AMINO LIPID COMPOUND, PREPARATION METHOD THEREFOR, COMPOSITION THEREOF AND USE THEREOF

Abstract

The present disclosure relates to an amino lipid compound, a preparation method therefor, a composition thereof and the use thereof. Specifically, the present disclosure relates to an amino lipid compound represented by formula (I) or a pharmaceutically acceptable salt or stereoisomer thereof, and the use thereof in the formulation of a lipid nanoparticle for delivering an active ingredient. The present disclosure also relates to a composition containing the amino lipid compound, and in particular relates to a lipid nanoparticle and the use thereof.

##STR00001##

Claims

1-11. (canceled)

12. An amino lipid compound having a structure of formula (I): ##STR00326## or a pharmaceutically acceptable salt or stereoisomer thereof, wherein: Z.sub.1, Z.sub.2, and Z.sub.4 are each independently a bond; Z.sub.3 is CH(OR.sub.7), C(O)O, OC(O), or a bond; Z.sub.5 and Z.sub.6 are each independently C(O)O or OC(O); A.sub.1, A.sub.2, and A.sub.5 are each independently a bond; A.sub.3, A.sub.6 and A.sub.7 are each independently C.sub.1-C.sub.12 alkylene or C.sub.2-C.sub.12 alkenylene having 1, 2, 3, 4 or more double bonds; A.sub.4 is C.sub.1-C.sub.12 alkylene, C.sub.2-C.sub.12 alkenylene having 1, 2, 3, 4 or more double bonds, or a bond; R.sub.1 and R.sub.2 are each independently C.sub.1-C.sub.18 alkyl, or C.sub.2-C.sub.18 alkenyl having 1, 2, 3, 4 or more double bonds; or R.sub.1 and R.sub.2together with the nitrogen atom to which they are attached form a 4- to 7-membered heterocycle having said nitrogen atom and 0, 1, 2 or 3 additional heteroatoms independently selected from N, O and S in the ring, the heterocycle being optionally substituted with 1, 2, 3 or more substituents independently selected from C.sub.1-C.sub.8 alkyl, C.sub.1-C.sub.8 haloalkyl, OC.sub.1-C.sub.8 alkyl, OC.sub.1-C.sub.8 haloalkyl, halogen, OH, CN, nitro, NH.sub.2, NH(C.sub.1-C.sub.6 alkyl), and N(C.sub.1-C.sub.6 alkyl).sub.2; R.sub.3 is H, C.sub.1-C.sub.18 alkyl, or C.sub.2-C.sub.18 alkenyl having 1, 2, 3, 4 or more double bonds; R.sub.4 and R.sub.5 are each independently C.sub.1-C.sub.18 alkyl, or C.sub.2-C.sub.18 alkenyl having 1, 2, 3, 4 or more double bonds; and R.sub.7 is H, C.sub.1-C.sub.12 alkyl, or C.sub.2-C.sub.12 alkenyl having 1, 2 or 3 double bonds.

13-23. (canceled)

24. The amino lipid compound according to claim 12, wherein: Z.sub.3 is C(O)O or OC(O).

25. The amino lipid compound according to claim 12, wherein: Z.sub.3 is C(O)O, wherein the C(O) moiety is bonded to A.sub.4; and R.sub.3 is C.sub.1-C.sub.18 alkyl, or C.sub.2-C.sub.18 alkenyl having 1, 2, 3, 4 or more double bonds.

26. The amino lipid compound according to claim 12, wherein A.sub.4 is a bond; or A.sub.4 is C.sub.1-C.sub.10 alkylene.

27-29. (canceled)

30. The amino lipid compound according to claim 12, wherein A.sub.3 is C.sub.1-C.sub.6 alkylene preferably (CH.sub.2).sub.2, (CH.sub.2).sub.3 or (CH.sub.2).sub.4.

31. The amino lipid compound according to claim 12, wherein A.sub.6 and A.sub.7 are each independently C.sub.5-C.sub.10 alkylene, preferably C.sub.6-C.sub.9 alkylene.

32. The amino lipid compound according to claim 12, wherein the alkyl as defined for R.sub.1 or R.sub.2 is C.sub.1-C.sub.4 alkyl, and preferably C.sub.1-C.sub.2 alkyl.

33. The amino lipid compound according to claim 12, wherein the heterocycle formed by R.sub.1 and R.sub.2 together with the nitrogen atom to which they are attached is a 5- to 7-membered heterocycle having said nitrogen atom and 0, 1 or 2 additional heteroatoms independently selected from N, O and S in the ring, the heterocycle being optionally substituted with 1, 2, or 3 substituents independently selected from C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 haloalkyl, OC.sub.1-C.sub.6 alkyl, OC.sub.1-C.sub.6 haloalkyl, halogen, OH, CN, nitro, NH.sub.2, NH(C.sub.1-C.sub.6 alkyl) and N(C.sub.1-C.sub.6 alkyl).sub.2.

34. The amino lipid compound according to claim 12, wherein the alkyl as defined for R.sub.3 is C.sub.2-C.sub.12 alkyl, preferably C.sub.1-C.sub.10 alkyl.

35. The amino lipid compound according to claim 12, wherein the alkenyl as defined for R.sub.3 is C.sub.2-C.sub.12 alkenyl having 1, 2, or 3 double bonds.

36-37. (canceled)

38. The amino lipid compound according to claim 12, wherein both Z.sub.5 and Z.sub.6 are C(O)O, and the C(O) moiety is bonded to A.sub.6 or A.sub.7.

39. The amino lipid compound according to claim 12, wherein the alkyl as defined for R.sub.4 or R.sub.5 is branched C.sub.8-C.sub.18 alkyl, such as branched C.sub.11-C.sub.18 alkyl.

40-55. (canceled)

56. The amino lipid compound according to claim 12, having one of the structures shown below: TABLE-US-00009 No. Structural formula 108 109 110 111 112 113 114 115 116 117 137 138 139 140 141 142 159 160 161 162 163 164 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379

57. A lipid nanoparticle comprising the amino lipid compound of claim 12.

58-72. (canceled)

73. A pharmaceutical composition comprising a lipid nanoparticle of comprising the amino lipid compound of claim 12, and a pharmaceutically acceptable carrier, diluent or excipient.

74-76. (canceled)

77. A method for delivering an active ingredient, comprising administering a lipid nanoparticles comprising the amino lipid compound of claim 12 as a delivery vehicle.

78. A method for the treatment and/or prevention of a disease, preferably for gene therapy, protein replacement therapy, antisense therapy, therapy by interfering RNA, or gene vaccination, comprising administering a lipid nanoparticle comprising the amino lipid compound of claim 12, or a pharmaceutical composition comprising said lipid nanoparticle, and a pharmaceutically acceptable carrier, diluent or excipient.

79-83. (canceled)

84. A method for transferring a nucleic acid, comprising administering a lipid nanoparticle comprising the amino lipid compound of claim 12, a pharmaceutical composition comprising said lipid nanoparticle, and a pharmaceutically acceptable carrier, diluent or excipient.

85. (canceled)

86. The amino lipid compound according to claim 12, wherein R.sub.1 and R.sub.2 are each independently C.sub.1-C.sub.4 alkyl, and preferably C.sub.1-C.sub.2 alkyl; and/or R.sub.4 and R.sub.5 are each independently branched C.sub.8-C.sub.18 alkyl, preferably branched C.sub.11-C.sub.18 alkyl.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0247] FIG. 1 shows the results of ALT enzyme activity test 12 h after in vivo delivery of the lipid nanoparticle in Experimental Example 4.

[0248] FIG. 2 shows the results of Elispot cell immunity test for spleen lymphocytes of mice with representative amino lipid compounds in Experimental Example 5.

[0249] FIG. 3 shows the results of Elispot cell immunity test for spleen lymphocytes of mice with representative amino lipid compounds in Experimental Example 5.

[0250] FIG. 4 shows the results of Elispot cell immunity test for spleen lymphocytes of mice with representative amino lipid compounds in Experimental Example 5.

[0251] FIG. 5 shows the IgG titer of serum from mice immunized for 14 days with LNP containing IN002.5.1 mRNA encapsulated with representative amino lipid compounds in Experimental Example 6.

[0252] FIG. 6 shows the IgG titer of serum from mice immunized for 14 days with LNP containing N002.5.1 mRNA encapsulated with representative amino lipid compounds in Experimental Example 6.

[0253] In order to make the purposes, technical solutions, and advantages of the present disclosure clearer, the present disclosure is described below with reference to specific examples. The follow examples are merely illustrative of the present disclosure and are not intended to be limiting.

EXAMPLES

[0254] The following examples are provided for purposes of illustration and not limitation.

[0255] The experimental methods for which specific conditions are not specified in the examples are usually under conventional conditions or conditions as recommended by the manufacturer of the raw material or commodity; and the reagents of unspecified origin are generally conventional reagents commercially available.

[0256] The abbreviations used in the examples have the following meanings:

TABLE-US-00004 DSC N,N-disuccinimidyl carbonate; TLC Thin layer chromatography; EA Ethyl acetate; DCM Dichloromethane; TEA Triethylamine; PMA Phosphomolybdic acid; THF Tetrahydrofuran; DMF N,N-dimethylformamide; EDCl 1-(3-dimethylaminopropyl)-3- ethylcarbodiimide hydrochloride; DMAP 4-dimethylaminopyridine; TEA3HF Triethylamine trihydrofluoride; M-DMG-2000 Methoxy PEG Dimyristoyl-rac-glycero; h Hour min Minute.

Example 1: Synthesis of Amino Lipid Compound 108

(1) Synthesis of Compound 108-M3

##STR00217##

[0257] N, N-dimethylaminopropylamine (108-M1) (3.2 g, 31.53 mmol), heptanal (108-M2) (3 g, 26.26 mmol), ethanol (15 mL), and palladium on carbon (0.15 g) were added to a 25 mL single-necked flask. The flask was transferred to a 500 mL autoclave, replaced with nitrogen for three times, then filled with hydrogen to 2.0 MPa, then deflated to 0.5 MPa, repeated for three times, and finally filled with hydrogen to 1.0 MPa. The mixture was reacted at room temperature for about 3 h.

[0258] TLC was used for monitoring, using EA: n-hexane=1:5 for developing, and a Rf=0.8 for the starting material heptanal was detected; after developing with methanol:DCM=1:1 and fumigating with iodine, a Rf=0.2 for the product (108-M3) and a Rf=0.1 for the starting material N,N-dimethylaminopropylamine (108-M1) were detected. After the reaction was completed, the reaction mixture was subjected to suction filtration, recovery of palladium on carbon, and concentration of the filtrate to obtain 4.6 g crude 108-M3. The crude 108-M3 was purified by silica gel column chromatography, eluted with EA:methanol=3:1 to obtain 3.30 g 108-M3 with a yield of 52%.

(2) Synthesis of Compound M5

##STR00218##

1) Synthesis of Compound M4-1

[0259] Dimethyl sebacate (M4-0) (170 g, 738.2 mmol) was added to a 2 L single-necked round bottom flask, and 850 ml DMF was added and cooled to 10 C., added with 46 g potassium hydroxide powder while stirring, and reacted at 10 C. for 20 h. The reaction solution was diluted with 1000 mL water, and extracted with 500 mL EA, and the solvent was removed by evaporation to obtain a crude product, which was purified by silica gel column chromatography, eluted with EA: n-hexane=1:5 to obtain 80.0 g monomethyl sebacate (M4-1) with a yield of 50%.

2) Synthesis of Compound M4-2

[0260] M4-1 (120 g, 555 mmol), dimethylamine hydrochloride (59 g), EDCl (149 g), and DMAP (6.8 g) were sequentially added to a 2 L single-necked round-bottom flask, dissolved in 1.2 L DCM, and well stirred, and pyridine (123 g) was finally added, and stirred at room temperature overnight. 1 L water was added to dilute, and pH was adjusted to 3 with diluted hydrochloric acid. The organic phase was separated, and the aqueous phase was extracted with 500 mL DCM. The organic phases were combined, and the solvent was removed by evaporation to obtain 126 g crude methyl 10-(dimethylamino)-10-oxodecanoate (M4-2-1), which was directly used in the next reaction.

[0261] Crude M4-2-1 (126 g) was added to a 1 L four-necked flask, dissolved in DCM (600 ml), cooled to 0 C. under the protection of nitrogen. Titanium tetrachloride (118 g) was added dropwise, then TEA (73.4 g) was added dropwise, followed by reacting at 0 C. for 2 h. 600 mL water was slowly added for quenching with stirring at 0 C. The organic phase was separated, and the aqueous phase was extracted with 300 ml DCM. The organic phases were combined, and the solvent was removed by evaporation to obtain 133 g methyl 12-(dimethylamino)-2-(8-dimethylamino)-8-oxooctyl)-3,12-dioxodecanoate (M4-2-2), which was directly used in the next reaction without further purification.

[0262] M4-2-2 (133 g) was added in a 1 L single-necked flask, then added with hydrobromic acid (500 ml, 48% aqueous solution) and refluxed at 120 C. overnight. The mixture was cooled to room temperature with stirring, then stirred at 10 C. for 20 min, and filtered with suction. The filter cake was washed with about 100 mL water to obtain 120 g crude 10-oxononadecanedioic acid (M4-2).

[0263] Crude M4-2 (120 g) and acetonitrile (1 L) were added to a 2 L single-necked flask and heated to 85 C. and refluxed for 0.5 h. After cooled to room temperature, the mixture was stirred at 10 C. for 20 min, and filtered with suction. The filter cake was rinsed with about 100 mL cold acetonitrile, and transferred to a flask, and the residual solvent was removed by evaporation to obtain 45 g M4-2 as an off-white solid.

[0264] .sup.1H NMR (600 MHz, DMSO-d6) 11.94 (brs, 1H), 2.37 (t, J=7.3, 4H), 2.18 (t, J=7.5, 4H), 1.50-11.41 (m, 8H), 1.24-1.19 (m, 16H).

[0265] LC-MS (ESI): (M-1) calculated 341.23, found 341.4.

3) Synthesis of Compound M4-3

[0266] EDCl (16.8 g), DCM (100 ml), triethylamine (8.86 g), DMAP (1.78 g), 7-tridecanol (10.5 g), and M4-2 (10.0 g, 29.2 mol) were sequentially added to a 500 mL round-bottom flask, and stirred at room temperature overnight. By TLC monitoring, the conversion of 7-tridecanol was almost complete (developing with EA: n-hexane=1:25, staining with PMA, Rf=0.4 for the starting material 7-tridecanol, Rf=0.5 for the product DTN-T), and the reaction was ended. 200 mL DCM and 300 mL water were added for extraction, the liquid was separated, the organic phase was collected, and the solvent was removed by evaporation to obtain 30 g yellow oily crude product, which was purified by silica gel column chromatography, eluted with EA: n-hexane=1:25 to obtain 15.72 g M4-3 with a yield of 85%.

[0267] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 2.37 (t, J=7.5, 4H), 2.27 (t, J=7.5, 4H), 1.64-1.48 (m, 16H), 1.31-1.26 (m, 48H), 0.87 (t, J=6.9, 12H).

4) Synthesis of Compound M4

[0268] M4-3 (30.0 g, 42.4 mmol) was added to a 1 L single-necked flask, dissolved in methanol (300 ml), and cooled to 0 C. Sodium borohydride (1.7 g) was slowly added with stirring, and reacted at 0 C. for 1 h after addition, then adjusted to pH 6 with diluted hydrochloric acid. The solvent was removed by evaporation. 300 mL DCM and 300 mL water were added for extraction, the organic phase was collected, and the solvent was removed by evaporation to obtain 42.7 g crude product, which was purified by silica gel column chromatography, eluted with EA: n-hexane=1:15 to obtain 24.6 g M4.

[0269] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.84 (m, 2H), 3.58-3.56 (m, 1H), 2.27 (t, J=7.5, 4H), 1.62-1.59 (m, 4H), 1.50-1.26 (m, 64H), 0.87 (t, J=6.9, 12H).

5) Synthesis of Compound M5

[0270] M4 (24 g, 33.8 mmol), toluene (240 ml), and TEA (5.1 g) were sequentially added to a 500 ml single-necked flask, stirring was started at room temperature, and triphosgene (15 g) was slowly added. After the addition, the temperature was raised to 70 C. to react for 2 h. Samples were taken for monitoring (TLC, EA: n-hexane=1:9), staining with PMA, Rf=0.2 for the starting material and Rf=0.8 for the product) until the reaction was completed.

[0271] The reaction solution was cooled to room temperature, filtered with suction. The filter cake was washed with toluene. The filtrate was collected, and the solvent was removed by evaporation. The residue was purified by silica gel column chromatography, and eluted with EA: n-hexane=1: 5-25 to obtain 21.6 g M5 as a light yellow transparent oil with a yield of 83%.

