APPLICATION OF HETEROCYCLIC COMPOUND CONTAINING AT LEAST TWO SULFUR ATOMS IN PREPARING NANO-VACCINE AND PREPARED NANO-VACCINE

Abstract

The present disclosure pertains to the technical field of immunotherapy or disease prevention and treatment with vaccines, in particular to a heterocyclic compound containing two or more sulfur atoms and an application thereof in preparing a nano-vaccine. Provided is the application of the heterocyclic compound containing at least two sulfur atoms and capable of being covalently or non-covalently linked to a polypeptide in preparing the nano-vaccine. A nanoparticle prepared by self-assembly of the compound and an antigen can enter the dendritic cytoplasm in nonendocytic pathway, thereby improving the uptake efficiency of the antigen and an immune adjuvant. In the process of entering a cell, the nano-vaccine can effectively avoid or reduce biodegradation of the antigen or nucleic acid adjuvant caused by enzymes in lysosomes, and therefore the nano-vaccine can efficiently activate the dendritic cells and improve the cross-presentation of the antigen, thereby effectively activating CD8+ T cells and promoting T cell proliferation. Therefore, the nano-vaccine can prevent tumor cell proliferation and virus infection by efficient immune activation and immune regulation.

Claims

1.-14. (canceled)

15. An application of a compound of formula I in preparation of nano-vaccine;
A-L-F  Formula I wherein, A is a heterocyclic group comprising two or more S atoms; L is none or a linking group; F is a group capable of being covalently or non-covalently linked to a polypeptide.

16. The application according to claim 15, wherein the heterocyclic group in A is a 4- to 8-membered ring.

17. The application according to claim 15, wherein the L is —(CH.sub.2).sub.n—, ##STR00021## wherein n=1˜5; R is —H, C.sub.1-5 alkyl group, ##STR00022## m=1˜50.

18. The application according to claim 16, wherein the L is —(CH.sub.2).sub.n—, ##STR00023## wherein n=1˜5; R is —H, C.sub.1-5 alkyl group, ##STR00024## m=1˜50.

19. The application according to claim 15, wherein the F is: ##STR00025## ##STR00026##

20. The application according to claim 16, wherein the F is: ##STR00027## ##STR00028##

21. The application according to claim 17, wherein the F is: ##STR00029## ##STR00030##

22. The application according to claim 18, wherein the F is: ##STR00031## ##STR00032##

23. The application according to claim 15, wherein the A is: ##STR00033## the F is: ##STR00034## the L is: ##STR00035##

24. The application according to claim 15, wherein the compound of formula I is: ##STR00036##

25. A nanoparticle, having a raw material comprising a compound of formula I and an antigen peptide;
A-L-F  Formula I wherein, A is a heterocyclic group comprising two or more S atoms; L is none or a linking group; F is a group capable of being covalently or non-covalently linked to a polypeptide.

26. The nanoparticle according to claim 25, wherein the antigen peptide is selected from tumor antigens, bacterial antigens or virus antigens.

27. The nanoparticle according to claim 26, wherein the tumor antigen is a tumor neoantigen selected from a neoantigen of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, central nervous system cancer, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastrointestinal cancer, external genital cancer, urogenital cancer, head cancer, kidney cancer, laryngeal cancer, liver cancer, lung cancer, muscle tissue cancer, neck cancer, oral or nasal mucosa cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, spleen cancer, small intestine cancer, large intestine cancer, gastric cancer, testicular cancer and/or thyroid cancer; the virus antigen is influenza virus antigen, Ebola virus antigen, coronavirus antigen, hepatitis virus antigen, mumps virus antigen, varicella-zoster virus antigen, measles virus antigen, rubella virus antigen, influenza virus antigen and/or Avian influenza virus antigen; the bacterial antigen is binding mycobacterial antigen, staphylococcal antigen, streptococcal antigen, pneumococcal antigen, anthracis antigen, diphtheria antigen, proteus antigen, pertussis antigen, Vibrio cholerae antigen, meningococcal antigen and/or typhoid bacillus antigen.

28. The nanoparticle according to claim 25, wherein the nanoparticle further comprises a nucleic acid adjuvant, and the nucleic acid adjuvant is CpG-ODN, Poly I:C.

29. The nanoparticle according to claim 28, wherein a molar ratio of the compound of formula I, the nucleic acid adjuvant and the antigen peptide is (50˜100):(0˜1):(20˜50).

