC class I molecule loaded with or bound to any one of, or any combination of, the TAPs defined herein, may be used for stimulating/amplifying CD8.sup.+ T lymphocytes in vivo or ex vivo. Accordingly, in another aspect, the present disclosure provides T cell receptor (TCR) molecules capable of interacting with or binding the herein-mentioned MHC class I molecule/TAP complex, and nucleic acid molecules encoding such TCR molecules, and vectors comprising such nucleic acid molecules. A TCR according to the present disclosure is capable of specifically interacting with or binding a TAP loaded on, or presented by, an MHC class I molecule, preferably at the surface of a living cell in vitro or in vivo.

[0126] The term TCR as used herein refers to an immunoglobulin superfamily member having a variable binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail; see, e.g., Janeway et al, Immunobiology: The Immune System in Health and Disease, 3rd Ed., Current Biology Publications, p. 4:33, 1997) capable of specifically binding to an antigen peptide bound to a MHC receptor. A TCR can be found on the surface of a cell and generally is comprised of a heterodimer having α and β chains (also known as TCRα and TCRβ, respectively). Like immunoglobulins, the extracellular portion of TCR chains (e.g., α-chain, β-chain) contain two immunoglobulin regions, a variable region (e.g., TCR variable α region or Vα and TCR variable β region or Vβ; typically amino acids 1 to 116 based on Rabat numbering at the N-terminus), and one constant region (e.g., TCR constant domain α or Cα and typically amino acids 117 to 259 based on Rabat, TCR constant domain β or Cβ, typically amino acids 117 to 295 based on Rabat) adjacent to the cell membrane. Also, like immunoglobulins, the variable domains contain complementary determining regions (CDRs. 3 in each chain) separated by framework regions (FRs). In certain embodiments, a TCR is found on the surface of T cells (or T lymphocytes) and associates with the CD3 complex.

[0127] A TCR and in particular nucleic acids encoding a TCR of the disclosure may for instance be applied to genetically transform/modify T lymphocytes (e.g., CD8.sup.+ T lymphocytes) or other types of lymphocytes generating new T lymphocyte clones that specifically recognize an MHC class I/TAP complex. In a particular embodiment, T lymphocytes (e.g., CD8.sup.+ T lymphocytes) obtained from a patient are transformed to express one or more TCRs that recognize a TAP and the transformed cells are administered to the patient (autologous cell transfusion). In a particular embodiment, T lymphocytes (e.g., CD8.sup.+ T lymphocytes) obtained from a donor are transformed to express one or more TCRs that recognize a TAP and the transformed cells are administered to a recipient (allogenic cell transfusion). In another embodiment, the disclosure provides a T lymphocyte e.g., a CD8.sup.+ T lymphocyte transformed/transfected by a vector or plasmid encoding a TAP-specific TCR. In a further embodiment the disclosure provides a method of treating a patient with autologous or allogenic cells transformed with a TAP-specific TCR. In certain embodiments, TCRs are expressed in primary T cells (e.g., cytotoxic T cells) by replacing an endogenous locus, e.g., an endogenous TRAC and/or TRBC locus, using, e.g., CRISPR, TALEN, zinc finger, or other targeted disruption systems.

[0128] In another embodiment, the present disclosure provides a nucleic acid encoding the above-noted TCR. In a further embodiment, the nucleic acid is present in a vector, such as the vectors described above.

[0129] In yet a further embodiment the use of a tumor antigen-specific TCR in the manufacture of autologous or allogenic cells for the treating of cancer (e.g., lymphoblastic leukemia, such as ALL) is provided.

[0130] In some embodiments, patients treated with the compositions (e.g., pharmaceutical compositions) of the disclosure are treated prior to or following treatment with allogenic stem cell transplant (ASCL), allogenic lymphocyte infusion or autologous lymphocyte infusion. Compositions of the disclosure include: allogenic T lymphocytes (e.g., CD8.sup.+ T lymphocyte) activated ex vivo against a TAP; allogenic or autologous APC vaccines loaded with a TAP; TAP vaccines and allogenic or autologous T lymphocytes (e.g., CD8.sup.+ T lymphocyte) or lymphocytes transformed with a tumor antigen-specific TCR. The method to provide T lymphocyte clones capable of recognizing a TAP according to the disclosure may be generated for and can be specifically targeted to tumor cells expressing the TAP in a subject (e.g., graft recipient), for example an ASCT and/or donor lymphocyte infusion (DLI) recipient. Hence the disclosure provides a CD8.sup.+ T lymphocyte encoding and expressing a T cell receptor capable of specifically recognizing or binding a TAP/MHC class I molecule complex. Said T lymphocyte (e.g., CD8.sup.+ T lymphocyte) may be a recombinant (engineered) or a naturally selected T lymphocyte. This specification thus provides at least two methods for producing CD8.sup.+ T lymphocytes of the disclosure, comprising the step of bringing undifferentiated lymphocytes into contact with a TAP/MHC class I molecule complex (typically expressed at the surface of cells, such as APCs) under conditions conducive of triggering T cell activation and expansion, which may be done in vitro or in vivo (i.e. in a patient administered with a APC vaccine wherein the APC is loaded with a TAP or in a patient treated with a TAP vaccine). Using a combination or pool of TAPs bound to MHC class I molecules, it is possible to generate a population CD8.sup.+ T lymphocytes capable of recognizing a plurality of TAPs. Alternatively, tumor antigen-specific or targeted T lymphocytes may be produced/generated in vitro or ex vivo by cloning one or more nucleic acids (genes) encoding a TCR (more specifically the alpha and beta chains) that specifically binds to a MHC class I molecule/TAP complex (i.e. engineered or recombinant CD8.sup.+ T lymphocytes). Nucleic acids encoding a TAP-specific TCR of the disclosure, may be obtained using methods known in the art from a T lymphocyte activated against a TAP ex vivo (e.g., with an APC loaded with a TAP); or from an individual exhibiting an immune response against peptide/MHC molecule complex. TAP-specific TCRs of the disclosure may be recombinantly expressed in a host cell and/or a host lymphocyte obtained from a graft recipient or graft donor, and optionally differentiated in vitro to provide cytotoxic T lymphocytes (CTLs). The nucleic acid(s) (transgene(s)) encoding the TCR alpha and beta chains may be introduced into a T cells (e.g., from a subject to be treated or another individual) using any suitable methods such as transfection (e.g., electroporation) or transduction (e.g., using viral vector). The engineered CD8.sup.+ T lymphocytes expressing a TCR specific for a TAP may be expanded in vitro using well known culturing methods.

[0131] The present disclosure provides methods for making the immune effector cells which express the TCRs as described herein. In one embodiment, the method comprises transfecting or transducing immune effector cells, e.g., immune effector cells isolated from a subject, such as a subject having a leukemia (e.g., ALL), such that the immune effector cells express one or more TCR as described herein. In certain embodiments, the immune effector cells are isolated from an individual and genetically modified without further manipulation in vitro. Such cells can then be directly re-administered into the individual. In further embodiments, the immune effector cells are first activated and stimulated to proliferate in vitro prior to being genetically modified to express a TCR. In this regard, the immune effector cells may be cultured before or after being genetically modified (i.e., transduced or transfected to express a TCR as described herein).

[0132] Prior to in vitro manipulation or genetic modification of the immune effector cells described herein, the source of cells may be obtained from a subject. In particular, the immune effector cells for use with the TCRs as described herein comprise T cells. T cells can be obtained from a number of sources, including peripheral blood mononuclear cells (PBMCs), bone marrow, lymph nodes tissue, cord blood, thymus issue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cell can be obtained from a unit of blood collected from the subject using any number of techniques known to the skilled person, such as FICOLL™ separation. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocyte, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing. In one embodiment of the invention, the cells are washed with PBS. In an alternative embodiment, the washed solution lacks calcium and may lack magnesium or may lack many if not all divalent cations. As would be appreciated by those of ordinary skill in the art, a washing step may be accomplished by methods known to those in the art, such as by using a semi-automated flow-through centrifuge. After washing, the cells may be resuspended in a variety of biocompatible buffers or other saline solution with or without buffer. In certain embodiments, the undesirable components of the apheresis sample may be removed in the cell directly resuspended culture media. In certain embodiments, T cells are isolated from peripheral blood mononuclear cells (PBMCs) by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient. A specific subpopulation of T cells, such as CD28+, CD4+, CD8+, CD45RA+, and CD45RO+T cells, can be further isolated by positive or negative selection techniques. For example, enrichment of a T cell population by negative selection can be accomplished with a combination of antibodies directed to surface markers unique to the negatively selected cells. One method for use herein is cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD8+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD11 b, CD16, HLA-DR, and CD4. Flow cytometry and cell sorting may also be used to isolate cell populations of interest for use in the present disclosure. PBMC may be used directly for genetic modification with the TCRs using methods as described herein. In certain embodiments, after isolation of PBMC, T lymphocytes are further isolated and in certain embodiments, both cytotoxic and helper T lymphocytes can be sorted into naive, memory, and effector T cell subpopulations either before or after genetic modification and/or expansion.

[0133] The present disclosure provides isolated immune cells such as CD8.sup.+ T lymphocytes that are specifically induced, activated and/or amplified (expanded) by a TAP (i.e., a TAP bound to MHC class I molecules expressed at the surface of cell), or a combination of TAPs. The present disclosure also provides a composition comprising CD8.sup.+ T lymphocytes capable of recognizing a TAP, or a combination thereof, according to the disclosure (i.e., one or more TAPs bound to MHC class I molecules) and said TAP(s). In another aspect, the present disclosure provides a cell population or cell culture (e.g., a CD8.sup.+ T lymphocyte population) enriched in CD8.sup.+ T lymphocytes that specifically recognize one or more MHC class I molecule/TAP complex(es) as described herein. Such enriched population may be obtained by performing an ex vivo expansion of specific T lymphocytes using cells such as APCs that express MHC class I molecules loaded with (e.g. presenting) one or more of the TAPs disclosed herein. “Enriched” as used herein means that the proportion of tumor antigen-specific CD8.sup.+ T lymphocytes in the population is significantly higher relative to a native population of cells, i.e. which has not been subjected to a step of ex vivo-expansion of specific T lymphocytes. In a further embodiment, the proportion of TAP-specific CD8.sup.+ T lymphocytes in the cell population is at least about 0.5%, for example at least about 1%, 1.5%, 2% or 3%. In some embodiments, the proportion of TAP-specific CD8.sup.+ T lymphocytes in the cell population is about 0.5 to about 10%, about 0.5 to about 8%, about 0.5 to about 5%, about 0.5 to about 4%, about 0.5 to about 3%, about 1% to about 5%, about 1% to about 4%, about 1% to about 3%, about 2% to about 5%, about 2% to about 4%, about 2% to about 3%, about 3% to about 5% or about 3% to about 4%. Such cell population or culture (e.g., a CD8.sup.+ T lymphocyte population) enriched in CD8.sup.+ T lymphocytes that specifically recognizes one or more MHC class I molecule/peptide (TAP) complex(es) of interest may be used in tumor antigen-based cancer immunotherapy, as detailed below. In some embodiments, the population of TAP-specific CD8.sup.+ T lymphocytes is further enriched, for example using affinity-based systems such as multimers of MHC class I molecule loaded (covalently or not) with the TAP(s) defined herein. Thus, the present disclosure provides a purified or isolated population of TAP-specific CD8.sup.+ T lymphocytes, e.g., in which the proportion of TAP-specific CD8.sup.+ T lymphocytes is at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%.