[0272] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.85 (m, 3H), 2.28 (t, J=7.5, 4H), 1.62-1.59 (m, 4H), 1.65-1.59 (m, 8H), 1.51-1.49 (m, 8H), 1.37-1.22 (m, 52H), 0.88 (t, J=7.1, 12H).

(3) Synthesis of Amino Lipid Compound 108

##STR00219##

[0273] 108-M3 (266 mg, 1.55 mmol), THE (10 ml), and potassium carbonate (178.3 mg) were sequentially added to a 50 ml single-necked flask, stirred and cooled to 0 C. M5 (1.0 g, 1.29 mmol) and THE (10 ml) were added through a constant pressure dropping funnel, with M5 being slowly added dropwise to the single-necked flask over about 10 min. After dropwise addition was completed, the mixture was stirred at 0 C. for 5 min, and then reacted at room temperature. After 1.5 h, the reaction was monitored by TLC (EA: n-hexane=30:1, developed with PMA, the product and the starting material 108-M3 were at the origin, and compound 108-M3 had a Rf=about 0.5) until the reaction was completed. 100 ml water and 100 ml EA were added to the reaction solution for extraction, the organic phase was collected, and the aqueous phase was extracted with 100 ml EA for three times. The organic phases were combined, dried with anhydrous sodium sulfate, and the solvent was removed by evaporation to obtain 1.1 g crude product, which was purified by silica gel column chromatography, eluted with EA: n-hexane=1:5 to obtain 630 mg amino lipid compound 108, as a colorless oil with a yield of 53.8% and a purity of 97.41%.

[0274] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.74 (m, 1H), 3.25-3.17 (m, 4H), 2.26 (t, J=7.5, 6H), 2.21 (s, 6H), 1.70 (m, 2H), 1.62-1.58 (m, 4H), 1.50-1.49 (m, 14H), 1.30-1.25 (m, 56H), 0.90-0.86 (m, 15H).

[0275] LC-MS (ESI): (M+H) calculated 907.8, found 908.2.

Example 2: Synthesis of Amino Lipid Compound 109

##STR00220##

[0276] According to the general synthetic process, 190 mg amino lipid compound 109, as a colorless oil with a yield of 21% and a purity of 94.94%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 109-M3 (1.55 mmol).

[0277] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.74 (m, 1H), 3.25-3.17 (m, 4H), 2.27 (t,J=7.5,6H), 2.22 (s, 6H), 1.70 (m, 2H), 1.72-1.69 (m, 4H), 1.63-1.58 (m, 14H), 1.33-1.26 (m, 58H), 0.87 (t,J=7.0,15H).

[0278] LC-MS (ESI): (M+H) calculated 921.9, found 922.2.

Example 3: Synthesis of Amino Lipid Compound 110

##STR00221##

[0279] According to the general synthetic process, 640 mg amino lipid compound 110, as a colorless oil with a yield of 60% and a purity of 97.71%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 110-M3 (1.55 mmol).

[0280] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.74 (m, 1H), 3.25-3.17 (m, 4H), 2.27 (t,J=7.5,6H), 2.22 (s, 6H), 1.72-1.70 (m, 2H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.28-1.26 (m, 60H), 0.88-0.86 (m, 15H).

[0281] LC-MS (ESI): (M+H) calculated 935.9, found 936.3.

Example 4: Synthesis of Amino Lipid Compound 111

##STR00222##

[0282] According to the general synthetic process, 510 mg compound 111, as a colorless oil with a yield of 47% and a purity of 97.18%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 111-M3 (1.55 mmol).

[0283] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.73 (m, 1H), 3.25-3.16 (m, 4H), 2.26 (t,J=7.5,6H), 2.21 (s, 6H), 1.70 (m, 2H), 1.62-1.57 (m, 4H), 1.50-1.49 (m, 14H), 1.27-1.25 (m, 62H), 0.88-0.86 (m, 15H).

[0284] LC-MS (ESI): (M+H) calculated 949.9, found 950.3.

Example 5: Synthesis of Amino Lipid Compound 112

##STR00223##

[0285] According to the general synthetic process, 760 mg amino lipid compound 112, as a colorless oil with a yield of 69% and a purity of 94.69%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 112-M3 (1.55 mmol).

[0286] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.73 (m, 1H), 3.25-3.16 (m, 4H), 2.26 (t,J=7.5,6H), 2.21 (s, 6H), 1.71-1.69 (m, 2H), 1.62-1.58 (m, 4H), 1.50-1.49 (m, 14H), 1.27-1.25 (m, 64H), 0.88-0.86 (m, 15H).

[0287] LC-MS (ESI): (M+H) calculated 963.9, found 964.3.

Example 6: Synthesis of Amino Lipid Compound 113

##STR00224##

[0288] According to the general synthetic process, 640 mg amino lipid compound 113, as a colorless oil with a yield of 58% and a purity of 98.04%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 113-M3 (1.55 mmol).

[0289] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.85 (m, 2H), 4.74 (m, 1H), 3.26-3.17 (m, 4H), 2.27 (t,J=7.5,6H), 2.22 (s, 6H), 1.71-1.70 (m, 2H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.28-1.25 (m, 66H), 0.89-0.86 (m, 15H).

[0290] LC-MS (ESI): (M+H) calculated 977.9, found 978.4.

Example 7: Synthesis of Amino Lipid Compound 114

##STR00225##

[0291] According to the general synthetic process, 270 mg amino lipid compound 114, as a colorless oil with a yield of 22% and a purity of 75.59%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 114-M3 (1.55 mmol).

[0292] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.84 (m, 2H), 4.74-4.72 (m, 1H), 3.40-3.33 (m, 2H), 3.24-3.19 (m, 2H), 2.63-2.53 (m, 6H), 2.27 (t, J=7.5, 4H),1.78-1.74 (m, 4H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.33-1.26 (m, 58H), 0.89-0.86 (m, 15H).

[0293] LC-MS (ESI): (M+H) calculated 933.86, found 934.3.

Example 8: Synthesis of Amino Lipid Compound 115

##STR00226##

[0294] According to the general synthetic process, 468 mg amino lipid compound 115, as a colorless oil with a yield of 38% and a purity of 77.72%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 115-M3 (1.55 mmol).

[0295] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.74-4.72 (m, 1H), 3.28-3.16 (m, 4H), 2.48-2.43 (m, 6H), 2.27 (t, J=7.5, 4H),1.77-1.74 (m, 6H), 1.63-1.58 (m, 4H), 1.50-1.49 (m, 14H), 1.33-1.26 (m, 58H), 0.88-0.86 (m, 15H).

[0296] LC-MS (ESI): (M+H) calculated 947.87, found 948.3.

Example 9: Synthesis of Amino Lipid Compound 117

##STR00227##

[0297] According to the general synthetic process, 140 mg amino lipid compound 117, as a colorless oil with a yield of 13% and a purity of 97.21%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 117-M3 (1.55 mmol).

[0298] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.73 (m, 1H), 3.21-3.16 (m, 4H), 2.84 (m, 1H), 2.65 (m, 1H), 2.31-2.25 (m, 6H), 2.11 (m, 1H), 1.69-1.58 (m, 9H), 1.50-1.49 (m, 15H), 1.33-1.26 (m, 60H), 1.04 (d, J=6.1, 3H), 0.88-0.86 (m, 15H).

[0299] LC-MS (ESI): (M+H) calculated 975.9, found 976.4.

Example 10: Synthesis of Amino Lipid Compound 137

##STR00228##

[0300] According to the general synthetic process, 200 mg amino lipid compound 137, as a colorless oil with a yield of 20% and a purity of 97.46%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 137-M3 (1.55 mmol).

[0301] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.00-4.83 (m, 2H), 4.77 (s, 1H), 3.38-3.33 (m, 2H), 3.29-3.17 (m, 2H), 2.60-2.44 (m, 2H), 2.32-2.29 (m, 10H), 1.69-1.60 (m, 4H), 1.56-1.54 (m, 14H), 1.34-1.30 (m, 56H), 0.94-0.90 (m, 15H).

[0302] LC-MS (ESI): (M+H) calculated 893.82, found 894.3.

Example 11: Synthesis of Amino Lipid Compound 138

##STR00229##

[0303] According to the general synthetic process, 490 mg amino lipid compound 138, as a colorless oil with a yield of 42% and a purity of 77.73%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 138-M3 (1.55 mmol).

[0304] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.73 (m, 1H), 3.35-3.28 (m, 2H), 3.23-3.19 (m, 2H), 2.45-2.40 (m, 2H), 2.28-2.25 (m, 10H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.33-1.26 (m, 58H), 0.90-0.86 (m, 15H).

[0305] LC-MS (ESI): (M+H) calculated 907.84, found 908.3.

Example 12: Synthesis of Amino Lipid Compound 139

##STR00230##

[0306] According to the general synthetic process, 470 mg amino lipid compound 139, as a colorless oil with a yield of 45% and a purity of 95.87%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 139-M3 (1.55 mmol).

[0307] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.73 (m, 1H), 3.35-3.28 (m, 2H), 3.23-3.19 (m, 2H), 2.46-2.40 (m, 2H), 2.28-2.26 (m, 10H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.33-1.26 (m, 60H), 0.88-0.86 (m, 15H).

[0308] LC-MS (ESI): (M+H) calculated 921.86, found 922.3.

Example 13: Synthesis of Amino Lipid Compound 140

##STR00231##

[0309] According to the general synthetic process, 470 mg amino lipid compound 140, as a colorless oil with a yield of 44% and a purity of 96.31%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 140-M3 (1.55 mmol).

[0310] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.87-4.84 (m, 2H), 4.73 (m, 1H), 3.35-3.28 (m, 2H), 3.23-3.19 (m, 2H), 2.46-2.40 (m, 2H), 2.28-2.26 (m, 10H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.33-1.26 (m, 62H), 0.88-0.86 (m, 15H).

[0311] LC-MS (ESI): (M+H) calculated 935.87, found 936.3.

Example 14: Synthesis of Amino Lipid Compound 141

##STR00232##

[0312] According to the general synthetic process, 330 mg amino lipid compound 141, as a colorless oil with a yield of 31% and a purity of 95.98%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 141-M3 (1.55 mmol).

[0313] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.84 (m, 2H), 4.73 (m, 1H), 3.35-3.28 (m, 2H), 3.23-3.19 (m, 2H), 2.46-2.40 (m, 2H), 2.28-2.26 (m, 10H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.33-1.26 (m, 62H), 0.88-0.86 (m, 15H).

[0314] LC-MS (ESI): (M+H) calculated 949.89, found 950.3.

Example 15: Synthesis of Amino Lipid Compound 142

##STR00233##

[0315] According to the general synthetic process, 580 mg amino lipid compound 142, as a colorless oil with a yield of 53% and a purity of 98.23%, was prepared from compound M5 (1.0 g, 1.29 mmol) and 142-M3 (1.55 mmol).

[0316] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.84 (m, 2H), 4.73 (m, 1H), 3.35-3.28 (m, 2H), 3.23-3.19 (m, 2H), 2.46-2.40 (m, 2H), 2.28-2.26 (m, 10H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 14H), 1.28-1.26 (m, 66H), 0.89-0.86 (m, 15H).

[0317] LC-MS (ESI): (M+H) calculated 963.9, found 964.3

Example 16: Synthesis of Amino Lipid Compound 255

(1) Synthesis of Compound 255-B

##STR00234##

1) Synthesis of Compound 255-A

[0318] 5-bromopentanoic acid (20.0 g, 110.5 mmol), DMF (269 mg, 3.7 mmol), and DCM (50 ml) were added to a 500 ml single-necked flask, cooled to 0 C. while stirring, and thionyl chloride (16.29 g, 221 mmol) was slowly added dropwise at 0 C. After maintaining the temperature for 30 min, the mixture was transferred to room temperature to react overnight. The solvent and excess thionyl chloride were removed by evaporation under reduced pressure to obtain 24 g acyl chloride compound.

[0319] N-butanol (5.46 g, 73.7 mmol) was weighed and dissolved in DCM (50 ml), cooled to 0 C. while stirring. The newly prepared acyl chloride was added dropwise at 0 C. After the completion of addition dropwise, the reaction solution was heated to room temperature, and added with 200 mL water after reacting for 5 h, and extracted twice with 200 mL DCM. The organic phases were combined, washed with 100 ml brine, dried over anhydrous sodium sulfate, and the solvent was removed by evaporation to obtain 28 g crude 255-A.

[0320] The crude product was purified by silica gel column chromatography, eluting with EA: n-heptane=1:25 to obtain 15.2 g 255-A, as a light yellow oil with a yield of 83%.

2) Synthesis of Compound 255-B

[0321] 3-dimethylaminopropylamine (9.8 g, 96.2 mmol) and acetonitrile (75 ml) were added to a 500 ml single-necked flask, dissolved by stirring, and added with potassium carbonate (6.64 g, 48.1 mmol) and cooled to 10 C. 255-A obtained in step 1) was dissolved in acetonitrile (75 ml), and slowly dropped into the reaction system. After the completion of dropwise addition, the mixture was reacted at 10 C. for 5 h, and then transferred to room temperature to react overnight. The solvent was removed by evaporation. The residue was extracted with water (100 ml) and ethyl acetate (100 ml) for three times. The organic phases were combined, washed with 50 ml saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to obtain 10.74 g crude 255-B, which was directly used in the next reaction.

(2) Synthesis of Amino Lipid Compound 255

##STR00235##

[0322] Crude 255-B (2.5 g, 9.72 mmol) and THE (50 ml) were added to a 250 mL flask, dissolved with stirring, and cooled to 0 C. M5 (5 g, 6.48 mmol) was weighed and dissolved in THE (50 ml), and slowly dropped into the reaction system. After the completion of dropwise addition, the mixture was reacted at 0 C. for 1 h, extracted with water (100 ml) and EA (100 ml) for three times. The organic phases were combined, washed sequentially with 50 ml water and 50 ml saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain 8 g crude 225-B, which was purified by silica gel column chromatography, eluted with EA: n-heptane=1:25 to obtain 3.25 g amino lipid compound 225, as a light yellow oil with a purity of 94.68% and a yield of 50%.

[0323] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.85 (m, 2H), 4.83-4.72 (m, 1H), 4.06 (t, J=6.7 Hz, 2H), 3.28 (m, 4H), 2.49-2.18 (m, 14H), 1.88-1.48 (m, 26H), 1.37-1.17 (m, 52H), 0.97 (t, J=7.4 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0324] LC-MS (ESI): (M+H) calculated 993.88, found 994.5.

Example 17: Synthesis of Amino Lipid Compound 250

##STR00236##

[0325] According to the general synthetic process, 600 mg amino lipid compound 250, as a pale yellow oil with a purity of 95.54% and a yield of 47%, was prepared from M5 (1.0 g, 1.29 mmol) and 250-B (0.47 g, 1.94 mmol).

[0326] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.94-4.86 (m, 2H), 4.77 (m, 1H), 4.16 (q, J=6.8 Hz, 2H), 3.34-3.14 (m, 4H), 2.32 (m, 8H), 2.25 (s, 4H), 1.54 (m, 25H), 1.38-1.24 (m, 56H), 0.91 (t, J=7.0 Hz, 12H).

[0327] LC-MS (ESI): (M+H) calculated 979.86, found 980.4.

Example 18: Synthesis of Amino Lipid Compound 251

##STR00237##

[0328] According to the general synthetic process, 1000 mg amino lipid compound 251, as a pale yellow oil with a purity of 95.54% and a yield of 52%, was prepared from M5 (1.5 g, 1.94 mmol) and 251-B (0.50 g, 1.94 mmol).

[0329] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.94-4.86 (m, 2H), 4.77 (m, 1H), 4.16 (q, J=6.8 Hz, 2H), 3.34-3.14 (m, 4H), 2.32 (m, 8H), 2.25 (s, 4H), 1.54 (m, 27H), 1.38-1.24 (m, 53H), 0.97 (t, J=7.4 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0330] LC-MS (ESI): (M+H) calculated 993.88, found 994.5.

Example 19: Synthesis of Amino Lipid Compound 252

##STR00238##

[0331] According to the general synthetic process, 650 mg amino lipid compound 252, as a pale yellow oil with a purity of 95.88% and a yield of 56%, was prepared from M5 (1.0 g, 1.29 mmol) and 252-B (0.53 g, 1.94 mmol).