30. A preparation method of the nanoparticle according to claim 25, comprising: a nano-vaccine preparation method comprising: mixing the compound of formula I, a nucleic acid adjuvant and the polypeptide antigen with a TM buffer, stirring at 37° C. for 15 min, and then dialyzing in deionized water, to prepare a solution comprising nanoparticles.

31. A preparation method of the nanoparticle according to claim 26, comprising: a nano-vaccine preparation method comprising: mixing the compound of formula I, a nucleic acid adjuvant and the polypeptide antigen with a TM buffer, stirring at 37° C. for 15 min, and then dialyzing in deionized water, to prepare a solution comprising nanoparticles.

32. A preparation method of the nanoparticle according to claim 27, comprising: a nano-vaccine preparation method comprising: mixing the compound of formula I, a nucleic acid adjuvant and the polypeptide antigen with a TM buffer, stirring at 37° C. for 15 min, and then dialyzing in deionized water, to prepare a solution comprising nanoparticles.

33. A preparation method of the nanoparticle according to claim 28, comprising: a nano-vaccine preparation method comprising: mixing the compound of formula I, the nucleic acid adjuvant and the polypeptide antigen with a TM buffer, stirring at 37° C. for 15 min, and then dialyzing in deionized water, to prepare a solution comprising nanoparticles.

34. A preparation method of the nanoparticle according to claim 29, comprising: a nano-vaccine preparation method comprising: mixing the compound of formula I, the nucleic acid adjuvant and the polypeptide antigen with a TM buffer, stirring at 37° C. for 15 min, and then dialyzing in deionized water, to prepare a solution comprising nanoparticles.

35. A nano-vaccine comprising the nanoparticle of claim 25 and an adjuvant acceptable in the nano-vaccine.

36. A nano-vaccine comprising the nanoparticle of claim 26 and an adjuvant acceptable in the nano-vaccine.

37. A nano-vaccine comprising the nanoparticle of claim 27 and an adjuvant acceptable in the nano-vaccine.

38. A nano-vaccine comprising the nanoparticle of claim 28 and an adjuvant acceptable in the nano-vaccine.

39. A nano-vaccine comprising the nanoparticle of claim 29 and an adjuvant acceptable in the nano-vaccine.

40. An application of the nano-vaccine of claim 35 in preparation of medicine for prevention and/or treatment of tumor, bacterial infection and/or virus infection.

41. An application of the nano-vaccine of claim 36 in preparation of medicine for prevention and/or treatment of tumor, bacterial infection and/or virus infection.

42. An application of the nano-vaccine of claim 37 in preparation of medicine for prevention and/or treatment of tumor, bacterial infection and/or virus infection.

43. An application of the nano-vaccine of claim 38 in preparation of medicine for prevention and/or treatment of tumor, bacterial infection and/or virus infection.

44. An application of the nano-vaccine of claim 39 in preparation of medicine for prevention and/or treatment of tumor, bacterial infection and/or virus infection.

45. A method for prevention and/or treatment of tumor, bacterial infection and/or virus infection, comprising: administering the nano-vaccine of claim 35.

46. A method for prevention and/or treatment of tumor, bacterial infection and/or virus infection, comprising: administering the nano-vaccine of claim 36.

47. A method for prevention and/or treatment of tumor, bacterial infection and/or virus infection, comprising: administering the nano-vaccine of claim 37.

48. A method for prevention and/or treatment of tumor, bacterial infection and/or virus infection, comprising: administering the nano-vaccine of claim 38.

49. A method for prevention and/or treatment of tumor, bacterial infection and/or virus infection, comprising: administering the nano-vaccine of claim 39.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0053] FIG. 1 shows a schematic illustration of nano-vaccine preparation and application of anti-tumor;

[0054] FIG. 2 shows the scanning electron microscopy images of the nano-vaccine of Example 3;

[0055] FIG. 3 shows the size distribution of the nano-vaccine of Example 3 and the control nano-vaccine;

[0056] FIG. 4 shows confocal fluorescence microscopy images of the nano-vaccine subcellular distribution in dendritic cells. Nano-vaccine of Example 3 was incubated with dendritic cells for 30 minutes, wherein the polypeptide antigens were labeled with red fluorescence, the nucleic acid adjuvants were labeled with green fluorescence, and the scale is 20 μm;

[0057] FIG. 5 shows confocal fluorescence microscopy images of the nano-vaccine subcellular distribution of Example 3 in dendritic cells, wherein the lysosomes were labeled with green fluorescence, the polypeptide antigens were labeled with red fluorescence, and the scale is 20 μm;