[0134] In another aspect, the present disclosure provides an antibody or an antigen-binding fragment thereof that specifically binds to a complex comprising a TAP as described herein bound to an HLA molecule, such as the HLA molecules defined herein. Such antibodies are commonly referred to as TCR-like antibodies. The term “antibody or antigen-binding fragment thereof” as used herein refers to any type of antibody/antibody fragment including monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, humanized antibodies, CDR-grafted antibodies, chimeric antibodies and antibody fragments so long as they exhibit the desired antigenic specificity/binding activity. Antibody fragments comprise a portion of a full-length antibody, generally an antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab′, F(ab′).sub.2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules (e.g., single-chain Fv, scFv), single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments, single-chain diabodies (scDbs), bispecific T cell engagers (BiTEs), dual affinity retargeting molecules (DARTs), bivalent scFv-Fcs, and trivalent scFv-Fcs. Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to, V.sub.H regions (V.sub.H, V.sub.H-V.sub.H), anticalins, PepBodies, antibody-T-cell epitope fusions (Troybodies) or Peptibodies. In an embodiment, the antibody or antigen-binding fragment thereof is a single-chain antibody, preferably a single-chain Fv (scFv). In an embodiment, the antibody or antigen-binding fragment thereof comprises at least one constant domain, e.g., a constant domain of a light and/or heavy chain, or a fragment thereof. In a further embodiment, the antibody or antigen-binding fragment thereof comprises a Fragment crystallizable (Fc) fragment of the constant heavy chain of an antibody. In an embodiment, the antibody or antigen-binding fragment is a scFv comprising a Fc fragment (scFV-Fc). In an embodiment, the scFv component is connected to the Fc fragment by a linker, for example a hinge. The presence of an Fc region is useful to induce a Complement-dependent cytotoxicity (CDC) or antibody-dependent cellular cytotoxicity (ADCC) response against a tumor cell.

[0135] In an embodiment, the antibody or antigen-binding fragment thereof is a multispecific antibody or an antigen-binding fragment thereof, such as a bispecific antibody or an antigen-binding fragment thereof, wherein at least one of the antigen-binding domains of the multispecific antibody or antibody fragment recognize(s) a complex comprising a TAP as described herein bound to an HLA molecule. In an embodiment, at least one of the antigen-binding domains of the multispecific antibody or antibody fragment recognize(s) an immune cell effector molecule. The term “immune cell effector molecule” refers to a molecule (e.g., protein) expressed by an immune cell and whose engagement by the multispecific antibody or antibody fragment leads to activation of the immune cells. Examples of immune cell effector molecules include the CD3 signaling complex in T cells such as CD8 T cells and the various activating receptors on NK cells (NKG2D, KIR2DS, NKp44, etc.). In a further embodiment, at least one of the antigen-binding domains of the multispecific antibody or antibody fragment recognize(s) and engage(s) the CD3 signaling complex in T cells (e.g., anti-CD3). In a further embodiment, the multispecific antibody or antibody fragment is a single-chain diabody (scDb). In a further embodiment, the scDb comprises a first antibody fragment (e.g., scFv) that binds to a complex comprising a TAP as described herein bound to an HLA molecule and a second antibody fragment (e.g., scFv) that binds to and engages an immune cell effector molecule, such as the CD3 signaling complex in T cells (e.g., anti-CD3 scFv). Such constructs may be used for example to induce the cytotoxic T cell-mediated killing of tumor cells expressing the tumor antigen/MHC complex recognized by the multispecific antibody or antibody fragment.sup.44-46. Antibodies or antigen-binding fragments thereof may also be used as a chimeric antigen receptor (CAR) to produce CAR T cells, CAR NK cells, etc. CAR combines a ligand-binding domain (e.g. antibody or antibody fragment) that provides specificity for a desired antigen (e.g., MHC/TAP complex) with an activating intracellular domain (or signal transducing domain) portion, such as a T cell or NK cell activating domain, providing a primary activation signal. Antigen-binding fragments of antibodies, and more particularly scFv, capable of binding to molecules expressed by tumor cells are commonly used as ligand-binding domains in CAR. Thus, in another aspect, the present disclosure provides a host cell, preferably an immune cell such as a T cell or NK cell, expressing the antibody or antibody fragment (e.g., scFv) described herein.

[0136] The present disclosure further relates to a pharmaceutical composition or vaccine comprising the above-noted immune cell (CD8.sup.+ T lymphocytes, CART cell) or population of TAP-specific CD8.sup.+ T lymphocytes. Such pharmaceutical composition or vaccine may comprise one or more pharmaceutically acceptable excipients and/or adjuvants, as described above.

[0137] The present disclosure further relates to the use of any TAP (e.g., SEQ ID NOs: 1-88, 92), nucleic acid, expression vector, T cell receptor, antibody/antibody fragment, cell (e.g., T lymphocyte, APC, CAR T cell), and/or composition according to the present disclosure, or any combination thereof, as a medicament or in the manufacture of a medicament. In an embodiment, the medicament is for the treatment of cancer, e.g., cancer vaccine. The present disclosure relates to any TAP, nucleic acid, expression vector, T cell receptor, antibody/antibody fragment, cell (e.g., T lymphocyte, APC), and/or composition (e.g., vaccine composition) according to the present disclosure, or any combination thereof, for use in the treatment of cancer e.g., as a cancer vaccine. The TAP sequences identified herein may be used for the production of synthetic peptides to be used i) for in vitro priming and expansion of tumor antigen-specific T cells to be injected into tumor patients and/or ii) as vaccines to induce or boost the anti-tumor T cell response in cancer patients, such as ALL patients.

[0138] In another aspect, the present disclosure provides the use of a TAP described herein (e.g., SEQ ID NOs: 1-88 and 92), or a combination thereof (e.g. a peptide pool), as a vaccine for treating cancer, such as a lymphoblastic leukemia, in a subject. The present disclosure also provides the TAP described herein, or a combination thereof (e.g. a peptide pool), for use as a vaccine for treating cancer, such as a lymphoblastic leukemia, in a subject. In an embodiment, the subject is a recipient of TAP-specific CD8.sup.+ T lymphocytes. Accordingly, in another aspect, the present disclosure provides a method of treating cancer (e.g., of reducing the number of tumor cells, killing tumor cells), said method comprising administering (infusing) to a subject in need thereof an effective amount of CD8.sup.+ T lymphocytes recognizing (i.e. expressing a TCR that binds) one or more MHC class I molecule/TAP complexes (expressed at the surface of a cell such as an APC). In an embodiment, the method further comprises administering an effective amount of the TAP, or a combination thereof, and/or a cell (e.g., an APC such as a dendritic cell) expressing MHC class I molecule(s) loaded with the TAP(s), to said subject after administration/infusion of said CD8.sup.+ T lymphocytes. In yet a further embodiment, the method comprises administering to a subject in need thereof a therapeutically effective amount of a dendritic cell loaded with one or more TAPs. In yet a further embodiment the method comprises administering to a patient in need thereof a therapeutically effective amount of an allogenic or autologous cell that expresses a recombinant TCR that binds to a TAP presented by an MHC class I molecule.

[0139] In another aspect, the present disclosure provides the use of CD8.sup.+ T lymphocytes that recognize one or more MHC class I molecules loaded with (presenting) a TAP, or a combination thereof, for treating cancer (e.g., of reducing the number of tumor cells, killing tumor cells) in a subject. In another aspect, the present disclosure provides the use of CD8.sup.+ T lymphocytes that recognize one or more MHC class I molecules loaded with (presenting) a TAP, or a combination thereof, for the preparation/manufacture of a medicament for treating cancer (e.g., for reducing the number of tumor cells, killing tumor cells), such as a lymphoblastic leukemia, in a subject. In another aspect, the present disclosure provides CD8.sup.+ T lymphocytes (cytotoxic T lymphocytes) that recognize one or more MHC class I molecule(s) loaded with (presenting) a TAP, or a combination thereof, for use in the treatment of cancer (e.g., for reducing the number of tumor cells, killing tumor cells), such as a lymphoblastic leukemia, in a subject. In a further embodiment, the use further comprises the use of an effective amount of a TAP (or a combination thereof), and/or of a cell (e.g., an APC) that expresses one or more MHC class I molecule(s) loaded with (presenting) a TAP, after the use of said TAP-specific CD8.sup.+ T lymphocytes.

[0140] The present disclosure also provides a method of generating an immune response against tumor cells (leukemic cells, ALL cells) expressing human class I MHC molecules loaded with any of the TAP disclosed herein (e.g., SEQ ID NOs: 1-88 and 92) or combination thereof in a subject, the method comprising administering cytotoxic T lymphocytes that specifically recognizes the class I MHC molecules loaded with the TAP or combination of TAPs. The present disclosure also provides the use of cytotoxic T lymphocytes that specifically recognizes class I MHC molecules loaded with any of the TAP or combination of TAPs disclosed herein for generating an immune response against tumor cells expressing the human class I MHC molecules loaded with the TAP or combination thereof.

[0141] In an embodiment, the methods or uses described herein further comprise determining the HLA class I alleles expressed by the patient prior to the treatment/use, and administering or using TAPs that bind to one or more of the HLA class I alleles expressed by the patient. For example, if it is determined that the patient expresses HLA-A2*01 and HLA-B40*01, any combinations of the TAPs of SEQ ID NO: 2-22 (that bind to HLA-A2*01), and/or of the TAPs of SEQ ID NO: 61-66 (that bind to HLA-B40*01) may be administered or used in the patient.

[0142] In an embodiment, the cancer is a blood cancer, preferably leukemia such as acute lymphoblastic (or lymphocytic) leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), myelodysplastic syndromes (MDS) and mixed lineage acute leukemias. In an embodiment, the leukemia is a lymphoblastic leukemia, in a further embodiment ALL (B-ALL or T-ALL), and preferably B-ALL. The ALL treated by the methods and uses described herein may be of any type or subtype (e.g., low-, intermediate- or high-risk ALL), such B lymphoblastic leukemia/lymphoma, not otherwise specified, B lymphoblastic leukemia/lymphoma with recurrent cytogenetic abnormalities (e.g., with t(9; 22) (Philadelphia chromosome), with t(1;19)(q23;p13), with t(12;21), with t(4;11)(q21;q23), with t(8;14)(q24;q32), with t(11;14)(p13;q11), with t(5;14), with hyperdiploidy (more than 50 chromosomes), with hypodiploidy (less than 50 chromosomes), or mixed lineage acute leukemias.