[0332] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.94-4.86 (m, 2H), 4.77 (m, 1H), 4.16 (q, J=6.8 Hz, 2H), 3.34-3.14 (m, 4H), 2.32 (m, 8H), 2.25 (s, 4H), 1.54 (m, 29H), 1.38-1.24 (m, 53H), 4.77 (t, J=12.3, 6.1 Hz, 1H), 0.98 (t, J=7.4 Hz, 3H), 0.92 (t, J=7.0 Hz, 12H).

[0333] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.5.

Example 20: Synthesis of Amino Lipid Compound 253

##STR00239##

[0334] According to the general synthetic process, 300 mg amino lipid compound 253, as a pale yellow oil with a purity of 96.09% and a yield of 27%, was prepared from M5 (1.0 g, 1.29 mmol) and 253-B (0.45 g, 1.94 mmol).

[0335] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.86 (m, 2H), 4.82-4.70 (m, 1H), 4.16 (q, J=7.1 Hz, 2H), 3.36-3.18 (m, 4H), 2.42-2.15 (m, 14H), 1.86-1.46 (m, 22H), 1.43-1.20 (m, 55H), 0.92 (t, J=7.0 Hz, 12H).

[0336] LC-MS (ESI): (M+H) calculated 965.85, found 966.5.

Example 21: Synthesis of Amino Lipid Compound 254

##STR00240##

[0337] According to the general synthetic process, 100 mg amino lipid compound 254, as a pale yellow oil with a purity of 91.94% and a yield of 8.9%, was prepared from M5 (1.0 g, 1.29 mmol) and 254-B (0.47 g, 1.94 mmol).

[0338] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.85 (m, 2H), 4.83-4.72 (m, 1H), 4.06 (t, J=6.7 Hz, 2H), 3.28 (m, 4H), 2.49-2.18 (m, 14H), 1.88-1.48 (m, 24H), 1.37-1.17 (m, 52H), 0.97 (t, J=7.4 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0339] LC-MS (ESI): (M+H) calculated 979.86, found 980.5.

Example 22: Synthesis of Amino Lipid Compound 256

##STR00241##

[0340] According to the general synthetic process, 480 mg amino lipid compound 256, as a pale yellow oil with a purity of 92.94% and a yield of 42%, was prepared from M5 (1.0 g, 1.29 mmol) and 256-B (0.53 g, 1.94 mmol).

[0341] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.85 (m, 2H), 4.83-4.72 (m, 1H), 4.06 (t, J=6.7 Hz, 2H), 3.28 (m, 4H), 2.49-2.18 (m, 14H), 1.88-1.48 (m, 26H), 1.37-1.17 (m, 54H), 0.91 (m, 15H).

[0342] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.3

Example 23: Synthesis of Amino Lipid Compound 257

##STR00242##

[0343] According to the general synthetic process, 290 mg amino lipid compound 257, as a pale yellow oil with a purity of 95.16% and a yield of 27%, was prepared from M5 (1.0 g, 1.29 mmol) and 257-B (0.42 g, 1.94 mmol).

[0344] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.84 (m, 2H), 4.81-4.70 (m, 1H), 4.17 (q, 7.1 Hz, 2H), 3.37-3.18 (m, 4H), 2.31 (m, 8H), 2.25 (s, 6H), 1.94-1.82 (m, 2H), 1.72 (m, 2H), 1.68-1.60 (m, 4H), 1.54 (m, 12H), 1.40-1.22 (m, 55H), 0.91 (t, J=7.0 Hz, 12H).

[0345] LC-MS (ESI): (M+H) calculated 951.83, found 952.4.

Example 24: Synthesis of Amino Lipid Compound 258

##STR00243##

[0346] According to the general synthetic process, 340 mg amino lipid compound 258, as a pale yellow oil with a purity of 92.94% and a yield of 31%, was prepared from M5 (1.0 g, 1.29 mmol) and 258-B (0.45 g, 1.94 mmol).

[0347] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.84 (m, 2H), 4.81-4.70 (m, 1H), 4.06 (t, J=6.7 Hz, 2H), 3.37-3.18 (m, 4H), 2.31 (m, 8H), 2.25 (s, 6H), 1.94-1.82 (m, 2H), 1.72 (m, 2H), 1.68-1.60 (m, 6H), 1.54 (m, 12H), 1.40-1.22 (m, 52H), 0.97 (t, J=7.4 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0348] LC-MS (ESI): (M+H) calculated 965.85, found 966.2.

Example 25: Synthesis of Amino Lipid Compound 259

##STR00244##

[0349] According to the general synthetic process, 320 mg amino lipid compound 259, as a pale yellow oil with a purity of 93.85% and a yield of 29%, was prepared from M5 (1.0 g, 1.29 mmol) and 259-B (0.47 g, 1.94 mmol).

[0350] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.84 (m, 2H), 4.81-4.70 (m, 1H), 4.10 (t, J=6.7 Hz, 2H), 3.37-3.18 (m, 4H), 2.31 (m, 8H), 2.25 (s, 6H), 1.94-1.82 (m, 2H), 1.72 (m, 2H), 1.68-1.60 (m, 6H), 1.54 (m, 12H), 1.40-1.22 (m, 54H), 0.97 (t, J=7.4 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0351] LC-MS (ESI): (M+H) calculated 979.86, found 980.3.

Example 26: Synthesis of Amino Lipid Compound 260

##STR00245##

[0352] According to the general synthetic process, 440 mg amino lipid compound 260, as a pale yellow oil with a purity of 95.54% and a yield of 40%, was prepared from M5 (1.0 g, 1.29 mmol) and 260-B (0.50 g, 1.94 mmol).

[0353] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.86 (m, 2H), 4.82-4.71 (m, 1H), 4.09 (t, J=6.8 Hz, 2H), 3.29 (m, 4H), 2.31 (m, 8H), 2.24 (s, 6H), 1.88 (m, 2H), 1.73 (m, 2H), 1.65 (m, 6H), 1.54 (m, 12H), 1.41-1.20 (m, 56H), 0.92 (m, 15H).

[0354] LC-MS (ESI): (M+H) calculated 993.88, found 994.2.

Example 27: Synthesis of Amino Lipid Compound 261

##STR00246##

[0355] According to the general synthetic process, 140 mg amino lipid compound 261, as a pale yellow oil with a purity of 92.13% and a yield of 12%, was prepared from M5 (1.0 g, 1.29 mmol) and 261-B (0.53 g, 1.94 mmol).

[0356] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.94-4.85 (m, 2H), 4.80-4.73 (m, 1H), 4.09 (t, J=6.8 Hz, 2H), 3.35-3.20 (m, 4H), 2.38-2.19 (m, 14H), 1.88 (m, 2H), 1.74 (m, 2H), 1.68-1.61 (m, 6H), 1.54 (m, 12H), 1.42-1.22 (m, 58H), 0.92 (m, 15H).

[0357] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.3.

Example 28: Synthesis of Amino Lipid Compound 262

##STR00247##

[0358] According to the general synthetic process, 500 mg amino lipid compound 262, as a pale yellow oil with a purity of 88.60% and a yield of 47%, was prepared from M5 (1.0 g, 1.29 mmol) and 262-B (0.39 g, 1.94 mmol).

[0359] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.97-4.84 (m, 2H), 4.84-4.72 (m, 1H), 4.07 (t, J=5.8 Hz, 2H), 3.54 (m, 2H), 3.37-3.23 (m, 2H), 2.60 (m, 2H), 2.30 (m, 6H), 2.25 (s, 6H), 1.73 (m, 2H), 1.68-1.60 (m, 4H), 1.54 (m, 12H), 1.39-1.21 (m, 55H), 0.91 (t, J=7.0 Hz, 12H).

[0360] LC-MS (ESI): (M+H) calculated 937.81, found 938.2.

Example 29: Synthesis of Amino Lipid Compound 263

##STR00248##

[0361] According to the general synthetic process, 580 mg amino lipid compound 263, as a pale yellow oil with a purity of 95.37% and a yield of 55%, was prepared from M5 (1.0 g, 1.29 mmol) and 263-B (0.42 g, 1.94 mmol). 1H NMR (600 MHz, CDCl.sub.3) 4.95-4.83 (m, 2H), 4.81-4.72 (m, 1H), 4.07 (t, J=5.8 Hz, 2H), 3.55 (m, 2H), 3.29 (m, 2H), 2.61 (m, 2H), 2.30 (m, 6H), 2.25 (s, 6H), 1.80-1.62 (m, 8H), 1.54 (m, 12H), 1.30 (m, 52H), 0.96 (t, J=7.2 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0362] LC-MS (ESI): (M+H) calculated 951.83, found 952.2.

Example 30: Synthesis of Amino Lipid Compound 264

##STR00249##

[0363] According to the general synthetic process, 220 mg amino lipid compound 264, as a pale yellow oil with a purity of 98.65% and a yield of 20%, was prepared from M5 (1.0 g, 1.29 mmol) and 264-B (0.45 g, 1.94 mmol).

[0364] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.83 (m, 2H), 4.81-4.72 (m, 1H), 4.07 (t, J=5.8 Hz, 2H), 3.55 (m, 2H), 3.29 (m, 2H), 2.61 (m, 2H), 2.30 (m, 6H), 2.25 (s, 6H), 1.80-1.62 (m, 8H), 1.54 (m, 12H), 1.30 (m, 54H), 0.96 (t, J=7.2 Hz, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0365] LC-MS (ESI): (M+H) calculated 965.85, found 966.2.

Example 31: Synthesis of Amino Lipid Compound 265

##STR00250##

[0366] According to the general synthetic process, 450 mg amino lipid compound 265, as a pale yellow oil with a purity of 98.47% and a yield of 40%, was prepared from M5 (1.0 g, 1.29 mmol) and 265-B (0.47 g, 1.94 mmol).

[0367] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.83 (m, 2H), 4.81-4.72 (m, 1H), 4.07 (t, J=5.8 Hz, 2H), 3.55 (m, 2H), 3.29 (m, 2H), 2.61 (m, 2H), 2.30 (m, 6H), 2.25 (s, 6H), 1.80-1.62 (m, 8H), 1.54 (m, 12H), 1.42-1.16 (m, 56H), 0.98-0.86 (m, 15H).

[0368] LC-MS (ESI): (M+H) calculated 979.86, found 980.2.

Example 32: Synthesis of Amino Lipid Compound 266

##STR00251##

[0369] According to the general synthetic process, 487 mg amino lipid compound 266, as a pale yellow oil with a purity of 94.01% and a yield of 42%, was prepared from M5 (1.0 g, 1.29 mmol) and 266-B (0.50 g, 1.94 mmol).

[0370] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.83 (m, 2H), 4.81-0.72 (m, 1H), 4.07 (t, J=5.8 Hz, 2H), 3.55 (m, 2H), 3.29 (m, 2H), 2.61 (m, 2H), 2.30 (m, 6H), 2.25 (s, 6H), 1.80-1.62 (m, 8H), 1.54 (m, 12H), 1.42-1.16 (m, 58H), 0.98-0.86 (m, 15H).

[0371] LC-MS (ESI): (M+H) calculated 993.88, found 994.3.

Example 33: Synthesis of Amino Lipid Compound 267

##STR00252##

[0372] According to the general synthetic process, 360 mg amino lipid compound 267, as a pale yellow oil with a purity of 98.16% and a yield of 31%, was prepared from M5 (1.0 g, 1.29 mmol) and 267-B (0.53 g, 1.94 mmol).

[0373] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.83 (m, 2H), 4.81-4.72 (m, 1H), 4.07 (t, J=5.8 Hz, 2H), 3.55 (m, 2H), 3.29 (m, 2H), 2.61 (m, 2H), 2.30 (m, 6H), 2.25 (s, 6H), 1.80-1.62 (m, 8H), 1.54 (m, 12H), 1.42-1.16 (m, 60H), 0.98-0.86 (m, 15H).

[0374] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.2.

Example 34: Synthesis of Amino Lipid Compound 268

##STR00253##

[0375] According to the general synthetic process, 500 mg amino lipid compound 268, as a pale yellow oil with a purity of 90.61% and a yield of 47%, was prepared from M5 (1.0 g, 1.29 mmol) and 268-B (0.37 g, 1.94 mmol).

[0376] .sup.1HNMR (600 MHz, CDCl.sub.3) 4.97-4.80 (m, 2H), 4.68-4.79 (m, 1H), 4.11-4.07 (m, 2H), 4.00 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 2.50-2.10 (m, 12H), 1.66-1.09 (m, 70H), 0.96-0.81 (m, 15H).

[0377] LC-MS (ESI): (M+H) calculated 923.80, found 924.1.

Example 35: Synthesis of Amino Lipid Compound 269

##STR00254##

[0378] According to the general synthetic process, 510 mg amino lipid compound 269, as a pale yellow oil with a purity of 96.02% and a yield of 48%, was prepared from M5 (1.0 g, 1.29 mmol) and 269-B (0.39 g, 1.94 mmol).

[0379] 1H NMR (600 MHz, CDCl.sub.3) 4.97-4.80 (m, 2H), 4.68-4.79 (m, 1H), 4.11-4.07 (m, 2H), 4.00 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 2.50-2.10 (m, 12H), 1.66-1.09 (m, 72H), 0.96-0.81 (m, 15H).

[0380] LC-MS (ESI): (M+H) calculated 937.81, found 938.1.

Example 36: Synthesis of Amino Lipid Compound 270

##STR00255##

[0381] According to the general synthetic process, 550 mg amino lipid compound 270, as a pale yellow oil with a purity of 97.66% and a yield of 51%, was prepared from M5 (1.0 g, 1.29 mmol) and 270-B (0.42 g, 1.94 mmol).

[0382] .sup.1HNMR (600 MHz, CDCl.sub.3) 4.97-4.80 (m, 2H), 4.68-4.79 (m, 1H), 4.11-4.07 (m, 2H), 4.00 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 2.50-2.10 (m, 12H), 1.66-1.09 (m, 74H), 0.96-0.81 (m, 15H).

[0383] LC-MS (ESI): (M+H) calculated 951.83, found 952.2.

Example 37: Synthesis of Amino Lipid Compound 271

##STR00256##

[0384] According to the general synthetic process, 230 mg amino lipid compound 271, as a pale yellow oil with a purity of 94.22% and a yield of 21%, was prepared from M5 (1.0 g, 1.29 mmol) and 271-B (0.45 g, 1.94 mmol).

[0385] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.82 (m, 2H), 4.80-4.65 (m, 1H), 4.14-4.04 (m, 2H), 4.01 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 1.56-1.44 (m, 12H), 1.39-1.18 (m, 76H), 0.95-0.82 (m, 15H).

[0386] LC-MS (ESI): (M+H) calculated 965.85, found 966.2.

Example 38: Synthesis of Amino Lipid Compound 272

##STR00257##

[0387] According to the general synthetic process, 450 mg amino lipid compound 272, as a pale yellow oil with a purity of 98.47% and a yield of 40%, was prepared from M5 (1.0 g, 1.29 mmol) and 272-B (0.47 g, 1.94 mmol).

[0388] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.82 (m, 2H), 4.80-4.65 (m, 1H), 4.14-4.04 (m, 2H), 4.01 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 1.56-1.44 (m, 12H), 1.39-1.18 (m, 78H), 0.95-0.82 (m, 15H).

[0389] LC-MS (ESI): (M+H) calculated 979.86, found 980.2.

Example 39: Synthesis of Amino Lipid Compound 273

##STR00258##

[0390] According to the general synthetic process, 460 mg amino lipid compound 273, as a pale yellow oil with a purity of 96.41% and a yield of 40%, was prepared from M5 (1.0 g, 1.29 mmol) and 273-B (0.50 g, 1.94 mmol).

[0391] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.82 (m, 2H), 4.80-4.65 (m, 1H), 4.14-4.04 (m, 2H), 4.01 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 1.56-1.44 (m, 12H), 1.39-1.18 (m, 80H), 0.95-0.82 (m, 15H).

[0392] LC-MS (ESI): (M+H) calculated 993.88, found 994.2.

Example 40: Synthesis of Amino Lipid Compound 274

##STR00259##

[0393] According to the general synthetic process, 420 mg amino lipid compound 274, as a pale yellow oil with a purity of 95.60% and a yield of 36%, was prepared from M5 (1.0 g, 1.29 mmol) and 274-B (0.53 g, 1.94 mmol).

[0394] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.82 (m, 2H), 4.80-4.65 (m, 1H), 4.14-4.04 (m, 2H), 4.01 (s, 1H), 3.93 (s, 1H), 3.34 (dt, J=31.0, 7.2 Hz, 2H), 1.56-1.44 (m, 12H), 1.39-1.18 (m, 82H), 0.95-0.82 (m, 15H).

[0395] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.3.