[0058] FIG. 6 shows confocal fluorescence microscopy images of the nano-vaccine subcellular distribution in dendritic cells. Nano-vaccine of Example 4 was incubated with dendritic cells for 30 minutes, wherein the polypeptide antigens were labeled with red fluorescence, the nucleic acid adjuvants were labeled with green fluorescence, and the scale is 10 μm;

[0059] FIG. 7 shows confocal fluorescence microscopy images of the nano-vaccine subcellular distribution of Example 4 in dendritic cells, wherein the lysosomes were labeled with green fluorescence, the polypeptide antigens were labeled with red fluorescence, and the scale is 10 μm;

[0060] FIG. 8 shows confocal fluorescence microscopy images of the nano-vaccine subcellular distribution in dendritic cells. Nano-vaccine of Example 5 was incubated with dendritic cells for 30 minutes, wherein the polypeptide antigens were labeled with red fluorescence, the nucleic acid adjuvants were labeled with green fluorescence, and the scale is 10 μm;

[0061] FIG. 9 shows confocal fluorescence microscopy images of the nano-vaccine subcellular distribution of Example 5 in dendritic cells, wherein the lysosomes were labeled with green fluorescence, the polypeptide antigens were labeled with red fluorescence, and the scale is 10 μm;

[0062] FIG. 10 shows the activation of dendritic cells after being treated with the nano-vaccine of Example 3 for 3 days;

[0063] FIG. 11 shows the proliferation of dendritic cells activated by the nano-vaccine prepared in Example 3 after co-cultivation with CD8+ T cells for 2 days;

[0064] FIG. 12 shows a mouse tumor growth curve of H22 murine liver cancer treated by the nano-vaccine of Example 3.

DETAILED DESCRIPTION OF THE INVENTION

[0065] The present disclosure provides an application of a heterocyclic compound comprising at least two S atoms in the preparation of nano-vaccine and the prepared nano-vaccine. Those skilled in the art may learn from the content of this disclosure and appropriately improve process parameters to realize. In particular, it should be pointed out that all similar replacements and modifications are obvious to those skilled in the art, and they are all deemed to be included in the present disclosure. The method and application of the present disclosure have been described through the preferred embodiments. It is obvious that relevant personnel can modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present disclosure to realize and apply the technology of present disclosure.

[0066] The materials used in the present disclosure are all common commercially available products, all of which can be purchased in the market.

[0067] (1) Chemical reagents: all nucleic acid adjuvants (see Table 1 for sequences) were prepared by Sangon Biotech (Shanghai) Co., Ltd. and synthesized by HPLC purification method. LysoTracker and Hoechst 33342 were purchased from Thermo Fisher Scientific Co., Ltd. of the United States of America. Ultrapure water was prepared by Milli-Q water purification system (18.2MΩ).

[0068] (2) Cell lines and cell culture: murine hepatocarcinoma cells H22 were purchased from the American Type Culture Collection (ATCC). H22 cells were cultured in DMEM medium (HyClone) supplemented with a final concentration of 10% fetal bovine serum (Gibco) and a final concentration of 100 IU/mL penicillin-streptomycin, in 5% CO.sub.2 at 37° C.

[0069] (3) The required murine nucleic acid adjuvant CpG-ODN was used to activate dendritic cells. The base sequence is as follows:

TABLE-US-00001 TABLE 1 DNA sequences of CpG-ODN used in the examples name Base sequence (5′ .fwdarw.  3′) FAM fluorescence TCCATGACGTTCCTGACGTT-FAM labeled CpG-ODN Unlabeled CpG-ODN TCCATGACGTTCCTGACGTT

[0070] Compound:

[0071] Compound 1:

##STR00016##

synthesized in Example 1;

[0072] Compound 2:

##STR00017##

synthesized in Example 2;

[0073] Compound 3:

##STR00018##

purchased from Macleans Biochemical Technology Co., Ltd.

[0074] The present disclosure was further illustrated by following examples.

Example 1

[0075] The dichloromethane solution comprising N,N′-carbonyldiimidazole and lipoic acid was gradually dropped into the dichloromethane comprising ethylenediamine kept at 0° C. The reaction mixture was stirred 1 h at 0° C. and 1 h at room temperature. The organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure, yielding substance as oil. The oily substance was dissolved in dichloromethane and 1H-pyrazole-1-carboxamidine hydrochloride was added. The suspension was stirred at room temperature until complete consumption of starting reagent. Solvent was removed under reduced pressure and the residue was dissolved in methanol. Ether was added to induce precipitation, and then the precipitate was washed with ether, yielding the final product Compound 1.

