ENDOPHYTIC FUNGUS OF OPHIOPOGON JAPONICUS AND USE THEREOF

20250250534 ยท 2025-08-07

    Inventors

    Cpc classification

    International classification

    Abstract

    An endophytic fungus of Ophiopogon japonicus and use thereof provided. The endophytic fungus is isolated from the living Ophiopogon japonicus plants, an Ophiopogon plant of Liliaceae, by a traditional tissue block separation method, with a category name of Fusarium falciforme OJ106, and a deposit number of CGMCC No. 40703. The methylophiopogonanone B is prepared through the PDB liquid fermentation of endophytic fungus strains. The endophytic fungus of Ophiopogon japonicus is an important microorganism for searching for new resources of the methylophiopogonanone B, and has a high application value.

    Sequence Listing

    TABLE-US-00001 SEQIDNO.1 cgactttggtgtgcgggagggacattaccgagttatacaactcatc aaccctgtgaacatacctataacgttgcctcggcgggaacagacg gccccgtaacacgggccgcccccgccagaagaccccctaactctg tttctataatgtttcttctgagtaaacaagcaaataaattaaaac tttcaacaacggatctcttggctctggcatcgatgaaaaacgcag cgaaatgcgataagtaatgtgaattgcaaaattcagtgaatcatc gaatctttgaacgcacattgccccgacagtattctggcgggcatg cctgttcaagcgtcattacaaccctcaggcccccgggcctggcgt tggggatcggeggaagccccctgcgggcacaacgccgtcccccaa atacagtggcggtcccgccgcagcttccattgcgtagtagctaac acctcgcaactggagagcggcgcggccacgccgtaaaacacccaa cttctgaatgttgacctcgaatcaggtaggaatacccgctgaact taagcatatcaataagcggtagtta

    Claims

    1. An endophytic fungus of Ophiopogon japonicus, wherein the endophytic fungus of Ophiopogon japonicus has been deposited in the China General Microbiological Culture Collection Center on Jun. 16, 2023, with a category name of Fusarium falciforme OJ106, and a deposit number of CGMCC No. 40703.

    2. Use of an endophytic fungus of Ophiopogon japonicus in preparation of methylophiopogonanone B.

    3. The use according to claim 2, wherein the endophytic fungus of Ophiopogon japonicus is adopted to prepare the methylophiopogonanone B by PDB liquid fermentation, which comprises: (1) taking a certain number of hyphae with an inoculating needle from an endophytic fungus strain of Ophiopogon japonicus under aseptic conditions, inoculating the hyphae on a sterilized PDA plate, and cultivating the hyphae in a mould incubator at 26 C. until the hyphae cover surface of PDA culture medium; and (2) taking the PDA plate full of hyphae, preparing a fungus block with a puncher, placing the obtained fungus block in a PDB liquid culture medium for dark culture at 26 C., and extracting a hypha fermentation broth after the culture to obtain the methylophiopogonanone B.

    4. The use according to claim 3, wherein a formula of the PDB liquid fermentation medium is: 200 g of potato, 20 g of glucose and 1000 mL of pure water.

    5. The use according to claim 3, wherein a formula of the PDA culture medium is: 200 g of potato, 20 g of glucose, 15 g of agar and 1000 mL of pure water.

    6. The use according to claim 3, wherein in the step (2), a process for extracting a hypha fermentation broth after the culture to obtain the methylophiopogonanone B comprises: filtering the hypha fermentation broth under a reduced pressure to be divided into two fractions of hyphae and fermentation broth, drying and crushing the hyphae, ultrasonicating with methanol, and filtering under a reduced pressure to obtain a hypha filtrate; and extracting the fermentation broth with an equal amount of ethyl acetate, combining extracted ethyl acetate liquid with the hypha filtrate, carrying out vacuum concentration to obtain a fermentation extract, and obtaining the methylophiopogonanone B by redissolution with methanol.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0022] FIG. 1 shows the colony morphology of Fusarium falciforme OJ106 on a PDA solid medium;

    [0023] FIG. 2 shows a fermentation broth morphology of Fusarium falciforme OJ106 on a PDB liquid medium;

    [0024] FIG. 3 shows the morphology of hyphae and spores of Fusarium falciforme OJ106 view by an optical microscope;

    [0025] FIG. 4 shows the gel electrophoresis of Fusarium falciforme OJ106 ITS sequences amplified based on ITS5 and ITS4 primers;

    [0026] FIG. 5 shows the phylogenetic tree of Fusarium falciforme OJ106 based on ITS sequences (NJ method);

    [0027] FIG. 6: chemical structure of methylophiopogonanone B;

    [0028] FIG. 7 shows the HPLC analysis of the fermentation broth of Fusarium falciforme OJ106 (A, B: a sample of methylophiopogonanone B and a standard product, respectively);

    [0029] FIG. 8 shows the LC-MS secondary mass spectrum of the fermentation broth of Fusarium falciforme OJ106 (A, B: a sample of methylophiopogonanone B and a standard product, respectively).