Example 41: Synthesis of Amino Lipid Compound 275

##STR00260##

[0396] According to the general synthetic process, 280 mg amino lipid compound 275, as a pale yellow oil with a purity of 90.83% and a yield of 25%, was prepared from M5 (1.0 g, 1.29 mmol) and 275-B (0.50 g, 1.94 mmol).

[0397] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.66 (t, J=8.8 Hz, 1H), 5.56 (t, J=8.8 Hz, 1H)4.90 (p, J=6.2 Hz, 2H), 4.79-4.74 (m, 1H), 4.66 (d, J=6.9 Hz, 2H), 3.34-3.23 (m, 4H), 2.31 (dd, J=20.5, 13.1 Hz, 8H), 2.24 (s, 6H), 2.18-2.12 (m, 2H), 1.89 (s, 2H), 1.73 (s, 2H), 1.68-1.61 (m, 4H), 1.54 (d, J=5.4 Hz, 12H), 1.38-1.23 (m, 54H), 1.05-0.99 (m, 3H), 0.91 (m, 12H).

[0398] LC-MS (ESI): (M+H) calculated 991.86, found 992.1.

Example 42: Synthesis of Amino Lipid Compound 276

##STR00261##

[0399] According to the general synthetic process, 110 mg amino lipid compound 276, as a pale yellow oil with a purity of 93.19% and a yield of 10%, was prepared from M5 (1.0 g, 1.29 mmol) and 276-B (0.52 g, 1.94 mmol).

[0400] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.67 (m, 1H), 5.61-5.52 (m, 1H), 4.94-4.86 (m, 2H), 4.79-4.74 (m, 1H), 4.66 (d, J=6.8 Hz, 2H), 3.29 (m, 4H), 2.38-2.08 (m, 16H), 1.93-1.23 (m, 74H), 0.93 (m, 15H).

[0401] LC-MS (ESI): (M+H) calculated 1005.88, found 1006.3.

Example 43: Synthesis of Amino Lipid Compound 277

##STR00262##

[0402] According to the general synthetic process, 350 mg amino lipid compound 277, as a pale yellow oil with a purity of 96.47% and a yield of 33%, was prepared from M5 (1.0 g, 1.29 mmol) and 277-B (0.52 g, 1.94 mmol).

[0403] 1H NMR (600 MHz, CDCl.sub.3) 5.54 (m, 1H), 5.37-5.30 (m, 1H), 4.94-4.85 (m, 2H), 4.80-4.74 (m, 1H), 4.10 (m, 2H), 3.34-3.21 (m, 4H), 2.44-2.04 (m, 18H), 1.93-1.22 (m, 72H), 1.00 (m, 3H), 0.91 (t, J=7.0 Hz, 12H).

[0404] LC-MS (ESI): (M+H) calculated 1005.88, found 1006.3.

Example 44: Synthesis of Amino Lipid Compound 279

##STR00263##

[0405] According to the general synthetic process, 250 mg amino lipid compound 279, as a pale yellow oil with a purity of 98.62% and a yield of 21%, was prepared from M5 (1.0 g, 1.29 mmol) and 279-B (0.58 g, 1.94 mmol).

[0406] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.50 (m, 1H), 5.36-5.30 (m, 1H), 4.89-4.84 (m, 2H), 4.73 (m, 1H), 4.06 (m, 2H), 3.31-3.18 (m, 4H), 2.30 (m, 16H), 2.08-1.21 (m, 78H), 0.94-0.82 (m, 15H).

[0407] LC-MS (ESI): (M+H) calculated 1033.91, found 1034.4.

Example 45: Synthesis of Amino Lipid Compound 280

##STR00264##

[0408] According to the general synthetic process, 190 mg amino lipid compound 280, as a pale yellow oil with a purity of 91.43% and a yield of 16%, was prepared from M5 (1.0 g, 1.29 mmol) and 280-B (0.61 g, 1.94 mmol).

[0409] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.66-5.60 (m, 1H), 5.54-5.48 (m, 1H), 4.89-4.83 (m, 2H), 4.76-4.71 (m, 1H), 4.62 (d, J=6.8 Hz, 2H), 3.33-3.19 (m, 4H), 2.34-2.06 (m, 16H), 1.89-1.23 (m, 80H), 0.88 (td, J=7.0, 4.8 Hz, 15H).

[0410] LC-MS (ESI): (M+H) calculated 1047.92, found 1048.4

Example 46: Synthesis of Amino Lipid Compound 281

##STR00265##

[0411] According to the general synthetic process, 480 mg amino lipid compound 281, as a pale yellow oil with a purity of 96.03% and a yield of 41%, was prepared from M5 (1.0 g, 1.29 mmol) and 281-B (0.55 g, 1.94 mmol).

[0412] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.68-5.59 (m, 1H), 5.50 (d, J=11.6, 6.7 Hz, 1H), 4.91-4.83 (m, 2H), 4.80-4.70 (m, 1H), 4.66 (m, 2H), 4.01 (s, 1H), 3.94 (s, 1H), 3.34 (m, 2H), 2.29-2.06 (m, 14H), 1.78-1.22 (m, 78H), 0.92-0.83 (m, 15H).

[0413] LC-MS (ESI): (M+H) calculated 1019.89, found 1020.3.

Example 47: Synthesis of Amino Lipid Compound 282

##STR00266##

[0414] According to the general synthetic process, 300 mg amino lipid compound 282, as a pale yellow oil with a purity of 94.87% and a yield of 27%, was prepared from M5 (1.0 g, 1.29 mmol) and 282-B (0.44 g, 1.94 mmol).

[0415] .sup.1H NMR (600 MHz, CDCl3) 5.71-5.63 (m, 1H), 5.55-5.47 (m, 1H), 4.93-4.87 (m, 2H), 4.83-4.73 (m, 1H), 4.73-4.67 (m, 2H), 4.06 (s, 1H), 3.98 (s, 1H), 3.38 (dt, J=29.1, 7.2 Hz, 2H), 2.36-2.10 (m, 14H), 1.80-1.23 (m, 70H), 1.03 (m, 3H), 0.91 m, 12H).

[0416] LC-MS (ESI): (M+H) calculated 963.83, found 964.2.

Example 48: Synthesis of Amino Lipid Compound 284

##STR00267##

[0417] According to the general synthetic process, 530 mg amino lipid compound 284, as a pale yellow oil with a purity of 94.29% and a yield of 45%, was prepared from M5 (1.0 g, 1.29 mmol) and 284-B (0.55 g, 1.94 mmol).

[0418] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.64 (m, 1H), 5.52-5.45 (m, 1H), 4.90-4.82 (m, 2H), 4.77-4.70 (m, 1H), 4.62 (d, J=6.7 Hz, 2H), 3.29-3.13 (m, 4H), 2.32-2.09 (m, 16H), 1.75-1.20 (m, 78H), 1.02-0.97 (m, 3H), 0.87 (m, 12H).

[0419] LC-MS (ESI): (M+H) calculated 1019.89, found 1020.2.

Example 49: Synthesis of Amino Lipid Compound 297

##STR00268##

[0420] According to the general synthetic process, 830 mg amino lipid compound 297, as a pale yellow oil with a purity of 97.59% and a yield of 73%, was prepared from M5 (1.0 g, 1.29 mmol) and 297-B (0.50 g, 1.94 mmol).

[0421] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.01-4.97 (m, 1H), 4.89-4.83 (m, 2H), 4.76-4.69 (m, 1H), 3.29-3.12 (m, 4H), 2.28-2.24 (m, 8H), 2.21 (s, 6H), 1.69 (s, 2H), 1.65-1.57 (m, 6H), 1.56-1.45 (m, 14H), 1.33-1.20 (m, 60H), 0.87 (t, J=7.0 Hz, 12H).

[0422] LC-MS (ESI): (M+H) calculated 993.88, found 994.3.

Example 50: Synthesis of Amino Lipid Compound 298

##STR00269##

[0423] According to the general synthetic process, 410 mg amino lipid compound 298, as a pale yellow oil with a purity of 97.33% and a yield of 36%, was prepared from M5 (1.0 g, 1.29 mmol) and 298-B (0.53 g, 1.94 mmol).

[0424] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.80 (m, 3H), 4.76-4.70 (m, 1H), 3.30-3.12 (m, 4H), 2.28-2.25 (m, 8H), 2.21 (s, 6H), 1.67 (s, 2H), 1.65-1.57 (m, 7H), 1.57-1.44 (m, 15H), 1.35-1.21 (m, 54H), 1.19 (d, J=6.3 Hz, 3H), 0.91-0.84 (m, 15H).

[0425] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.3.

Example 51: Synthesis of Amino Lipid Compound 299

##STR00270##

[0426] According to the general synthetic process, 640 mg amino lipid compound 299, as a pale yellow oil with a purity of 98.14% with a yield of 57%, was prepared from M5 (1.0 g, 1.29 mmol) and 299-B (0.56 g, 1.94 mmol).

[0427] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.93-4.89 (d, J=5.8 Hz, 1H), 4.89-4.83 (m, 2H), 4.76-4.70 (m, 1H), 3.26-3.15 (m, 4H), 2.28-2.26 (m, 8H), 2.21 (s, 6H), 1.69 (s, 2H), 1.64-1.58 (m, 7H), 1.65-1.55 (m, 15H), 1.33-1.21 (m, 56H), 1.19 (d, J=6.2 Hz, 3H), 0.91 (t, J=7.3 Hz, 3H), 0.87 (t, J=7.0 Hz, 12H).

[0428] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.3.

Example 52: Synthesis of Amino Lipid Compound 300

##STR00271##

[0429] According to the general synthetic process, 550 mg amino lipid compound 300, as a pale yellow oil with a purity of 98.00% and a yield of 47%, was prepared from M5 (1.0 g, 1.29 mmol) and 300-B (0.56 g, 1.94 mmol).

[0430] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.83 (m, 2H), 4.76-4.71 (m, 2H), 3.26-3.15 (m, 4H), 2.31-2.24 (m, 8H), 2.21 (s, 6H), 1.68 (s, 2H), 1.67-1.57 (m, 8H), 1.57-1.44 (m, 16H), 1.35-1.20 (m, 54H), 0.87 (t, J=7.1 Hz, 18H).

[0431] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.1.

Example 53: Synthesis of Amino Lipid Compound 301

##STR00272##

[0432] According to the general synthetic process, 750 mg amino lipid compound 301, as a pale yellow oil with a purity of 98.18% and a yield of 67%, was prepared from M5 (1.0 g, 1.29 mmol) and 301-B (0.47 g, 1.94 mmol).

[0433] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.03-4.95 (m, 1H), 4.89-4.83 (m, 2H), 4.76-4.70 (m, 1H), 3.28-3.18 (m, 4H), 2.26 (t, J=7.5 Hz, 8H), 2.21 (s, 6H), 1.69 (s, 2H), 1.60 (dt, J=14.5, 7.4 Hz, 6H), 1.51 (t, J=14.9 Hz, 14H), 1.32-1.21 (m, 58H), 0.87 (t, J=7.0 Hz, 12H).

[0434] LC-MS (ESI): (M+H) calculated 979.86, found 980.1.

Example 54: Synthesis of Amino Lipid Compound 302

##STR00273##

[0435] According to the general synthetic process, 680 mg amino lipid compound 302, as a pale yellow oil with a purity of 97.32% and a yield of 60%, was prepared from M5 (1.0 g, 1.29 mmol) and 302-B (0.50 g, 1.94 mmol).

[0436] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.79 (m, 3H), 4.75-4.69 (m, 1H), 3.30-3.13 (m, 4H), 2.32-2.23 (m, 8H), 2.21 (s, 6H), 1.74-1.65 (m, 2H), 1.63-1.55 (m, 8H), 1.55-1.47 (m, 14H), 1.32-1.21 (m, 52H), 1.19 (d, J=6.2 Hz, 3H), 0.90-0.85 (m, 15H).

[0437] LC-MS (ESI): (M+H) calculated 993.88, found 994.1.

Example 55: Synthesis of Amino Lipid Compound 303

##STR00274##

[0438] According to the general synthetic process, 390 mg amino lipid compound 303, as a pale yellow oil with a purity of 95.21% and a yield of 34%, was prepared from M5 (1.0 g, 1.29 mmol) and 303-B (0.53 g, 1.94 mmol).

[0439] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.93-4.90 (m, 1H), 4.88-4.83 (m, 2H), 4.76-4.69 (m, 1H), 3.27-3.19 (m, 4H), 2.31-2.22 (t, J=7.5 Hz, 8H), 2.20 (s, 6H), 1.69 (s, 2H), 1.61-1.57 (m, 8H), 1.53-1.47 (m, 14H), 1.33-1.21 (m, 54H), 1.19 (d, J=6.2 Hz, 3H), 0.91-0.86 (m, 15H).

[0440] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.1.

Example 56: Synthesis of Amino Lipid Compound 304

##STR00275##

[0441] According to the general synthetic process, 660 mg amino lipid compound 304, as a pale yellow oil with a purity of 98.51% and a yield of 57%, was prepared from M5 (1.0 g, 1.29 mmol) and 304-B (0.53 g, 1.94 mmol).

[0442] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.83 (m, 2H), 4.77-4.70 (m, 2H), 3.27-3.17 (m, 4H), 2.31 (s, 2H), 2.26 (t, J=7.5 Hz, 6H), 2.21 (s, 6H), 1.69 (s, 2H), 1.63-1.44 (m, 24H), 1.35-1.18 (m, 52H), 0.87 (t, J=7.0 Hz, 18H).

[0443] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.1.

Example 57: Synthesis of Amino Lipid Compound 305

##STR00276##

[0444] According to the general synthetic process, 490 mg amino lipid compound 305, as a pale yellow oil with a purity of 97.96% and a yield of 42%, was prepared from M5 (1.0 g, 1.29 mmol) and 305-B (0.56 g, 1.94 mmol).

[0445] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.94-4.83 (m, 3H), 4.76-4.69 (m, 1H), 3.28-3.18 (m, 4H), 2.31-2.25 (m, 8H), 2.21 (s, 6H), 1.69 (s, 2H), 1.63-1.56 (m, 8H), 1.54-1.46 (m, 14H), 1.35-1.21 (m, 56H), 1.19 (d, J=6.2 Hz, 3H), 0.90-0.86 (m, 15H).

[0446] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.1.

Example 58: Synthesis of Amino Lipid Compound 306

##STR00277##

[0447] According to the general synthetic process, 410 mg amino lipid compound 306, as a pale yellow oil with a purity of 96.94% and a yield of 35%, was prepared from M5 (1.0 g, 1.29 mmol) and 306-B (0.56 g, 1.94 mmol).

[0448] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.79 (m, 3H), 4.75-4.69 (m, 1H), 3.29-3.15 (m, 4H), 2.31 (s, 2H), 2.27-2.23 (m, 6H), 2.20 (s, 6H), 1.69 (s, 2H), 1.64-1.44 (m, 24H), 1.36-1.19 (m, 54H), 0.88 (dt, J=14.0, 7.3 Hz, 18H).

[0449] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.1.

Example 59: Synthesis of Amino Lipid Compound 307

##STR00278##

[0450] According to the general synthetic process, 160 mg amino lipid compound 307, as a pale yellow oil with a purity of 92.29% and a yield of 16%, was prepared from M5 (1.0 g, 1.29 mmol) and 307-B (0.45 g, 1.94 mmol).

[0451] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.02-4.98 (m, 1H), 4.88-4.84 (m, 2H), 4.75-4.71 (m, 1H), 3.27-3.23 (m, 4H), 2.28-2.25 (m, 8H), 2.21 (m, 6H), 1.83 (m, 2H), 1.73-1.69 (m, 2H), 1.61-1.59 (m, 4H), 1.50-1.49 (m, 12H), 1.28-1.22 (m, 58H), 0.87 (t, J=6.9 Hz, 12H).

[0452] LC-MS (ESI): (M+H) calculated 965.85, found 966.1.

Example 60: Synthesis of Amino Lipid Compound 308

##STR00279##

[0453] According to the general synthetic process, 660 mg amino lipid compound 308, as a pale yellow oil with a purity of 98.69% and a yield of 59%, was prepared from M5 (1.0 g, 1.29 mmol) and 308-B (0.47 g, 1.94 mmol).

[0454] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.82 (m, 3H), 4.75-4.71 (m, 1H), 3.26-3.22 (m, 4H), 2.27-2.25 (m, 8H), 2.20 (s, 6H), 1.84 (m, 2H), 1.69 (m, 2H), 1.61-1.49 (m, 18H), 1.29-1.25 (m, 52H), 1.19 (d, J=6.2 Hz, 3H), 0.89-0.85 (m, 15H).

[0455] LC-MS (ESI): (M+H) calculated 979.86, found 980.1.