[0143] In an embodiment, the TAP, nucleic acid, expression vector, T cell receptor, antibody/antibody fragment, cell (e.g., T lymphocyte, CART or NK cell, APC), and/or composition according to the present disclosure, or any combination thereof, may be used in combination with one or more additional active agents or therapies to treat cancer, such as chemotherapy (e.g., vinca alkaloids, agents that disrupt microtubule formation (such as colchicines and its derivatives), anti-angiogenic agents, therapeutic antibodies, EGFR targeting agents, tyrosine kinase targeting agent (such as tyrosine kinase inhibitors), transitional metal complexes, proteasome inhibitors, antimetabolites (such as nucleoside analogs), alkylating agents, platinum-based agents, anthracycline antibiotics, topoisomerase inhibitors, macrolides, retinoids (such as all-trans retinoic acids or a derivatives thereof), geldanamycin or a derivative thereof (such as 17-AAG), surgery, immune checkpoint inhibitors or immunotherapeutic agents (e.g., PD-1/PD-L1 inhibitors such as anti-PD-1/PD-L1 antibodies, CTLA-4 inhibitors such as anti-CTLA-4 antibodies, B7-1/B7-2 inhibitors such as anti-B7-1/B7-2 antibodies, TIM3 inhibitors such as anti-TIM3 antibodies, BTLA inhibitors such as anti-BTLA antibodies, CD47 inhibitors such as anti-CD47 antibodies, GITR inhibitors such as anti-GITR antibodies), antibodies against tumor antigens (e.g., anti-CD19, anti-CD22 antibodies), cell-based therapies (e.g., CAR T cells, CAR NK cells), and cytokines such as IL-2, IL-7, IL-21, and IL-15. In an embodiment, the TAP, nucleic acid, expression vector, T cell receptor, cell (e.g., T lymphocyte, APC), and/or composition according to the present disclosure is administered/used in combination with an immune checkpoint inhibitor. In an embodiment, the TAP, nucleic acid, expression vector, T cell receptor, cell (e.g., T lymphocyte, APC), and/or composition according to the present disclosure is administered/used in combination one or more chemotherapeutic drugs used for the treatment of ALL (e.g., vincristine, dexamethasone, prednisone, doxorubicin (Adriamycin), daunorubicin, cyclophosphamide, L-asparaginase (or pegaspargase), and/or high doses of methotrexate or cytarabine (ara-C), imatinib (Gleevec) or dasatinib (Sprycel), or in combination with another ALL therapy, for example stem cell/bone marrow transplantation.

[0144] The additional therapy may be administered prior to, concurrent with, or after the administration of the TAP, nucleic acid, expression vector, T cell receptor, antibody/antibody fragment, cell (e.g., T lymphocyte, CAR T or NK cell, APC), and/or composition according to the present disclosure.

MODE(S) FOR CARRYING OUT THE INVENTION

[0145] The present invention is illustrated in further details by the following non-limiting examples.

Example 1: Materials and Methods

[0146] Cell Culture

[0147] The Epstein-Barr virus (EBV)-transformed B-lymphoblastoid cell line (B-LCL) was derived from peripheral blood mononuclear cells as described previously.sup.27. Cells were grown in RPM11640 containing HEPES and supplemented with 10% heat-inactivated fetal bovine serum, penicillin/streptomycin, and L-glutamine and expanded in roller bottles. The cells were then collected, washed with PBS and either used fresh or stored at −80° C.

[0148] Cell Transplantation in Mice

[0149] The ALL specimens used in this study were collected and cryopreserved at the Leukemia Cell Bank of Quebec at Maisonneuve-Rosemont Hospital, Montreal. The project was approved by the Research Ethics Boards of Maisonneuve-Rosemont Hospital and of the Université de Montréal. For 10H080 sample, B-ALL cells were expanded in vivo after transplantation in mice as follows. NOD Cg-Prkdc.sup.scidII2rg.sup.tm1Wjl/SzJ (NSG) mice were purchased from Jackson Laboratory and bred in a specific pathogen-free animal facility. All animal procedures were approved by the Deontology Committee on Animal Experimentation at the Université de Montréal. B-ALL cells were thawed at 37° C., washed and resuspended in RPMI (Life Technologies). A total of 1-2×10.sup.6 B-ALL cells were transplanted via the tail vein into 8-12-week-old sub-lethally irradiated (250 cGy, 137Cs-gamma source) NSG mice. Mice were sacrificed 30-60 days post-injection when showing signs of disease. Spleens were mechanically dissociated and leukemic cells were isolated by Ficoll™ gradient. The purity and viability of the samples (usually >90%) were then assessed by flow cytometry. B-ALL cells were identified as human CD45.sup.+CD19.sup.+. For 16 additional ALL samples, one hundred million cells were thawed (1 min in 37° C. water bath) and resuspended in 48 ml of 4° C. PBS. Two million cells (1 ml) were pelleted and resuspended in 1 ml Trizol™ for RNA-Sequencing while the remaining 98 million were pelleted and snap-frozen in liquid nitrogen for mass spectrometry analyses.

[0150] Immunoprecipitation of MHC I

[0151] The W6/32 antibodies (BioXcell) were incubated in PBS for 60 min at room temperature with PureProteome protein A magnetic beads (Millipore) at a ratio of 1 mg of antibody per mL of slurry. Antibodies were covalently cross-linked to magnetic beads using dimethylpimelidate as described previously.sup.11. The beads were stored at 4° C. in PBS pH 7.2 and 0.02% NaN.sub.3. Biological replicates of cell pellets were resuspended in 1 mL PBS pH 7.2 and solubilized by adding 1 mL of detergent buffer containing PBS pH 7.2, 1% (w/v) CHAPS (Sigma) supplemented with Protease inhibitor cocktail (Sigma). After 60 min incubation with tumbling at 4° C., samples were spun at 16,000 g for 30 min at 4° C. Supernatants were transferred into new tubes containing magnetic beads coupled to W6/32 antibodies at a ratio of 10 □g of W6/32 antibody per 1×10.sup.6 cells. Samples were incubated with tumbling for 180 min at 4° C. and placed on a magnet to recover bound MHC I complexes to magnetic beads. Magnetic beads were first washed with 8×1 mL PBS, then with 1×1 mL of 0.1×PBS and finally with 1×1 mL of water. MHC I complexes were eluted from the magnetic beads by acidic treatment using 0.2% formic acid (FA). To remove any residual magnetic beads, eluates were transferred into 2 mL Costar mL Spin-X centrifuge tube filters (0.45 μm, Corning) and spun 2 min at 855 g. Filtrates containing peptides were separated from MHC I subunits (HLA molecules and β-2 macroglobulin) using home-made stage tips packed with twenty 1 mm diameter octadecyl (C-18) solid-phase extraction disks (EMPORE). Stage tips were pre-washed first with methanol then with 80% acetonitrile (ACN) in 0.1% trifluoroacetic acid (TFA) and finally with 0.1% FA. Samples were loaded onto the stage tips and the peptides were retained on the stage tips while the HLA molecules and β-2 macroglobulin were found in the flow through. Stage tips were washed with 0.1% FA and peptides were eluted with 30% ACN in 0.1% TFA. The peptides were dried using vacuum centrifugation and then stored at −20° C. until MS analysis.

[0152] TMT Labeling

[0153] Samples were reconstituted in 100 μL of 200 mM HEPES buffer, pH 8.2. The TMT reagents (Thermo Fisher Scientific) were dissolved in 40 μL of anhydrous ACN (Sigma-Aldrich) and added to the peptides. The solution was gently mixed and incubated for 90 min without agitation at RT before the reaction was quenched by hydroxylamine (Thermo Fisher Scientific). Samples were desalted on Silica C18 UltraMicroSpin Column (The Nest Group), dried down and reconstituted in 4% FA (EMD Millipore). Benchmark evaluation was typically performed from MHC I peptide extracts corresponding to 2×10.sup.6 B-LCL cells/injection. For extracts of less than 100×10.sup.6 B-LCL cells, peptides were dissolved in 20 μL 200 mM HEPES buffer, pH 8.2 and mixed with 5 μL of 0.02 mg/μL of TMT.sub.0126. For larger cell amounts up to 2,000×10.sup.6 BLCL, 0.8 mg of TMT.sub.0126 label was used, and the reaction volume was scaled accordingly. Note that TMT labeling efficiency can vary significantly, and label concentration should be adjusted to maximize yield.sup.28.

[0154] For absolute quantification of MiHAs, synthetic peptides of concentration ranging from 0.75-192 fmoles were labeled with TMT-127N, TMT-128N, TMT-128C, TMT-129N, TMT-129C, TMT-130N, TMT-130C and TMT-131 while MHC I peptide extracts from 20×10.sup.6 B-LCL cells were labeled with TMT-126. Note that the channel TMT-127C was unused to determine the extent of interfering fragment ions.

[0155] FAIMS

[0156] The FAIMS Pro (Thermo Fisher Scientific) inner and outer electrodes were separated by a 1.5 mm gap and heated to a temperature of 100° C. For this study, the inner and outer electrodes were heated to a common temperature of 100° C. to maximize ion transmission. Nitrogen (N.sub.2) was used as a carrier gas with a temperature control gas flow rate of 5 L/min and a user carrier gas of 1.6 L/min. The dispersion voltage (DV) was set to −5000 V with a 3 MHz frequency for the high electric field. The FAIMS transit time was 40 ms. The compensation voltage (CV) for optimal transmission of target peptide ions in LC-FAIMS-MS/MS experiments was determined by infusing synthetic peptides and using CV Scan Tool in the Tune User Interface Software.

[0157] Mass Spectrometry

[0158] Vacuum dried peptides were resuspended 4% FA and analyzed by LC-MS/MS using an Easy nLC1000 coupled to a Tribrid Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific). Peptides were separated on a custom C18 reversed-phase column (150 μm i.d.×200 mm, Jupiter Proteo 4 μm, 300 Å, Phenomenex) using a flow rate of 600 nL/min and a linear gradient of 5-40% ACN (0.2% FA) in 150 min, followed by 15 min at 70% ACN (0.2% FA) and 15 min re-equilibration at 5% ACN (0.2% FA). Survey scan (MS1) were acquired with the Orbitrap at a resolving power of 120,000 (at m/z 200) over a scan range of 300-1100 m/z with a target values of 5×10.sup.5 with a maximum injection time of 100 ms. MS/MS spectra were acquired at higher energy collisional dissociation with a normalized collision energy of 35, and an exclusion time of 45 s. Up to twenty precursor ions were accumulated with a precursor isolation window of 1.6 m/z, an advanced gain control (AGC) of 2×10.sup.4 with a maximum injection time of 500 ms and fragment ions were transferred to the Orbitrap analyzer operating at a resolution of 50,000 at m/z 200. For the TMT 10-plex analysis with FAIMS, the MS2 approach described above was used with minor modifications. The linear gradient was shortened to 60 min, followed by 15 min re-equilibration at 5% ACN (0.2% FA), and targeted LC-MS/MS used a list of selected precursor ions. The MS1 maximum injection time was set to 50 ms, and the isolation window for MS2 was 1 Th with an offset of 0.3 Th. For the SPS-MS3 method, the parameters for the MS scan were the same as for the FAIMS MS2 method (scan range m/z 300-1,100, Orbitrap resolution 120,000, AGC 5×10.sup.5 and maximum injection time 50 ms) followed by a 3 sec top speed approach for MS2 in the ion trap (Isolation window 0.7 Th, CID at 35% collision energy, normal scan rate mode, AGC 2×10.sup.4 with maximal injection time of 50 ms) followed by the selection of synchronous precursor ions for MS3 acquisition (scan range m/z 100-500, Orbitrap resolution of 50,000, AGC of 1×10.sup.5, maximum injection time of 300 ms, 4 notches, isolation window of 2.0 Th and a collision energy of up to 65%).