##STR00019##

Example 2

[0076] ##STR00020##

[0077] The anhydrous CH.sub.2Cl.sub.2 solution of molecule 1 was activated by adding 1,1-carbonyldiimidazole (CDI), and then molecule 2 was added for condensation reaction to obtain molecule 3. Trifluoroacetic acid (TFA) was added to the CH.sub.2Cl.sub.2 solution of molecule 3 to remove the tert-butoxycarbonyl protecting group to obtain molecule 4. Molecule 4, levulinic acid, 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), and N, N-diisopropylethylamine (DIPEA) were added in anhydrous CH.sub.2Cl.sub.2, molecule 5 was obtained through condensation reaction.

Example 3

[0078] Nano-vaccine preparation method: compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (mouse liver cancer cell H22 polypeptide antigen, amino acid sequence: HTDAHAQAFAALFDSMH, N terminal connected to a Cy3 label, and isoelectric point: 5.71) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain nano-vaccine.

[0079] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The results show that CpG-ODN, polypeptide antigen and compound 1 formed spherical nano-vaccines in the TM buffer (pH=7.4), with a particle size of about 100 nm (as shown in FIG. 2a). The concentration of the active ingredient CpG-ODN was 8.8 μg/mL, the concentration of polypeptide antigen was 6.11 μg/mL.

Comparative Example

[0080] The compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), 2.5 mg/mL control polypeptide antigen (amino acid sequence: YKYRYLRHGKLR, N-terminal connected to a Cy3 label, and the isoelectric point: 10.55) were mixed at a volume ratio of 1:1:1, Next, a 60 to 70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain comparative nano-vaccine. The dynamic light scattering analysis showed that the hydrodynamic size of the nano-vaccine was about 100 nm, while the hydrodynamic size of the comparative nano-vaccine was about 600 nm. This result indicated that due to the difference in the isoelectric point of the polypeptide, the size of the formed comparative nano-vaccine was too large to achieve a high-efficiency cell uptake.

Example 4

[0081] Nano-vaccine preparation method: compound 2 prepared in Example 2 (concentration: 146.2 mM), 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus antigen polypeptide 1, amino acid sequence: FYYVWKSYV, N terminal connected to a Cy3 label, isoelectric point: 8.43) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0082] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 8.8 μg/mL, and the concentration of polypeptide antigen was 6.11 μg/mL.

Example 5

[0083] Nano-vaccine preparation method: compound 3 (concentration: 146.2 mM), 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus polypeptide antigen 2, amino acid sequence: KYTQLCQYL, N-terminal connected to a Cy3 label, isoelectric point: 8.5) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0084] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 8.8 μg/mL, and the concentration of polypeptide antigen was 6.11 μg/mL.

Example 6

[0085] Nano-vaccine preparation method: compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus polypeptide antigen 3, amino acid sequence: SYYSLLMPI, isoelectric point: 5.55) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0086] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 7.8 μg/mL, and the concentration of polypeptide antigen was 7.41 μg/mL.

Example 7

[0087] Nano-vaccine preparation method: compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus polypeptide antigen 4, amino acid sequence: RYVLMDGSI, isoelectric point: 6.21) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0088] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 7.1 μg/mL, and the concentration of polypeptide antigen was 5.82 μg/mL.

Example 8

[0089] Nano-vaccine preparation method: compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus polypeptide antigen 5, amino acid sequence: AYANSVFNI, isoelectric point: 5.55) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0090] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 9.1 μg/mL, and the concentration of polypeptide antigen was 7.21 μg/mL.

Example 9

[0091] Nano-vaccine preparation method: compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus polypeptide antigen 6, amino acid sequence: TYASALWEI, isoelectric point: 3.75) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0092] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 7.1 μg/mL, and the concentration of polypeptide antigen was 7.67 μg/mL.

Example 10

[0093] Nano-vaccine preparation method: compound 1 (concentration: 146.2 mM) prepared in Example 1, 100 mM nucleic acid adjuvant (CpG-ODN), and 2.5 mg/mL polypeptide antigen (new coronavirus polypeptide antigen 7, amino acid sequence: GYLKLTDNV, isoelectric point: 6.21) were mixed at a volume ratio of 1:1:1. Next, a 60-70 times volume of TM buffer solution (pH 7.4) to the mixture was added, then stirred at 37° C. for 15 min and dialyzed in deionized water for 24 h to remove the unloaded nucleic acid adjuvant or polypeptide antigen, to finally obtain the nano-vaccine.