Example 61: Synthesis of Amino Lipid Compound 309

##STR00280##

[0456] According to the general synthetic process, 740 mg amino lipid compound 309, as a pale yellow oil with a purity of 97.45% and a yield of 65%, was prepared from M5 (1.0 g, 1.29 mmol) and 309-B (0.50 g, 1.94 mmol).

[0457] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.94-4.84 (m, 3H), 4.75-4.71 (m, 1H), 3.27-3.23 (m, 4H), 2.28-2.25 (m, 8H), 2.21 (s, 6H), 1.84 (m, 2H), 1.70 (m, 2H), 1.63-1.48 (m, 18H), 1.31-1.26 (m, 54H), 1.19 (d, J=6.2 Hz, 3H), 0.92-0.86 (m, 15H).

[0458] LC-MS (ESI): (M+H) calculated 993.88, found 994.1.

Example 62: Synthesis of Amino Lipid Compound 310

##STR00281##

[0459] According to the general synthetic process, 650 mg amino lipid compound 310, as a pale yellow oil with a purity of 99.28% and a yield of 57%, was prepared from M5 (1.0 g, 1.29 mmol) and 310-B (0.50 g, 1.94 mmol).

[0460] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.78-4.72 (m, 2H), 3.27-3.23 (m, 4H), 2.30-2.26 (m, 8H), 2.21 (s, 6H), 1.86 (m, 2H), 1.70 (m, 2H), 1.62-1.50 (m, 20H), 1.30-1.26 (m, 52H), 0.87 (t, J=7.0 Hz, 18H).

[0461] LC-MS (ESI): (M+H) calculated 993.88, found 994.3.

Example 63: Synthesis of Amino Lipid Compound 311

##STR00282##

[0462] According to the general synthetic process, 420 mg amino lipid compound 311, as a pale yellow oil with a purity of 97.21% and a yield of 36%, was prepared from M5 (1.0 g, 1.29 mmol) and 311-B (0.53 g, 1.94 mmol).

[0463] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.92-4.84 (m, 3H), 4.75-4.71 (m, 1H), 3.27-3.23 (m, 4H), 2.28-2.25 (m, 8H), 2.21 (m, 6H), 1.84 (m, 2H), 1.70 (m, 2H), 1.62-1.48 (m, 18H), 1.28-1.25 (m, 56H), 1.19 (d, J=6.3 Hz, 3H), 0.90-0.86 (m, 15H).

[0464] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.1.

Example 64: Synthesis of Amino Lipid Compound 312

##STR00283##

[0465] According to the general synthetic process, 650 mg amino lipid compound 312, as a pale yellow oil with a purity of 97.79% and a yield of 56%, was prepared from M5 (1.0 g, 1.29 mmol) and 312-B (0.53 g, 1.94 mmol).

[0466] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.81 (m, 3H), 4.76-4.71 (m, 1H), 3.27-3.23 (m, 4H), 2.28-2.25 (m, 8H), 2.20 (s, 6H), 1.85 (m, 2H), 1.70 (m, 2H), 1.62-1.49 (m, 20H), 1.27-1.25 (m, 54H), 0.91-0.86 (m, 18H).

[0467] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.1.

Example 65: Synthesis of Amino Lipid Compound 313

##STR00284##

[0468] According to the general synthetic process, 330 mg amino lipid compound 313, as a pale yellow oil with a purity of 96.97% and a yield of 28%, was prepared from M5 (1.0 g, 1.29 mmol) and 313-B (0.56 g, 1.94 mmol).

[0469] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.92-4.84 (m, 3H), 4.75-4.71 (m, 1H), 3.27-3.23 (m, 4H), 2.28-2.25 (m, 8H), 2.20 (s, 6H), 1.84 (s, 2H), 1.70 (s, 2H), 1.61-1.50 (m, 18H), 1.30-1.26 (m, 58H), 1.19 (d, J=6.3 Hz, 3H), 0.89-0.86 (m, 15H).

[0470] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.2.

Example 66: Synthesis of Amino Lipid Compound 314

##STR00285##

[0471] According to the general synthetic process, 122 mg amino lipid compound 314, as a pale yellow oil with a purity of 91.54% and a yield of 10%, was prepared from M5 (1.0 g, 1.29 mmol) and 314-B (0.56 g, 1.94 mmol).

[0472] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.83-4.79 (m, 1H), 4.76-4.71 (m, 1H), 3.27-3.23 (m, 4H), 2.29-2.25 (m, 8H), 2.21 (s, 6H), 1.85 (m, 2H), 1.70 (m, 2H), 1.61-1.49 (m, 20H), 1.28-1.25 (m, 56H), 0.89-0.86 (m, 18H).

[0473] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.3.

Example 67: Synthesis of Amino Lipid Compound 315

##STR00286##

[0474] According to the general synthetic process, 480 mg amino lipid compound 315, as a pale yellow oil with a purity of 98.27% and a yield of 41%, was prepared from M5 (1.0 g, 1.29 mmol) and 315-B (0.56 g, 1.94 mmol).

[0475] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.92-4.85 (m, 3H), 4.76-4.72 (m, 1H), 3.27-3.23 (m, 4H), 2.28-2.25 (m, 8H), 2.21 (s, 6H), 1.84 (m, 2H), 1.70 (m, 2H), 1.63-1.58 (m, 4H), 1.53-1.46 (m, 16H), 1.28-1.26 (m, 56H), 0.91-0.86 (m, 18H).

[0476] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.1.

Example 68: Synthesis of Amino Lipid Compound 316

##STR00287##

[0477] According to the general synthetic process, 300 mg amino lipid compound 316, as a pale yellow oil with a purity of 94.90% and a yield of 28%, was prepared from M5 (1.0 g, 1.29 mmol) and 316-B (0.42 g, 1.94 mmol).

[0478] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.02-4.98 (m, 1H), 4.88-4.84 (m, 2H), 4.75-4.73 (m, 1H), 3.52-3.48 (m, 2H), 3.29-3.25 (m, 2H), 2.56-2.51 (m, 2H), 2.27 (t, J=7.5 Hz, 6H), 2.21 (m, 6H), 1.70 (m, 2H), 1.63-1.58 (m, 4H), 1.51-1.50 (m, 12H), 1.30-1.23 (m, 58H), 0.87 (t, J=6.9 Hz, 12H).

[0479] LC-MS (ESI): (M+H) calculated 951.83, found 952.0.

Example 69: Synthesis of Amino Lipid Compound 317

##STR00288##

[0480] According to the general synthetic process, 300 mg amino lipid compound 317, as a pale yellow oil with a purity of 92.50% and a yield of 27%, was prepared from M5 (1.0 g, 1.29 mmol) and 317-B (0.45 g, 1.94 mmol).

[0481] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.82 (m, 3H), 4.74 (m, 1H), 3.52-3.48 (m, 2H), 3.29-3.25 (m, 2H), 2.58-2.53 (m, 2H), 2.27 (t, J=7.6 Hz, 6H), 2.21 (s, 6H), 1.69 (m, 2H), 1.61-1.49 (m, 18H), 1.28-1.19 (m, 55H), 0.87(t, J=7.0 Hz, 15H).

[0482] LC-MS (ESI): (M+H) calculated 965.85, found 966.0.

Example 70: Synthesis of Amino Lipid Compound 318

##STR00289##

[0483] According to the general synthetic process, 283 mg amino lipid compound 318, as a pale yellow oil with a purity of 94.86% and a yield of 25%, was prepared from M5 (1.0 g, 1.29 mmol) and 318-B (0.47 g, 1.94 mmol).

[0484] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.93-4.90 (m, 1H), 4.88-4.84 (m, 2H), 4.74 (m, 1H), 3.51-3.47 (m, 2H), 3.28-3.25 (m, 2H), 2.57-2.52 (m, 2H), 2.28-2.25 (m, 6H), 2.21 (m, 6H), 1.69 (m, 2H), 1.61-1.49 (m, 18H), 1.27-1.19 (m, 57H), 0.90-0.86 (m, 15H).

[0485] LC-MS (ESI): (M+H) calculated 979.86, found 980.1.

Example 71: Synthesis of Amino Lipid Compound 319

##STR00290##

[0486] According to the general synthetic process, 350 mg amino lipid compound 319, as a pale yellow oil with a purity of 97.46% and a yield of 31%, was prepared from M5 (1.0 g, 1.29 mmol) and 319-B (0.47 g, 1.94 mmol).

[0487] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.76-4.73 (m, 2H), 3.52-3.48 (m, 2H), 3.29-3.25 (m, 2H), 2.61-2.55 (m, 2H), 2.28-2.25 (m, 6H), 2.20 (s, 6H), 1.69 (m, 2H), 1.61-1.49 (m, 20H), 1.27-1.25 (m, 52H), 0.88-0.86 (m, 18H).

[0488] LC-MS (ESI): (M+H) calculated 979.86, found 980.0.

Example 72: Synthesis of Amino Lipid Compound 320

##STR00291##

[0489] According to the general synthetic process, 350 mg amino lipid compound 320, as a pale yellow oil with a purity of 96.53% and a yield of 31%, was prepared from M5 (1.0 g, 1.29 mmol) and 320-B (0.50 g, 1.94 mmol).

[0490] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.83 (m, 3H), 4.73 (m, 1H), 3.51-3.47 (m, 2H), 3.28-3.24 (m, 2H), 2.57-2.51 (m, 2H), 2.26 (t, J=7.5 Hz, 6H), 2.20 (s, 6H), 1.69 (m, 2H), 1.61-1.49 (m, 18H), 1.27-1.19 (m, 59H), 0.89-0.85 (m, 15H).

[0491] LC-MS (ESI): (M+H) calculated 993.88, found 994.1.

Example 73: Synthesis of Amino Lipid Compound 321

##STR00292##

[0492] According to the general synthetic process, 450 mg amino lipid compound 321, as a pale yellow oil with a purity of 98.04% and a yield of 40%, was prepared from M5 (1.0 g, 1.29 mmol) and 321-B (0.50 g, 1.94 mmol).

[0493] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.81 (m, 3H), 4.73 (m, 1H), 3.51-3.48 (m, 2H), 3.28-3.25 (m, 2H), 2.59-2.54 (m, 2H), 2.27-2.25 (m, 6H), 2.20 (s, 6H), 1.69 (m, 2H), 1.61-1.49 (m, 20H), 1.27-1.25 (m, 54H), 0.89-0.85 (m, 18H).

[0494] LC-MS (ESI): (M+H) calculated 993.88, found 994.1.

Example 74: Synthesis of Amino Lipid Compound 322

##STR00293##

[0495] According to the general synthetic process, 350 mg amino lipid compound 322, as a pale yellow oil with a purity of 97.74% and a yield of 30%, was prepared from M5 (1.0 g, 1.29 mmol) and 322-B (0.53 g, 1.94 mmol).

[0496] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.91-4.84 (m, 3H), 4.73 (m, 1H), 3.51-3.47 (m, 2H), 3.28-3.24 (m, 2H), 2.57-2.52 (m, 2H), 2.28-2.25 (m, 6H), 2.20 (m, 6H), 1.69 (m, 2H), 1.61-1.49 (m, 18H), 1.27-1.19 (m, 61H), 0.89-0.86 (m, 15H).

[0497] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.1.

Example 75: Synthesis of Amino Lipid Compound 323

##STR00294##

[0498] According to the general synthetic process, 520 mg amino lipid compound 323, as a pale yellow oil with a purity of 99.64% and a yield of 45%, was prepared from M5 (1.0 g, 1.29 mmol) and 323-B (0.53 g, 1.94 mmol).

[0499] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.83-4.80 (m, 1H), 4.74 (m, 1H), 3.52-3.48 (m, 2H), 3.29-3.25 (m, 2H), 2.60-2.55 (m, 2H), 2.28-2.25 (m, 6H), 2.20 (s, 6H), 1.69-1.50 (m, 22H), 1.28-1.26 (m, 56H), 0.88-0.86 (m, 18H).

[0500] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.0.

Example 76: Synthesis of Amino Lipid Compound 325

##STR00295##

[0501] According to the general synthetic process, 620 mg amino lipid compound 325, as a pale yellow oil with a purity of 93.75% and a yield of 54%, was prepared from M5 (1.0 g, 1.29 mmol) and 325-B (0.56 g, 1.94 mmol).

[0502] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.91-4.84 (m, 3H), 4.74 (m, 1H), 3.51-3.47 (m, 2H), 3.28-3.23 (m, 2H), 2.57-2.52 (m, 2H), 2.26 (t, J=7.5 Hz, 6H), 2.21 (m, 6H), 1.69 (m, 2H), 1.61-1.59 (m, 18H), 1.27-1.19 (m, 63H), 0.89-0.86 (m, 15H).

[0503] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.2.

Example 77: Synthesis of Amino Lipid Compound 326

##STR00296##

[0504] According to the general synthetic process, 700 mg amino lipid compound 326, as a pale yellow oil with a purity of 98.56% and a yield of 60%, was prepared from M5 (1.0 g, 1.29 mmol) and 326-B (0.56 g, 1.94 mmol).

[0505] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.83-4.81 (m, 1H), 4.74 (m, 1H), 3.52-3.49 (m, 2H), 3.29-3.26 (m, 2H), 2.60-2.55 (m, 2H), 2.60-2.55 (m, 2H), 2.28-2.26 (m, 6H), 2.21 (s, 6H), 1.70-1.50 (m, 22H), 1.28-1.26 (m, 58H), 0.88-0.86 (m, 18H).

[0506] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.3.

Example 78: Synthesis of Amino Lipid Compound 327

##STR00297##

[0507] According to the general synthetic process, 550 mg amino lipid compound 327, as a pale yellow oil with a purity of 98.53% and a yield of 46%, was prepared from M5 (1.0 g, 1.29 mmol) and 327-B (0.56 g, 1.94 mmol).

[0508] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.91-4.84 (m, 3H), 4.74 (m, 1H), 3.52-3.48 (m, 2H), 3.29-3.25 (m, 2H), 2.59-2.54 (m, 2H), 2.28-2.25 (m, 6H), 2.21 (s, 6H), 1.70 (m, 2H), 1.62-1.59 (m, 4H), 1.51-1.50 (m, 16H), 1.28-1.26 (m, 58H), 0.90-0.86 (m, 18H).

[0509] LC-MS (ESI): (M+H) calculated 1021.91, found 1022.2.

Example 79: Synthesis of Amino Lipid Compound 328

##STR00298##

[0510] According to the general synthetic process, 220 mg amino lipid compound 328, as a pale yellow oil with a purity of 97.73% and a yield of 21%, was prepared from M5 (1.0 g, 1.29 mmol) and 328-B (0.39 g, 1.94 mmol).

[0511] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.06-5.00 (m, 1H), 4.88-4.84 (m, 2H), 4.78-1.70 (m, 1H), 3.96 (m, 1H), 3.88 (s, 1H), 3.37-3.29 (m, 2H), 2.28-2.25 (m, 6H), 2.21-2.20 (m, 6H), 1.71 (m, 2H), 1.62-1.58 (m, 4H), 1.50-1.49 (m, 12H), 1.27-1.23 (m, 58H), 0.87 (m, 12H).

[0512] LC-MS (ESI): (M+H) calculated 937.81, found 938.3.

Example 80: Synthesis of Amino Lipid Compound 329

##STR00299##

[0513] According to the general synthetic process, 650 mg amino lipid compound 329, as a pale yellow oil with a purity of 98.08% and a yield of 60%, was prepared from M5 (1.0 g, 1.29 mmol) and 329-B (0.42 g, 1.94 mmol).

[0514] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.90-4.84 (m, 3H), 4.78-4.70 (m, 1H), 3.98 (s, 1H), 3.94-3.87 (m, 1H), 3.40-3.29 (m, 2H), 2.28-2.25 (m, 6H), 2.20-2.19 (m, 6H), 1.74-1.67 (m, 2H), 1.61-1.49 (m, 18H), 1.27-1.20 (m, 55H), 0.90-0.86 (m, 15H).

[0515] LC-MS (ESI): (M+H) calculated 951.83, found 952.3.

Example 81: Synthesis of Amino Lipid Compound 330

##STR00300##

[0516] According to the general synthetic process, 740 mg amino lipid compound 330, as a pale yellow oil with a purity of 92.28% and a yield of 67%, was prepared from M5 (1.0 g, 1.29 mmol) and 330-B (0.45 g, 1.94 mmol).