    [0030] FIG. 9 shows the UHPLC-QTOF-MS secondary mass spectrum of the fermentation broth of Fusarium falciforme OJ106 (A, B: a sample of methylophiopogonanone B and a standard product, respectively).

    DESCRIPTION OF EMBODIMENTS

    [0031] The specific embodiments provided by the present disclosure will be described in detail with examples followed.

    Example 1: Endophytic Fungi Isolated from Wild Ophiopogon Japonicus in Hangzhou, Zhejiang, China

    [0032] The endophytic fungi were isolated and obtained according to the following steps: fresh leaves, tuberous roots and roots of Ophiopogon japonicus were washed under tap water, the surface moisture was absorbed by sterilized filter paper, and three-step surface disinfection treatment was carried out: disinfection with 75 vol % of an ethanol solution for 1 min, disinfection with 1 wt % of a sodium hypochlorite solution (leaves for 1 min, roots for 3 min, tuberous roots for 5 min), and disinfection with 75 vol % of an ethanol solution for 30 s. After disinfection, they were rinsed with sterilized water for 5 times, and the surface moisture of plant tissues was absorbed by sterilized filter paper. A sterilized medical scalpel was used to cut leaves, roots and tuberous roots into tissue blocks with a size of about 5 mm5 mm, and 12 tissue blocks were randomly selected from the three parts. Four tissue blocks, as one group, were placed in a culture dish with a PDA (200 g of potato, 20 g of glucose, 15 g of agar, 1000 mL of pure water) medium containing penicillin sodium 50 mg.Math. L.sup.1. After the culture dish was sealed with a sealing film, the tissue blocks were cultured in a mould incubator at 26 C. for 7 days to observe the growth of colonies. After the colonies grew around the tissue block, they were transferred to a new PDA culture dish for continuous culture. The isolated and purified endophytic fungi were cultured on an inclined plane and stored at 4 C., and the isolated endophytic fungus strains were combined into different morphological types according to the colony characteristics. Finally, the endophytic fungus Fusarium falciforme OJ106 of the present disclosure was obtained, the solid culture characteristics thereof were: dark clone on a PDA culture medium at 26 C., rapid growth, round, white, fluffy hyphae with a thick outer ring and a thin inner ring, uniform colony morphology, neat edges, and staggered white hyphae, as shown in FIG. 1. The liquid culture thereof is characterized by the following: [0033] (1) culturing in a PDB liquid medium at 26 C. and 180 rpm in the dark in a thermostatic shaker for 11 days; [0034] (2) characteristics of fermentation culture: on the first day of culture, a small amount of white mycelium grew out of the white fungus block, and the fermentation broth was clear, so that the fungus block could be clearly observed; after 2-4 days of culture, white hyphae gradually grew from the white fungus block, and the fermentation broth became slightly turbid and the fungus block was blurred; after 5-8 days of culture, the fermentation broth gradually became turbid, and the fungus block was faintly visible, and the fermentation broth was in a thin gel form under shaking; from the 9th to 11th day of culture, the color of the fermentation broth deepened further, and the fungus block dissolved in the fermentation broth; and at the later stage, the fermentation broth was gelatinous and yellow-white, as shown in FIG. 2.

    [0035] The morphological characteristics under the microscope were: the mycelium was translucent, with a thickness of 0.5-1.1 m, and had branches and a smooth surface; and most spores were visible and had diaphragms inside, and were sickle-shaped, as shown in FIG. 3.

    [0036] The endophytic fungus OJ106 (Fusarium falciforme) was deposited at a low temperature (4 C.).

    [0037] A few hyphae were taken by an inoculating needle from a frozen tube of the OJ106 (Fusarium falciforme) strain under aseptic conditions, and activated in a new PDA culture medium, and then cultured in a mould incubator at 26 C. for 7 days until the plate was full of fungus for ITS sequence amplification and identification. The DNA of the strain was extracted, and ITS gene was amplified by PCR using ITS5 and ITS4 primers. PCR reaction cycle parameter amplification steps: 1, 95 C., 3 min, initial denaturation; 2, 94 C., 40 s, denaturation; 3, 52 C., 50 s, annealing; 4, 72 C., 1 min, extension; 5, repeat 2-4 for 35 times; 6, 72 C., 10 min, expansion. The electrophoretogram of ITS amplification is shown in FIG. 4, and the base sequence is shown in SEQ ID NO. 1.

    [0038] The PCR product detected by agarose gel electrophoresis was sent to Shanghai Bio Techne Company for sequencing. Using the sequence measured for the PCR product as a target sequence, the homologous sequence was searched in GenBank database in NCBI. The reference sequences which were most like the morphological sequence were downloaded, and Neighbor-joining (NJ) phylogenetic analysis was to randomly select one sequence, and comparison was carried out 1000 times to determine the phylogenetic status of the strain to be identified. The phylogenetic tree is shown in FIG. 5. The endophytic fungus strain of the present disclosure was identified as Fusarium falciforme by microbial taxonomy. The strain has been deposited in the China General Microbiological Culture Collection Center (CGMCC) (No. 3, First Yard, Beichen West Road, Chaoyang District, Beijing, 100101) on Jun. 16, 2023, with a deposit number of CGMCC No. 40703.