[0159] Peptide Identification and TMT Quantification

[0160] Database searches were performed using PEAKS X (Bioinformatics Solutions Inc.) Mass tolerances for precursor and fragment ions were set to 10 ppm and 0.02 Da, respectively. Searches were performed without enzyme specificity and with variable modifications for deamidation (N, Q) and oxidation (M). MAPDP was used to generate subject-specific protein sequence databases.sup.29. Protein entries are derived from the Ensembl reference genome release 75 (GRCh37.p13) and 88 (GRCh38.p10) respectively for B-LCL and B-ALL.sup.30. Single amino-acid polymorphism derived from RNA-Seq data sets available in the NCBI Bioproject database: B-BCL: PRJNA286122, B-ALL: PRJNA454807.sup.31,32 were incorporated in the protein entries. Polymorphisms were called by Casava (Illumina) for B-LCL and FreeBayes 1.0.2.sup.33 for B-ALL. Only SNV with a quality score above 20 were included. Additionally, only expressed transcripts quantified by Kallisto v0.43.0 were retained for B-ALL.sup.34.

[0161] Bioinformatic Analyses

[0162] PEAKS results were loaded into MAPDP and the MHC I peptide selection was achieved using the following criteria: peptide false discovery rate was limited to 5%, peptide length between 8-15 residues, and a threshold of top 2% ranked predicted sequences according to NetMHC 4.0. MiHAs were selected using MAPDP based on dbSNP human b151 GRCh37p13 and gnomAD exomes r2.1.1 annotations and the following criteria: the peptide sequence must not be present in another protein (single genetic origin), must not derive from HLA or IgG genes, and the minor allele frequency (MAF) must be higher or equal to 0.05. MS/MS of MiHA were manually validated (4 consecutives fragment above background required). Peak areas for MiHA peptides were extracted from PEAKS label-free quantification to compare the detection between experimental methods and cell amounts.

[0163] Identification and Validation of Tumor Specific Antigens (TSAs)

[0164] Tumor specific antigens were identified from ALL samples according to the method previously described.sup.31. To assign a genomic location to TSA candidates, reads containing MHC peptide-coding sequences were mapped on the reference genome (GRCh38.88) using BLAT (tool from the UCSC genome browser). For TSA candidates with a clear genomic location, IGV (integrative genome browser) was used to visualize expression of MHC peptide-coding sequences in ALL vs. mTECs RNA sequencing data and to exclude sequences originating from a hypervariable region (MHC, Ig or TCR genes) or for which the mutation overlaps a germline polymorphism reported in dbSNP build 149. Finally, expression of TSA candidates in normal cells was assessed using RNA sequencing data from two sources as described.sup.31: i) human mTECs (GEO GSE127825 and GSE127826) and ii) 28 adult human tissues (˜50 donors per tissue), which had been sequenced by the GTEx consortium and downloaded from the GTEx Portal.

Example 2: Isobaric Peptide Labeling Using Tandem Mass Tag Increased Immunopeptidome Coverage

[0165] To enhance the detection of MHC I peptides, chemical labeling of free amino groups was first investigated using of tandem mass tag (TMT).sup.35. This modification enables the parallel quantification of different samples by monitoring reporter fragment ions originating from isobaric precursor ions. The number of identifications for the native and TMT-modified peptides purified from immunoisolated MHC I complex of an Epstein-Barr virus (EBV) transformed B-LCL obtained from normal peripheral mononuclear cells was compared (FIG. 1A). These immortalized cells expressed approximately 3×10.sup.6 MHC I molecules/cell based on flow cytometry analyses.sup.11. High-resolution HLA genotyping revealed that these cells possessed five HLA class I alleles: A*01:01, A*02:01, B*07:02, B*44:03 and C*07:02.

[0166] Triplicate LC-MS/MS analyses of native and TMT-derivatized MHC I peptides from 2×10.sup.6 B-LCL cells for gradient elution of 90, 180, and 240 min was performed (FIGS. 6A-C). For native peptides, an optimal number of identifications was observed for the 180 min gradient resulting in 3,235 unique peptides per run on average. TMT labeling of the corresponding samples enabled the identification of 4,984 unique peptides on average per run for the same gradient length, and only a 5% increase in identification was observed for the 240 min gradient. It is noteworthy that shorter gradient led to more intense peptide signals, though a lower number of identifications were typically observed for both native and TMT-labeled peptides (FIGS. 7A-F). Gradient elution extending beyond 180 min did not lead to significant improvement in the number identification possibly due to peak broadening and reduced peak intensity. More than 62% overlap in peptide identification was obtained between replicates of each gradient length for both sets of samples. Altogether, a total of 6,658 unique TMT-modified MHC I peptides was identified in the 180 min LC-MS/MS runs, of which 3,065 peptides were common with their native counterparts (FIG. 1B). On average, TMT labeling improved the number of identified MHC I peptides by 50%, and the corresponding peptides displayed 10% higher identification scores than native peptides (FIG. 1C). Interestingly, these analyses also enabled the identification of 9 MiHAs, several of which were not identified in the native MHC I peptides.

[0167] Next, the changes in physicochemical characteristics of native and derivatized MHC I peptides in terms of hydrophobicity, MS signal and charge state distribution was examined. TMT-labeling generally enhanced the formation of multi-protonated peptide ions, and a larger proportion of TMT-labeled peptides were observed as doubly- and triply-protonated ions (FIG. 1D). The conversion of the primary amine of native peptides into a moiety containing a dimethyl piperidine enhanced their proton affinity and partly explained the propensity of TMT-labeled peptides to form higher charge state peptide ions. It was also noted that TMT derivatization renders MHC I peptides more hydrophobic as reflected by their increased retention times (FIG. 1E). This feature was advantageously exploited recently to improve the detection of hydrophilic phosphopeptides that can be underrepresented in large-scale phosphoproteomic experiments.sup.36. The systematic analysis also revealed that TMT labeling improved the MS signal compared to the corresponding native peptides, and increased the detection of low abundance peptides (FIG. 1F). However, it is unclear if the enhanced MS signal observed for TMT-labeled peptides is associated with the higher proportion of organic solvent at which peptides eluted or the enhanced formation of multiply-charged ions. Nonetheless, TMT-labeling of MHC I peptides favored their detection and increased the immunopeptidome coverage.

[0168] To determine if TMT labeling had an impact on MS/MS fragmentation of MHC I peptides or the HLA allele groups detected, the distribution of identified peptides and their fragment ions were analyzed. Generally, it was found that N-terminus peptide labeling with TMT favored the formation of b-type fragment ions compared to native MHC I peptides where y-type fragments were more prominent (FIG. 2A). it was also noted that a-, b-, and y-type fragment ions were observed for both native and TMT-labeled peptides with a significantly lower occurrence of other types of fragment ions (FIG. 8). The b1 ion appeared to be highly abundant in TMT-labeled peptides but not in native peptides, and former peptides tend to have more and stronger b-type ions than their native counterparts irrespective of their HLA allele groups. The intensity of y ions in TMT-labeled peptides decreased appreciably with the length of the y-type ion series.

[0169] These observations indicate that TMT-labeling changed the distribution and pattern of peptide fragmentation. Interestingly, these changes favored the identification of TMT-labeled peptides of underrepresented HLA allele groups, most notably A*01:01, A*02:01 and B*44:03 (FIG. 2B). While the relative distribution of peptides for each corresponding allele groups remained similar between native and TMT-labeled peptides, an increase of 45-118% in the number of unique peptides for these three groups was observed. For HLA allele groups B*07:02 and C*07:02, a change of −2% and 23%, respectively, was observed. It was also noted that the number of a-, b- and y-type fragment ions observed was higher upon TMT labeling compared to native peptides (14 vs. 11 fragment ions), and that allele groups A*01:01, A*02:01 and B*44:03 displayed the highest number of fragment ions (FIG. 2C). The fact that HLA allele groups display different response upon TMT labeling possibly reflect the variability in N-termini reactivity towards the N-hydroxysuccinimide ester and the influence of neighboring amino acids. Taken together, these results indicate that TMT labeling of MHC I peptides enhanced the comprehensiveness of peptide analyses and favored the identification of HLA allele groups such as A*01:01, A*02:01 and B*44:03 that were underrepresented in the native immunopeptidome of B-LCL cells.

Example 3: Immunopeptidome Analyses of B-ALL Cells Uncovers New Tumor-Specific Antigens

[0170] The impact of TMT-labeling on a second cell model derived from human B-ALL cells from a leukemic patient was evaluated. These cells were expanded in vivo by transplanting them in mice, and harvesting the spleen of injected animals after 30-60 d (FIG. 3A). B-ALL cells express a lower number of MHC I molecules at the cell surface than B-LCL (5×10.sup.5 molecules/cell).sup.11. Preliminary experiments were performed on 100 million B-ALL cells isolated from mice using Ficoll™ density gradient. Cells were lysed and MHC I peptides extracted following immunoaffinity purification. Purified peptides were either kept in their native forms or derivatized with TMT prior to LC-MS/MS analyses. To uncover peptide variants that are not present in reference proteome databases, a proteogenomic strategy where a customized database from the RNA sequencing of the tumor sample was built, and the repertoire of MHC I peptides coded by all genomic regions was comprehensively mapped.sup.31, was used.

[0171] A total of 7,728 unique MHC I peptides, of which 2,084 peptides were common to both native and TMT-labeled peptides (FIG. 3B), was identified. It was observed that TMT-labeling enhanced the number of identified MHC I peptides by 76%, and enabled the identification of an additional 4,179 peptides compared to 1,465 peptides for their native counterparts. From the 3,549 and 6,263 MHC I peptides identified in the native and TMT-labeled extracts of B-ALL cells, 12-22%, 9-21%, 34-37%, and 32-33% were presented by allele groups A*02:01, A*11:01, B*40:01 and B*44:03, respectively (FIG. 3C). The relative distribution of allelic products of native and TMT-labeled MHC I peptides was similar except for A*11:01 where a reduced number of identifications was observed upon TMT labeling. This allele group is characterized by a Lys residue at position 9, and variable labeling of this site and the amino group of the N-terminus could account for the lower number of identified TMT peptides. Peptides corresponding to the other three alleles showed significant gains in identification following TMT-labeling, especially A*02:01 where a 3-fold increase in the number of identified peptides was obtained. These results confirmed earlier findings observed for B-LCL cells where TMT labeling enhanced the number of identified MHC I peptides.