[0517] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.98-4.92 (m, 1H), 4.88-4.85 (m, 2H), 4.78-4.71 (m, 1H), 3.97 (dd, J1=19.6 Hz, J2=17.6 Hz, 1H), 3.90 (dd, J1=25 Hz, J2=18 Hz, 1H), 3.40-3.30 (m, 2H), 2.27 (t, J=7.5 Hz, 6H), 2.22-2.21 (m, 6H), 1.74-1.45 (m, 20H), 1.36-1.21 (m, 57H), 0.92-0.86 (m, 15H).

[0518] LC-MS (ESI): (M+H) calculated 965.85, found 966.6.

Example 82: Synthesis of Amino Lipid Compound 331

##STR00301##

[0519] According to the general synthetic process, 338 mg amino lipid compound 331, as a pale yellow oil with a purity of 93.50% and a yield of 31%, was prepared from M5 (1.0 g, 1.29 mmol) and 331-B (0.45 g, 1.94 mmol).

[0520] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.84 (m, 2H), 4.82-4.71 (m, 2H), 4.01 (s, 1H), 3.94 (s, 1H), 3.38-3.30 (m, 2H), 2.27 (t, J=7.5 Hz, 6H), 2.21-2.20 (m, 6H), 1.74-1.46 (m, 22H), 1.28-1.26 (m, 52H), 0.89-0.86 (m, 18H).

[0521] LC-MS (ESI): (M+H) calculated 965.85, found 966.6.

Example 83: Synthesis of Amino Lipid Compound 332

##STR00302##

[0522] According to the general synthetic process, 517 mg amino lipid compound 332, as a pale yellow oil with a purity of 96.71% and a yield of 46%, was prepared from M5 (1.0 g, 1.29 mmol) and 332-B (0.47 g, 1.94 mmol).

[0523] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.90 (m, 1H), 4.89-4.84 (m, 2H), 4.78-4.71 (m, 1H), 3.98 (s, 1H), 3.94-3.87 (m, 1H), 3.39-3.30 (m, 2H), 2.28-2.26 (m, 6H), 2.21-2.20 (m, 6H), 1.73-1.47 (m, 20H), 1.33-1.21 (m, 59H), 0.91-0.86 (m, 15H).

[0524] LC-MS (ESI): (M+H) calculated 979.86, found 980.3.

Example 84: Synthesis of Amino Lipid Compound 333

##STR00303##

[0525] According to the general synthetic process, 519 mg amino lipid compound 333, as a pale yellow oil with a purity of 96.56% and a yield of 46%, was prepared from M5 (1.0 g, 1.29 mmol) and 333-B (0.47 g, 1.94 mmol).

[0526] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.89-4.84 (m, 3H), 4.78-4.71 (m, 1H), 4.00 (s, 1H), 3.93 (s, 1H), 3.37-3.30 (m, 2H), 2.28-2.26 (m, 6H), 2.21-2.20 (m, 6H), 1.71-1.49 (m, 22H), 1.30-1.26 (m, 54H), 0.91-0.86 (m, 18H).

[0527] LC-MS (ESI): (M+H) calculated 979.86, found 980.4.

Example 85: Synthesis of Amino Lipid Compound 334

##STR00304##

[0528] According to the general synthetic process, 935 mg amino lipid compound 334, as a pale yellow oil with a purity of 93.38% and a yield of 82%, was prepared from M5 (1.0 g, 1.29 mmol) and 334-B (0.50 g, 1.94 mmol).

[0529] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.95-4.90 (m, 1H), 4.89-4.84 (m, 2H), 4.78-4.71 (m, 1H), 3.98 (s, 1H), 3.93-3.86 (m, 1H), 3.39-3.30 (m, 2H), 2.28-2.26 (m, 6H), 2.22-2.20 (m, 6H), 1.74-1.69 (m, 2H), 1.63-1.49 (m, 18H), 1.29-1.21 (m, 61H), 0.88 (t, J=6.8 Hz, 15H).

[0530] LC-MS (ESI): (M+H) calculated 993.88, found 994.3.

Example 86: Synthesis of Amino Lipid Compound 335

##STR00305##

[0531] According to the general synthetic process, 432 mg amino lipid compound 335, as a pale yellow oil with a purity of 94.97% and a yield of 46%, was prepared from M5 (1.0 g, 1.29 mmol) and 335-B (0.50 g, 1.94 mmol).

[0532] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.83 (m, 3H), 4.78-4.71 (m, 1H), 4.00 (s, 1H), 3.93 (s, 1H), 3.37-3.30 (m, 2H), 2.28-2.26 (m, 6H), 2.21-2.20 (m,6H), 1.74-1.68 (m, 2H), 1.62-1.50 (20H), 1.28-1.26 (m, 56H), 0.89-0.86 (m, 18H).

[0533] LC-MS (ESI): (M+H) calculated 993.88, found 994.3.

Example 87: Synthesis of Amino Lipid Compound 336

##STR00306##

[0534] According to the general synthetic process, 375 mg amino lipid compound 336, as a pale yellow oil with a purity of 95.91% and a yield of 33%, was prepared from M5 (1.0 g, 1.29 mmol) and 336-B (0.50 g, 1.94 mmol).

[0535] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.96-4.91 (m, 1H), 4.88-4.84 (m, 2H), 4.78-4.71 (m, 1H), 3.99 (s, 1H), 3.92 (s, 1H), 3.35-3.30 (m, 2H), 2.28-2.26 (m, 6H), 2.21-2.20 (m, 6H), 1.73-1.69 (m, 2H), 1.63-1.58 (m, 4H), 1.54-1.46 (m, 16H), 1.28-1.26 (m, 56H), 0.92-0.86 (m, 18H).

[0536] LC-MS (ESI): (M+H) calculated 993.88, found 994.3.

Example 88: Synthesis of Amino Lipid Compound 338

##STR00307##

[0537] According to the general synthetic process, 460 mg amino lipid compound 338, as a pale yellow oil with a purity of 96.25% and a yield of 40%, was prepared from M5 (1.0 g, 1.29 mmol) and 338-B (0.53 g, 1.94 mmol).

[0538] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.83 (m, 3H), 4.77-4.72 (m, 1H), 4.00 (s, 1H), 3.92 (s, 1H), 3.36-3.31 (m, 2H), 2.28-2.25 (m, 6H), 2.21-2.20 (m, 6H), 1.82-1.46 (m, 22H), 1.28-1.26 (m, 58H), 0.87 (t, J=6.7 Hz, 18H).

[0539] LC-MS (ESI): (M+H) calculated 1007.90, found 1008.4.

Example 89: Synthesis of Amino Lipid Compound 339

##STR00308##

[0540] According to the general synthetic process, 207 mg amino lipid compound 339, as a pale yellow oil with a purity of 92.98% and a yield of 18%, was prepared from M5 (1.0 g, 1.29 mmol) and 339-B (0.53 g, 1.94 mmol).

[0541] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.93-4.90 (m, 1H), 4.88-4.84 (m, 2H), 4.78-4.71 (m, 1H), 3.99 (s, 1H), 3.91 (s, 1H), 3.37-3.29 (m, 2H), 2.28-2.21 (m, 12H), 1.78-1.50 (m, 22H), 1.28-1.26 (m, 58H), 0.90-0.86 (m, 18H).

[0542] LC-MS (ESI): (M+H) calculated 1007.89, found 1008.3.

Example 90: Synthesis of Amino Lipid Compound 365

##STR00309##

[0543] According to the general synthetic process, 750 mg amino lipid compound 365, as a pale yellow oil with a purity of 96.10% and a yield of 65%, was prepared from M5 (1.0 g, 1.29 mmol) and 365-B (0.52 g, 1.94 mmol).

[0544] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.75-4.71 (m, 1H), 4.14-4.10 (m, 2H), 3.28-3.18 (m, 4H), 2.49-2.44 (m, 6H), 2.30-2.26 (m, 6H), 1.79-1.50 (m, 26H), 1.30-1.24 (m, 57H), 0.87 (t, J=6.8 Hz, 12H).

[0545] LC-MS (ESI): (M+H) calculated 1005.88, found 1006.4.

Example 91: Synthesis of Amino Lipid Compound 366

##STR00310##

[0546] According to the general synthetic process, 750 mg amino lipid compound 366, as a pale yellow oil with a purity of 93.80% and a yield of 64%, was prepared from M5 (1.0 g, 1.29 mmol) and 366-B (0.55 g, 1.94 mmol).

[0547] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.73-4.69 (m, 1H), 4.13-4.10 (m, 2H), 3.21-3.17 (m, 4H), 2.48 (m, 6H), 2.29-2.25 (m, 6H), 1.77 (m, 4H), 1.62-1.59 (m, 6H), 1.50-1.49 (m, 18H), 1.27-1.22 (m, 57H), 0.87 (t, J=6.8 Hz, 12H).

[0548] LC-MS (ESI): (M+H) calculated 1019.89, found 1020.4.

Example 92: Synthesis of Amino Lipid Compound 367

##STR00311##

[0549] According to the general synthetic process, 650 mg amino lipid compound 367, as a pale yellow oil with a purity of 96.49% and a yield of 60%, was prepared from M5 (1.0 g, 1.29 mmol) and 367-B (0.42 g, 1.94 mmol).

[0550] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.78-4.70 (m, 1H), 4.19-4.14 (m, 2H), 3.99 (s, 1H), 3.92 (s, 1H), 3.40-3.32 (m, 2H), 2.51-2.44 (m, 6H), 2.26 (t, J=7.5 Hz, 4H), 1.77 (m, 6H), 1.61-1.59 (m, 4H), 1.50-1.48 (m, 12H), 1.30-1.22 (m, 55H), 0.87 (t, J=7.0 Hz, 12H).

[0551] LC-MS (ESI): (M+H) calculated 949.81, found 950.2.

Example 93: Synthesis of Amino Lipid Compound 368

##STR00312##

[0552] According to the general synthetic process, 550 mg amino lipid compound 368, as a pale yellow oil with a purity of 93.24% and a yield of 50%, was prepared from M5 (1.0 g, 1.29 mmol) and 368-B (0.44 g, 1.94 mmol).

[0553] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.77-4.70 (m, 1H), 4.19-4.14 (m, 2H), 3.97 (s, 1H), 3.89 (s, 1H), 3.35-3.27 (m, 2H), 2.49-2.44 (m, 6H), 2.27 (t, J=7.5 Hz, 4H), 1.78 (m, 4H), 1.61-1.47 (m, 20H), 1.30-1.22 (m, 55H), 0.87 (t, J=7.0 Hz, 12H).

[0554] LC-MS (ESI): (M+H) calculated 963.83, found 964.3.

Example 94: Synthesis of Amino Lipid Compound 369

##STR00313##

[0555] According to the general synthetic process, 206 mg amino lipid compound 369, as a pale yellow oil with a purity of 92.16% and a yield of 15%, was prepared from M6 (1.0 g, 1.34 mmol) and 369-B (0.53 g, 1.94 mmol).

[0556] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.75-4.71 (m, 1H), 4.06 (t, J=6.3 Hz, 2H), 3.96 (d, J=5.9 Hz, 4H), 3.20 (m, 4H), 2.29-2.27 (m, 8H), 2.23-2.22 (m, 6H), 1.69-1.27 (m, 74H), 0.93 (t, J=7.5 Hz, 3H) 0.89-0.86 (m, 12H).

[0557] LC-MS (ESI): (M+H) calculated 979.86, found 980.3.

Example 95: Synthesis of Amino Lipid Compound 370

##STR00314##

[0558] According to the general synthetic process, 155 mg amino lipid compound 370, as a pale yellow oil with a purity of 92.69% and a yield of 11%, was prepared from M6 (1.0 g, 1.34 mmol) and 370-B (0.50 g, 1.94 mmol).

[0559] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.75-4.71 (m, 1H), 4.06 (t, J=6.7 Hz, 2H), 3.97 (d, J=5.6 Hz, 4H), 3.25-3.21 (m, 4H), 2.32-2.26 (m, 8H), 2.21 (s, 6H), 1.88 (bs, 2H), 1.71-1.69 (m, 2H), 1.61-1.60 (m, 10H), 1.51-1.50 (m, 4H), 1.39-1.36 (m, 2H), 1.28-1.27 (m, 52H), 0.93 (t, J=7.5 Hz, 3H) 0.90-0.87 (m, 12H).

[0560] LC-MS (ESI): (M+H) calculated 965.85, found 966.3.

Example 96: Synthesis of Amino Lipid Compound 371

##STR00315##

[0561] According to the genera synthetic process, 300 mg amino lipid compound 371, as a pale yellow oil with a purity of 93.23% and a yield of 22%, was prepared from M6 (1.0 g, 1.34 mmol) and 371-B (0.50 g, 1.94 mmol).

[0562] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.75-4.71 (m, 1H), 4.05 (t, J=6.8 Hz, 2H), 3.95 (d, J=5.9 Hz, 4H), 3.26-3.23 (m, 4H), 2.28 (t, J=7.5 Hz, 8H), 2.21 (s, 6H), 1.84 (m, 2H), 1.70 (m, 2H), 1.62-1.58 (m, 8H), 1.50 (m, 4H), 1.32-1.26 (m, 56H), 0.91-0.86 (m, 15H).

[0563] LC-MS (ESI): (M+H) calculated 965.85, found 966.2.

Example 97: Synthesis of Amino Lipid Compound 372

##STR00316##

[0564] According to the general synthetic process, 150 mg amino lipid compound 372, as a pale yellow oil with a purity of 94.31% and a yield of 10%, was prepared from M6 (1.0 g, 1.34 mmol) and 372-B (0.50 g, 1.94 mmol).

[0565] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.74 (m, 1H), 4.06 (m, 2H), 3.97 (d, J=5.6 Hz, 4H), 3.52-3.49 (m, 2H), 3.29-3.25 (m, 2H), 2.60-2.55 (m, 2H), 2.30-2.26 (m, 6H), 2.21 (m, 6H), 1.73-1.67 (m, 2H), 1.62-1.58 (m, 8H), 1.51 (m, 4H), 1.28-1.23 (m, 58H), 0.90-0.87 (m, 15H).

[0566] LC-MS (ESI): (M+H) calculated 965.85, found 966.3.

Example 98: Synthesis of Amino Lipid Compound 373

##STR00317##

[0567] According to the general synthetic process, 296 mg amino lipid compound 373, as a pale yellow oil with a purity of 91.57% and a yield of 22%, was prepared from M6 (1.0 g, 1.34 mmol) and 373-B (0.53 g, 1.94 mmol).

[0568] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.74 (m, 1H), 4.06 (m, 2H), 3.96 (d, J=5.6 Hz, 4H), 3.52-3.49 (m, 2H), 3.28-3.24 (m, 2H), 2.59-2.54 (m, 2H), 2.30-2.25 (m, 6H), 2.21 (s, 6H), 1.69 (m, 2H), 1.61-1.59 (m, 8H), 1.51 (m, 4H), 1.28 (m, 58H), 0.89-0.86 (m, 15H).

[0569] LC-MS (ESI): (M+H) calculated 979.86, found 980.3.

Example 99: Synthesis of Amino Lipid Compound 374

##STR00318##

[0570] According to the general synthetic process, 405 mg amino lipid compound 374, as a pale yellow oil with a purity of 93.54% and a yield of 31%, was prepared from M6 (1.0 g, 1.34 mmol) and 374-B (0.37 g, 1.94 mmol).

[0571] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.78-4.70 (m, 1H), 4.19-4.14 (m, 2H), 4.00-3.92 (m, 6H), 3.38-3.25 (m, 2H), 2.29 (t, J-7.5 Hz, 6H), 2.22 (d, J=16.7 Hz, 6H), 1.75-1.70 (m, 2H), 1.61-1.26 (m, 65H), 0.90-0.87 (m, 12H).

[0572] LC-MS (ESI): (M+H) calculated 895.77, found 896.2.

Example 100: Synthesis of Amino Lipid Compound 375

##STR00319##

[0573] According to the general synthetic process, 977 mg amino lipid compound 375, as a pale yellow oil with a purity of 92.77% and a yield of 70%, was prepared from M6 (1.0 g, 1.34 mmol) and 375-B (0.50 g, 1.94 mmol).

[0574] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.79-4.70 (m, 1H), 4.12-4.08 (m, 2H), 4.00-3.92 (m, 6H), 3.37-3.25 (m, 2H), 2.29 (t, J-7.5 Hz, 6H), 2.22 (d, J=10.2 Hz, 6H), 1.74-1.27 (m, 74H), 0.90-0.87 (m, 15H).

[0575] LC-MS (ESI): (M+H) calculated 965.85, found 966.6.

Example 101: Synthesis of Amino Lipid Compound 376

##STR00320##

[0576] According to the general synthetic process, 380 mg amino lipid compound 376, as a pale yellow oil with a purity of 93.62% and a yield of 27%, was prepared from M5 (1.0 g, 1.29 mmol) and 376-B (0.45 g, 1.94 mmol).