[0094] The dynamic light scattering analysis and the scanning electron microscope images indicated the successful preparation of nano-vaccine. The concentration of active ingredient CpG-ODN was 9.12 μg/mL, and the concentration of polypeptide antigen was 7.14 μg/mL.

Effectiveness Verification

A. Laser Confocal Fluorescence Imaging Analysis of the Internalization of Nano-Vaccine in Dendritic Cells:

[0095] Nano-vaccines prepared in Examples 3-10 with CpG-ODN and polypeptide antigens respectively labeled with FAM and Cy3 fluorescent dyes were co-cultured with immature dendritic cells in a glass-bottom dishes for 30 minutes, and then stained with Hoechst 33342. The subcellular location of nano-vaccines was observed by laser confocal fluorescence microscope.

[0096] The laser confocal fluorescence microscope images indicated that the nano-vaccine could quickly enter the dendritic cells. The cellular uptake of the nano-vaccine of Example 3 is shown in FIG. 3. In order to further verify that the vaccine enters the cell through a thiol-mediated uptake instead of an endocytic pathway, cells were stained with a lysosome dye (LysoTracker green). The nano-vaccine labeled with red fluorescence was mostly separated from the lysosomes and localized in the cytoplasm. This result suggested that the internalization pathway of nano-vaccine is the nonendocytic thiol-mediated uptake, and it was predicted that the nano-vaccine can significantly reduce the risk of degradation of CpG-ODN and polypeptide antigens in lysosomes (FIG. 4).

[0097] In addition, the cellular uptake of the nano-vaccine of Example 4 is shown in FIGS. 5-6; and the cellular uptake of the nano-vaccine of Example 5 is shown in FIGS. 7-8.

B. Nano-Vaccines Induce the Dendritic Cells Maturation Efficiently:

[0098] Dendritic cells were seeded in a 6-well plate and cultured at 37° C. The dendritic cells were co-cultured with PBS buffer, CpG-ODN alone, polypeptide antigen, CpG-ODN and polypeptide antigen mixture, and nano-vaccine (Example 3) for 3 days, with LPS as a positive control. Then the dendritic cells were stained with antibodies of CD11c, CD80, CD86 labeled with fluorochrome, and flow cytometry was used for phenotype analysis. The data showed that the nano-vaccine treatment group had the highest proportion of mature dendritic cells compared with the other groups (PBS, CpG-ODN alone, polypeptide antigen, CpG-ODN and polypeptide antigen mixture), LPS was the positive control group (as shown in FIG. 9).

C. Dendritic Cells Activated by Nano-Vaccine can Effectively Activate T Cell Maturation and Proliferation:

[0099] To demonstrate that the nano-vaccine (Example 3) can efficiently activate the T cell-dependent immune response and enhance T cell maturation and cell proliferation, the dendritic cells of the different treatment groups in the above experiment B were co-cultured with immature mouse primary T cells inoculated into a 6-well plate for 2 days. Next, the T cells stimulated by dendritic cells were stained with fluorochrome-labeled CD8 antibody, and the phenotype was analyzed by flow cytometry. In addition, to evaluate the proliferation of CD8+ T cells, the T cells stimulated by dendritic cells were labeled with CFSE dye and co-cultured for 2 days. The fluorescence quantitation was analyzed using flow cytometry. The increased fluorescence intensity on the left side (P2) (as shown in FIG. 10) showed that dendritic cells treated with nano-vaccine can efficiently stimulate T cell maturation and effectively promote T cell proliferation.

D. Mice Immunized with Nano-Vaccine can Effectively Prevent Tumors

[0100] To evaluate the tumor prevention effects of the nano-vaccine synthesized in Example 3, BCLB/c male mice (5 weeks old) were inoculated with PBS buffer, CpG-ODN alone, polypeptide antigen, CpG-ODN and polypeptide antigen mixture, and nano-vaccine for once every 5 days. After five times immunizations, mice were transplanted with H22 tumors. The tumor size was measured every 3 days and the tumor growth curve was plotted. As shown in FIG. 11, the tumor growth of the mice treated with the nano-vaccine was obviously inhibited, and its inhibition efficiency was higher than that of other treatment groups. It was proved that the nano-vaccine can inhibit the growth of H22 liver cancer tumor more efficiently, and provide research basis for tumor immune prevention and/or treatment.

[0101] Therefore, nano-vaccine has good anti-tumor activity and has good clinical transformation and application prospects in tumor immunotherapy.

[0102] The above are only the preferred embodiments of the present disclosure. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present disclosure, various improvements and modifications can be made, and these improvements and modifications should also be considered the protection scope of the present disclosure.