[0172] To evaluate the scalability of this approach, triplicate analyses of TMT-labeled peptides from 20, 60, and 100 million cells were conducted (FIG. 3D). Reproducible numbers of identification were observed for each sample set, and more than 60% of identified peptides were shared across replicates (FIGS. 9A-B). A progressive increase in the number of identified MHC I peptides ranging from 3,919 to 6,251 for extracts of 20 to 100 million cells was observed. The relatively modest increase in identification from 60 to 100 million cells possibly reflects the limited dynamic range of peptide sequencing and the stochastic sampling of MS/MS spectra in an increasing sample complexity.

[0173] The improved immunopeptidome coverage obtained using TMT labeling enabled the identification of low abundance peptides and variants that were not typically observed in native MHC I peptides. Altogether, the detailed analysis of TMT-labeled peptides identified a total of 6,971 unique MHC I peptides found in at least two replicates (FIG. 9A). Among these, 81 MiHAs with a MAF≥0.05 were identified, a level that corresponded to a balanced genetic polymorphism among the human population.sup.37. In the context of leukemia immunotherapy, MiHAs found on the surface of malignant cells can trigger a strong graft versus tumor effect.sup.38. Previous investigations on transplanted B-ALL cells enabled the identification of only 5 MiHAs from native MHC I peptides.sup.11. Clearly, TMT labeling facilitated the comprehensive profiling of the immunopeptidome of leukemic cells to identify minor antigens of relevance for allogeneic hematopoietic cell transplantation.

[0174] Building upon the improved sensitivity of the TMT labeling approach for immunopeptidome analyses, the subpopulation of MHC I peptides representing putative TSAs was next determined in 10H080 sample as well as 16 additional primary ALL samples. In this category, mTSAs that derived from polymorphic DNA sequences originating from either exonic or non-exonic regions, and aberrantly expressed TSAs (aeTSAs) that result from the deregulated expression of unmutated transcripts not expressed in normal somatic cells, including medullary epithelial cells (mTECs), were regrouped. To select cancer-specific TSAs, only peptide candidates for which no transcript was detected in mTEC cells of human thymi were considered, as they express most known genes and play a central role in immune tolerance.sup.31,39. Accordingly, a total of 92 TSAs was identified in the immunopeptidome of 17 primary ALL samples, of which 88 TSAs are novel, 3 (RIFGFRLWK, SLTALVFHV, TSFAETWMK) were previously identified in human B-ALL samples.sup.31, and 1 (IPLNPFSSL) was previously identified in human AML sample.sup.42. All TSA peptide candidates corresponded to aeTSAs and no mTSA were detected. To ensure that the expression of aeTSA candidates was cancer-specific, their RNA expression in 27 human peripheral tissues downloaded from the Genotype-Tissue Expression (GTEx) was analyzed. Peptide candidates whose coding RNA sequence was expressed at levels <10 reads per hundred million (rphm) in any peripheral tissue other than those with low expression of MHC (e.g., brain, nerve, testis) were thus selected. Out of the 92 aeTSA candidates, two were expressed in the testis, indicating that some cancer germline antigens (CGAs) driven by epigenetic alterations are aeTSAs but that most aeTSAs are not CGAs.

[0175] Features of all aeTSAs are reported in Table 1. It is noteworthy that the proteogenomic approach may underestimate the total number of aeTSAs resulting from atypical translation (5′UTR, 3′UTR, intergenic, frameshift). Indeed, to minimize the number of false positives in the TSA list, aeTSAs for which their RNA was expressed in some normal tissues, not knowing which reading frame could be translated, were excluded. It was found that the majority of TSAs identified herein corresponded to noncanonical translation events (FIG. 4A). Interestingly, a large proportion of aeTSAs originated from intronic (41%) and intergenic (24%) regions, while other TSAs were assigned to UTRs (6%), noncoding RNA (15%) and exonic regions (18%).