[0577] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.85-4.82 (m, 2H), 4.72-4.71 (m, 1H), 3.65 (s, 3H), 3.20 (m, 4H), 2.30-2.24 (m, 8H), 2.21 (bs, 6H), 1.69 (m, 2H), 1.62-1.59 (m, 6H), 1.49 (m, 14H), 1.26-1.25 (m, 54H), 0.87-0.84 (m, 12H).

[0578] LC-MS (ESI): (M+H) calculated 965.85, found 966.3.

Example 102: Synthesis of Amino Lipid Compound 377

##STR00321##

[0579] According to the general synthetic process, 468 mg amino lipid compound 377, as a pale yellow oil with a purity of 91.13% and a yield of 41%, was prepared from M5 (1.0 g, 1.29 mmol) and 377-B (0.34 g, 1.94 mmol).

[0580] .sup.1H NMR (600 MHz, CDCl.sub.3) 4.88-4.84 (m, 2H), 4.78-4.70 (m, 1H), 4.02, (s, 1H), 3.94 (s, 1H), 3.71 (d, J=7.6 Hz, 3H), 3.36 (t, J=7.1 Hz, 1H), 3.32 (t, J=7.1 Hz, 1H), 2.33-2.25 (m, 6H), 2.22 (d, J=14.2 Hz, 6H), 1.75-1.67 (m, 2H), 1.62-1.58 (m, 4H), 1.53-1.46 (m, 12H), 1.33-1.25 (m, 52H), 0.87 (t, J=7.0 Hz, 12H).

[0581] LC-MS (ESI): (M+H) calculated 909.78, found 910.2.

Example 103: Synthesis of Amino Lipid Compound 181

(1) Synthesis of Compound 181-B

##STR00322##

1) Synthesis of (2-bromoethoxy)-tert-butyldimethylsilane (181-A)

[0582] 2-bromoethanol (5 g, 40 mmol), DCM (100 ml), and imidazole (4.08 g, 60 mmol) were added to a 250 mL round-bottom flask, cooled to 0 C. while stirring, added with TBSCl (7.23 g, 48 mmol), and heated to room temperature, and reacted at room temperature for 14 h. The reaction mixture was quenched by addition of saturated aqueous sodium bicarbonate, extracted twice with DCM (200 ml). The organic phases were combined, washed with 50 ml saturated aqueous sodium chloride, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain 10.78 g crude product, which was used directly in the next reaction.

2) Synthesis of N1-(2-(tert-butyldimethylsilyloxy)ethyl)-N3,N3-dimethylpropane-1,3-diamine (181-B)

[0583] Potassium carbonate (3.87 g, 28 mmol), acetonitrile (80 ml), and 3-dimethylaminopropylamine (7.55 ml, 60 mmol) were added to a 250 mL round-bottom flask, stirred at room temperature for 1 h, and then cooled to 10 C. 181-A(9.57 g, 40 mmol, dissolved in 20 ml acetonitrile) was slowly added through a dropping funnel. The mixture was reacted overnight at 10 C., and filtered. The filtrate was concentrated, and extracted with water (60 ml) and ethyl acetate (60 ml). The organic phase was separated, washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain 7.8 g crude 181-B, which was purified by silica gel column chromatography, eluted with EA:MeOH=5:1 to obtain 3.98 g 181-B, as a pale yellow oil.

(2) Synthesis of Amino Lipid Compound 181

##STR00323##

1) Synthesis of Compound 181-C

[0584] 181-B (0.50 g, 1.92 mmol) and THF (20 ml) were added to a 25 ml single-necked flask, stirred at 0 C. for 10 min, and potassium carbonate (0.19 g, 1.41 mmol) was added, and M5 (0.99 g, 1.28 mmol, dissolved in 5 ml THF) was added dropwise. After the completion of addition dropwise, the mixture was reacted for 30 min. Water (50 ml) and DCM (50 ml) were added to the reaction solution for extraction. The organic phase was separated, and the aqueous phase was extracted twice with DCM (100 ml). The organic phases were combined, washed with saturated sodium chloride aqueous solution (50 ml), dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated, and the concentrate was purified by silica gel column chromatography, eluted with EA to obtain 597 mg 181-C, as a pale yellow oil with a yield of 47%.

2) Synthesis of Compound 181

[0585] 181-C(0.60 g, 0.6 mmol) and THF (5 ml) were added to a 50 ml single-necked flask, TEA 3HF (863 mg, 5.36 mmol) was added dropwise while stirring at room temperature, and the mixture was reacted with stirring for 1 h. The reaction solution was quenched by addition of 10 ml saturated aqueous ammonium chloride solution, and extracted with ethyl acetate (50 ml) and water (50 ml). The organic phase was separated, and the aqueous phase was extracted twice with ethyl acetate (100 ml). The organic phases were combined, washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated, and the concentrate was purified by silica gel column chromatography, eluted with DCM:MeOH=20:1 to obtain 236 mg amino lipid compound 181, as a light yellow oil with a purity of 93.86% and a yield of 44.67%.

[0586] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.34 (s, 1H), 4.94-4.85 (m, 2H), 4.78 (m, 1H), 3.75 (t, J=4.8 Hz, 2H), 3.56-3.33 (m, 4H), 2.78 (s, 1H), 2.55 (s, 4H), 2.42 (s, 3H), 2.31 (t, J=7.5 Hz, 4H), 2.08 (m, 1H), 1.91 (m, 1H), 1.68-1.59 (m, 4H), 1.52 (m, 12H), 1.38-1.20 (m, 52H), 0.91 (t, J=6.5 Hz, 12H).

[0587] LC-MS (ESI): (M+H) calculated 881.42, found 882.2.

Example 104: Synthesis of Amino Lipid Compound 187

##STR00324##

[0588] According to the general synthetic process, amino lipid compound 187-C was prepared from compound M5 (1.0 g, 1.29 mmol) and 187-B (0.53 g, 1.9 mmol), and then 382 mg compound 187, as a colorless oil with a yield of 33.1% and a purity of 93.90%, was prepared from 187-C.

[0589] .sup.1H NMR (600 MHz, CDCl.sub.3) 5.34 (s, 1H), 4.95-4.86 (m, 2H), 4.81 (m, 1H), 3.62-3.55 (t, J=4.8 Hz, 2H), 3.53-3.41 (t, J=6.6 Hz, 2H), 3.31-3.19 (t, J=6.9 Hz, 2H), 2.42-2.25 (m, 12H), 1.76 (m, 4H), 1.69-1.61 (m, 4H), 1.53 (m, 12H), 1.38-1.21 (m, 52H), 0.96-0.85 (m, 12H).

[0590] LC-MS (ESI): (M+H) calculated 895.45, found 896.2.

Biological Tests

[0591] The amino lipid compounds 118, SM102, and ALC-0315 used in the biological tests of the present disclosure have the following structures:

##STR00325##

[0592] Amino lipid compound 118 can be prepared according to the synthesis method of compound 10 (Example 9) described in Chinese patent application CN107922364A; SM102 and ALC-0315 are commercially available or can be prepared according to the well-known techniques in the art.

Experimental Example 1: Preparation of Lipid Nanoparticle Encapsulating Luciferase mRNA (Fluc mRNA)

[0593] (1) Formulating:

[0594] A specified amount of Fluc mRNA stock solution, 0.2 M sodium acetate buffer, and DEPC water were added to a container, and mixed well to obtain a water phase;

[0595] The amino lipid compound of the present disclosure, a helper lipid, a structural lipid, and a PEG-lipid were separately dissolved in absolute ethanol to prepare respective solutions at concentrations of 20 mg/mL, 10 mg/mL, 20 mg/mL, and 25 mg/mL, respectively. The above four solutions were pipetted at a molar ratio of Lipid:DSPC:CHOHP:M-DMG-2000 of 48:10:40.5:1.5, and mixed well to prepare an alcohol phase. [0596] (2) Encapsulation: The water phase and the alcohol phase were injected into a microfluidic chip at a flow rate of water phase: alcohol phase=12 mL/min: 4 mL/min by using a microfluidic preparation instrument (MPE-L2), and encapsulation was carried out at a flow rate of water phase: alcohol phase=9 mL/min: 3 mL/min to obtain mRNA-encapsulating lipid nanoparticle (mRNA-LNP). [0597] (3) Dialysis: The product of step (2) was loaded in a dialysis bag and placed in a Tris Buffer-8% sucrose solution for replacement to remove ingredients such as residual ethanol, unassembled lipids. Dialysis was conducted for 2 h with magnetic stirring at room temperature and under protection from light (dialysate was replaced every 1 hour). [0598] (4) The product of step (3) was sterilized by passing through a 0.22 m microporous membrane, and then packaged.

[0599] Lipid nanoparticle formulations encapsulating Fluc mRNA were prepared, with a concentration of Fluc mRNA of 0.2 g/L, a mass ratio of Fluc mRNA to Lipid of 1:10, a particle size of 80-130 nm, and a encapsulation efficiency of 85% or higher.

Experimental Example 2: Performance Evaluation of In Vivo Delivery of Lipid Nanoparticle

[0600] Animal preparation: Female BALB/c mice of 6-8 weeks old were selected and raised in an SPF grade breeding room. Animal testing was conducted in strict accordance with the guidelines of national health institutions and animal ethics requirements.

[0601] In vivo Delivery: prior to injection of the test LNP formulations, the LNP formulations were gently and repeatedly inverted to thoroughly mix the formulation samples. A corresponding amount of the formulation samples were aspirated with a 1 ml insulin syringe, and the LNP formulations were injected by tail vein injection (IV), with 3 mice in duplicate per formulation. Each mouse was injected with 75 L of the luciferase mRNA (Fluc mRNA)-encapsulating lipid nanoparticle formulation prepared in Experimental Example 1.

[0602] 6 hours after injection of LNP formulations, mice were injected with 200 L D-Luciferin luciferase developing substrate (Catalog No. 122799; Manufacturer: Perkin Elmer). After the substrate was injected, the mice were anesthetized with isoflurane inhalation, and the injection time of luciferase developing substrate was recorded. 10 minutes after the substrate injection, the animals were placed in supine position, and the signal distribution and expression intensity of luciferase in the body and various organs of the animals were observed with In Vivo Imaging System (IVIS).

[0603] The encapsulation efficiency of the lipid nanoparticle encapsulating luciferase mRNA (Fluc mRNA) with a representative amino lipid compound and the fluorescence expression intensity induced by the same are shown in Table 4, with the amino lipid compound 118 as a control.

TABLE-US-00005 TABLE 4 (Spleen/ Amino Total lipid Encapsulation Total Flux) compound efficiency flux Liver Spleen * 100% 108 91.78% 3.40E+08 6.84E+07 1.02E+06 0.30 109 92.87% 2.80E+08 5.22E+07 8.53E+05 0.30 110 90.82% 2.44E+08 5.83E+07 8.71E+05 0.36 259 94.08% 6.40E+08 1.37E+08 1.29E+07 2.02 260 95.36% 4.11E+08 9.60E+07 3.27E+06 0.80 264 94.12% 4.95E+08 1.61E+08 8.05E+06 1.63 265 94.59% 3.93E+08 7.57E+07 1.91E+06 0.49 266 94.26% 2.67E+08 8.09E+07 1.60E+06 0.60 267 93.13% 4.01E+08 9.91E+07 1.54E+06 0.38 268 92.22% 1.23E+08 2.11E+07 8.01E+06 6.51 270 93.46% 4.40E+08 1.34E+08 7.36E+06 1.67 271 93.59% 2.68E+08 7.57E+07 4.76E+06 1.78 272 93.96% 4.04E+08 7.42E+07 3.03E+06 0.75 273 87.42% 1.78E+08 4.33E+07 2.37E+06 1.33 274 93.06% 3.25E+08 7.08E+07 2.60E+06 0.80 275 90.61% 8.16E+08 1.23E+08 8.84E+06 1.08 276 88.92% 7.70E+08 1.43E+08 4.67E+06 0.61 277 91.00% 3.14E+08 7.98E+07 8.42E+06 2.68 279 92.43% 6.29E+08 9.55E+07 4.57E+06 0.73 284 91.63% 3.42E+08 3.29E+07 5.20E+06 1.52 298 92.85% 2.61E+08 3.32E+07 2.13E+06 0.82 303 93.23% 6.41E+08 8.58E+07 5.56E+06 0.87 304 92.03% 5.18E+08 1.06E+08 1.48E+07 2.86 305 90.70% 6.71E+08 9.19E+07 7.03E+06 1.05 306 91.92% 2.45E+08 4.13E+07 5.44E+06 2.22 308 93.71% 6.29E+08 9.58E+07 4.93E+06 0.78 309 91.62% 3.69E+08 4.90E+07 3.44E+06 0.93 316 90.67% 8.16E+08 1.26E+08 2.03E+07 2.49 320 92.13% 7.04E+08 1.13E+08 4.97E+06 0.71 321 93.85% 7.21E+08 1.27E+08 1.47E+07 2.04 322 90.32% 7.90E+08 9.73E+07 6.56E+06 0.83 337 92.38% 3.58E+08 6.49E+07 3.30E+06 0.92 338 91.13% 6.32E+08 1.07E+08 3.20E+06 0.51 365 92.45% 6.73E+08 9.03E+07 4.45E+06 0.66 366 93.63% 5.82E+08 8.92E+07 4.11E+06 0.71 367 91.21% 9.45E+07 1.06E+07 4.33E+05 0.46 368 87.51% 3.97E+08 6.14E+07 1.25E+07 3.15 371 93.17% 1.12E+09 2.92E+08 2.36E+07 2.11 372 92.17% 5.43E+08 1.67E+08 8.59E+06 1.58 373 92.01% 4.77E+08 9.15E+07 6.93E+06 1.45 375 94.18% 4.06E+08 1.55E+08 7.63E+06 1.88 118 90.53% 6.46E+08 1.88E+08 2.19E+06 0.34

[0604] The multiple of spleen delivery/total delivery of fluorescence expression intensity induced by lipid nanoparticle encapsulating luciferase mRNA (Fluc mRNA) with a representative amino lipid compound to amino lipid compound 118 is shown in Table 5.

TABLE-US-00006 TABLE 5 Amino lipid compound Multiple 108 0.88 109 0.90 110 1.05 259 5.93 260 2.34 264 4.78 265 1.43 266 1.76 267 1.13 268 19.15 270 4.92 271 5.22 272 2.21 273 3.92 274 2.35 275 3.19 276 1.78 277 7.89 279 2.14 284 4.47 298 2.40 303 2.55 304 8.40 305 3.08 306 6.53 308 2.31 309 2.74 316 7.32 320 2.08 321 6.00 322 2.44 337 2.71 338 1.49 365 1.94 366 2.08 367 1.35 368 9.26 371 6.20 372 4.65 373 4.27 375 5.53 118 1.00

[0605] As can be seen from Table 5, all amino lipid compounds, except amino lipid compounds 108 and 109, showed a stronger delivery preference to spleen, as compared to amino lipid compound 118.

Experimental Example 3: Performance Evaluation of Delivery to Lymph Nodes of Lipid Nanoparticle

[0606] Animal preparation: Female BALB/c mice of 6-8 weeks old were selected and raised in an SPF grade breeding room. Animal testing was conducted in strict accordance with the guidelines of national health institutions and animal ethics requirements.

[0607] In vivo Delivery: prior to injection of the test LNP formulations, the LNP formulations were gently and repeatedly inverted to thoroughly mix the formulation samples. A corresponding amount of the formulation samples were aspirated with a 1 ml insulin syringe, and the LNP formulations were injected by tail vein injection (IV), with 3 mice per formulation. Each mouse was injected with 75 L the luciferase mRNA (Fluc mRNA)-encapsulating lipid nanoparticle formulation prepared in Experimental Example 1.

[0608] 6 hours after injection of LNP formulations, mice were injected with 200 L D-Luciferin luciferase developing substrate (Catalog No. 122799; Manufacturer: Perkin Elmer). After the substrate was injected, the mice were anesthetized with isoflurane inhalation, and the injection time of luciferase developing substrate was recorded. 10 minutes after the substrate injection, the animals were placed in supine position, and the signal distribution and expression intensity of luciferase in lymph nodes were observed with In Vivo Imaging System (IVIS).

[0609] The intensity of fluorescence expression induced by the lipid nanoparticle encapsulating luciferase mRNA (Fluc mRNA) with a representative amino lipid compound is shown in Table 6, with SM-102 as a control.

TABLE-US-00007 TABLE 6 Amino lipid compound Expression intensity 250 1.77E+06 268 1.78E+06 SM-102 4.94E+05

[0610] As can be seen from Table 6, the amino lipid compounds 250 and 268 have a better delivery effect on lymph nodes than SM102, showing a stronger preference to lymph nodes.