    Example 2: Adopting the endophytic fungus of Ophiopogon japonicus to prepare

    [0039] the methylophiopogonanone B by PDB liquid fermentation. [0040] (1) Strain activation and fermentation: the OJ106 Ophiopogon japonicus strain deposited at a low temperature (4 C.) was inoculated on a PDA culture medium, which was then placed in a mould incubator at 26 C. for 7 days in the dark. After the culture medium was covered with fungal hyphae, a puncher was burnt with an alcohol lamp for sterilization. After the puncher was cooled, 100 pieces of fungus blocks were punched out in an area with dense colonies in the PDA culture dish and transferred to a PDB conical flask with an inoculating needle that had been burnt and cooled in a similar way. The flask was sealed and put into a constant temperature shake flask for fermentation (constant temperature shake flask: 180 rpm, 26 C.). All the above operations were carried out under aseptic conditions, and the puncher and inoculating needle needed to be burned before and after each use. When the culture dish is punched, it was advisable to punch continuously in a fan shape. After 11 days of culture, the hypha fermentation broth was filtered under a reduced pressure and divided into hyphae and fermentation broth for subsequent use. [0041] (2) Extraction of hyphae: the hyphae were dried in a 40 C. oven until the weight was constant. After weighing and grinding, the powder was poured into a hydrolysis tube, and corresponding methanol was added according to a volume ratio of 3:50, followed by ultrasound extraction (with a power of 250 W, and a frequency of 33 kHz) for 40 min. After filtering, the filtrate was concentrated to obtain an extract A. [0042] (3) Extraction of filtrate: into the fermentation broth in step (1), an equal amount of ethyl acetate was added for extraction, and an ethyl acetate layer was taken to obtain extract B. The extracts A and B were combined by redissolution with methanol and then concentrated under a reduced pressure at 50 C. to obtain a fermentation extract. [0043] (4) HPLC detection: An appropriate amount of a standard substance of methylophiopogonanone B was accurately weighed, respectively. Methylophiopogonanone B, the molecular formula of which is C.sub.19H.sub.20O.sub.5, and the chemical structure of methylophiopogonanone B is shown in FIG. 6. Methanol was used to prepare standard solutions with final concentrations of 0.410, 0.296, 0.306 and 0.302 mg.Math.mL.sup.1, respectively. A proper amount of the solution was poured into a liquid bottle, which was marked with the purity and date, and refrigerated at 4 C. for subsequent use. The fermentation broth of OJ106 was subjected to by HPLC analysis and compared with the standard substances of the main effective active ingredients of Ophiopogon japonicus. HPLC chromatographic conditions: ZORBAX Eclipse XDB-C18 column (150 mm4.6 mm, 5 m), mobile phase water-acetonitrile, column temperature 30 C., 20 L, detection wavelengths of 260 and 267 nm, a flow rate of 1 mL min-1, gradient elution procedure, sample solution injection in turn, and peak time recorded. [0044] (5) LC-MS/UHPLC-QTOF-MS detection: the OJ106 fermentation broth was further analyzed by LC-MS. ESI-MS conditions: spray gas (high purity nitrogen, 35 psi); collision gas (high purity helium); auxiliary gas (high purity nitrogen 12 L min.sup.1); capillary temperature (350 C.); HV voltage (3500 V); scanning range (m/z 100-2200); stability of the compound (100%); collision energy (0.3-2 v); ESI ion source (positive and negative ion mode); flow rate (0.4 mL min.sup.1); sample volume (10 L). The final analysis was confirmed by UHPLC-QTOF-MS, the chromatograph was Agilent1290, the flow rate was 0.4 mL min.sup.1, the sample volume was 2 L, the shielding gas was N2 (sprayer: 50 psi gas temperature: 350 C., gas flow rate: 11 L.Math.min.sup.1), and the detector was a Q-TOF negative ion detector (scanning range: 100-1100; mass spectrometry resolution: m/z 400, scanning rate 1.5 Hz; error: 2 ppm). According to the above HPLC and LC-MS/UHPLC-QTOF-MS analysis, as shown in FIGS. 7, 8 and 9, it is shown that the liquid fermentation of the endophytic fungus strain of Ophiopogon japonicus can produce methylophiopogonanone B with a yield of 0.56 g/g.

    [0045] The preferred embodiment of the present disclosure has been described in detail above, but the present disclosure is not limited to the embodiment. Those skilled in the art can make various equivalent modifications or substitutions without violating the spirit of the present disclosure, and these equivalent modifications or substitutions shall fall into the scope defined by the claims of this application.