TABLE-US-00007 TABLE 1 Features of the aeTSA identified in the studies described herein Sequence Genomic Ensembi (SEQ ID NO:) Status Position Origin Transcript id Gene NEQTTILY (1) Novel chr9: 2037127- intron ENST00000382203 SMARCA2 2037150 ALFSNEVSL (2) Novel chr18: 13509916- intron ENST00000587905 LDLRAD4 13509942 FIPDLFTEL(3) Novel chr7: 30 255 455- intergenic N/A N/A 30 255 481 FLLDHILTI (4) Novel chr1: 158481592- IncRNA ENST00000535880 AL365440.2 158481618 FLLESRETL(5) Novel chr11: 4060859- intron ENST00000532919 STIM1 4060885 FLLPTSLSL (6) Novel chr2:58 187 587- intron ENST00000403295 FANCL 58 187 613 FLLSDELLL (7) Novel chr19: 12436696- intron ENST00000301547 ZNF443 12436722 GLATAVWLL (8) Novel chr10: 45 303 916- exon ENST00000553795 OR13A1 45 303 942 GLLTASIFL (9) Novel chr12: 10054315- exon ENST00000355819 CLEG9A 10054341 GTLCLLTFI (10) Novel chr2: 157 333 520- intergenic N/A N/A 157 333 546 KLLQPLPIT (11) Novel chr12: 46715090- IncRNA ENST00000611243 AC008014.1 46715116 LLQNLIVLL (12) Novel chr7: 158786203- intron ENST00000251527 ESYT2 158786229 LLSLYLVSI (13) Novel chr21: 15528085- intergenic N/A N/A 15528109 LMLLFVVLL (14) Novel chr7: 961442- intron ENST00000457254 COX19 961468 SLANETHTL (15) Novel chr17: 3729513- exon ENST00000263087 ITGAE 3729539 VLLDFPALL (16) Novel chr21: 42683073- intergenic N/A N/A 42683099 VLLSKILYP (17) Novel chr5: 102751630- intergenic N/A N/A 102751656 WLVEKLSGV (18) Novel chrX: 148221715- intergenic N/A N/A 148221741 YLFAHSIIL (19) Novel chr1: 198738082- intergenic N/A N/A 198738108 YLGYAVAV (20) Novel chr17: 3753909- exon ENST00000263087 ITGAE 3755123 YLQEISLRL (21) Novel chr10: 128316002- IncRNA ENST00000630252 LINC01163 128316028 SLLGIGLLA (22) Novel chr8: 17237977- intron ENST00000523917 CNOT7 17238003 AAMESPIQSK (23) Novel chr2: 1800191- IncRNA ENST00000638628 AC093390.2 1800220 ALFGFVGFPNK (24) Novel chr7: 27151832- IncRNA ENST00000518451 HOXA3 27151864 ALFVLTSIK (25) Novel chr6: 110184721- intron ENST00000307731 CD40 110184747 ATSLTIQEK (26) Novel chr2: 123839904- intergenic N/A N/A 123839930 AVAVPLLPR (27) Novel chr2: 123839872- intergenic N/A N/A 123839898 GTISGGFFK (28) Novel chr12: 68333644- IncRNA ENST00000546086 LINC02384 68333664; chr12: 68442064- 68442069 GVANSLLK (29) Novel chr6: 156 112 915- intergenic N/A N/A 156 112 938 GVSPVLFLK (30) Novel chr19: 36 684 826- intergenic N/A N/A 36 684 852 LLGLPQPPK (31) Novel chrY: 19072786- IncRNA ENST00000331787 TTTY14 19072812 LSSRLPLGK (32) Novel chr9: 96 398 754- intron ENST00000375256 ZNF367 96 398 780 NLLFSRVFK (33) Novel chr2: 143159367- intron ENST00000295095 ARHGAP1 143159393 5 STGVLTVLK (34) Novel chr2: 1810045- IncRNA ENST00000638628 AC093390.2 1810071 SVFDRTNNR (35) Novel chr1: 110491121- intergenic N/A N/A 110491147 SVVPHPLQK (36) Novel chr14: 22322773- intergenic N/A N/A 22322799 TTSSIYIRK (37) Novel chr3: 66781042- intergenic N/A N/A 66781068 LYTFIKHEF (38) Novel chr4: 174495485- exon ENST00000510835 HPGD 174495511 SYFDPSYSNF (39) Novel chr7: 92658800- intergenic N/A N/A 92658829 SYLASFLLY (40) Novel chr9: 105513917- intron ENST00000394926 FSD1L 105513943 VYSPSPLNF (41) Novel chr2: 1782377- intergenic N/A LTR48B 1782403 VYTQVSAF (42) Novel chr19: 685806- exon ENST00000613411 PRSS57 685829 YSVLTVTF (43) Novel chr3: 42559254- intron ENST00000451653 SEC22C 42559277 NLGLFLSY (44) Novel chr1: 107730876- intron ENST00000370056 VAV3 107730899 AVGGFRSSW (45) Novel chr17: 4448248- exon ENST00000575194 SPNS3 4448274 SQVQAVLLAW (46) Novel chr1: 113944573- intron ENST00000369558 HIPK1 113944602 QTNSGSLAR (47) Novel chr6: 144045542- intron ENST00000628069 PLAGN1 144045568 DVAGVGMPK (48) Novel chr1: 98044989- IncRNA ENST00000634594 MIR137HG 98045015 DVMASLARV (49) Novel chr17: 3759461- exon ENST00000263087 ITGAE 3759487 EVGAVFAVL (50) Novel chr3: 151369504- exon ENST00000474524 MED12L 151369530 VVADILLSV (51) Novel chr17: 4478617- exon ENST00000355530 SPNS3 4486233 SSLSGPVSSL (52) Novel chr14: 99265648- intergenic N/A N/A 99265677 AFRVIVAL (53) Novel chr10: 11556133- intron ENST00000379237 USP6NL 11556156 EHYNKVVVM (54) Novel chr14: 106465542- intergenic N/A N/A 106465568 VQAQVLEAI (55) Novel chr3: 45886725- intron ENST00000483279 LZTFL1 45886751 NNMAIIYSY (56) Novel chr9: 112611600- intron ENST00000374244 KIAA1958 112611626 EPSHSINVY (57) Novel chr7: 38316972- intergenic N/A N/A 38316998 IPVGSGLGYVL (58) Novel chr17: 4446186- exon ENST00000355530 SPNS3 4446914 DHDIGVYSV (59) Novel chr22: 22245035- exon ENST00000403807 VPREB1 22245061 HFEWQPPL (60) Novel chr11: 36574859- exon ENST00000299440 RAG1 36574882 GEFLVPLSL (61) Novel chr11: 64490401- intergenic N/A N/A 64490427 GEVDGAQQAM (62) Novel chr11: 61880352- intron ENST00000278829 FADS3 61880381 IEEVSQGLL (63) Novel chr19: 11155732- exon ENST00000592540 SPC24 11155758 IESEDFGFWSL (64) Novel chr7: 136 177 375- IncRNA ENST00000445293 AC078845.1 136 177 407 LENSGFILI (65) Novel chr5: 134 948 472- intron ENST00000254908 PCBD2 134 948 498 REPLEILITL (66) Novel chr19: 41456461- IncRNA ENST00000588495 PCAT19 41456487 EETDAYKSL (67) Novel chrX: 131734445- IncRNA ENST00000637577 FIRRE 131734471 SELQLPVTF (68) Novel chr7: 76349523- intron ENST00000307630 YWHAG 76349549 QEIATSHNI (69) Novel chr15: 40622254- exon ENST00000399668 KNL1 40622280 AQFLLFIA (70) Novel chr7: 19703301- intron ENST00000222567 TWISTNB 19703324 FEISSVTTA (71) Novel chr17: 3747932- exon ENST00000263087 ITGAE 3747958 KEVGGLRSA (72) Novel chr17: 80770839- intergenic N/A N/A 80770865 TEFGPVIG (73) Novel chrX: 38573320- intron ENST00000378482 TSPAN7 38573343 ISLPALEVL (74) Novel chr2: 47706606- intron ENST00000606499 MSH6 47706632 LPSPPLPPSL (75) Novel chr1: 167630182- 5'UTR ENST00000367854 RCSD1 167630211 LYLPSVVLI (76) Novel chr7: 39957700- intron ENST00000611390 CDK13 39957726 RPPAPLLPVL (77) Novel chr5: 43095886- intron ENST00000514169 ZNF131 43095915 SLHYSVSL (78) Novel chr4: 2846794- intron ENST00000264758 ADD1 2846817 SLPDHQGVL (79) Novel chr10: 96295027- IncRNA ENST00000454484 AL136181.1 96295053 EAVSQGKDF (80) Novel chr12: 104494469- intron ENST00000303694 CHST11 104494495 YSSYLSIHY (81) Novel chr2: 113187675- intron ENST00000245796 PDS4 113187701 ASLGLSLAL (82) Novel chr3: 183977404- intron ENST00000334444 ABCC5 183977430 LCHRTPPSL (83) Novel chr5: 179764917- intron ENST00000292599 MAML1 179764943 LSISPFQAI (84) Novel chr14: 106198472- intergenic N/A N/A 106198498 GWGGSPLYL (85) Novel chr9: 27441807- intron ENST00000262244 MOB3B 27441833 YFDPSYSNF (86) Novel chr7: 92658803- intron ENST00000265734 CDK6 92658829 ISLSSIVSV (87) Novel chr6: 31755981- intron ENST00000468136 MSH5 31756007 LSISSLVSV (88) Novel chrX: 136719927- intron ENST00000370620 ARHGEF6 136719953 SLTALVFHV (89) Prev. chr14: 95710553- 3'UTR ENST00000554012 TCL1A reported 95710559 in B-ALL RIFGFRLWK (90) Prev. chr1: 80641339- IncRNA ENST00000418041 LINC01781 reported 80641365 in B-ALL TSFAETWMK (91) Prev. chr7: 43947484- Intron ENST00000415051 POLR2J4 reported 43947510 in B-ALL IPLNPFSSL (92) Prev. chr16: 20709861- intron ENST00000501740 ACSM3 reported 20709887 in AML Sequence HLA Percentile Tumor (SEQ ID NO:) allele Rank Nucleotide sequence (SEQ ID NO:) Sample NEQTTILY (1) HLA- 1.94 AATGAACAGACTACCATTTTGTAC (93) 11H099 A*01:01 ALFSNEVSL (2) HLA- 0.3 GCACTTTTTAGCAATGAAGTGTCTTTG (94) 10H080 A*02:01 FIPDLFTEL(3) HLA- 0.25 TTCATCCCAGATCTATTTACAGAATTA (95) 10H080 A*02:01 FLLDHILTI (4) HLA- 0.001 TTTCTTTTGGATCACATATTGACCATT (96) 05H129 A*02:01 FLLESRETL (5) HLA- 0.023 TTCCTATTGGAGTCCAGGGAAACTTTA (97) 17H112 A*02:01 FLLPTSLSL (6) HLA- 0.03 TTCTTGCTTCCAACTTCACTTTCTTTG (98) 10H080 A*02:01 FLLSDELLL (7) HLA- 0.026 TTTCTTCTCTCTGATGAACTTCTTTTA (99) 17H017 A*02:01 GLATAVWLL (8) HLA- 0.08 GGGCTGGCCACAGCCGTGTGGCTGCTC (100) 10H080 A*02:01 GLLTASIFL (9) HLA- 0.115 GGATTATTAACGGCATCCATTTTCTTG (101) 17H112 A*02:01 GTLCLLTFI (10) HLA- 1.5 GGTACCTTGTGCCTATTAACTTTCATT (102) 10H080 A*02:01 KLLQPLPIT (11) HLA- 0.822 AAACTCCTCCAACCTCTGCCCATTACC (103) 17H112 A*02:01 LLQNLIVLL(12) HLA- 0.6 CTTCTTCAAAATTTAATAGTGCTGTTA (104) 10H080 A*02:01 LLSLYLVSI (13) HLA- 0.4 CTCTTAAGTTTGTATTTAGTAAGTATA (105) 10H080 A*02:01 LMLLFVVLL (14) HLA- 1.755 TTAATGTTACTCTTTGTCGTATTACTA (106) 08H028 A*02:01 SLANETHTL (15) HLA- 0.033 TCTTTGGCCAACGAGACCCACACCCTT (107) 16H116 A*02:01 VLLDFPALL (16) HLA- 0.025 GTACTGTTGGACTTTCCGGCTCTGTTA (108) 16H116 A*02:01 VLLSKILYP (17) HLA- 1.666 GTTTTACTTTCAAAAATACTATATCCA (109) 17H017 A*02:01 WLVEKLSGV (18) HLA- 0.086 TGGTTGGTGGAGAAGCTCAGTGGTGTG (110) 17H017 A*02:01 YLFAHSIIL (19) HLA- 0.03 TACTTGTTTGCACATTCCATTATCTTA (111) 16H133 A*02:01 YLGYAVAV (20) HLA- 1.305 TACCTGGGTTACGCTGTGGCCGTG (112) 16H116 A*02:01 YLQEISLRL (21) HLA- 0.005 TATCTGCAAGAAATATCATTAAGATTA (113) 17H112 A*02:01 SLLGIGLLA (22) HLA- 1.2 AGTCTTTTAGGAATAGGATTGTTGGCA (114) 10H080 A*02:01 AAMESPIQSK (23) HLA- 0.014 GCAGCCATGGAGTCTCCTATACAGTCCAAG 14H148 A*11:01 (115) ALFGFVGFPNK (24) HLA- 0.399 GCCCTATTTGGTTTTGTTGGATTCCCCAACAAG 17H112 A*11:01 (116) ALFVLTSIK (25) HLA- 0.441 GCACTGTTTGTGTTAACATCAATAAAA (117) 14H148 A*11:01 ATSLTIQEK (26) HLA- 0.014 GCTACAAGTCTCACCATCCAGGAAAAA (118) 17H112 A*11:01 AVAVPLLPR (27) HLA- 0.053 GCTGTAGCAGTTCCCCTCCTGCCTAGG (119) 17H112 A*11:01 GTISGGFFK (28) HLA- 0.006 GGAACTATATCAGGTGGCTTCTTCAAA (120) 17H112 A*11:01 GVANSLLK (29) HLA- 1.6 GGTGTGGCCAATAGTCTTTTAAAA (121) 10H080 A*11:01 GVSPVLFLK (30) HLA- 0.01 GGCGTCTCTCCTGTGTTATTTCTAAAG (122) 10H080 A*11:01 LLGLPQPPK (31) HLA- 0.76 CTTCTGGGCTTGCCTCAGCCTCCTAAA (123) 17H112 A*11:01 LSSRLPLGK (32) HLA- 0.4 CTGTCTTCAAGACTGCCACTGGGGAAG (124) 10H080 A*11:01 NLLFSRVFK (33) HLA- 0.513 AACCTTCTGTTTAGTAGAGTTTTTAAG (125) 17H112 A*11:01 STGVLTVLK (34) HLA- 0.029 TCAACTGGAGTCCTCACTGTGCTAAAG (126) 14H148 A*11:01 SVFDRTNNR (35) HLA- 0.037 AGTGTCTTTGACAGGACCAATAACCGT (127) 14H148 A*11:01 SVVPHPLQK (36) HLA- 0.001 TCAGTAGTGCCTCATCCCCTTCAAAAG (128) 14H148 A*11:01 TTSSIYIRK (37) HLA- 0.007 ACAACCAGTTCAATCTACATAAGAAAG (129) 16H133 A*11:01 LYTFIKHEF (38) HLA- 0.012 TTGTACACATTTATAAAACATGAATTC (130) 14H025 A*24:02 SYFDPSYSNF (39) HLA- 0.008 TCCTACTTTGATCCTTCGTACAGCAATTTT 05H080_ A*24:02 (131) 14H025 SYLASFLLY (40) HLA- 0.228 TCATACCTGGCATCTTTCTTGTTGTAC (132) 05H175 A*24:02 VYSPSPLNF (41) HLA- 0.001 GTATATTCTCCAAGCCCATTGAATTTC (133) 14H025 A*24:02 VYTQVSAF (42) HLA- 0.348 GTGTACACGCAGGTGTCCGCCTTT (134) 10H013 A*24:02 YSVLTVTF (43) HLA- 0.518 TATTCTGTTCTAACAGTAACTTTT (135) 14H025 A*24:02 NLGLFLSY (44) HLA- 1.223 AATCTGGGGCTTTTTCTCTCATAC (136) 17H017 A*29:02 AVGGFRSSW (45) HLA- 0.03 GCCGTGGGAGGCTTCAGGAGCAGCTGG (137) 15H042_ A*32:01 14H025 SQVQAVLLAW (46) HLA- 0.356 TCACAGGTTCAAGCAGTTCTCCTAGCTTGG 14H025 A*32:01 (138) QTNSGSLAR (47) HLA- 0.123 CAGACAAACAGTGGATCTCTCGCCAGA (139) 10H013 A*66:01 DVAGVGMPK (48) HLA- 0.054 GACGTGGCAGGAGTTGGCATGCCCAAG (140) 05H080 A*68:01 DVMASLARV (49) HLA- 0.02 GATGTGATGGCCTCCCTCGCCAGAGTC (141) 16H116 A*68:02 EVGAVFAVL (50) HLA- 0.151 GAAGTGGGAGCCGTGTTTGCTGTCTTA (142) 16H116_ A*68:02 13H051 VVADILLSV (51) HLA- 0.014 GTGGTTGCCGACATCCTGCTGTCTGTG (143) 16H116 A*68:02 SSLSGPVSSL (52) HLA- 1.838 TCATCTCTGAGTGGTCCAGTGAGCTCGCTG 15H042 B*07:02 (144) AFRVIVAL (53) HLA- 1.451 GCCTTTAGGGTTATTGTTGCTTTA (145) 17H112 B*08:01 EHYNKVVVM (54) HLA- 0.003 GAACACTACAATAAAGTAGTGGTAATG (146) 13H051 B*14:02 VQAQVLEAI (55) HLA- 1.145 GTGCAAGCCCAGGTTTTAGAAGCCATC (147) 13H051 B*15:10 NNMAIIYSY (56) HLA- 0.269 AACAATATGGCAATAATCTATTCTTAT (148) 05H148 B*18:01 EPSHSINVY (57) HLA- 0.033 GAGCOATCCCATTOAATAAATGTTTAT (149) 11H099 B*35:01 IPVGSGLGYVL (58) HLA- 0.945 ATCCCCGTTGGAAGTGGTCTGGGCTACGTG 11H099 B*35:01 CTG (150) DHDIGVYSV (59) HLA- 0.016 GACCATGACATCGGTGTGTACAGCGTC 17H017 B*39:01 (151) HFEWQPPL (60) HLA- 0.923 CACTTTGAGTGGCAGCCACCTCTG (152) 17H017 B*39:01 GEFLVPLSL (61) HLA- 0.012 GGGGAGTTCCTTGTTCCTCTGTCCCTC 08H125 B*40:01 (153) GEVDGAQQAM (62) HLA- 0.2 GGTGAAGTGGATGGGGCACAGCAGGCAAT 10H080 B*40:01 G (154) IEEVSQGLL (63) HLA- 0.26 ATAGAGGAGGTGAGCCAGGGGCTGCTC 08H125 B*40:01 (155) IESEDFGFWSL (64) HLA- 0.5 ATAGAGTCAGAAGACTTTGGATTTTGGAGT 10H080 B*40:01 CTG (156) LENSGFILI (65) HLA- 0.15 CTGGAGAATAGTGGATTTATATTAATA (157) 10H080 B*40:01 REPLEILITL (66) HLA- 0.12 AGAGAACCATTGGAGATACTCATTACTCTT 10H080 B*40:01 (158) EETDAYKSL (67) HLA- 0.112 GAAGAGACAGATGCCTACAAAAGCCTC 16H116 B*44:02 (159) SELQLPVTF (68) HLA- 0.009 AGTGAATTACAACTACCTGTTACTTTC (160) 05H129 B*44:02 QEIATSHNI (69) HLA- 0.012 CAGGAGATAGCAACAAGCCATAATATA (161) 14H025 B*49:01 AQFLLFIA (70) HLA- 1.912 GCCCAATTCCTTCTCTTTATTGCA (162) 17H112 B*50:01 FEISSVTTA (71) HLA- 0.007 TTTGAAATCAGCTCTGTAACCACAGCC (163) 17H112_ B*50:01 14H025 KEVGGLRSA (72) HLA- 0.007 AAAGAGGTGGGTGGGCTTAGGTCAGCT (164) 14H025 B*50:01 TEFGPVIG (73) HLA- 1.67 ACTGAGTTTGGTCCTGTCATTGGG (165) 14H025 B*50:01 ISLPALEVL (74) HLA- 0.603 ATATCCCTTCCTGCTCTAGAGGTTCTG (166) 17H017 0*01:02 LPSPPLPPSL (75) HLA- 0.147 CTCCCCTCCCCTCCCCTTCCTCCCTCCCTC 17H017 0*01:02 (167) LYLPSVVLI (76) HLA- 1.886 TTATATTTGCCCTCTGTTGTGCTGATC (168) 17H017 0*01:02 RPPAPLLPVL (77) HLA- 0.525 CGGCCACCAGCTCCTCTGCTCCCTGTCCTT 16H133 0*01:02 (169) SLHYSVSL (78) HLA- 1.051 TCACTGCACTACTCTGTCTCTTTA (170) 17H017 0*01:02 SLPDHQGVL (79) HLA- 0.01 AGTCTCCCAGATCACCAGGGTGTCTTA (171) 17H017 0*01:02 EAVSQGKDF (80) HLA- 1.779 GAGGCAGTTTCCCAGGGGAAGGATTTT (172) 16H116 0*02:02 YSSYLSIHY (81) HLA- 0.052 TATTCTAGTTATTTAAGCATTCATTAT (173) 08H125 0*02:02 ASLGLSLAL (82) HLA- 0.331 GCCTCACTGGGCTTAAGCTTGGCTTTG (174) 08H125 0*03:04 LCHRTPPSL (83) HLA- 1.511 TTGTGCCACCGCACTCCACCCAGCCTG (175) 13H051 0*03:04 LSISPFQAI (84) HLA- 0.207 TTATCTATTTCTCCTTTTCAGGCTATC (176) 13H051 0*03:04 GWGGSPLYL (85) HLA- 0.879 GGGTGGGGAGGGAGTCCTTTGTACCTA (177) 11H099 0*04:01 YFDPSYSNF (86) HLA- 0.001 TACTTTGATCCTTCGTACAGCAATTTT (178) 08H028_ 0*04:01 14H148 ISLSSIVSV (87) HLA- 0.038 ATTTCTCTCTCTTCTATAGTTTCTGTA (179) 16H133 0*15:02 LSISSLVSV (88) HLA- 0.097 TTATCTATTTCTTCTCTTGTGAGTGTT (180) 16H133 0*15:02 SLTALVFHV (89) HLA- 0.06 TCCCTCACAGCACTAGTATTTCATGTT (181) 10H080 A*02:01 RIFGFRLWK (90) HLA- 0.01 AGGATTTTTGGCTTTCGGCTCTGGAAA (182) 10H080 A*11:01 TSFAETWMK (91) HLA- 0.01 ACATCCTTTGCAGAGACATGGATGAAA (183) 10H080 A*11:01 IPLNPFSSL (92) HLA- 0.172 ATACCTTTGAATCCTTTCAGTTCTTTG (184) 11H099 B*35:01