Experimental Example 4: Evaluation of In Vivo Safety of Lipid Nanoparticle

[0611] A human erythropoietin mRNA (hEPO mRNA)-encapsulating lipid nanoparticle formulation was prepared according to the method as described in Experimental Example 1, with replacing the luciferase mRNA (Fluc mRNA) with human erythropoietin mRNA (hEPO mRNA), with a concentration of hEPO mRNA of 0.2 g/L, a mass ratio of hEPO mRNA to Lipid of 1:10, a particle size of 90-130 nm, and an encapsulation efficiency of above 90% or higher.

[0612] Animal preparation: Female BALB/c mice of 6-8 weeks old were selected and raised in an SPF grade breeding room. Animal testing was conducted in strict accordance with the guidelines of national health institutions and animal ethics requirements.

[0613] In vivo Delivery: Prior to injection of the test LNP formulations, the LNP formulations were gently and repeatedly inverted to thoroughly mix the formulation samples. A corresponding amount of the formulation samples were aspirated with a 1 ml insulin syringe, and the LNP formulations were injected by tail vein injection (IV), with 5 mice per formulation. Each mouse was injected with 300 L of the human erythropoietin mRNA (hEPO mRNA)-encapsulating lipid nanoparticle formulation.

[0614] Serum acquisition: Blood samples of mice were collected 12 h after injection, placed in tubes without anticoagulants, and naturally coagulated at room temperature for 30-60 min, and then centrifuged at a speed of 3500 rpm for 10 min to obtain the supernatant, which was the serum.

[0615] The detection of alanine transaminase was carried out according to instructions of the kit (Nanjing Jiancheng Bioengineering Institute, Catalog. No. C009-2-1), and a standard curve was made using the standard provided in the kit. D-PBS was used in the experiment, which was purchased from Sangon Biotech (Shanghai) Co., Ltd., Catalog No. E607009-0600.

[0616] The method of detection of enzyme activity of alanine aminotransferase (ALT) in serum of the mice is as follows:

Preparation of ALT Standard Curve:

[0617] (1) Enzymatic reaction: 0, 2, 4, 6, 8 and 10 L of 2 mol/mL sodium pyruvate standard solution were sequentially added to 5 L of 0.1 mol/L phosphate buffer, and the volume was supplemented to 25 L with a matrix solution, and repeatedly aspirating and spitting with a pipette for mixing well; [0618] (2) Addition reaction: 20 L 2,4-dinitrophenylhydrazine solution was added to all reaction wells in (1), mixed by aspirating and spitting, and then placed in an incubator at 37 C. to react for 20 min; [0619] (3) Developing: 200 L of 0.4 mol/L NaOH solution was added to all reaction wells in (2) to stop the reaction, mixed by aspirating and spitting, and incubated at room temperature for 15 min. The OD value of each well was measured at 510 nm in a microplate reader; and [0620] (4) Data processing of standard curve: The corresponding absolute OD value for each well was obtained by subtracting the OD value for 0 L well from the measured OD value for each well, the corresponding ALT Karmen units being 0, 28, 57, 97, 150 and 200 U/L, respectively. The standard curve was obtain by taking the absolute OD value as the abscissa and the corresponding Karmen unit as the ordinate.

Detection of ALT Enzyme Activity in Serum Samples:

[0621] (1) Reagent preparation: an ALT matrix solution was placed in an incubator at 37 C. for preheating; [0622] (2) Enzymatic reaction: 5 L diluted serum was aspirated and added to a 96-well plate, then 20 L matrix solution was added to the corresponding sample well and mixed by repeatedly aspirating and spitting to avoid bubbling, and then placed in an incubator at 37 C. for 30 min; [0623] (3) Addition reaction: 20 L 2,4-dinitrophenylhydrazine was added to all reaction wells in (2), mixed by aspirating and spitting, and then reacted in an incubator at 37 C. for 20 min; [0624] (4) Developing: 200 L of 0.4 mol/L NaOH solution was added to all reaction wells in (3) to stop the reaction, mixed by aspirating and spitting, and then incubated at room temperature for 15 min. The OD value for each well was measured at a wavelength of 510 nm in a microplate reader; and [0625] (5) Calculation of ALT enzyme activity in serum: The absolute OD value of the corresponding sample well was obtained by subtracting the OD value for the control well from the obtained OD value of the sample well, and was substituted into the standard curve formula to calculate the ALT enzyme activity (Karmen unit) for the corresponding serum sample.

[0626] The in vivo safety evaluation results of the lipid nanoparticle encapsulating human erythropoietin (hEPO) mRNA with the representative amino lipid compounds are shown in FIG. 1, with ALC00315 and SM-102 as controls.

[0627] As can be seen from FIG. 1, as compared to the commercially available ALC0315 and SM-102, the representative amino lipid compounds exhibit comparable or lower ALT enzyme activity (Karmen unit), with 252, 255, 259, 260, 263, 264, 266, 267, 270, 272, and 273 having significantly lower ALT enzyme activity (Karmen unit) and having better safety.

Experimental Example 5: IFN- Elispot Cellular Immunity Test

[0628] An IN002.5.1 mRNA-encapsulating lipid nanoparticle formulation was prepared according to the method as described in Experimental Example 1, with replacing the luciferase mRNA (Fluc mRNA) with IN002.5.1 mRNA, with a concentration of IN002.5.1 mRNA of 0.2 g/L, a mass ratio of IN002.5.1 mRNA to Lipid of 1:10, a particle size of 80-130 nm, and an encapsulation efficiency of 90% or higher.

[0629] The sequence of IN002.5.1 mRNA is one obtained by replacing all uracil (u) in SEQ ID NO. 1 with N1-methylpseudouridine. Of note is that the t (thymine) in the RNA sequence, SEQ ID NO. 1, in the Sequence Listing is actually u (uracil), according to the WIPO Standard ST. 26 for nucleotide or amino acid sequence listing.

[0630] Animal preparation: Female BALB/c mice of 6-8 weeks old were selected and raised in an SPF grade breeding room. Animal testing was conducted in strict accordance with the guidelines of national health institutions and animal ethics requirements.

[0631] Immunization of mice: Prior to injection of the test LNP formulations, the LNP formulations were gently and repeatedly inverted to thoroughly mix the formulation samples. A corresponding amount of the formulation samples were aspirated with a 1 ml insulin syringe, and the LNP formulations were injected by intramuscular injection (IM) in the tails, with 8 mice per formulation. Each mouse was injected with 50 L of the IN002.5.1 mRNA encapsulating lipid nanoparticle formulation.

[0632] Spleen acquisition: On the 7th day after immunization, 3 to 4 mice from each LNP immunization group were selected and euthanized, and their spleens were acquired in a super clean bench.

[0633] Serum collection: On the 14th day after immunization, 150 L orbital blood was collected from 5 mice for each LNP immunization group, and the blood was placed in a tube without anticoagulant, and naturally coagulated at room temperature for 30-60 min, and then centrifuged at a speed of 3500 rpm for 10 min to obtain the supernatant, which was the serum.

Elispot Test of Mouse Lymphocytes:

[0634] Isolation of lymphocytes: The spleens of mice were taken out in a super clean bench. 7 mL of mouse lymphocyte separation solution was added to a 6-well cell culture plate. Mouse spleen cells were ground with a syringe piston, and the suspension of the spleen cells was filtered through a cell screen and immediately transferred to a 15 mL centrifuge tube. 1000 L RPMI 1640 medium was slowly added with keeping the liquid interface distinct. After centrifugation at 800 g with a horizontal rotor at room temperature for 30 minutes, a clear stratification can be visible. The lymphocyte layer was aspirated, then added with 10 mL RPMI 1640 medium, and inverted for washing. The cells were collected by centrifugation at 250 g for 10 min at room temperature, and the red blood cells were lysed. After completing lysis of red blood cells, the supernatant was poured, and the cells were resuspended in culture medium and counted.

[0635] Addition of stimulant and culture of lymphocyte: RPMI-1640 medium containing 10% fetal bovine serum was used to activate the pre-coated plate. After standing at room temperature for at least 30 min, the medium was removed, and a cell suspension at adjusted concentration was added (100 L/well). The medium used to resuspend the cells was used as a background negative control. 10 L positive stimulant working solution (PMA+Ionomycin (dissolved in DPBS) was added to a positive control well; 10 L medium used to resuspend the cells was added to a negative control well; 10 L/well of a peptide library diluted with RPMI 1640 was added to experimental wells. After all samples and the stimulant were added, the plate was covered, incubated in an incubator with 5% CO.sub.2 at 37 C. for 16-24 h.

[0636] Elispot detection after culture: The cells and the culture medium in the wells were dumped, and the wells were lysed with 200 L/well of ice-cold deionized water at 4 C. for 10 min. The liquid in the wells were shaken out, and the wells were washed five times with PBS buffer. The wells were incubated with 100 L/well of 1 g/ml detection antibody for 2 h at room temperature; and after washing the plate 5 times with PBS, the wells were incubated with 100 L/well of 1000-fold diluted enzyme labeled avidin (Streptavidin-HRP) for 1 h at room temperature. After washing the plate with PBS for 5 times, the wells were incubated with TMB Substrate developing solution which had been equilibrated to room temperature, at room temperature in the dark for 15 min. The developing solution was dumped, and the front side and the back side of the plate and the base were washed for 3 to 5 times with deionize water to stop developing.

[0637] Spot counting of ELISPOT plate: The plate was placed at room temperature in a cool and dark place, and the base was closed after the plate was naturally dried. Various parameters of spots were recorded by reading the plate in an enzyme-linked immunospot analyzer.

[0638] The results of the IFN-7 Elispot cellular immunity test with lipid nanoparticle encapsulating IN002.5.1 mRNA with representative amino lipid compounds are shown in FIG. 2, FIG. 3 and FIG. 4, with ALC0315 as a control.

[0639] The test results are shown in FIG. 2, FIG. 3 and FIG. 4. It can be seen from FIG. 2 that the amino lipid compounds 270, 271, 272, 273 and 274 show better cellular immunity effect compared to the commercially available ALC0315. It can be seen from FIG. 3 that the amino lipid compounds 263, 264, 265, 267 and 268 show better cellular immunity effect compared to the commercially available ALC0315. It can be seen from FIG. 4 that the amino lipid compounds 302 and 307 show better cellular immunity effect compared to the commercially available ALC0315.

Experimental Example 6: Humoral Immunity Test for Total Binding IgG Antibody

[0640] The serum obtained in Experimental Example 5 was used to perform a humoral immunity test for the antigen-specific IgG against the expression of IN002.5.1 mRNA.

Test Reagent Preparation:

[0641] Washing solution: taking a suitable amount of a coating solution, adding Tween 20 to reach a final concentration of Tween 20 of 0.05%, and mixing thoroughly for later use.

[0642] Blocking solution: accurately weighing BSA, adding it into the washing solution to 3% w/v and then mixing thoroughly for later use (prepare and use immediately).

[0643] Sample diluent: accurately weighing BSA, adding it to the washing solution to 1% w/v, and mixing thoroughly for later use (prepare and use immediately).

Operation Steps:

[0644] Coating: diluting the coat protein with SARS-COV-2 antigen protein (Acro, #SPNC52He) in PBS buffer to a concentration required for the test, and then mixing thoroughly for later use; 100 L/well, sealing with a sealing film, and then placing at 2 to 8 C. overnight (16 to 20 h) or incubating at 37 C. for 2 h.

[0645] Plate washing: after incubation, washing by machine three times with the washing solution at 300 l/well, and patting for drying on clean paper.

[0646] Blocking: adding the blocking solution to the ELISA plate at 250 l/well, sealing the plate with a sealing film, and incubating at 37 C. for 40-60 min.

[0647] Plate washing: after blocking, washing the plate with machine 3 times with the washing solution at 300 l/well, and patting for drying on clean paper.

[0648] Sample preparation: taking the serum separated in advance, mixing through vortex for IgG titer detection (if stored in a refrigerator at 80 C., dissolving it at 4 C. in advance).

[0649] Serum sample dilution: taking the separated serum, determining the first dilution multiple (generally 300-3000 times) according to different immunization time, and taking this dilution multiple as the first dilution multiple for gradient dilution with 8 gradients in total; adding the diluted serum to the ELISA plate at 100 l/well, and incubating at 37 C. (Incubation time depends on different test requirement.)

[0650] Plate washing: after the incubation, washing the plate by machine three times with the washing solution at 300 l/well, and patting for drying on clean paper.

[0651] Enzyme-labeled secondary antibody: diluting the enzyme-labeled secondary antibody with the sample diluent at a certain dilution multiple, 100 l/well, and incubating at 37 C. (Incubation time depends on different test requirement.)

[0652] Plate washing: after the incubation, washing the plate by machine three times with the washing solution at 300 l/well, and patting for drying on clean paper

[0653] Developing: equilibrating TMB single-component development solution to room temperature in advance, adding it to the plate at 100 l/well, and incubating at room temperature in the dark.

[0654] Stopping: after developing, adding a stop solution at 50 l/well.

[0655] Reading: selecting a detection wavelength of 450 nm and a reference wavelength of 630 nm, and reading and analyzing in a microplate reader.

Result Calculation

[0656] Data analysis was performed based on the OD.sub.450 values obtained in the microplate reader SoftMax Pro. The formula for calculating the cut-off value was as following:

[0657] Cut-off value=mean OD.sub.450 of negative serum solution2.1

[0658] Note: when the mean value of OD.sub.450 of a negative serum solution is <0.05, it shall be calculated as 0.05; when the mean value of OD.sub.450 is >0.05, it shall be calculated as the actual OD.sub.450 value, and the Cut-off value shall be kept to three decimal places.

[0659] The antibody titer was the maximum dilution corresponding to the mean value of OD.sub.450 of control and test serum >the Cut-off value.

[0660] The results of the humoral immunity test for binding total anti-IgG using lipid nanoparticle encapsulating IN002.5.1 mRNA with representative amino lipid compounds are shown in FIG. 5 and FIG. 6, with ALC00315 as a control.

[0661] The test results are shown in FIG. 5 and FIG. 6. It can be seen from FIG. 5 that the amino lipid compounds 269, 270, 271, 273 and 274 show better humoral immunity effect compared to the commercially available ALC0315. It can be seen from FIG. 6 that the amino lipid compounds 263, 264, 265 and 266 show better humoral immunity effect than the commercially available ALC0315.

TABLE-US-00008 DNAsequencecorrespondingtoIN002.5.1mRNAsequence(SEQIDNO.1): GGGGAAAGCTTTAATACGACTCACTATAGGACAGATCGCCTGGAGACGCCATC CACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCG GGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCA GTCACCGTCCTTGACACGGGATCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCC TCTGGTGTCCAGCCAGTGTGTGAACCTGAGGACCAGAACACAGCTGCCTCCAGCC TACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCA GCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGG TTCCACGCCATCCACGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCG TGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCATCGAGAAGTCCAACATCATC AGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCG TGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGA CCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGGC GTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGAT GGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAA GAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGC GGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGC ATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACAC CTGGCGATAGCAGCAGCGGACTGACAGCTGGTGCCGCCGCTTACTATGTGGGCTAC CTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACG CCGTGGATTGTGCTCTGGACCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTT CACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGA ATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCA ATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGC GTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTA CGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGAC AGCTTCGTGATCCGGGGAGATGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCA ACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCC TGGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACCGGTACA GGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGAT CTATCAGGCCGGCAGCAAGCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTC CCACTGCAGTCCTACGGCTTTCAGCCCACAAATGGCGTGGGCTATCAGCCCTACAG AGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCT AAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCC TGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCA GTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGG AAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGC ACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTGAACTGTACCGAAG TGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACC GGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGCACGTGA ACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAG ACACAGACAAACAGCCGGCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATT GCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTAT CGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCA TGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTG CTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTG ACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTG AAGCAGATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAATTTCAGCCA GATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTG TTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTATGGCGATTGTCT GGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACA GTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCT GGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATC CCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGT GCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAG ATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGAACGTG GTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAACT TCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAG GCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACAT ACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGC CGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGC GGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTT TCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCA TCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGG CACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCG ACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACC GTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAG TACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCA ATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCA AGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGT ACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATC GTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGG CTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTG CTGAAGGGCGTGAAACTGCACTACACATGATGAGGTACCCGGGTGGCATCCCTGT GACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCA GCCTTGTCCTAATAAAATTAAGTTGCATCGGGCCCAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0662] In addition to those described in this disclosure, various modifications to this disclosure will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.