[0176] TSA candidates identified from 10H080 sample (SEQ ID NO: 2, 3, 6, 8, 10, 13, 14, 22, 29, 30, 32, 62, 64, 65 and 66) were validated with their corresponding synthetic peptides (FIGS. 10A-10y). An example is shown in FIG. 4B where the MS/MS spectra of the TMT-labeled peptide IESEDFGFWSL obtained from the endogenous B-ALL sample and its synthetic counterpart was compared. Validation of TSA candidates relied on the correlation of fragment ions and retention time between native and synthetic peptides. MS/MS spectra were correlated with Pearson coefficient >0.75 and retention time of synthetic peptides was within +/−2 min of their native counterparts. The genomic location of each aeTSA was identified and the corresponding transcripts were confirmed to be expressed only in the B-ALL sample. All TSAs identified here derived from non-mutated yet aberrantly expressed transcripts that could be shared by multiple leukemic specimens. This, in addition to the low expression of TSA transcripts across a panel of human tissues, and mTECs make them attractive candidates for leukemia vaccine development.

Example 4: Determination of Antigen Expression Using Isobaric Peptide Labeling

[0177] The prioritization of antigens for TSA immunization or for optimal graft versus tumor effects using MiHAs partly relies on the abundance of the corresponding antigens. While the antigen discovery approach described herein typically uses shotgun mass spectrometry, the limited dynamic range of peptide identification may preferentially select the most abundant antigens, and can underestimate the extent of antigens shared across different patients. To determine the expression of antigens presented at the cell surface by MHC I molecules, the capability of targeted LC-MS/MS assays was evaluated using isobaric peptide labeling. Accordingly, 27 MiHAs previously identified in B-lymphoblastoid cells from a cohort of 13 subjects where the corresponding peptides were found to share optimal features for immunotherapy of hematologic cancers were selected.sup.38. The B-LCL cells described in the previous section were obtained from a different subject and shared alleles A*02:01 and B*44:03 though only 9 of the 27 optimal MiHAs were identified in the samples upon TMT labeling. It is noteworthy that all transcripts of the corresponding genes were expressed in the selected B-LCL cells. It was surmised that several of the undetected MiHAs from the B-LCL cells could be identified and quantified using targeted LC-MS/MS analyses. To determine the abundance of MiHAs presented by MHC I molecules, LC-MS/MS with synchronous precursor selection (SPS).sup.40 was performed, quantitative measurements were compared with those obtained using LC-MS/MS with and without FAIMS.

[0178] Immunopurified MHC I peptide extracts from 20 million B-LCL cells were labeled with TMT-126 while synthetic peptides of different amounts ranging from 0.75 to 192 fmoles were labeled with TMT-127 to TMT-131 (FIG. 5A). The TMT-127C channel was left empty to determine the extent of interfering ions. Triplicate LC-MS/MS analyses with and without FAIMS were performed on the corresponding peptide extracts, precursor ion tolerance was set to 5 ppm, and only MS/MS spectra acquired within ±30 s of the expected retention time of each MiHA peptide were considered for quantitative measurements. To minimize the contribution of interfering signals, only MS-MS spectra where no signal was detected in the TMT-127C channel or when the intensity of the endogenous peptide ion (TMT-126) was above that of the TMT-128C were selected. For absolute quantification, the occurrence of at least 7 consecutive reporter ions with a linear correlation coefficient, r≥0.9, was relied upon. In total, 25 of the 27 MiHAs selected were quantified, the remaining 2 MiHAs were below the limit of quantification. The abundance of endogenous MiHAs obtained from all three LC-MS/MS approaches ranged from 2.3 to 18.6 fmoles. From these analyses, it was estimated that MiHA expression varied from 70 to 560 molecules/cell assuming quantitative peptide recoveries from immunoaffinity purification (FIG. 5B). Each method provided reproducible measurements with relative standard deviation (RSD) ranging from 24-34%, on average. It was noted that MiHA expression levels determined by LC-MS/MS and SPS were comparable to those achieved when using FAIMS, and measurements were typically within 18% of each other. However, when comparing SPS with LC-MS/MS, larger variations with values overestimated by 31%, on average, were found. This overestimation is associated with the co-selection of precursor ions in LC-MS/MS.

[0179] Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word “comprising” is used as an open-ended term, substantially equivalent to the phrase “including, but not limited to”. The singular forms “a”, “an” and “the” include corresponding plural references unless the context clearly dictates otherwise.

REFERENCES

[0180] (1) Murata, S.; Takahama, Y.; Kasahara, M.; Tanaka, K. Nat Immunol 2018, 19, 923-931. [0181] (2) Davis, M. M.; Krogsgaard, M.; Huse, M.; Huppa, J.; Lillemeier, B. F.; Li, Q. J. Annu Rev Immunol 2007, 25, 681-695. [0182] (3) Neefjes, J.; Jongsma, M. L.; Paul, P.; Bakke, O. Nat Rev Immunol 2011, 11, 823-836. [0183] (4) Roche, P. A.; Furuta, K. Nat Rev Immunol 2015, 15, 203-216. [0184] (5) Blum, J. S.; Wearsch, P. A.; Cresswell, P. Annu Rev Immunol 2013, 31, 443-473. [0185] (6) Rock, K. L.; Reits, E.; Neefjes, J. Trends Immunol 2016, 37, 724-737. [0186] (7) Hoare, H. L.; Sullivan, L. C.; Pietra, G.; Clements, C. S.; Lee, E. J.; Ely, L. K.; Beddoe, T.; Falco, M.; Kjer-Nielsen, L.; Reid, H. H.; McCluskey, J.; Moretta, L.; Rossjohn, J.; Brooks, A. G. Nat Immunol 2006, 7, 256-264. [0187] (8) Robinson, J.; Guethlein, L. A.; Cereb, N.; Yang, S. Y.; Norman, P. J.; Marsh, S. G. E.; Parham, P. PLoS Genet 2017, 13, e1006862. [0188] (9) Robinson, J.; Halliwell, J. A.; Hayhurst, J. D.; Flicek, P.; Parham, P.; Marsh, S. G. Nucleic Acids Res 2015, 43, D423-431. [0189] (10) Weinzierl, A. O.; Lemmel, C.; Schoor, O.; Muller, M.; Kruger, T.; Wernet, D.; Hennenlotter, J.; Stenzl, A.; Klingel, K.; Rammensee, H. G.; Stevanovic, S. Mol Cell Proteomics 2007, 6, 102-113. [0190] (11) Lanoix, J.; Durette, C.; Courcelles, M.; Cossette, E.; Comtois-Marotte, S.; Hardy, M. P.; Cote, C.; Perreault, C.; Thibault, P. Proteomics 2018, 18, e1700251. [0191] (12) Bassani-Sternberg, M.; Braunlein, E.; Klar, R.; Engleitner, T.; Sinitcyn, P.; Audehm, S.; Straub, M.; Weber, J.; Slotta-Huspenina, J.; Specht, K.; Martignoni, M. E.; Werner, A.; Hein, R.; D, H. B.; Peschel, C.; Rad, R.; Cox, J.; Mann, M.; Krackhardt, A. M. Nat Commun 2016, 7, 13404. [0192] (13) Bilich, T.; Nelde, A.; Bichmann, L.; Roerden, M.; Salih, H. R.; Kowalewski, D. J.; Schuster, H.; Tsou, C. C.; Marcu, A.; Neidert, M. C.; Lubke, M.; Rieth, J.; Schemionek, M.; Brummendorf, T. H.; Vucinic, V.; Niederwieser, D.; Bauer, J.; Marklin, M.; Peper, J. K.; Klein, R., et al. Blood 2019, 133, 550-565. [0193] (14) Caron, E.; Kowalewski, D. J.; Chiek Koh, C.; Sturm, T.; Schuster, H.; Aebersold, R. Mol Cell Proteomics 2015, 14, 3105-3117. [0194] (15) Shraibman, B.; Barnea, E.; Kadosh, D. M.; Haimovich, Y.; Slobodin, G.; Rosner, I.; Lopez-Larrea, C.; Hilf, N.; Kuttruff, S.; Song, C.; Britten, C.; Castle, J.; Kreiter, S.; Frenzel, K.; Tatagiba, M.; Tabatabai, G.; Dietrich, P. Y.; Dutoit, V.; Wick, W.; Platten, M., et al. Mol Cell Proteomics 2018, 17, 2132-2145. [0195] (16) Mommen, G. P.; Frese, C. K.; Meiring, H. D.; van Gaans-van den Brink, J.; de Jong, A. P.; van Els, C. A.; Heck, A. J. Proc Natl Acad Sci USA 2014, 111, 4507-4512. [0196] (17) Murphy, J. P.; Konda, P.; Kowalewski, D. J.; Schuster, H.; Clements, D.; Kim, Y.; Cohen, A. M.; Sharif, T.; Nielsen, M.; Stevanovic, S.; Lee, P. W.; Gujar, S. J Proteome Res 2017, 16, 1806-1816. [0197] (18) Granados, D. P.; Yahyaoui, W.; Laumont, C. M.; Daouda, T.; Muratore-Schroeder, T. L.; Cote, C.; Laverdure, J. P.; Lemieux, S.; Thibault, P.; Perreault, C. Blood 2012, 119, e181-191. [0198] (19) Liepe, J.; Marino, F.; Sidney, J.; Jeko, A.; Bunting, D. E.; Sette, A.; Kloetzel, P. M.; Stumpf, M. P.; Heck, A. J.; Mishto, M. Science 2016, 354, 354-358. [0199] (20) Laumont, C. M.; Perreault, C. Cell Mol Life Sci 2018, 75, 607-621. [0200] (21) Granados, D. P.; Laumont, C. M.; Thibault, P.; Perreault, C. Curr Opin Immunol 2015, 34, 1-8. [0201] (22) Roopenian, D.; Choi, E. Y.; Brown, A. Immunol Rev 2002, 190, 86-94. [0202] (23) Spierings, E.; Hendriks, M.; Absi, L.; Canossi, A.; Chhaya, S.; Crowley, J.; Dolstra, H.; Eliaou, J. F.; Ellis, T.; Enczmann, J.; Fasano, M. E.; Gervais, T.; Gorodezky, C.; Kircher, B.; Laurin, D.; Leffell, M. S.; Loiseau, P.; Malkki, M.; Markiewicz, M.; Martinetti, M., et al. PLoS Genet 2007, 3, e103. [0203] (24) Murphy, J. P.; Yu, Q.; Konda, P.; Paulo, J. A.; Jedrychowski, M. P.; Kowalewski, D. J.; Schuster, H.; Kim, Y.; Clements, D.; Jain, A.; Stevanovic, S.; Gygi, S. P.; Mancias, J. D.; Gujar, S. Anal Chem 2019, 91, 5106-5115. [0204] (25) Pfammatter, S.; Bonneil, E.; McManus, F. P.; Prasad, S.; Bailey, D. J.; Belford, M.; Dunyach, J. J.; Thibault, P. Mol Cell Proteomics 2018, 17, 2051-2067. [0205] (26) Pfammatter, S.; Bonneil, E.; Thibault, P. J Proteome Res 2016, 15, 4653-4665. [0206] (27) Granados, D. P.; Sriranganadane, D.; Daouda, T.; Zieger, A.; Laumont, C. M.; Caron-Lizotte, O.; Boucher, G.; Hardy, M. P.; Gendron, P.; Cote, C.; Lemieux, S.; Thibault, P.; Perreault, C. Nat Commun 2014, 5, 3600. [0207] (28) Zecha, J.; Satpathy, S.; Kanashova, T.; Avanessian, S. C.; Kane, M. H.; Clauser, K. R.; Mertins, P.; Carr, S. A.; Kuster, B. Mol Cell Proteomics 2019, 18, 1468-1478. [0208] (29) Courcelles, M.; Durette, C.; Daouda, T.; Laverdure, J. P.; Vincent, K.; Lemieux, S.; Perreault, C.; Thibault, P. J Proteome Res 2020. [0209] (30) Hunt, S. E.; McLaren, W.; Gil, L.; Thormann, A.; Schuilenburg, H.; Sheppard, D.; Parton, A.; Armean, I. M.; Trevanion, S. J.; Flicek, P.; Cunningham, F. Database (Oxford) 2018, 2018. [0210] (31) Laumont, C. M.; Vincent, K.; Hesnard, L.; Audemard, E.; Bonneil, E.; Laverdure, J. P.; Gendron, P.; Courcelles, M.; Hardy, M. P.; Cote, C.; Durette, C.; St-Pierre, C.; Benhammadi, M.; Lanoix, J.; Vobecky, S.; Haddad, E.; Lemieux, S.; Thibault, P.; Perreault, C. Sci Transl Med 2018, 10. [0211] (32) Pearson, H.; Daouda, T.; Granados, D. P.; Durette, C.; Bonneil, E.; Courcelles, M.; Rodenbrock, A.; Laverdure, J. P.; Cote, C.; Mader, S.; Lemieux, S.; Thibault, P.; Perreault, C. J Clin Invest 2016, 126, 4690-4701. [0212] (33) Garrison, E.; Marth, G. arXiv e-prints 2012. [0213] (34) Bray, N. L.; Pimentel, H.; Melsted, P.; Pachter, L. Nat Biotechnol 2016, 34, 525-527. [0214] (35) Thompson, A.; Schafer, J.; Kuhn, K.; Kienle, S.; Schwarz, J.; Schmidt, G.; Neumann, T.; Johnstone, R.; Mohammed, A. K.; Hamon, C. Anal Chem 2003, 75, 1895-1904. [0215] (36) Tsai, C. F.; Smith, J. S.; Krajewski, K.; Zhao, R.; Moghieb, A. M.; Nicora, C. D.; Xiong, X.; Moore, R. J.; Liu, T.; Smith, R. D.; Jacobs, J. M.; Rajagopal, S.; Shi, T. Anal Chem 2019, 91, 11606-11613. [0216] (37) Genomes Project, C.; Abecasis, G. R.; Altshuler, D.; Auton, A.; Brooks, L. D.; Durbin, R. M.; Gibbs, R. A.; Hurles, M. E.; McVean, G. A. Nature 2010, 467, 1061-1073. [0217] (38) Granados, D. P.; Rodenbrock, A.; Laverdure, J. P.; Cote, C.; Caron-Lizotte, O.; Carli, C.; Pearson, H.; Janelle, V.; Durette, C.; Bonneil, E.; Roy, D. C.; Delisle, J. S.; Lemieux, S.; Thibault, P.; Perreault, C. Leukemia 2016, 30, 1344-1354. [0218] (39) Ehx, G.; Perreault, C. Genome Med 2019, 11, 29. [0219] (40) McAlister, G. C.; Nusinow, D. P.; Jedrychowski, M. P.; Wuhr, M.; Huttlin, E. L.; Erickson, B. K.; Rad, R.; Haas, W.; Gygi, S. P. Anal Chem 2014, 86, 7150-7158. [0220] (41) Perez-Riverol, Y.; Csordas, A.; Bai, J.; Bernal-Llinares, M.; Hewapathirana, S.; Kundu, D. J.; Inuganti, A.; Griss, J.; Mayer, G.; Eisenacher, M.; Perez, E.; Uszkoreit, J.; Pfeuffer, J.; Sachsenberg, T.; Yilmaz, S.; Tiwary, S.; Cox, J.; Audain, E.; Walzer, M.; Jarnuczak, A. F., et al. Nucleic Acids Res 2019, 47, D442-D450. [0221] (42) Ehx G, Larouche J D, Durette C, Laverdure J P, Hesnard L, Vincent K, Hardy M P, Thériault C, Rulleau C, Lanoix J, Bonneil E, Feghaly A, Apavaloaei A, Noronha N, Laumont C M, Delisle J S, Vago L, Hébert J, Sauvageau G, Lemieux S, Thibault P, Perreault C. Immunity. 2021, 54, Epub ahead of print. [0222] (43) Martin Thomsen, Claus Lundegaard, Søren Buus, Ole Lund, and Morten Nielsen. Immunogenetics. 2013 September; 65(9): 655-665. [0223] (44) Douglass et al., Sci. Immunol. 6, eabd5515 (2021) 1 Mar. 2021; [0224] (45) Hsiue et al., Science. 2021 Mar. 5; 371(6533):eabc8697. Epub 2021 Mar. 1. [0225] (46) Yang et al., Theranostics 2019, Vol. 9, Issue 25: 7792-7806.